Reference product for methylmalonic acidemia and use thereof

By preparing positive reference cells for the MMACHC gene mutation site using the CRISPR/Cas system, the problems of poor stability and narrow applicability of existing quality control products were solved, achieving efficient and stable detection of the methylmalonic acidemia gene and improving the accuracy and reliability of the detection.

CN122303419APending Publication Date: 2026-06-30SHENZHEN ZHUOYUN HAIZHI TECHNOLOGY CO LTD +2
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHENZHEN ZHUOYUN HAIZHI TECHNOLOGY CO LTD
Filing Date
2026-04-13
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing quality control products for methylmalonic acidemia gene testing suffer from high production costs, poor stability, and narrow applicability, resulting in insufficient accuracy and reliability.

Method used

Gene editing was performed using the CRISPR/Cas system to prepare positive reference cells containing specific mutation sites in the MMACHC gene. Stable references were constructed using specific primers and probes for gene detection.

Benefits of technology

It provides efficient and stable quality control materials, applicable to various detection methods and technology platforms, improving the accuracy and reliability of detection, closely approximating the genetic characteristics of clinical samples, and suitable for the standardization and quality control of MMA diagnostic kits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303419A_ABST
    Figure CN122303419A_ABST
Patent Text Reader

Abstract

This invention relates to the fields of molecular biology and human genetic disease detection; specifically, it relates to a reference standard for methylmalonic acidemia and its application. The reference standard comprises positive reference cells with MMACHC gene mutation sites. The genome of the positive reference cells contains one or more combinations of specific mutation sites of the following MMACHC genes: c.609G>A, c.567insT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G, and c.394C>T. This reference standard provides reliable technical support for the accurate detection of methylmalonic acidemia, especially MMACHC gene-related mutations, and is of great significance in improving detection accuracy and promoting detection standardization.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and human genetic disease detection; specifically, this invention relates to a reference material for methylmalonic acidemia and its application. Background Technology

[0002] With the development of gene testing technology, numerous gene testing products for disease detection have emerged on the market. To ensure the performance and effectiveness of these products, quality control materials have become indispensable standard references. They are not only crucial for product performance verification but also play an important role in interlaboratory quality assessment, laboratory problem identification, validation of the effectiveness of new methods, performance confirmation of new laboratory platforms, and internal quality control. Methylmalonic acidemia (MMA), also known as methylmalonic aciduria, is a hereditary disease caused by the accumulation of certain organic acids in the body due to specific enzyme deficiencies or vitamin B12 metabolism disorders. Based on its genotype, it can be divided into several subtypes, most of which follow an autosomal recessive inheritance pattern, with only one type exhibiting X-linked recessive inheritance.

[0003] However, the quality control products currently used for gene testing of methylmalonic acidemia mainly include: (1) quality control products based on clinical samples. Although the accuracy is high, clinical samples are limited and cannot be stably produced, making them difficult to obtain and industrialize, resulting in high prices; (2) quality control products prepared using plasmids or gene fragments, provided that the mutation or deletion sites related to methylmalonic acidemia are clearly identified. However, different manufacturers design quality control products based on the detection sites of their own products, without forming a unified standard. This also leads to the fact that quality control products produced by different gene testing manufacturers are often only applicable to a certain testing product. Quality control products from different manufacturers are not interchangeable, have a narrow range of applications, and the plasmid structure is relatively simple, not close to clinical samples, resulting in detection bias. In addition, plasmid quality control products have poor stability and will degrade due to prolonged storage or repeated freeze-thaw cycles, making them difficult to preserve for a long time.

