Application of thromboretin-4 in the diagnosis and treatment of endometriosis
By screening and validating THBS4 as a key gene in endometriosis, highly sensitive diagnostic biomarkers and inhibitors were developed, solving the challenges of early diagnosis and treatment, achieving non-invasive diagnosis and hormone-free treatment, and significantly improving diagnostic efficacy and treatment outcomes.
Patent Information
- Application Number
- CN202610590036.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-30
- Publication Date
- 2026-06-30
AI Technical Summary
Current technologies lack highly sensitive and specific early non-invasive diagnostic biomarkers, which often delays the diagnosis of endometriosis patients from the onset of symptoms by 7-9 years. Furthermore, current treatment options lack specific targeted therapies, and hormone therapy has significant side effects and is prone to recurrence.
Using THBS4 as a diagnostic biomarker, we screened and verified its key role in endometriosis through various bioinformatics analysis methods. We developed THBS4 inhibitors as a targeted therapy strategy, and used enzyme-linked immunosorbent assay (ELISA) and Western blotting to detect THBS4 expression levels. We also used lentivirus-mediated shRNA to silence the THBS4 gene to inhibit lesion growth.
It provides highly sensitive and specific non-invasive or minimally invasive diagnostic biomarkers that can effectively diagnose early endometriosis and assess disease severity. Furthermore, THBS4 inhibitors significantly inhibit lesion growth and fibrosis in in vivo and in vitro models, providing a non-hormone-dependent precision therapeutic target.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically relating to the application of thrombospondin-4 (THBS4) as a biomarker in the preparation of diagnostic products for endometriosis, and the application of THBS4 inhibitors in the preparation of drugs for the treatment of endometriosis. Background Technology
[0002] Endometriosis (EMs) refers to the growth of functional endometrial tissue (glands and stroma) outside the uterine cavity and the lining of the uterine body. It is a common chronic, estrogen-dependent inflammatory disease with an incidence of approximately 6-10% in women of reproductive age, and its incidence is gradually increasing and trending towards earlier onset. Its biological behavior is similar to that of malignant tumors, exhibiting characteristics such as adhesion, invasion, and distant metastasis. Ovarian endometriosis (OEM), in particular, significantly increases the risk of ovarian cancer, severely impacting patients' quality of life.
[0003] Currently, the clinical diagnosis of endometrial cancer (EMs) mainly relies on patient symptoms, gynecological examination, imaging examinations, and biochemical indicators such as serum cancer antigen 125 (CA125). However, a definitive diagnosis still requires laparoscopic surgery and pathological examination. Due to the lack of highly sensitive and specific early non-invasive biomarkers, the time from symptom onset to diagnosis is often delayed by 7-9 years. CA125 is currently the most commonly used clinical auxiliary diagnostic indicator, but its level is not significantly elevated in patients with early or mild EMs, and it can also be elevated in epithelial cancers and various inflammatory diseases, resulting in limited diagnostic specificity and sensitivity. Therefore, finding novel, highly specific, and highly sensitive biomarkers for the early prediction and disease monitoring of EMs is an urgent clinical problem to be solved.
[0004] In terms of treatment, current approaches primarily rely on hormone regulation and surgical resection, lacking specific targeted therapies. While hormone therapy can alleviate symptoms, it has significant side effects and a high relapse rate after discontinuation. Therefore, identifying new therapeutic targets and developing non-hormone-dependent targeted therapy strategies is of great clinical significance. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a new use for THBS4 as a diagnostic marker and therapeutic target for endometriosis. The specific technical solution is as follows: The first aspect of this invention provides the use of a reagent for detecting THBS4 expression levels in the preparation of products for diagnosing endometriosis.
