Cas12c9-based fusion proteins and their applications in adenine base editing
By constructing a fusion protein containing the R-loop binding domain RHBD1, the adenine base editing efficiency of the CRISPR/Cas12C9 system was improved, solving the problem of low editing efficiency of the CRISPR/Cas12C9 system in adenine-rich regions, and realizing efficient gene editing in crops such as rice.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2026-06-08
- Publication Date
- 2026-07-03
Smart Images

Figure SMS_1
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to Cas12C9-based fusion proteins and their application in adenine base editing. Background Technology
[0002] Single nucleotide polymorphisms (SNPs) are a common type of genetic mutation during crop domestication and genetic improvement. In agricultural organisms, SNPs are ubiquitous across different varieties and populations, and many important agronomic traits are determined by SNPs generated through natural variation or physicochemical mutagenesis. However, natural and physicochemical mutagenesis are random and cannot generate SNPs in specific genomic regions.
[0003] Base editing systems, comprised of base-modifying enzymes and the CRISPR / Cas system, are modern genetic engineering technologies that enable targeted mutations of specific nucleotides without creating DNA double-strand breaks. This is a highly efficient and precise artificial SNP generation technology. Its main principle is that target bases are modified under the guidance of gRNA (guide RNA), and the modified bases gradually achieve the desired base replacement after DNA replication and repair. Since its development, base editing technology has been successfully applied to various crops due to its high efficiency and the fact that it does not require donor DNA. It has not only been successfully used for functional correction of genes controlling key agronomic traits in crops, but also for generating a large number of SNPs in the directed evolution of endogenous genes in crops. This provides a large genetic variation basis for the artificial creation of new germplasm, greatly accelerating precise crop improvement and germplasm innovation.
[0004] When selecting target sites for plant base editing, it is necessary to consider the recognition PAM (Protospacer Adjacent Motifs) of the Cas protein and the range of its base editing activity window. Currently, plant base editing technology based on the CRISPR / SpCas9 system has been well-developed, offering high base editing efficiency and a wide variety of base editing types, thus making it widely used in practical applications. However, because the CRISPR / SpCas9 system primarily recognizes NGG PAM motifs, its base editing in thymine (T) and adenine (A)-rich genomic regions is limited. The CRIPSR / Cas12 system, which recognizes thymine-rich PAM motifs, can effectively compensate for the shortcomings of the CRISPR / SpCas9 system. However, due to differences in structure and mechanism of action between the two types of Cas proteins—for example, Cas9 has two independent endonuclease domains (HNH cleaves the target strand, RuvC cleaves the non-target strand), while Cas12a mainly relies on a single RuvC domain to cleave both DNA strands. In plant base editing, the nicking enzyme Cas9 (D10A) is more efficient than the fully inactivated nuclease dCas9, as the residual nuclease activity facilitates the replacement of modified bases with other bases. However, for Cas12, only the nuclease-inactivated dCas12 can be used for plant base editing. Therefore, current plant base editing technology based on the CRIPSR / Cas12 system is very slow and inefficient. The CRIPSR / Cas12C9 system (also known as the CRIPSR / Cas12i3 system) is a novel Cas12 system independently developed in my country. It recognizes the TTN PAM motif, but the development of base editing technology based on this system is even more lagging, resulting in low efficiency and an urgent need for optimization to improve editing efficiency. Therefore, improving and optimizing the CRIPSR / Cas12C9 system-mediated base editing technology will help build a complete plant base editing technology system, expand the editing target range, accelerate the correction of crop gene function research, and promote the directed evolution and germplasm innovation of endogenous genes.
[0005] The editing performance of base editing systems is influenced by a combination of factors, including substrate accessibility, the inherent properties of the base-modifying enzyme, and the intracellular environment. Substrate accessibility is closely related to the ability of the Cas protein to open double-stranded DNA and form a gRNA-DNA R-loop. After the R-loop structure is formed, the modifying enzyme can bind to the single-stranded DNA substrate; therefore, the editing performance mainly depends on the interaction between the substrate nucleotides within the R-loop and the modifying enzyme. Introducing relevant tool proteins or polypeptide domains to increase the binding ability of the modifying enzyme and target DNA may improve the editing efficiency of CRIPSR / Cas12C9 system-mediated base editing technology. Summary of the Invention
[0006] The technical problem to be solved by this invention is to improve the efficiency of CRISPR / Cas12C9 system-mediated adenine base editing.