[0004] Therefore, there is an urgent need for a quality control product that is low in production cost, stable in storage, and widely applicable to improve the accuracy and reliability of MMA gene testing, thereby better serving patient diagnosis and treatment. This new quality control product will help overcome the limitations of existing quality control products and promote the application and development of gene testing technology in hereditary diseases such as MMA. Summary of the Invention

[0005] (a) Technical problems to be solved

[0006] In view of the above-mentioned defects and deficiencies in the existing technology, the present invention provides a reference material for the detection of methylmalonic acidemia gene. This reference material provides reliable technical support for the accurate detection of methylmalonic acidemia, especially MMACHC gene-related mutations, and is of great significance in improving detection accuracy and promoting detection standardization.

[0007] (II) Technical Solution

[0008] In a first aspect, the present invention provides a reference for the detection of the MMACHC gene in methylmalonic acidemia, the reference comprising positive reference cells with MMACHC gene mutation sites, wherein the genome of the positive reference cells contains one or more combinations of specific mutation sites of the following MMACHC genes:

[0009] c.609G>A, c.567insT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G and c.394C>T.

[0010] The meaning of c.609G>A is as follows: c. indicates that the mutation occurs in the coding DNA sequence; 609 indicates that the mutation is located at the 609th nucleotide of the gene (numbered according to the transcript reference sequence NM_015506.3); G>A indicates that the base at this position is mutated from guanine (G) to adenine (A) (i.e., a single nucleotide substitution). c.567insT indicates the insertion of thymine at position 567. c.658_660delAAG indicates the deletion of the AAG sequence at positions 658 to 660. c.1A indicates a start codon mutation, where adenine (A) is mutated to guanine (G).

[0011] Preferably, it includes one or more combinations of specific mutation sites of the following MMACHC genes: c.609G>A, c.567insT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G, and c.394C>T.

[0012] The pathogenic variant gene for human combined MMA cb1C serotype is known in this art to be MMACHC. The human MMACHC gene has a Gene ID of 25974, is located on chromosome 1 at p34.1, and consists of four exons totaling 282 amino acids (transcript NM_015506.3). The protein encoded by the MMACHC gene is involved in the energy transduction of cobalamin (vitamin B12) uptake.

[0013] Preferably, the positive reference cells are prepared by gene editing using the CRISPR / Cas system.

[0014] The CRISPR-Cas9 system originates from the adaptive immune mechanism of bacteria and consists of clustered regularly spaced short palindromic repeats (CRISPR) and the Cas9 nuclease. Its core function is RNA-guided targeted DNA recognition and cleavage. It has now been modified into a universal gene-editing tool applicable to eukaryotes such as mammalian cells (including humans), oviparous animals, plants, and fungi. The editing mechanism of the CRISPR-Cas9 system includes: (1) Guide RNA design: Single-stranded guide RNA (sgRNA) is generated by transcription or chemical synthesis. Its 5' end contains a spacer sequence of about 20 nt, which is complementary to the target DNA (such as the MMACHC gene); the 3' end forms a hairpin structure to bind to the Cas9 protein; (2) Complex assembly and targeting: sgRNA (single-guide RNA) and Cas9 protein form a ribonucleoprotein complex (RNP), which is located to a specific site in the genome (such as c.609G>A) by the base complementarity principle of the spacer sequence; (3) DNA cutting and repair: The HNH and RuvC domains of Cas9 cut the two strands of the target DNA respectively, producing double-strand breaks (DSB); the cell repairs through the following two pathways: ① Non-homologous end joining (NHEJ): It is easy to introduce insertion / deletion mutations (Indels), which is suitable for gene knockout; ② Homologous targeted repair (HDR): It requires an exogenous donor template and can achieve precise editing (such as point mutation introduction).

[0015] This invention uses the CRISPR / Cas system to prepare positive reference cells, which is highly efficient, specific, and traceable. Off-target effects can be reduced by optimizing the sgRNA design. The edited cells need to be verified by Sanger sequencing or NGS to verify the mutation sites and ensure that the reference genotype is consistent with the design.

