A spotted leafed phalaenopsis and a preparation method thereof

By constructing the CymMV VIGS system for Phalaenopsis orchids, rapid silencing of the PePDS gene in Phalaenopsis orchids was achieved, solving the problems of long breeding cycles and difficult genetic manipulation, creating variegated Phalaenopsis orchids, and broadening the application of gene function research and breeding.

CN122303294APending Publication Date: 2026-06-30SHANGHAI NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610255460.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-04
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly achieve gene silencing in Phalaenopsis orchids, especially in the creation of leaf traits. Furthermore, genetic manipulation is difficult, the breeding cycle is long, and virus-induced gene silencing (VIGS) technology has not been effectively utilized.

Method used

A CymMV-based VIGS system was constructed, and recombinant plant virus vectors were introduced into Phalaenopsis orchids via Agrobacterium-mediated transformation or gene gun bombardment to specifically silence the PePDS gene and achieve rapid induction of the variegated leaf phenotype.

Benefits of technology

Variegated leaves can be created on Phalaenopsis orchid leaves without the need for tissue culture regeneration, shortening the breeding cycle, broadening the scope of gene function research, providing new methods for the genetic improvement and variety breeding of Phalaenopsis orchids, and creating ornamental orchids with specific phenotypes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention relates to plant genetic engineering, and more particularly to a variegated Phalaenopsis orchid and its preparation method, the preparation method comprising the following steps: (1) according to the target gene with the base sequence shown in SEQ ID No. 1 PePDS (1) Synthesize specific nucleotide fragments; (2) Construct specific nucleotide fragments into a plant virus vector; (3) Introduce the recombinant plant virus vector obtained in step (2) into Phalaenopsis orchid plant material; (4) Screen to obtain Phalaenopsis orchids with silenced target genes. This invention achieves rapid, efficient, and non-transgenic leaf color variegation creation in commercial Phalaenopsis orchid varieties for the first time through VIGS technology; it not only breaks through the technical bottleneck of difficult and long cycle of genetic manipulation of orchid plants, significantly shortening the trait verification cycle, but also induces diverse and highly ornamental variegated leaf phenotypes such as albino, yellow, or purple in different varieties, and has the advantages of simple operation, low cost, and industrialization feasibility.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to plant genetic engineering, and more particularly to a variegated Phalaenopsis orchid and its preparation method. Background Technology

[0002] Phalaenopsis orchids are beloved by consumers for their unique flower shapes, vibrant colors, and long blooming periods. The global orchid industry is undergoing a crucial transformation, and Phalaenopsis, as the "Queen of Orchids," has become one of the most industrialized potted flower varieties worldwide due to its long blooming period and vibrant colors. However, with the maturation of production technology, the market faces a severe challenge of "homogenization." As the flower consumption market upgrades, Generation Z has become the main consumer force. They not only focus on the vibrancy of the flowers but also pursue the overall artistry and individuality of the plant. Therefore, Phalaenopsis orchids with special leaf patterns (such as golden edges, silver edges, tiger stripes, and speckled gold) often command higher market prices than ordinary varieties due to their unique ornamental value and scarcity, possessing extremely high collectible value and economic benefits.

[0003] Plant genetic engineering plays a crucial role in the discovery of functional genes and germplasm innovation in Phalaenopsis orchids, but it also faces significant challenges. Due to the long growth cycle of Phalaenopsis orchids (typically requiring 2-3 years to flower, with a breeding cycle of 8-10 years), the difficulty in establishing genetic transformation systems, and the low efficiency of transformation, research on the variegated leaf phenotype of Phalaenopsis orchids has progressed slowly. Against this backdrop, virus-induced gene silencing (VIGS) technology has shown unique advantages. VIGS is a molecular tool based on RNA interference (RNAi), which uses recombinant viruses carrying target gene fragments to infect plants, specifically inhibiting the expression of endogenous genes. It has advantages such as short cycle time and no need for tissue culture regeneration. Although there have been attempts to apply VIGS in some orchid species, there are still few reports on VIGS systems suitable for creating leaf traits (such as leaf spots and pigment synthesis) in Phalaenopsis orchids. Summary of the Invention

[0004] The purpose of this invention is to provide a variegated Phalaenopsis orchid and its preparation method.