[0007] To solve the above technical problems, the present invention provides the following technical solution:
[0008] The first aspect of the present invention provides a fusion protein, which is composed of a nuclear localization signal NLS1, an adenine deaminase TadA8e, a flexible linker peptide Linker1, an R-loop binding domain RHBD1, a flexible linker peptide Linker2, a nuclease-inactivated Cas12C9 protein, and a nuclear localization signal NLS2 connected sequentially from the N-terminus to the C-terminus.
[0009] The amino acid sequence of the nuclear localization signal NLS1 is shown in SEQ ID NO. 1, the amino acid sequence of the adenine deaminase TadA8e is shown in SEQ ID NO. 2, the amino acid sequence of the flexible linker peptide Linker1 is shown in SEQ ID NO. 3, the amino acid sequence of the R-ring binding domain RHBD1 is shown in SEQ ID NO. 4, the amino acid sequence of the flexible linker peptide Linker2 is shown in SEQ ID NO. 5, the amino acid sequence of the nuclease-inactivated Cas12C9 protein is shown in SEQ ID NO. 6, and the amino acid sequence of the nuclear localization signal NLS2 is shown in SEQ ID NO. 7.
[0010] Further, the nucleic acid sequence encoding the nuclear localization signal NLS1 is shown in SEQ ID NO. 8, the nucleic acid sequence encoding the adenine deaminase TadA8e is shown in SEQ ID NO. 9, the nucleic acid sequence encoding the flexible linker peptide Linker1 is shown in SEQ ID NO. 10, the nucleic acid sequence encoding the R-loop binding domain RHBD1 is shown in SEQ ID NO. 11, the nucleic acid sequence encoding the flexible linker peptide Linker2 is shown in SEQ ID NO. 12, the nucleic acid sequence encoding the nuclease-inactivated Cas12C9 protein is shown in SEQ ID NO. 13, and the nucleic acid sequence encoding the nuclear localization signal NLS2 is shown in SEQ ID NO. 14.
[0011] A second aspect of the present invention provides a gene that encodes the fusion protein.
[0012] A third aspect of the present invention provides a recombinant plasmid containing the said gene.
[0013] A fourth aspect of the present invention provides a recombinant cell containing the fusion protein or the gene described above.
[0014] The fifth aspect of the present invention provides a recombinant bacterium containing the fusion protein or the gene described above.
[0015] A sixth aspect of the present invention provides an adenine base editing system comprising the fusion protein, the gene, the recombinant plasmid, the recombinant cell or the recombinant bacteria, and sgRNA; wherein the sgRNA is used to guide the fusion protein to edit the adenine gene of a target sequence in the target cell.
[0016] The seventh aspect of the present invention provides the application of the fusion protein, the gene, the recombinant plasmid, the recombinant cell, the recombinant bacteria, or the adenine base editing system in rice genome editing, wherein the application is to perform site-directed mutation of adenine to guanine in the rice genome.
[0017] The eighth aspect of the present invention provides the use of the fusion protein, the gene, the recombinant plasmid, the recombinant cell, the recombinant bacteria, or the adenine base editing system in the preparation of gene editing products.
[0018] Compared with the prior art, the present invention has the following beneficial effects:
[0019] (1) This invention provides a novel R-loop binding domain RHBD1, which is fused with adenine deaminase TadA8e and nuclease-inactivated Cas12C9 protein (dCas12C9) to construct an adenine base editor. This editor can effectively achieve A to G base substitution at the target sites of OsACC and OsARF4 in rice endogenous target genes. The editing efficiency is significantly better than the control editor containing RHBD7 or OsRHBD, with the highest editing efficiency of 33.33% at the OsARF4 target site.
[0020] (2) This invention is the first to apply the R-loop binding domain to the CRISPR / dCas12C9 adenine base editing system. By stabilizing or promoting the formation of the R-loop structure, it improves the accessibility of base-modifying enzymes to single-stranded DNA substrates, thereby significantly improving the editing efficiency and providing a new optimization strategy for base editing technology based on Cas12 family proteins.
[0021] (3) The dCas12C9 used in this invention recognizes the TTN PAM sequence, which complements the commonly used SpCas9 (recognizes NGG PAM), expanding the application range of base editing technology in thymine (T) and adenine (A) genomic regions, and is especially suitable for the precise improvement of crops such as rice.