[0016] Preferably, when preparing cells with specific mutation sites in the MMACHC gene using the CRISPR / Cas system, the sgRNA sequences used for different mutation sites are as follows:

[0017] c.609G>A:ACTGGCGTGATTGGACTTAC CGG (SEQ ID NO:1);

[0018] c.567insT: AGCCTTCGAGTAGGGCGATA CGG (SEQ ID NO:2);

[0019] c.482G>A: GGGCTGGTTTGCCATCCGAG GGG (SEQ ID NO: 3);

[0020] c.1A>G: TCAGCGTGTAACGTGCGCTA TGG (SEQ ID NO: 4);

[0021] c.217C>T: CTGGGTCAGTCAGCATTCGG AGG (SEQ ID NO: 5);

[0022] c.315C>G: GGATCTTGGGGCGTCGGTTG GGG (SEQ ID NO: 6);

[0023] c.394C>T: CAGCCTCCACATCTTGTCGT TGG (SEQ ID NO:7);

[0024] c.658_660delAAG: GCTCTTCTGAGTAGCGCTCC TGG (SEQ ID NO: 8);

[0025] c.80A>G:GAGGGATAAACTAACCTGGA AGG (SEQ ID NO:9).

[0026] Preferably, the reference material further comprises negative reference cells, such as wild-type cells or cells (lines) with non-target mutation sites.

[0027] Preferably, the reference material further includes a detection limit reference material, wherein the detection limit reference material cells are composed, for example, of a specified proportion (known content) of positive reference material cells and negative reference material cells.

[0028] Preferably, the reference material further includes a repeatable reference material, which comprises multiple (≥3) cell samples with the same content of positive reference cells and / or negative reference cells.

[0029] Secondly, the present invention provides the application of the reference material for the detection of the MMA gene in methylmalonic acidemia in evaluating the detection performance of the kit.

[0030] Preferably, the kit is used to detect isolated nucleotide samples to confirm whether the sample donor suffers from methylmalonic acidemia caused by a mutation site in the MMACHC gene; the kit includes specific primer pairs and probe combinations for detecting MMACHC gene mutations; when evaluating the detection performance of the kit, the kit to be evaluated is used to test positive and negative reference cells in the reference material, wherein the negative reference cells are wild-type cells or cells (lines) with non-target mutation sites, and the test results are compared to evaluate the usability of the test kit.

[0031] The probe can be a fluorescent probe, such as a TaqMan fluorescent probe, with a fluorescent reporter group labeled at its 5' end and a fluorescent quencher group labeled at its 3' end. The kit also includes reagents for the amplification reaction, especially reagents suitable for PCR amplification, such as: Taq DNA polymerase, dNTPs, PCR amplification buffer, and Mg²⁺. 2+ One or more of UNG enzyme and dUTP. The detection process includes the following steps: amplifying a nucleic acid sample from a subject using the specific primer pair to obtain the target nucleotide fragment; simultaneously, using the probe to identify and bind to the region in the amplification product (or original template) corresponding to the probe sequence; and determining whether a methylmalonic acidemia (MMA)-related gene (such as the MMACHC gene) exists in the biological sample and whether the gene has been mutated by detecting the fluorescence signal generated by the binding of the probe and the template.

[0032] Preferably, the method further includes testing the detection limit reference standard with the kit to be evaluated to assess the sensitivity of the kit (evaluating the detection limit of the kit), wherein the detection limit reference standard cells are, for example, composed of a specified proportion (known content) of positive reference standard cells and negative reference standard cells.

[0033] Preferably, the test also includes testing a reproducibility reference with the kit to be evaluated to assess the stability of the kit (evaluating the difference in results of the kit in detecting cell samples with the same content of positive reference cells and / or negative reference cells), wherein the reproducibility reference includes multiple (≥3) cell samples with the same content of positive reference cells and / or negative reference cells.