[0005] The present invention adopts the following technical solution:

[0006] This invention provides a method for preparing variegated Phalaenopsis orchids, comprising the following steps:

[0007] (1) Based on target genes PePDS Synthesize specific nucleotide fragments;

[0008] target genes PePDS The nucleotide sequence of the sequence is shown in SEQ ID No. 1:

[0009] (2) Constructing specific nucleotide fragments into plant virus vectors;

[0010] (3) Introduce the recombinant plant virus vector obtained in step (2) into Phalaenopsis plant material;

[0011] (4) Screening was conducted to obtain Phalaenopsis plant materials with target gene silencing, namely Phalaenopsis variegated.

[0012] SEQ ID No.1: TTGCAGTGGAAGGAACATTCCATGGTTTTTGCAATGCCTAACAAACCAGGAGAATTCAGCCGCTTTGATTTTCCAGAGGTCCTTCCAGCTCCCTTTAATGGTATATGGGCCATCTTAAAGAACA ATGAAATGCTGACCTGGTCAGAAAAAGTGAAATTTGCTATTGGACTTTTGCCAGCCATTGTTGGAGGGCAGTCTTATGTTGAGGCTCAGGATATTTTAACAGTTAAAGAGTGGATGAAACGGCAGGGTG.

[0013] Although virus-induced gene silencing (VIGS) technology has been used for functional gene research in some model plants and crops, its application in orchids, especially Phalaenopsis, has long been limited by the lack of efficient and stable viral vector systems and suitable infection methods. Existing technologies generally consider Phalaenopsis genetic manipulation difficult and its regeneration cycle long, making it difficult to support rapid phenotypic verification. Therefore, the industry has mostly focused on traditional hybridization breeding, rather than considering VIGS as a feasible means of creating foliage traits. This invention breaks through this technological bias, and for the first time constructs a CymMV-based VIGS system and applies it precisely. PePDS Gene silencing enables rapid, localized, and observable induction of variegated leaf phenotypes.

[0014] Preferably, the plant virus vector in step (2) is selected from any one of Cymbidium flake virus (CymMV) vector, tobacco brittle virus (TRV) vector, and cucumber mosaic virus (CMV) vector.

[0015] Preferably, the plant virus vector is the Cymbidium faberi leaf virus vector, i.e., the CymMV vector.

[0016] Preferably, step (1) specifically includes the following steps:

[0017] Design amplification primers based on target genes;

[0018] RNA was extracted from Phalaenopsis orchids and reverse transcribed to obtain cDNA. Specific nucleotide fragments were amplified by PCR using amplification primers.

[0019] Preferably, the method for introducing Phalaenopsis plant material in step (3) is selected from either Agrobacterium-mediated transformation or gene gun bombardment.

[0020] Preferably, the method for introducing Phalaenopsis plant material is Agrobacterium-mediated transformation.

[0021] Preferably, the step of introducing Phalaenopsis orchid plant material in step (3) includes:

[0022] The recombinant plant virus vector obtained in step (2) was transformed into Agrobacterium competent cells, and Agrobacterium recombinant plant virus vector was obtained by screening.

[0023] Prepare an infection solution containing recombinant plant virus vector Agrobacterium and acetylsuccinone (AS);

[0024] Select Phalaenopsis orchid plant material, use a syringe to draw up the infection solution, and inject it into the underside of the leaf until the infection solution soaks into part of the leaf tissue.

[0025] Preferably, the Phalaenopsis plant material in step (3) is a Phalaenopsis plant leaf with initial flower buds.

[0026] Preferably, the OD600 value of the Agrobacterium concentration in the infection solution is 0.6-1.2.

[0027] Preferably, the screening is any one of phenotypic observation, pigment content determination, or real-time quantitative PCR detection.

[0028] This invention also provides a variegated Phalaenopsis orchid, in which the target gene is silenced in wild-type Phalaenopsis orchids using the above method. PePDS get.

[0029] Compared with the prior art, the present invention has the following significant advantages:

[0030] 1. This method can effectively achieve gene silencing in Phalaenopsis orchids, based on the phytoene dehydrogenase gene (…). PePDS The experimental results showed that the leaves of the silenced plants exhibited obvious whitening or colored mottled phenotypes, and the chlorophyll and carotenoid contents were significantly reduced.

[0031] 2. This method does not require a lengthy tissue culture and regeneration process; variegated Phalaenopsis orchids can be created on leaves simply by injection.

