Pluripotent stem cell secreted proteins, their combinations, and their application in the preparation of agents to delay the aging of human mesenchymal stem cells.

By screening and purifying the pluripotent stem cell secretory protein combination GAPDH/S100A8/S100A9 and adding it to WJMSCs culture medium, the aging problem of mesenchymal stem cells during in vitro expansion was solved, and their activity and proliferation capacity were improved.

CN122297647APending Publication Date: 2026-06-30SUN YAT SEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SUN YAT SEN UNIV
Filing Date
2026-03-16
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

In existing technologies, mesenchymal stem cells are prone to aging during in vitro expansion, leading to a decrease in their activity and efficacy, which affects their effectiveness in clinical applications.

Method used

By screening and validating pluripotent stem cell secreted proteins using mass spectrometry, the GAPDH/S100A8/S100A9 protein combination was purified and added to the culture medium of WJMSCs to delay their replicative senescence.

Benefits of technology

It effectively reduced the expression of aging-related markers in WJMSCs, increased cell proliferation rate and activity, and delayed the cellular aging process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122297647A_ABST
    Figure CN122297647A_ABST
Patent Text Reader

Abstract

This invention discloses secretory proteins of pluripotent stem cells (EPSCs), combinations thereof, and their application in the preparation of agents for delaying the aging of human mesenchymal stem cells (MSCs). The application of S100A9 protein, S100A8 protein, GAPDH protein, or any combination thereof in the preparation of agents for delaying the aging of human mesenchymal stem cells (MSCs); the amino acid sequence of the S100A9 protein is shown in SEQ ID NO.1, the amino acid sequence of the S100A8 protein is shown in SEQ ID NO.3, and the amino acid sequence of the GAPDH protein is shown in SEQ ID NO.5. This invention studies the secretory proteins of EPSCs to discover and explore anti-aging factors, identifies secretory proteins with the effect of delaying MSC aging, provides a potential solution for reducing in vitro expansion and aging of MSCs and improving their therapeutic effects, and also provides a new perspective for anti-MSC aging research.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to pluripotent stem cell secretory proteins, combinations thereof, and their application in the preparation of agents that delay the aging of human mesenchymal stem cells. Background Technology

[0002] Mesenchymal stem cells (MSCs) are adult pluripotent stem cells derived from the mesoderm in early embryonic development. They can self-renew, differentiate into multiple lineages, and form clonal cell populations. Furthermore, MSCs possess unique nutritional properties and immunomodulatory capabilities, and are widely used to promote tissue repair and regeneration, regulate immune responses, and maintain cellular homeostasis. The paracrine effects of extracellular vesicles, growth factors, and metabolites synthesized and released by MSCs have been shown to play a role in the clinical treatment of various diseases. Wharton's jelly-derived mesenchymal stem cells (WJMSCs) are more primitive than MSCs derived from adult tissues, possessing intermediate characteristics between embryonic and adult stem cells, and represent a primitive stromal cell population with therapeutic potential.

[0003] Recent studies have shown that clinical trials using in vitro expanded MSCs have yielded unsatisfactory results, primarily due to the continuous decline in MSC activity and potency during the production process. With increasing culture time, MSCs undergo telomere shortening and other phenotypic changes. Research indicates that replicative senescence is the earliest discovered type of cellular senescence, including cyclin-dependent kinase inhibitors (such as...) p16 INK4a and p21 CIP1 Increased expression of β-galactosidase, positive staining for senescence-associated β-galactosidase (SA-β-Gal), slowed or arrested cell proliferation, and SASP (such as...) IL-6 The expression and secretion of MSCs are also important. More importantly, MSCs gradually enter a senescent state as replication declines. Although they cannot be distinguished by their marker phenotypes, their functional characteristics, especially their immune properties, undergo significant changes.

[52] Therefore, delaying the senescence of MSCs is crucial for enhancing their therapeutic effects and addressing clinical application challenges.