[0022] (4) The base editing system constructed in this invention is easy to operate and has high editing efficiency. It can provide an efficient technical tool for the directed evolution, functional correction and new germplasm creation of crop endogenous genes, and has important agricultural application value and broad industrialization prospects. Detailed Implementation
[0023] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.
[0024] Example 1: Construction of a rice CRIPSR / Cas12C9 adenine base editing tool vector based on the R-loop binding domain
[0025] (1) Construction of plasmid pUbi:rBE134e1
[0026] The nuclear localization signal NLS1 (SEQ ID NO. 8), adenine deaminase TadA8e (SEQ ID NO. 9), flexible linker peptide Linker1 (SEQ ID NO. 10), R-ring binding domain RHBD1 (SEQ ID NO. 11), flexible linker peptide Linker2 (SEQ ID NO. 12), dCas12C9 (SEQ ID NO. 13), and nuclear localization signal NLS2 (SEQ ID NO. 14) were sequentially spliced in order from 5' to 3' to form the rice adenine base editor rBE134e1. rBE134e1 was artificially synthesized by Qingke Biotechnology Co., Ltd. (Beijing) and ligated into the pUC57 plasmid vector to obtain the positive plasmid pUC57-rBE134e1. The 5.2 kb rBE134e1 gene fragment was recovered after double digestion with SpeI / Acc65I, and the 12 kb backbone fragment was recovered after double digestion with SpeI / Acc65I. The recovered 5.2 kb rBE134e1 gene fragment was ligated to the recovered 12 kb backbone fragment to obtain the plasmid pUbi:rBE134e1.
[0027] (2) Construction of plasmid pUbi:rBE134e2
[0028] The nuclear localization signal NLS1 (SEQ ID NO. 8), adenine deaminase TadA8e (SEQ ID NO. 9), flexible linker peptide Linker1 (SEQ ID NO. 10), R-ring binding domain RHBD7 (SEQ ID NO. 15), flexible linker peptide Linker2 (SEQ ID NO. 12), dCas12C9 (SEQ ID NO. 13), and nuclear localization signal NLS2 (SEQ ID NO. 14) were sequentially spliced in order from 5' to 3' to form the rice adenine base editor rBE134e2. rBE134e2 was artificially synthesized by Qingke Biotechnology Co., Ltd. (Beijing) and ligated into the pUC57 plasmid vector to obtain the positive plasmid pUC57-rBE134e2. The 5.2 kb rBE134e2 gene fragment was recovered after double digestion with SpeI / Acc65I, and the 12 kb backbone fragment was recovered after double digestion with SpeI / Acc65I. The recovered 5.2 kb rBE134e2 gene fragment was ligated to the recovered 12 kb backbone fragment to obtain the plasmid pUbi:rBE134e2.
[0029] (3) Construction of plasmid pUbi:rBE134e3
[0030] The nuclear localization signal NLS1 (SEQ ID NO. 8), adenine deaminase TadA8e (SEQ ID NO. 9), flexible linker peptide Linker1 (SEQ ID NO. 10), R-ring binding domain OsRHBD (SEQ ID NO. 16), flexible linker peptide Linker2 (SEQ ID NO. 12), dCas12C9 (SEQ ID NO. 13), and nuclear localization signal NLS2 (SEQ ID NO. 14) were sequentially spliced in order from 5' to 3' to form the rice adenine base editor rBE134e3. rBE134e3 was artificially synthesized by Qingke Biotechnology Co., Ltd. (Beijing) and ligated into the pUC57 plasmid vector to obtain the positive plasmid pUC57-rBE134e3. The 5.2 kb rBE134e3 gene fragment was recovered after double digestion of pUC57:rBE134e2 with SpeI / Acc65I, and the 12 kb backbone fragment was recovered after double digestion of pUbi:Cas9-NG with SpeI / Acc65I. The recovered 5.2 kb rBE134e3 gene fragment was ligated to the recovered 12 kb backbone fragment to obtain the plasmid pUbi:rBE134e3.