[0032] 3. This method broadens the application scope in the field of Phalaenopsis gene function research, providing the possibility for in-depth research on gene functions in multiple aspects such as Phalaenopsis leaf pattern formation, flower color regulation and growth and development. It also provides new ideas and methods for the genetic improvement and variety breeding of Phalaenopsis, which helps to shorten the breeding cycle and cultivate Phalaenopsis varieties with specific phenotypes or excellent traits. Attached Figure Description

[0033] Figure 1 Phalaenopsis orchid phytoene dehydrogenase ( PePDS Structural domain analysis diagram;

[0034] Figure 2 Phalaenopsis orchid phytoene dehydrogenase ( PePDS Sequence alignment diagram of the protein;

[0035] Figure 3 The images show the leaf phenotypes of Phalaenopsis orchids. a) is the leaf phenotype of the blank control group (WT) 5 weeks after inoculation; b) is the leaf phenotype of the negative control group (CymMV EV) 5 weeks after inoculation; c) is the leaf phenotype of the experimental group (CymMV EV). PePDS The leaf phenotype 5 weeks after inoculation showed that the experimental group of leaves had obvious white and yellow spots;

[0036] Figure 4 The graph shows the pigment content in the leaves of Phalaenopsis orchids after gene silencing. In the graph, a is a statistical graph of chlorophyll content in leaves of different treatment groups; b is a statistical graph of carotenoid content in leaves of different treatment groups; **** indicates P<0.0001, *** indicates P<0.001.

[0037] Figure 5 This is a statistical graph showing the expression levels of related genes after gene silencing in Phalaenopsis orchids. a) represents the relative expression level of the viral coat protein gene (CP), used to indicate viral infection efficiency; b) represents the expression level of the target gene (…). PePDS The relative expression level of ) is used to indicate gene silencing efficiency; ** indicates P<0.01, **** indicates P<0.0001.

[0038] Figure 6 The images show the phenotype of the Phalaenopsis orchid 'Neon'. Figure a shows the leaf phenotype of the negative control group at week 5, and figure b shows... PePDS Leaf phenotype in week 5 of the silent experimental group. Detailed Implementation

[0039] The technical solution of the present invention will be further described below with reference to specific embodiments.

[0040] Example 1: Construction of Phalaenopsis gene silencing viral vector and preparation of Agrobacterium tumefaciens

[0041] 1. The phytopene dehydrogenase gene ( PePDS Preparation of specific nucleotide fragments

[0042] (1) Total RNA was extracted from Phalaenopsis leaves and reverse transcribed to obtain cDNA. Specific methods can be found in the instructions of commercially available plant RNA extraction and reverse transcription kits.

[0043] (2) The phytopenic lycopene dehydrogenase (PDS) gene and protein sequences of the relevant species were retrieved and downloaded from the NCBI GenBank database: PePDS (XM_020730635.1), DcPDS (XM_020822624.2), OhPDS (GU132865.1), NbPDS (EU165355.1), and AtPDS (NM_202816.2). Conserved base patterns of the PDS protein sequences of these five species were predicted using online tools.

[0044] (3) Obtain Phalaenopsis orchids from the database information. PePDS Gene sequence was obtained, and specific primers (primer F and primer R) were designed to amplify cDNA from Phalaenopsis orchids for use in silencing. PePDS Gene-specific nucleotide fragments. PCR amplification procedures were performed according to standard molecular biology experimental procedures.

[0045] (4) The PCR product was detected by agarose gel electrophoresis and then purified to obtain... PePDS Specific nucleotide fragments.

[0046] Primer F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTCGTTTGCAGTGGAAGGAACATTC-3', as shown in SEQ ID No. 2.

[0047] Primer R: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTACACCCTGCCGTTTCATCC-3', as shown in SEQ ID No. 3.

[0048] 2. Recombinant viral vector CymMV- PePDS Construction

[0049] (1) Cymbidium leaf virus (CymMV) plasmid was selected as the vector backbone. A 50 μL restriction enzyme digestion system was prepared: 2-5 μg CymMV plasmid DNA, specific restriction endonuclease (…). Spe I and Sac I) Add 1 μL of each of the following: 10× Reaction Buffer and 5 μL of other reagents, then add nuclease-free water to a final volume of 50 μL. Incubate the reaction mixture in a 37°C water bath for 2–4 hours. After the reaction, perform 1% agarose gel electrophoresis. Cut off the gel containing the linearized vector fragment, purify and recover it, and determine its concentration for later use.