[0004] Extended pluripotent stem cells (EPSCs) are a type of pluripotent stem cell line capable of forming chimeric embryos and differentiating into extraembryonic lineages. Numerous studies have shown that the secreted factors of pluripotent stem cells comprise a complex set of factors with diverse components, playing an indispensable role in cell growth and immune regulation. Recent research indicates that pluripotent stem cell secreted factors may, to some extent, delay the senescence of other cell types, but the specific components remain unclear. Summary of the Invention

[0005] This invention provides pluripotent stem cell secretory proteins, combinations thereof, and their application in the preparation of agents that delay the aging of human mesenchymal stem cells.

[0006] The present invention provides the following technical solutions

[0007] 1. Mass spectrometry screening and anti-aging function verification of secretory proteins from pluripotent stem cells were performed.

[0008] 2. Purify the GAPDH / S100A8 / S100A9 protein combination.

[0009] 3. In vitro addition of the GAPDH / S100A8 / S100A9 protein combination delayed the replicative senescence of WJMSCs.

[0010] 4. EPSCs supernatant secreted proteins delay WJMSC replication-induced senescence.

[0011] 5. The secretory protein combination (S100A9 / S100A8 / GAPDH) delays the replicative senescence of WJMSCs.

[0012] Therefore, the first object of the present invention is to provide the use of S100A9 protein, S100A8 protein, GAPDH protein or any combination thereof in the preparation of agents for delaying the aging of human mesenchymal stem cells.

[0013] The amino acid sequence of the S100A9 protein is shown in SEQ ID NO.1, and its encoding nucleotide sequence is shown in SEQ ID NO.2. The amino acid sequence of the S100A8 protein is shown in SEQ ID NO.3, and its encoding nucleotide sequence is shown in SEQ ID NO.4. The amino acid sequence of the GAPDH protein is shown in SEQ ID NO.5, and its encoding nucleotide sequence is shown in SEQ ID NO.6.

[0014] Preferably, the combination of S100A9 protein, S100A8 protein and GAPDH protein is used in the preparation of agents that delay the aging of human mesenchymal stem cells.

[0015] Further preferred application is the use of a combination of S100A9 protein, S100A8 protein, and GAPDH protein in a molar ratio of 1:1:1 in the preparation of a formulation for delaying the aging of human mesenchymal stem cells.

[0016] More preferably, the concentrations of S100A9 protein, S100A8 protein and / or GAPDH protein in the formulation are 50 nM-200 nM.

[0017] Preferably, the formulation further contains available excipients.

[0018] Preferably, the formulation can be formulated into various dosage forms, such as solid or liquid dosage forms, wherein the liquid dosage form is a solution, suspension or emulsion, and preferably, the solid dosage form is a tablet, capsule, pill or powder.

[0019] The second objective of this invention is to provide a formulation for delaying the aging of human mesenchymal stem cells, which contains S100A9 protein, S100A8 protein, GAPDH protein, or any combination thereof as active ingredients.

[0020] Since MSCs need to be expanded in vitro to reach therapeutic doses, cellular senescence is inevitable during this process. Although studies on combating MSC senescence have been reported, they mainly focus on optimizing culture medium composition and culture environment, with relatively little research on anti-senescence components, especially secreted proteins. This invention studies the secreted proteins of EPSCs to discover and explore anti-senescence factors, identify secreted proteins with the effect of delaying MSC senescence, provide a potential solution for reducing in vitro expansion and senescence of MSCs and improving their therapeutic efficacy, and also provide a new perspective for anti-MSC senescence research. Attached Figure Description

[0021] Figure 1 Long-term addition of EPSC culture supernatant to culture delayed WJMSC senescence. (A / B) After 5 / 15 days of culture. p16 and p21 (C) Relative mRNA expression level, (D) EdU staining and positive rate, (E) Absorbance at OD 450 nm measured by CCK8, and (S) SA-β-Gal staining and positive rate. Data are expressed as mean ± standard error. n=3, **, p <0.01,***, p <0.001, ns, p>0.05 (t-test).

[0022] Figure 2 It involves the collection and mass spectrometry identification of secreted proteins, the process of collecting and processing secreted proteins in EPSC supernatant, and mass spectrometry samples.

[0023] Figure 3 It utilizes a prokaryotic expression system for the expression and purification of candidate proteins.