[0031] Example 2: Adenine base editing of rice endogenous target genes OsACC and OsARF4
[0032] Genomic DNA sequences of the genes OsACC (Genome Accession Number LOC_Os05g22940) and OsARF4 (Genome Accession Number LOC_Os01g70270) were obtained from the MSU / TIGR Rice Genome Database (http: / / rice.plantbiology.msu.edu / ). Two target sites, OsACC-T1 and OsACC-T2, were designed for the OsACC gene: For OsACC-T1, a spacer sequence T1 (SEQ ID NO. 17) was designed containing a target spacer that matches the end of the BsaI restriction site. TTG The primers for GTGTGGAGAATATACATGGAAGT (underlined part is TTN PAM) are fOsACC-F1 (SEQ ID NO.18) (acacGTGTGGAGAATATACATGGAAGT, with a BsaI-cleaved sticky end acac at the 5' end) and fOsACC-R1 (SEQ ID NO.19) (ctctACTTCCATGTATATTCTCCACAC, with a BsaI-cleaved sticky end ctct at the 5' end); for OsACC-T2, a spacer sequence T2 (SEQ ID NO.20) containing a target matching BsaI cleavage site was designed. TTA The primers for CCTCTGTATGATCTCCTCCGGTC (underlined part is TTN PAM) are fOsACC-F2 (SEQ ID NO. 21) (acacCCTCTGTATGATCTCCTCCGGTC, with a BsaI-cleaved sticky terminator aacac at the 5' end) and fOsACC-R2 (SEQ ID NO. 22) (ctctGACCGGAGGAGATCATACAGAGG, with a BsaI-cleaved sticky terminator ctct at the 5' end). For the OsARF4 gene, a spacer sequence containing a target matching the BsaI cleavage site was designed (SEQ ID NO. 23). TTG The primers for GAACTGACAAACACACTCCAACC (underlined part is TTN PAM) are fOsARF4-F1 (SEQ ID NO. 24) (acacGAACTGACAAACACACTCCAACC, with a BsaI-cleaved sticky end aacac at the 5' end) and fOsARF4-R1 (SEQ ID NO. 25) (ctctGGTTGGAGTGTGTTTGTCAGTTC, with a BsaI-cleaved sticky end ctct at the 5' end).
[0033] After synthesizing the primers, fOsACC-F1 / fOsACC-R1, fOsACC-F2 / fOsACC-R2, and fOsARF4-F1 / fOsARF4-R1 were phosphorylated using T4 polynucleotide kinase, annealed to form double strands, and then the dimers of fOsACC-F1 / fOsACC-R1, fOsACC-F2 / fOsACC-R2, and fOsARF4-F1 / fOsARF4-R1 were cloned into the BsaI restriction site of the pHZ33 vector (CN202411772220.6), respectively. Sequencing results showed that the results were correct, and pHZ33:fOsACC-1, pHZ33:fOsACC-2, and pHZ33:fOsARF4-1 were obtained sequentially. pHZ33:fOsACC-1, pHZ33:fOsACC-2, and pHZ33:fOsARF4-1 were linearized by ApaI digestion. pUbi:rBE134e1 was then fused with pHZ33:fOsACC-1, pHZ33:fOsACC-2, and pHZ33:fOsARF4-1 using the Gateway™ LR Clonase™ II Enzyme mix (Cat. No. 11791-100, Invitrogen, USA) to obtain pUbi:rBE134e1-fOsACC-1, pUbi:rBE134e1-fOsACC-2, and pUbi:rBE134e1-fOsARF4-1, respectively.
[0034] Similarly, pUbi:rBE134e2 was fused with pHZ33:fOsACC-1, pHZ33:fOsACC-2, and pHZ33:fOsARF4-1, respectively, to obtain pUbi:rBE134e2-fOsACC-1, pUbi:rBE134e2-fOsACC-2, and pUbi:rBE134e2-fOsARF4-1, respectively. pUbi:rBE134e3 was fused with pHZ33:fOsACC-1, pHZ33:fOsACC-2, and pHZ33:fOsARF4-1, respectively, to obtain pUbi:rBE134e3-fOsACC-1, pUbi:rBE134e3-fOsACC-2, and pUbi:rBE134e3-fOsARF4-1, respectively.
[0035] Nine targeting vectors, including pUbi:rBE134e1-fOsACC-1, pUbi:rBE134e1-fOsACC-2, and pUbi:rBE134e1-fOsARF4-1, were transformed into the japonica rice variety Kitaake using Agrobacterium-mediated transformation. DNA was then extracted from the T0 generation of regenerated rice plants using the CTAB method.