[0034] (III) Beneficial Effects

[0035] The positive reference cells containing the MMACHC gene mutation site in this invention are stable, regenerable cells constructed by introducing high-frequency pathogenic mutation sites of the MMACHC gene into the cells using gene editing technology. This reference cell is closest to clinical samples in genetic characteristics and biological properties, possessing good stability and quantifiability, making it an ideal quality control reference. It is not only applicable to various detection methods and technology platforms, but can also be used as a standardized quality control material in the development of MMA diagnostic kits, facilitating unified evaluation and quality control of kit performance, and is of great significance for the detection of the MMACHC gene in methylmalonic acidemia. Furthermore, the reference cell can also be used to evaluate the efficacy of drugs or treatment regimens for methylmalonic acidemia. Attached Figure Description

[0036] Figure 1 shows the sequencing results of the 293T-hMMACHC (c.G609A) cell line.

[0037] Figure 2 shows the sequencing results of the 293T-hMMACHC (c.567insT) cell line.

[0038] Figure 3 shows the sequencing results of the 293T-hMMACHC (c.G482A) cell line.

[0039] Figure 4 shows the sequencing results of the 293T-hMMACHC(c.A1G) cell line.

[0040] Figure 5 shows the sequencing results of the 293T-hMMACHC (c.C217T) cell line.

[0041] Figure 6 shows the sequencing results of the 293T-hMMACHC (c.C315G) cell line.

[0042] Figure 7 shows the sequencing results of the 293T-hMMACHC (c.C394T) cell line.

[0043] Figure 8 shows the sequencing results of the 293T-hMMACHC (c.658-660delAAG) cell line.

[0044] Figure 9 shows the sequencing results of the 293T-hMMACHC (c.A80G) cell line. Detailed Implementation

[0045] To better explain and facilitate understanding of the present invention, the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0046] Example 1

[0047] This embodiment relates to a method for preparing positive reference cells with MMACHC gene mutation sites. The objective of this embodiment is to use the CRISPR / Cas system to perform gene editing on cells and introduce high-frequency pathogenic mutation sites in the MMACHC gene. The high-frequency pathogenic mutation sites in the MMACHC gene include: c.609G>A, c.567insT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G, and c.394C>T.

[0048] The specific steps are as follows:

[0049] 1. The following sgRNA sequences (applicable to SpCas9 system version) corresponding to the MMACHC gene mutation sites were designed and artificially synthesized:

[0050] 293T-hMMACHC(c.G609A)

[0051] sgRNA: ACTGGCGTGATTGGACTTAC CGG(SEQ ID NO:1)

[0052] 293T-hMMACHC(c.567insT)

[0053] sgRNA: AGCCTTCGAGTAGGGCGATA CGG(SEQ ID NO:2)

[0054] 293T-hMMACHC(c.G482A)

[0055] sgRNA: GGGCTGGTTTGCCATCCGAG GGG(SEQ ID NO:3)

[0056] 293T-hMMACHC(c.A1G)

[0057] sgRNA: TCAGCGTGTAACGTGCGCTA TGG(SEQ ID NO:4)

[0058] 293T-hMMACHC(c.C217T)

[0059] sgRNA: CTGGGTCAGTCAGCATTCGG AGG(SEQ ID NO:5)

[0060] 293T-hMMACHC(c.C315G)

[0061] sgRNA: GGATCTTGGGGCGTCGGTTG GGG(SEQ ID NO:6)

[0062] 293T-hMMACHC(c.C394T)

[0063] sgRNA: CAGCCTCCACATCTTGTCGT TGG(SEQ ID NO:7)

[0064] 293T- hMMACHC(c.658-660delAAG)

[0065] sgRNA: GCTCTTCTGAGTAGCGCTCC TGG(SEQ ID NO:8)

[0066] 293T- hMMACHC(c.A80G)

[0067] sgRNA:GAGGTAACTAACCTGGA(SEQ ID NO:9)。

[0068] The above sgRNA design tool is GPP sgRNA Designer, with a targeting efficiency of approximately 13%.

[0069] 2. Electroporation of target cells

[0070] (1) 293T cells in the logarithmic growth phase (confluence 80-90%) were digested into single-cell suspensions, and a portion of the cells were taken to detect their number and viability.