[0006] By integrating multiple GEO public datasets using bioinformatics, and employing differential expression analysis, three machine learning algorithms (Lasso, Random Forest, and SVM-RFE), and weighted gene co-expression network analysis (WGCNA) for systematic screening, and after multi-center validation with clinical samples, THBS4 was identified and confirmed for the first time as a key pivot gene in endometriosis. qRT-PCR and Western blot experiments showed that the mRNA and protein expression levels of THBS4 in ectopic endometrial tissue were significantly higher than those in normal endometrial tissue (P<0.05). Enzyme-linked immunosorbent assay (ELISA) results showed that the THBS4 protein level in peripheral plasma of endometriosis patients was significantly higher than that in healthy controls, and the THBS4 level in stage III-IV patients was significantly higher than that in stage I-II patients (P<0.0001), indicating a positive correlation between THBS4 expression level and disease severity. Receiver operating characteristic (ROC) curve analysis showed that THBS4 alone had an AUC of 0.930 (95% confidence interval: 0.866–0.995) for diagnosing EMs, with a sensitivity of 92% and a specificity of 92%, significantly superior to CA125 (AUC = 0.767, sensitivity 74%, specificity 84%). When THBS4 and CA125 were used in combination for diagnosis, the AUC reached 0.968, with sensitivity and specificity increasing to 94% and 88%, respectively. Therefore, THBS4 can serve as a reliable biomarker for diagnosing EMs, especially early-stage EMs, and can reflect disease severity, possessing significant clinical translational value.
[0007] Furthermore, the reagent for detecting THBS4 expression levels can be any known reagent in the art capable of detecting protein or mRNA expression levels in biological samples. Preferably, the reagent is a reagent for detecting THBS4 protein expression levels, such as antibodies detected by methods such as enzyme-linked immunosorbent assay (ELISA), Western blotting, or immunohistochemistry (IHC). The reagent can also be a reagent for detecting THBS4 mRNA expression levels, such as specific primer pairs and / or probes for quantitative real-time polymerase chain reaction (qRT-PCR). The diagnostic product can be a diagnostic kit containing the aforementioned reagents. In a preferred embodiment, the diagnostic kit further includes a reagent for detecting CA125 to achieve joint detection of THBS4 and CA125, further improving diagnostic efficacy.
[0008] A second aspect of the present invention provides the use of substances that inhibit or silence THBS4 gene expression in the preparation of medicaments for treating endometriosis.
[0009] In vitro cell function experiments confirmed that silencing the THBS4 gene in human endometrial stromal cells (hESCs) using lentivirus-mediated shRNA (short hairpin RNA) (knockdown efficiency of 73.34%) significantly inhibited cell proliferation (MTT assay), invasion (Transwell assay), and migration (cell scratch assay) (P<0.05). Conversely, overexpression of THBS4 significantly enhanced the invasion and migration abilities of hESCs (P<0.05). In vivo animal experiments confirmed that in a C57BL / 6J mouse model of endometriosis, silencing THBS4 expression by intraperitoneal injection of adeno-associated virus expressing THBS4-shRNA (AAV9-THBS4-shRNA) resulted in a significant reduction in the volume of ectopic lesions (P<0.05) and a significant decrease in the collagen fiber deposition area (assessed by Masson staining) in the lesion tissue compared to the control group (P<0.05). This indicates that targeted inhibition of THBS4 can effectively suppress the growth and fibrosis of endometriosis lesions, thus exerting a therapeutic effect.
[0010] Furthermore, the substance that inhibits or silences THBS4 gene expression can be interfering RNA (such as shRNA, siRNA), antisense oligonucleotides, ribozymes, or expression vectors (such as plasmids, viral vectors) for expressing the above molecules. Preferably, the expression vector is a recombinant lentiviral vector or a recombinant adeno-associated virus (AAV) vector. In a specific embodiment, the substance is a recombinant adeno-associated virus carrying shRNA targeting the THBS4 gene, serotype AAV9, delivered in the form of AAV9-THBS4-shRNA.
[0011] The present invention also provides a pharmaceutical composition for treating endometriosis, comprising a therapeutically effective amount of the aforementioned substance capable of inhibiting or silencing THBS4 gene expression, and a pharmaceutically acceptable carrier, diluent, or excipient. This pharmaceutical composition can be formulated into parenteral administration formulations such as injections.