[0024] Figure 4 S100A9, S100A8, GAPDH proteins, or combinations thereof, reduce the expression levels of aging-related biomarkers.

[0025] Figure 5 The S100A9 / S100A8 / GAPDH protein combination was used to delay the replicative senescence of WJMSCs through long-term culture, with the addition of EGFP, 50 nM and 200 nM concentrations of the combined protein; (A) after 10 days of culture and (B) after 20 days of culture. p16 , p21 p53 and IL-6 relative mRNA expression levels, (C) p53 and after 20 days of culture. p21 Relative protein expression levels, ANOVA and Dunnett post-hoc tests, data are expressed as mean ± standard error, n=3, *, p <0.05, *, p <0.01, ***, p <0.001,****, p <0.0001.

[0026] Figure 6 The senescence phenotype of WJMSCs decreased after 20 days of culture with the S100A9 / S100A8 / GAPDH protein combination, compared to 20 days with no EGFP, 50 nM, and 200 nM protein combinations respectively. (A) SA-β-Gal staining and positive percentage, (B) EdU staining and positive percentage, (C) CCK8 absorbance at OD 450 nm. ANOVA and Tukey post-hoc tests were used. Data are expressed as mean ± standard error, n=3, ***, p <0.001, ****, p <0.0001. Specific implementation methods

[0027] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0028] Example 1

[0029] 1. Pluripotent stem cell culture supernatant delays WJMSC senescence

[0030] EPSCs in culture medium LCDM (see literature Yang, Y., B. Liu, J. Xu, J. Wang, J. Wu, C. Shi, Y. Xu, J. Dong, C. Wang, W. Lai, J. Zhu, L. Xiong, D. Zhu, X. Li, W. Yang, T. Yamauchi, A. Sugawara, Z. Li, F. Sun, X. Li, C. Li, A. He, Y. Du, T. Wang, C. Zhao, H. Li, X. Chi, H. Zhang, Y. Liu, C. Li, S. Duo, M. Yin, H.Shen, JCI Belmonte, and H. Deng. "Derivation of Pluripotent Stem Cellswith in Vivo Embryonic and Extraembryonic Potency." Cell Cells were cultured (20% O2, 5% CO2, 37℃) for 3 days, followed by centrifugation (1000 rpm, 5 min). The supernatant was collected and cell debris and impurities were removed using a 0.22 μm needle filter to obtain EPSC culture supernatant (EPSCsMedium). LCDM or EPSC culture supernatant was added at a volume ratio of 1:5 to WJMSCs medium (DMEM / F12 with 10% fetal bovine serum and 1% penicillin antibiotics) for continuous passage of MSCs. Cells were collected and analyzed after 5 days of culture. The results showed that the two groups of cells... p16 and p21 The relative expression levels of mRNA (p16-F: AACGCACCGAATAGTTACGG, p16-R: ACCAGCGTGTCCAGGAAG; p21-F: CGAGTCAGTTCCTTGTGGAG, p21-R: CATGGGTTCTGACGGACAT) did not change. Figure 1 A). However, this situation changed after 15 days of culture; compared to LCDM, the MSCs in the EPSC culture supernatant group... p16 and p21 The relative expression level of mRNA was significantly reduced ( Figure 1 B). Analysis of the two cell groups after 15 days of culture showed that, compared with the LCDM group, the EPSCs Medium group exhibited an increased proliferation rate, such as an increased proportion of EdU-positive cells (B). Figure 1 C) and CCK8 detection showed an increase in absorbance at OD 450 nm ( Figure 1 As shown in D), the proportion of SA-β-Gal positive cells decreased ( Figure 1 E). These results indicate that adding EPSC culture supernatant during WJMSC expansion can effectively delay the replicative senescence of WJMSCs, and this is likely mediated by secreted proteins in the EPSC culture supernatant.