[0071] (2) Take 5×10 5 ~1×10 6 One cell was placed in a sterile tube and centrifuged at 300×g for 3 minutes.

[0072] (3) Discard the supernatant, resuspend the cell pellet in 100 μl Buffer R, add 30 μg of endotoxin-free CRPSPR expression plasmid and oligo and mix well.

[0073] (4) Add 3ml of Buffer E2 to the electroporation cup and then place it into the slot of the electroporation instrument.

[0074] (5) Use a 100 μl electroporation pipette tip to aspirate the cells and the above mixture, insert it into the electroporation cup, set the electroporation conditions, and start electroporation (125V, pulse time 5 ms, interval 50ms).

[0075] (6) After the electroporation is completed, the cells are seeded into 6-well plates with preheated culture medium and cultured for a longer period of time.

[0076] (7) Repeat the above steps until all samples have been electrospun.

[0077] 3. Screening and Monoclonalization

[0078] (1) Observe the electroporation effect under a microscope 24-48 h after transfection, and add drugs (purinemycin, 1 μg / mL) to screen cells.

[0079] (2) Take a certain amount of cell suspension, dilute it using the limiting dilution method and seed it into a 96-well plate. Place the cells in a 37°C, 5% CO2 incubator and incubate for 24 hours.

[0080] (3) Genomic DNA was extracted from the remaining cells using the TIANGEN Blood / Cell / Tissue Genomic DNA Extraction Kit, and PCR amplification was performed on the knockout region using primers.

[0081] The PCR amplification reaction system and reaction procedure are shown in Table 1 and Table 2, respectively.

[0082] Table 1: PCR amplification reaction system

[0083]

[0084] Table 2: PCR Amplification Reaction Procedure

[0085]

[0086] Table 1 shows the forward primer ATTCCCCAGCAAGCTCAGCGTGTAA and the reverse primer GGTCCACATGGGAGAAAATCAAGGG.

[0087] (4) Sequencing of PCR products

[0088] In sequence sequencing near the gRNA target site, positive samples will show overlapping peaks at the target site and in the subsequent sequence. Therefore, the positive sample is confirmed by detecting overlapping peaks.

[0089] (5) After the cells are seeded into 96-well plates and cultured for about a week, observe the growth of the clones and mark the wells containing single-clonal cell clusters.

[0090] (6) After about two to four weeks, digest the grown single clones, divide them into two, and pass them into two 96-well plates for further culture.

[0091] (7) When the cell confluence reaches 60% or more, a plate can be taken out for identification of monoclonal cells.

[0092] 3. Screening and identification of monoclonal antibodies

[0093] (1) Pour out the culture medium in the 96-well plate, add 100 μl of Ubigene rapid nucleic acid release reagent, and let stand at room temperature for 10 minutes.

[0094] (2) Centrifuge at 3000 rpm for 5 minutes to release the nucleic acid of the cells into the supernatant.

[0095] (3) PCR amplification of the knockout region

[0096] The PCR reaction system and reaction procedure are shown in Tables 3 and 4.

[0097] Table 3: PCR Reaction System

[0098]

[0099] Table 4: PCR Reaction Procedure

[0100]

[0101] Table 3 lists the forward primer as ATTCCCCAGCAAGCTCAGCGTGTAA and the reverse primer as GGTCCACATGGGAGAAAATCAAGGG.

[0102] (4) Sequencing of PCR products and analysis of the knockout results. If the sequencing results have no overlapping peaks and are consistent with the wild type, the clone is an unsuccessfully edited clone; if the sequencing results have no overlapping peaks and are consistent with the mutant sequence, the clone is a successfully point-mutated clone with the same mutation status for each allele; if the sequencing results have overlapping peaks, the clone may be a heterozygote or an edited clone with different allele indel status.

[0103] The Sanger sequencing results of the cell lines constructed using the above methods are shown in Table 5 and Figures 1-9.