[0012] Compared with the prior art, the present invention has the following beneficial effects: (1) It provides a novel, highly sensitive and specific non-invasive or minimally invasive diagnostic biomarker for endometriosis, which has significantly better diagnostic efficacy than the existing biomarker CA125. It is especially effective in diagnosing early-stage patients and can be used for the assessment and monitoring of disease severity, with broad clinical application prospects. (2) It reveals for the first time the functional promoting role of THBS4 in the occurrence and development of endometriosis, and proves that the gene silencing strategy targeting THBS4 can effectively inhibit disease progression in both in vivo and in vitro models. It provides a novel, non-hormone-dependent precision therapeutic target and candidate drug for EMs, with significant drug development value. Attached Figure Description
[0013] Figure 1 A comprehensive analysis of the bioinformatics screening and validation of THBS4 expression and diagnostic efficacy. (A) is the principal component analysis (PCA) plot of the training and validation sets; (B) is the volcano plot of differentially expressed genes; (C) is the heatmap of the top 40 significantly differentially expressed genes; (D) is the Venn diagram of the intersection of three machine learning algorithms (Lasso, RF, SVM-RFE); and (E) is the box plot and ROC curve of THBS4 expression in the training set and external validation set (GSE5108).
[0014] Figure 2 : Validation of THBS4 expression levels and evaluation of diagnostic efficacy in clinical samples. Among them, (A) is a band diagram of THBS4 protein expression in ectopic and normal endometrial tissues detected by Western blotting; (B) is a bar chart of mRNA expression levels in two groups detected by qRT-PCR; (C) is a bar chart comparing CA125 and THBS4 levels in plasma of patients with different stages of endometrial emphysema and controls; (D) is the ROC curve of THBS4, CA125 and the combination of the two for the diagnosis of endometrial emphysema.
[0015] Figure 3 Figure 1 shows the in vitro experimental results of the effect of THBS4 on the function of human endometrial stromal cells (hESCs). (A) is a fluorescence micrograph (100×) of hESCs 144 hours after lentiviral infection; (B) shows the relative expression level of THBS4 mRNA by qRT-PCR in each group; (C) shows the Western blot analysis of THBS4 protein in each group; (D) shows the MTT proliferation curves of each group; (E) shows crystal violet stained images (100×) of each group in the Transwell invasion experiment; (F) shows a statistical graph of the number of Transwell-invaded cells; (G) shows a representative image of the cell scratch healing experiment; and (H) shows a statistical graph of cell migration rate.
[0016] Figure 4 Figure 1: In vivo treatment experiment of mouse model of endometriosis. (A) is a schematic diagram of the animal experiment process; (B) is a gross image and HE staining image (100×) of the ectopic lesion; (C) is the ELISA detection results of serum THBS4 level in mice of each group; (D) is a comparison of the volume of ectopic lesions in mice of each group; (E) is the Masson staining image (100×) of lesion tissue in each group and a statistical graph of collagen deposition area. Detailed Implementation
[0017] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0018] Example 1: Validation of THBS4 expression levels in clinical samples and evaluation of diagnostic efficacy.
[0019] Clinical Sample Source: This study was approved by the Medical Ethics Committee of the Affiliated Maternal and Child Health Hospital of Jiangnan University (Approval No.: 2024-06-0319-09), and all participants signed informed consent forms. Ectopic endometrial tissue was collected from 9 patients with ovarian endometriosis (OEM) and 9 patients with normal endometrial tissue from patients undergoing total hysterectomy due to benign lesions. Peripheral blood was also collected from 25 patients with stage I-II OEM, 25 patients with stage III-IV OEM, and 25 healthy controls.
[0020] Tissue sample detection: Total RNA was extracted from tissues using the TRIzol method, reverse transcribed, and then qRT-PCR was performed using THBS4-specific primers (F: catggtgccagggtgtggga, R: gccccacagcggtaagatcc) and GAPDH internal control primers. Total protein was extracted from tissues using RIPA lysis buffer and detected by Western blotting with anti-THBS4 antibody (1:1000, Abcam).