[0031] 2. Identification of secreted proteins in EPSC supernatant

[0032] The overall procedure for collecting and detecting secreted proteins is as follows: EPSC cells were cultured in serum-free medium (LCDM medium) (20% O2, 5% CO2, 37℃). 30 ml of cell supernatant was collected after three days of culture and centrifuged at 4000 rpm for 10 min to remove cellular impurities. Then, the supernatant was concentrated using ultrafiltration tubes with molecular weight cutoffs of 10 kDa and 3 kDa to reduce volume and increase concentration. Following this, the proteins were precipitated using trichloroacetic acid and subjected to SDS-PAGE and gel extraction. Figure 2 After trypsin digestion, the samples were sent to the testing center for LC-MS (Liquid Chromatography Mass Spectrometry) detection. Finally, peptide information was obtained by comparing with the human protein coding library, thereby obtaining three proteins: S100A9, S100A8, and GAPDH. The amino acid sequence of the S100A9 protein is shown in SEQ ID NO.1, and its encoding nucleotide sequence is shown in SEQ ID NO.2. The amino acid sequence of the S100A8 protein is shown in SEQ ID NO.3, and its encoding nucleotide sequence is shown in SEQ ID NO.4. The amino acid sequence of the GAPDH protein is shown in SEQ ID NO.5, and its encoding nucleotide sequence is shown in SEQ ID NO.6.

[0033] Prokaryotic expression and purification of 3 proteins

[0034] First, candidate proteins (S100A9 / S100A8 / GAPDH) were selected for prokaryotic expression and purification. The overall process is as follows: Figure 3As shown, the encoding nucleotide sequences of S100A9, S100A8, and GAPDH were tagged with 6×His and inserted into the multiple cloning site of the vector pET28a, respectively. After culturing, the proteins were induced to express. Ni-NTA affinity purification and gel filtration chromatography were performed sequentially. Finally, the samples were filtered and dispensed to obtain proteins suitable for addition to WJMSCs for culture, namely proteins S100A9, S100A8, and GAPDH. Following the same method, enhanced green fluorescent protein (EGFP, whose nucleotide sequence is shown in SEQ ID NO.7) was also expressed and purified to obtain protein EGFP, which served as a control in subsequent experiments to avoid the influence of prokaryotic expression and purification of the protein itself on WJMSCs. Sample analysis during the flow-through, washing, and elution stages of Ni-NTA chromatography showed that affinity purification yielded protein samples with relatively high purity and concentration. Figure 3 This invention employs gel filtration chromatography purification based on affinity purification. The eluted sample after Ni-NTA affinity purification is concentrated by ultrafiltration to match the loading volume requirements for the next purification step. After gel filtration chromatography purification, SDS-PAGE is used to detect the proteins. The proteins S100A9, S100A8, GAPDH, and EGFP are thus obtained.

[0035] 4. Long-term protein combination supplementation to delay MSC senescence

[0036] WJMSCs were continuously passaged in LCDM medium (20% O2, 5% CO2, 37℃). The culture system was supplemented with 200 nM of protein S100A9, 200 nM of S100A8, and 200 nM of GAPDH individually, as well as a combination of the three proteins (600 nM, 200 nM each). For groups with less than 600 nM (proteins S100A9, S100A8, GAPDH, or their total amount), EGFP was added to make up the difference, ensuring a uniform concentration. 600 nM of EGFP was used as a control. The blank control consisted of untreated WJMSCs. After 20 days of culture, compared to EGFP, both the individual proteins and the combined proteins reduced the expression levels of p16, p21, and IL-6 mRNA. The combined protein significantly reduced the expression levels of these factors. Figure 4 This indicates that the combined addition of GAPDH / S100A8 / S100A9 proteins more effectively reduces the expression levels of aging-related biomarkers.