[0050] (2) Construction of recombinant plasmid CymMV- PePDS The ligation reaction was performed using a one-step homologous recombinase, following the sequence of vector and the ligation reaction obtained in step 1. PePDS Prepare a 20 μL reaction mixture using a specific nucleotide fragment molar ratio of 2:1 to 5:1, 5× CE II Buffer, Exnase II recombinase, and ddH2O. After gentle mixing, incubate at 37°C in a metal bath or PCR instrument for 30 minutes. Immediately after the reaction, cool to 4°C to complete the construction of the recombinant plasmid CymMV-PePDS.

[0051] (3) Take 5-10 μL of the ligation product from step (2) and add it to 100 μL of thawed *E. coli* DH5α competent cells. Incubate on ice for 30 minutes; heat shock at 42℃ for 90 seconds, then quickly transfer to ice to cool for 2-3 minutes; add 600 μL of antibiotic-free LB broth and incubate at 37℃ and 200 rpm for 1 hour. Select single colonies for PCR identification and sequencing analysis. After confirming that the inserted fragment sequence is correct, extract the plasmid to obtain the successfully constructed CymMV-PePDS recombinant plasmid. At the same time, construct an empty vector plasmid, named CymMV-EV, by using the same transformation and screening steps for unmodified or self-ligated CymMV vectors as a negative control.

[0052] 3. Preparation of recombinant Agrobacterium

[0053] (1) CymMV- PePDS The CymMV-EV plasmid was transformed into Agrobacterium GV3101 competent cells.

[0054] (2) After antibiotic screening and PCR verification, positive monoclonal colonies were selected for amplification culture to obtain Agrobacterium tumefaciens bacterial suspension containing recombinant viral vector.

[0055] 4. Preparation of the infiltration solution

[0056] (1) Collect the Agrobacterium cells by centrifuging the cultured Agrobacterium cultured to the logarithmic growth phase.

[0057] (2) Resuspend the bacterial cells in an infection buffer containing 10 mM MgCl2, 10 mM MES (pH 5.6) and 1500 μM acetylsylgenone (AS) and adjust the bacterial concentration to OD600=1.0.

[0058] (3) The resuspended bacterial solution was incubated at room temperature in the dark for 2 hours to obtain the Agrobacterium infection solution for infection.

[0059] Example 2: Gene silencing in Phalaenopsis orchids via injection infection

[0060] 1. Selection and Infection of Plant Materials

[0061] Healthy Phalaenopsis orchid plants with early flower buds were selected as experimental materials. CymMV- prepared in Example 1 was drawn using a 1 mL needleless syringe. PePDS Infection solution (experimental group) or CymMV-EV infection solution (negative control group).

[0062] Select suitable sites on the underside of Phalaenopsis orchid leaves, place the syringe close to the leaf surface, and slowly inject the infection solution until the solution wets part of the leaf tissue, forming obvious water-soaked patches. Simultaneously, uninjected plants were set up as a blank control group (WT).

[0063] Example 3: Validation of gene silencing method in Phalaenopsis orchids

[0064] (1) Phenotypic observation: Infected plants were cultured under suitable growth conditions (e.g., temperature 25℃ / 20℃, photoperiod 16h / 8h). Leaf phenotypic changes were observed 4-6 weeks after inoculation. Results are as follows: Figure 3 As shown, the leaves of the blank control group (WT) and the negative control group (CymMV-EV) maintained normal green color; while the experimental group (CymMV-EV)... PePDS The leaves showed obvious white patches and yellowing in both the infected and new leaf areas, indicating that... PePDS The gene was successfully silenced.

[0065] (2) Pigment content determination: Samples were taken to determine the chlorophyll and carotenoid content in the leaves. Results are as follows: Figure 3 As shown, compared with the control group, the chlorophyll and carotenoid contents in the leaves of the experimental group were significantly decreased (P<0.001), further confirming that... PePDS Gene silencing blocks the carotenoid synthesis pathway, which in turn leads to the photo-oxidative decomposition of chlorophyll.

[0066] (3) Gene expression analysis: Total RNA was extracted from leaves, reverse transcribed into cDNA, and the expression levels of relevant genes were detected using qRT-PCR. Results are as follows: Figure 4 As shown, the relative expression level of the viral capsid protein gene (CP) was significantly increased in the experimental group, proving that the virus had successfully infected and replicated; at the same time, the expression level of endogenous target genes was also significantly increased. PePDS The relative expression level of the gene was significantly lower than that of the control group (P<0.01), indicating that efficient gene silencing was achieved at the transcriptional level.