[0021] Plasma sample testing: The concentration of THBS4 protein in plasma was detected using a human THBS4 ELISA kit (Elabscience); CA125 levels were tested by the hospital's clinical laboratory.
[0022] result: like Figure 2 As shown in A and 2B, compared with normal endometrial tissue, the expression levels of THBS4 protein and mRNA in ectopic endometrial tissue were significantly increased (P<0.05).
[0023] Plasma test results (Table 2, Figure 2 C) showed that plasma THBS4 levels in patients with stage I-II and stage III-IV EMs were significantly higher than those in the healthy control group (P<0.0001), and the level was even higher in patients with stage III-IV EMs; while the CA125 level in patients with stage I-II EMs was not significantly different from that in the control group.
[0024] like Figure 2 As shown in Figure D, ROC analysis indicated that the AUC for THBS4 alone was 0.930 (95% CI: 0.866-0.995), with a sensitivity of 92% and a specificity of 92%; the AUC for CA125 alone was 0.767 (95% CI: 0.660-0.874); and the AUC for the combined diagnosis of THBS4 and CA125 was 0.968 (95% CI: 0.933-1.00), with a sensitivity of 94% and a specificity of 88%.
[0025] Conclusion: THBS4 is stably and highly expressed in ectopic tissues and peripheral blood of patients with EMs, and can be used as a highly efficient biomarker for diagnosing EMs, especially early EMs. Its diagnostic efficacy is significantly better than that of CA125, and the combined detection can complement each other and enhance the effect.
[0026] Example 2: The regulatory effect of THBS4 on the malignant behavior of human endometrial stromal cells (hESCs).
[0027] Cells, Viruses, and Grouping: Human primary endometrial stromal cells (hESCs, ProCare Biotechnology) were cultured in DMEM / F12 medium containing 10% FBS. Lentiviral interference vector LV-shTHBS4 targeting THBS4, overexpression vector LV-THBS4, and corresponding negative control viruses were constructed (Shanghai Genechem Co., Ltd.).
[0028] The experiment was divided into 5 groups: (1) interference group (KD); (2) interference negative control group (KD-NC); (3) overexpression group (OE); (4) overexpression negative control group (OE-NC); (5) blank control group (Blank).
[0029] Cell infection and function experiments: Lentiviral agents were added at a multiplicity of infection (MOI) of 10, and the medium was changed 16 hours post-infection. MTT assays were performed 168 hours post-infection. Cell suspensions were seeded into 96-well plates (2000 cells / well) and cultured continuously for 5 days, with OD values at 490 nm measured daily to plot growth curves. Invasion assays were performed using Transwell chambers (with Matrigel), and migration assays were performed using matrigel-free chambers. Cells that penetrated the membrane were counted after 24 hours. Cell migration ability was assessed using a scratch assay; images were taken at 0, 24, and 48 hours, and the healing area was calculated using ImageJ software.
[0030] result: qRT-PCR and Western Blot validation showed that THBS4 mRNA and protein levels were significantly downregulated in the KD group, with a knockdown efficiency of 73.34%. Figure 3 (B, C); OE group showed significantly upregulated expression levels.
[0031] MTT experiment ( Figure 3 D) showed that the proliferation rate of cells in the KD group was significantly slower than that of its negative control group from day 3 (P<0.05), while there was no statistically significant difference between the OE group and its negative control group.
[0032] Invasion Experiment ( Figure 3 E, F) showed that the number of transmembrane cells was significantly reduced in the KD group (P<0.001) and significantly increased in the OE group (P<0.01).
[0033] Scratch test ( Figure 3 The results (G, H) showed that the cell migration rate in the OE group was significantly higher than that in the control group (P<0.05), while the migration rate in the KD group showed a decreasing trend but no statistical difference.
[0034] Conclusion: Silencing THBS4 can effectively inhibit the proliferation and invasion of endometrial stromal cells and reduce their malignant phenotype, verifying the in vitro effectiveness of THBS4 as a therapeutic target.
[0035] Example 3: In vivo therapeutic effect of AAV-mediated THBS4 gene silencing on EMs mouse model.