[0037] Furthermore, WJMSCs were continuously passaged in LCDM medium (20% O2, 5% CO2, 37℃). The WJMSCs cell culture system contained a combination of 50 nM protein S100A9, 50 nM S100A8, and 50 nM GAPDH. Figure 5 50 nM Pros), or a combination of 200 mM protein S100A9, 200 nM S100A8, and 200 nM GAPDH ( Figure 5 200 nM of Pros was added to the WJMSCs cell culture system. For groups with less than 600 nM (total amounts of proteins S100A9, S100A8, and GAPDH), EGFP was added to make up the difference, ensuring a uniform concentration. The blank control consisted of untreated WJMSCs cells, while the EGFP group received 600 nM of EGFP as a control. Cells were cultured continuously, and samples were taken on days 10 and 20 for analysis. Results showed that after 10 days of continuous passage culture, compared to EGFP, both the 50 nM and 200 nM protein combinations significantly reduced the expression levels of p16, p21, p53, and IL-6 mRNA. Figure 5 (A) This change persisted and became more pronounced after 20 days of culture. Notably, after 20 days of culture, the 200 nM group demonstrated a more effective ability to reduce the expression levels of aging marker gene mRNAs compared to the 50 nM group. Figure 5 B), and also showed the same changes in protein expression levels as in mRNA expression levels. Figure 5 C).

[0038] Subsequently, senescence-related assays were performed on these WJMSCs after 20 days of continuous passage culture, including SA-β-Gal staining ( Figure 6 A) EdU staining for cell proliferation detection ( Figure 6 B) and CCK8 cell proliferation detection ( Figure 6 C). Consistent with changes in mRNA expression of senescence marker genes, the combined protein at concentrations of 50 nM and 200 nM significantly reduced the proportion of SA-β-Gal-positive cells, increased the proportion of EdU-positive cells, and enhanced cell viability compared to EGFP. Most of these changes were also observed between the 50 nM and 200 nM concentrations. These results indicate that the combined addition of 50 and 200 nM GAPDH / S100A8 / S100A9 proteins can effectively delay the replicative senescence of MSCs during in vitro expansion, with the 200 nM concentration showing a stronger effect. Furthermore, no difference in cellular senescence levels was observed between the EGFP-added group and the blank control group, ruling out the influence of purified protein on cellular senescence during long-term culture.

[0039] S100A9 (SEQ ID NO.1) protein S100-A9 [Homo sapiens] - Protein - NCBI mtckmsqler nietiintfh qysvklghpd tlnqgefkel vrkdlqnflk kenknekviehimedldtna dkqlsfeefi mlmarltwas hekmhegdeg pghhhkpglg egtp

[0040] S100A9 (SEQ ID NO.2) Homo sapiens S100 calcium binding protein A9 (S100A9), mRNA - Nucleotide - NCBI atgactt gcaaaatgtc gcagctggaa cgcaacatag agaccatcat caacaccttccaccaatact ctgtgaagct ggggcaccca gacaccctga accaggggga attcaaagag ctggtgcgaaagatctgca aaattttctc aagaaggaga ataagaatga aaaggtcacatcac gcagacaagc agctgagctt cgaggagttc atcatgctga tggcgaggct aacctgggcctcccacgaga agatgcacga gggtgacgag ggccctggcc accaccataa gccaggcctc ggggagggcacccctaa

[0041] S100A8(SEQ ID NO.3) protein S100-A8 isoform a [Homo sapiens] - Protein - NCBI mslvsclsed lkvlffrwgk svgimltele calnsiidvy hkyslikgnf havyrddlkklletecpqyi rkkgadvwfk eldintdgav nfqeflilvi kmgvaahkks heeshke

[0042] S100A8(SEQ ID NO.4) Homo sapiens S100 calcium binding protein A8 (S100A8), transcript vari - Nucleotide - NCBI atgtc tcttgtcagc tgtctttcag aagacctgaa ggttctgttt ttcaggtggggcaagtccgt gggcatcatg ttgaccgagc tggagaaagc cttgaactct atcatcgacg tctaccacaagtactccctg ataaagggga atttccatgc cgtctacagg gatgacctga agaaattgct agagaccgagtgtcctcagt atatcagga aaagggtgca gacgtctggt tcaaagagtt ggatatcaac actgatggtgcagttaactt ccaggagttc ctcattctgg tgataagat gggcgtggca gcccacaaaa aaagccatgaagaaagccac aaagagtag