[0104] Table 5: CRISPR / Cas gene editing cell lines and sequencing

[0105]

[0106] 4. Positive clone amplification and cryopreservation

[0107] For positive clones identified as having successfully mutated point mutations (accounting for 13% of the cells), continue passage and amplification. Once the cell count is sufficient, freeze and back them up.

[0108] 5. Cell Characterization

[0109] The cells exhibited good passage stability, and the mutations were retained after passage, which were verified by Sanger sequencing.

[0110] Example 2

[0111] In this embodiment, the cell lines prepared in Example 1 and identified by sequencing were quantified for DNA and then diluted to different test concentrations to prepare reference standards. Taking the reference standard corresponding to the c.609G>A mutation site as an example, the reference standard includes a positive reference cell reference standard, a negative reference standard, a detection limit reference standard, and a repeatability reference standard; the reference standard includes three genotypes: wild type, heterozygous mutant, and homozygous mutant.

[0112] The wild-type mutant was prepared from genomic DNA of cell line 293T-WT, the homozygous mutant was prepared from genomic DNA of cell line 293T-hMMACHC (c.G609A), and the heterozygous mutant was prepared by mixing genomic DNA of cell line 293T-WT and cell line 293T-hMMACHC (c.G609A) in a 1:1 ratio. Information on the c.609G>A mutation site reference material prepared in this example is shown in Table 6.

[0113] Table 6: Reference Sites for c.609G>A Mutation Sites

[0114]

[0115] Example 3

[0116] In this embodiment, the reference sample prepared in Example 2 was used to perform performance testing on the probe and primer pairs for detecting the c.609G>A mutation.

[0117] The primer pairs and probes for detecting the c.609G>A mutation in the MMACHC gene include: a premixed solution of the c.609G>A mutation primers and probes consisting of an upstream primer c.609-F, a downstream primer c.609-R, a wild-type probe c.609-WT, and a mutant probe c.609-MT (see Table 11).

[0118] Performance testing includes the following aspects:

[0119] 1. Use the above primer pairs and probe sets to detect positive and negative reference samples to evaluate the usability of the probes and primer pairs.

[0120] Test the c.609G>A mutation-positive reference materials. All results should be positive; see Table 7 for the test results. Test the c.609G>A mutation-negative reference materials. All results should be negative; see Table 8 for the test results.

[0121] Table 7: Detection Results of Positive Reference Samples

[0122]

[0123] Table 8: Test Results of Negative Reference Samples

[0124]

[0125] 2. Use the above primer pairs and probe set to detect the detection limit reference sample to evaluate the sensitivity of the probe and primer pairs.

[0126] The reference standard for detection limit was tested, and the test was repeated 20 times. The L1 test result should be negative, and the L2-L3 test results should be positive. The detection rate should be no less than 95%. The test results are shown in Table 9 below.

[0127] Table 9: Detection Limit Reference Sample Detection Results

[0128]

[0129] 3. Use the above primer pairs and probe sets to test the reproducibility reference sample to evaluate the stability of the probes and primer pairs.

[0130] The repeatability references were tested 10 times each. The results of the 10 tests should all be negative for R1-R2 and positive for R3-R6. The CV value of the Ct value should be ≤5%. The test results are shown in Table 10 below.

[0131] Table 10: Results of Repeatability Reference Material Tests

[0132]

[0133] The above describes the preparation and detection of the c.609G>A mutation site reference. The sequences of the TaqMan probes and primer pairs used in this embodiment's detection system are shown in Table 11.

[0134] Similar to Example 3, the preparation methods and components of cell references for the remaining mutation sites (c.567dupT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G, and c.394C>T) can refer to the references prepared with the c.609G>A mutation site described above. The sequences of the Taq Man probes and primer pairs in the detection system are shown in Table 11.