[0036] Animal model establishment and treatment: Six-week-old female C57BL / 6J mice (Hangzhou Ziyuan) were selected and, after acclimatization, an endometrial fragmentation model was established using the recognized intraperitoneal injection method. Mice that successfully modeled the model were randomly divided into three groups (n=9 per group): (1) AAV9-THBS4-shRNA treatment group, with 100 μL of 2.15 × 10⁻⁶ mcg intraperitoneally. 12 (1) Recombinant adeno-associated virus at a concentration of vg / mL; (2) AAV9-NC negative control group, injected with an equal amount of control virus at the same concentration; (3) Sodium chloride model control group, injected with an equal amount of physiological saline.
[0037] Sample testing: Mice were sacrificed 4 weeks after drug treatment. Blood was collected from the eyeballs, and serum was separated. THBS4 levels were detected using a mouse THBS4 ELISA kit (Kulu Biotech). Ectopic lesions were dissected and completely dissected, and their volumes were measured and calculated. Some lesion tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned for HE staining and Masson's trichrome staining. Histopathological changes were observed under a light microscope, and the area of collagen fiber deposition in Masson staining was quantitatively analyzed using ImageJ software.
[0038] result: Serum ELISA results ( Figure 4 C) showed that, compared with the AAV9-NC group and the saline group, the serum THBS4 level in mice in the AAV9-THBS4-shRNA group was significantly lower (P<0.05).
[0039] Lesion volume assessment ( Figure 4 D) showed that the volume of ectopic lesions in the treatment group mice was significantly smaller than that in the two control groups (P<0.05).
[0040] Masson staining ( Figure 4 E) showed that the percentage of collagen fiber (blue stained area) deposition area in the lesions of the treatment group was significantly lower than that of the two control groups (P<0.05).
[0041] Conclusion: THBS4 gene silencing mediated by AAV9 vector can effectively inhibit the growth and fibrosis of endometriosis lesions in vivo, showing good therapeutic potential.
[0042] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.
Claims
1. The use of a reagent for detecting the expression level of platelet-reactive protein-4 (THBS4) in the preparation of products for the diagnosis of endometriosis.
2. The application according to claim 1, characterized in that, The reagent used to detect THBS4 expression level is either a reagent for detecting THBS4 protein expression level or a reagent for detecting THBS4 mRNA expression level.
3. The application according to claim 2, characterized in that, The reagents used to detect the expression level of THBS4 protein are those used to detect THBS4 protein by enzyme-linked immunosorbent assay (ELISA), Western blotting, or immunohistochemistry.
4. The application according to claim 2, characterized in that, The reagent used to detect THBS4 mRNA expression levels is a reagent for detecting THBS4 mRNA by real-time quantitative polymerase chain reaction (qRT-PCR), including specific primer pairs and probes.
5. The application according to any one of claims 1 to 4, characterized in that, The product is a diagnostic kit, which also includes a reagent for detecting cancer antigen 125 (CA125) for the combined diagnosis of endometriosis using THBS4 and CA125.
6. Application of substances that inhibit or silence THBS4 gene expression in the preparation of drugs for treating endometriosis.
7. The application according to claim 6, characterized in that, The substance that inhibits or silences THBS4 gene expression is a short hairpin RNA (shRNA), small interfering RNA (siRNA), antisense oligonucleotide, or expression vector encoding the THBS4 gene.
8. The application according to claim 7, characterized in that, The expression vector is a recombinant lentiviral vector or a recombinant adeno-associated virus (AAV) vector.
9. A pharmaceutical composition for treating endometriosis, characterized in that, It contains a therapeutically effective amount of a substance that can inhibit or silence THBS4 gene expression, and a pharmaceutically acceptable carrier.
10. The pharmaceutical composition according to claim 9, characterized in that, The substance that can inhibit or silence THBS4 gene expression is a recombinant adeno-associated virus carrying shRNA targeting the THBS4 gene, and the serotype of the recombinant adeno-associated virus is AAV9.