[0043] GAPDH(SEQ ID NO.5) glyceraldehyde-3-phosphate dehydrogenase isoform 1 [Homo sapiens] - Protein - NCBI mgkvkvgvng fgrigrlvtr aafnsgkvdi vaindpfidl nymvymfqyd sthgkfhgtvkaengklvin gnpitifqer dpskikwgda gaeyvvestg vfttmekaga hlqggakrvi isapsadapmfvmgvnheky dnslkiisna scttnclapl akvihdnfgi veglmttvha itatqktvdg psgklwrdgrgalqniipas tgaakavgkv ipelngkltg mafrvptanv svvdltcrle kpakyddik vvkqasegplkgilgytehq vvssdfnsdt hsstfdagag ialndhfvkl iswydnefgy snrvvdlmah mask

[0044] GAPDH(SEQ ID NO.6) Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcr - Nucleotide - NCBI atgg ggaaggtgaa ggtcggagtc aacggatttg gtcgtattgg gcgcctggtcaccagggctg cttttaactc tggtaaagtg gatattgttg ccatcaatga ccccttcatt gacctcaactacatggttta catgttccaa tatgattcca cccatggcaa attccatggc accgtcaagg ctgagaacgggaagcttgtc atcaatggaa atcccatcac catcttccag gagcgagatc cctccaaaat caagtggggcgatgctggcg ctgagtacgt cgtggagtcc actggcgtct tcaccaccat ggagaaggct ggggctcatt tgcaggggggagccaaaagg gtcatcatct ctgccccctc tgctgatgcc cccatgttcg tcatgggtgt gaaccatgagaagtatgaca acagcctcaa gatcatcagc tgacaacttt ggtatcgtgg aaggactcat gaccacagtc catgccatca ctgccacccagaagactgtg gatggcccct ccgggaaact gtggcgtgat ggccgcgggg ctctccagaa catcatccctgcctctactg gcgctgccaa ggctgtgccc aggcatct cggagcgc actggcatggccttccgtgt ccccactgcc aacgtgtcag tggtggacct gacctgccgt ctagaaaaac ctgccaaatatgatgacatc aagaaggtgg tgaagcaggc gtcggagggc cccctcaagg gcatcctggg ctacactgagcaccaggtgg tctccctc tgacgctggg gctggcattgccctcaacga ccactttgtc aagctcattt cctggtatga caacgaattt ggctacagca acagggtggtggacctcatg gcccacatgg cctccaagga gtaa

[0045] EGFP(SEQ ID NO.7) ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA。

Claims

1. The application of S100A9 protein, S100A8 protein, GAPDH protein, or any combination thereof in the preparation of agents to delay the aging of human mesenchymal stem cells; The amino acid sequence of the S100A9 protein is shown in SEQ ID NO.1, the amino acid sequence of the S100A8 protein is shown in SEQ ID NO.3, and the amino acid sequence of the GAPDH protein is shown in SEQ ID NO.

5.

2. The application according to claim 1, characterized in that, This refers to the application of the combination of S100A9 protein, S100A8 protein, and GAPDH protein in the preparation of agents that delay the aging of human mesenchymal stem cells.

3. The application according to claim 2, characterized in that, This refers to the application of a combination of S100A9 protein, S100A8 protein, and GAPDH protein in a molar ratio of 1:1:1 in the preparation of a formulation to delay the aging of human mesenchymal stem cells.

4. The application according to claim 2 or 3, characterized in that, The concentrations of S100A9 protein, S100A8 protein, and / or GAPDH protein in the formulation are 50 nM to 200 nM, respectively.

5. The application according to claim 1, characterized in that, The formulation also contains available excipients.

6. The application according to claim 5, characterized in that, The dosage form of the preparation is either a solid dosage form or a liquid dosage form.

7. The application according to claim 6, characterized in that, The liquid dosage form is a solution, suspension, or emulsion.

8. The application according to claim 6, characterized in that, The solid dosage forms mentioned are tablets, capsules, pills, and powders.

9. A preparation for delaying the aging of human mesenchymal stem cells, characterized in that, It contains S100A9 protein, S100A8 protein, GAPDH protein or any combination thereof as active ingredients; The amino acid sequence of the S100A9 protein is shown in SEQ ID NO.1, the amino acid sequence of the S100A8 protein is shown in SEQ ID NO.3, and the amino acid sequence of the GAPDH protein is shown in SEQ ID NO.5.