[0067] Example 4: Validation of the VIGS system and analysis of the purple phenotype in different varieties of Phalaenopsis orchid 'Neon'

[0068] (1) Verification Steps: To verify the universality and phenotypic diversity of the VIGS method described in this invention across different Phalaenopsis orchid varieties, the commercially available Phalaenopsis orchid variety 'Neon', rich in anthocyanins, was selected as the experimental material. Following the method described in Example 2, the CymMV-... PePDS Agrobacterium-mediated infection was injected into the abaxial surface of 'Neon' plant leaves, with CymMV-EV serving as a negative control. The treated plants were cultured under the same conditions, and phenotypes were observed at week 5 post-inoculation.

[0069] (2) Phenotypic observation: Results are as follows Figure 6 As shown, the leaves of the negative control group (EV) remained a normal dark green. Figure 6 a); while the experimental group (CymMV-PePDS) showed significant reddish-purple patches in both the injection site and the systemic migration area ( Figure 6 (b) is distinctly different from the albino or yellowish phenotypes found in conventional varieties.

[0070] (3) Explanation of phenotypic causes: PePDS Gene silencing blocks the biosynthesis of carotenoids. Without the photoprotective effect of carotenoids, chlorophyll undergoes photo-oxidative degradation under light, leading to leaf fading. However, in the specific 'Neon' variety, whose leaves already contain a high background level of anthocyanins, the reddish-purple anthocyanins are no longer masked and become visible after the previously dominant green chlorophyll degrades. This result not only proves that the VIGS system is applicable to Phalaenopsis orchid varieties with different genotypes but also demonstrates that silencing the same target gene (…) PePDS By combining the genetic backgrounds of different varieties, leaf patterns with rich colors (such as white spots, yellow spots, purple spots, etc.) can be created, which have extremely high ornamental value and breeding application potential.

Claims

1. A method for preparing variegated Phalaenopsis orchids, characterized in that, Includes the following steps: (1) Based on target genes PePDS Synthesize specific nucleotide fragments; target genes PePDS The nucleotide sequence of the sequence is shown in SEQ ID No. 1: (2) Constructing specific nucleotide fragments into plant virus vectors; (3) Introduce the recombinant plant virus vector obtained in step (2) into Phalaenopsis orchid plant material; (4) Screening to obtain Phalaenopsis plant materials with target gene silence, namely Phalaenopsis variegated.

2. The preparation method according to claim 1, characterized in that, The plant virus vector mentioned in step (2) is selected from any one of the following: Cymbidium faberi leaf virus vector, tobacco brittle virus vector, and cucumber mosaic virus vector.

3. The preparation method according to claim 1, characterized in that, The plant virus vector is the Cymbidium faberi leaf virus vector.

4. The preparation method according to claim 1, characterized in that, The steps for introducing Phalaenopsis orchid plant material in step (3) include: The recombinant plant virus vector obtained in step (2) was transformed into Agrobacterium competent cells, and Agrobacterium recombinant plant virus vector was obtained by screening. Prepare an infection solution containing recombinant plant virus vector Agrobacterium and acetylsuccinone; Select Phalaenopsis orchid plant material, use a syringe to draw up the infection solution, and inject it into the underside of the leaf until the infection solution soaks into part of the leaf tissue.

5. The preparation method according to claim 1, characterized in that, The Phalaenopsis plant material mentioned in step (3) is the leaf of a Phalaenopsis plant with initial flower buds.

6. The preparation method according to claim 1, characterized in that, The OD600 value of the Agrobacterium concentration in the infection solution is 0.6-1.

2.

7. The preparation method according to claim 1, characterized in that, The screening can be any one of phenotypic observation, pigment content determination, or real-time quantitative PCR detection.

8. The preparation method according to claim 1, characterized in that, The method for introducing Phalaenopsis plant material in step (3) is selected from either Agrobacterium-mediated transformation or gene gun bombardment.

9. The preparation method according to claim 1, characterized in that, The method for introducing Phalaenopsis orchid plant material is Agrobacterium-mediated transformation.

10. A variegated Phalaenopsis orchid, characterized in that, Obtained by the preparation method according to any one of claims 1-9.