[0135] Table 11: Probe and primer pair sequences for detecting genes at different mutation sites

[0136]

[0137] Testing has shown that the reference sample designed in this invention meets expectations and can be used for performance evaluation of products for detecting gene mutations in combined methylmalonic acidemia, maximally simulating the complexity of clinical samples and the specificity and sensitivity of the testing system. Unless otherwise indicated, the practice of this invention will utilize conventional techniques such as biotechnology, organic chemistry, and inorganic chemistry. It is obvious that this invention can be implemented in other ways besides those specifically described in the foregoing description and examples.

[0138] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features. These modifications or substitutions, or combinations of technical features in the above embodiments that do not conflict with each other, can be made in accordance with the manner described in the embodiments. These modifications, substitutions or combinations do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A reference standard for detecting the MMA gene in methylmalonic acidemia, characterized in that, The reference sample contains positive reference cells with MMACHC gene mutation sites, and the genome of the positive reference cells contains one or more combinations of specific mutation sites of the following MMACHC genes: c.609G>A, c.567insT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G and c.394C>T.

2. The reference article according to claim 1, characterized in that, The positive reference cells contained combinations of specific mutation sites of the following MMACHC genes in their genome: c.609G>A, c.567insT, c.658_660delAAG, c.482G>A, c.1A>G, c.80A>G, c.217C>T, c.315C>G, and c.394C>T.

3. The reference article according to claim 1, characterized in that, The positive reference cells were prepared using a CRISPR / Cas system for gene editing.

4. The reference article according to claim 3, characterized in that, When preparing cells with specific mutation sites in the MMACHC gene using the CRISPR / Cas system, the sgRNA sequences used for different mutation sites are as follows: The sgRNA sequence of c.609G>A is shown in SEQ ID NO:

1. The sgRNA sequence of c.567insT is shown in SEQ ID NO:

2. The sgRNA sequence of c.482G>A is shown in SEQ ID NO:

3. The c.1A>G sgRNA sequence is shown in SEQ ID NO:

4. The sgRNA sequence of c.217C>T is shown in SEQ ID NO:

5. The sgRNA sequence of c.315C>G is shown in SEQ ID NO:

6. The sgRNA sequence of c.394C>T is shown in SEQ ID NO:

7. The sgRNA sequence of c.658_660delAAG is shown in SEQ ID NO:

8. The sgRNA sequence of c.80A>G is shown in SEQ ID NO:

9.

5. The reference article according to claim 1, characterized in that, The reference material also includes negative reference cells, which are wild-type cells or cells with non-target mutation sites.

6. The reference article according to claim 1, characterized in that, The reference standard also includes a detection limit reference standard, wherein the detection limit reference standard cells are composed of a specified ratio of positive reference standard cells and negative reference standard cells.

7. The reference article according to claim 1, characterized in that, The reference material also includes a repeatable reference material, which comprises multiple cell samples with the same content of positive reference cells and / or negative reference cells.

8. The use of the reference material for MMA gene detection in methylmalonic acidemia as described in any one of claims 1-7 in evaluating the detection performance of the kit.

9. The application according to claim 8, characterized in that, The kit is used to detect in vitro nucleotide samples to confirm whether the sample donor has methylmalonic acidemia caused by a mutation site in the MMACHC gene. The kit includes specific primer pairs and probe combinations for detecting MMACHC gene mutations. When evaluating the detection performance of the kit, the kit to be evaluated is used to test positive and negative reference cells in the reference sample. The negative reference cells are wild-type cells or cells with non-target mutation sites. The test results are compared to evaluate the usability of the test kit.

10. The application according to claim 9, characterized in that, It also includes testing the detection limit reference standard with the kit to be evaluated to assess the sensitivity of the kit, wherein the detection limit reference standard cells are composed of a specified ratio of positive reference standard cells and negative reference standard cells; It also includes testing reproducibility references with the kit to be evaluated to assess the stability of the kit, wherein the reproducibility references include multiple cell samples with the same content of positive reference cells and / or negative reference cells.