[0036] For pUbi:rBE134e1-fOsACC-1, pUbi:rBE134e2-fOsACC-1, and pUbi:rBE134e3-fOsACC-1, specific PCR primers for identification were designed based on the T1 DNA sequence of the OsACC gene target site: OsACC-T1-F1 (SEQ ID NO. 26) (ggagtgagtacggtgtgcAGATGCAGCTAGACAGTGGTG) and OsACC-T1-R1 (SEQ ID NO. 27) (gagttggatgctggatggGCCAAGTCGAGCAAGATAAGC). Using the genomic DNA of the corresponding T0 generation regenerated rice plants as templates, PCR amplification was performed, and the PCR products were sequenced to detect and analyze the events and efficiency of gene editing at the target site.
[0037] For pUbi:rBE134e1-fOsACC-2, pUbi:rBE134e2-fOsACC-2, and pUbi:rBE134e3-fOsACC-2, specific PCR primers for identification were designed based on the T2 DNA sequence of the OsACC gene target site: OsACC-T2-F1 (SEQ ID NO. 28) (ggagtgagtacggtgtgcAAACAGAACGGGCTTGAGAGTT) and OsACC-T2-R1 (SEQ ID NO. 29) (gagttggatgctggatggGTTCGGGTGAGGTTCGGTGA). Using the genomic DNA of the corresponding T0 generation regenerated rice plants as templates, PCR amplification was performed, and the PCR products were sequenced to detect and analyze the events and efficiency of gene editing at the target site.
[0038] For pUbi:rBE134e1-fOsARF4-1, pUbi:rBE134e2-fOsARF4-1, and pUbi:rBE134e3-fOsARF4-1, specific PCR primers for identification were designed based on the target site DNA sequence of the OsARF4 gene: OsARF4-F1 (SEQ ID NO. 30) (ggagtgagtacggtgtgcTTGCTGTTGAATATCATCAGGGC) and OsARF4-R1 (SEQ ID NO. 31) (gagttggatgctggatggTCTGCGTAGAGCACAGCAAA). Using the genomic DNA of the corresponding T0 generation regenerated rice plants as templates, PCR amplification was performed, and the PCR products were sequenced to detect and analyze the events and efficiency of target site gene editing.
[0039] The bases are edited as follows (Table 1):
[0040] Table 1. Comparison of A to G editing efficiency of the adenine base editing tool rBE134e1~3
[0041]
[0042] (1) The rice adenine base editor rBE134e1 achieved an A-to-G substitution efficiency of 22.22% for the target bases of OsACC-T1, and 6 out of 27 independent transgenic rice lines were found to contain the expected A-to-G substitution; the rice adenine base editor rBE134e2 achieved an A-to-G substitution efficiency of 12.50% for the target bases of OsACC-T1, and 6 out of 48 independent transgenic rice lines were found to contain the expected A-to-G substitution; the rice adenine base editor rBE134e3 achieved an A-to-G substitution efficiency of 5.66% for the target bases of OsACC-T1, and 1 out of 18 independent transgenic rice lines was found to contain the expected A-to-G substitution.
[0043] (2) The efficiency of rice adenine base editor rBE134e1 in replacing the target base A to G of OsACC-T2 was 0.00%, and no expected A to G replacement was detected in 27 independent transgenic rice lines; the efficiency of rice adenine base editor rBE134e2 in replacing the target base A to G of OsACC-T2 was 4.17%, and 2 out of 48 independent transgenic rice lines were found to contain the expected A to G replacement; the efficiency of rice adenine base editor rBE134e3 in replacing the target base A to G of OsACC-T2 was 0.00%, and no expected A to G replacement was detected in 48 independent transgenic rice lines.
[0044] (3) The rice adenine base editor rBE134e1 achieved an efficiency of 33.33% in replacing the target base A to G of OsARF4, and 9 out of 27 independent transgenic rice lines were found to contain the expected A to G replacement; the rice adenine base editor rBE134e2 achieved an efficiency of 8.33% in replacing the target base A to G of OsARF4, and 4 out of 48 independent transgenic rice lines were found to contain the expected A to G replacement; the rice adenine base editor rBE134e3 achieved an efficiency of 0.00% in replacing the target base A to G of OsARF4, and 0 out of 48 independent transgenic rice lines were found to contain the expected A to G replacement.
[0045] In summary, the rice adenine base editor rBE134e1 provided by this invention can efficiently achieve A to G substitution.
Claims
1. A fusion protein, characterized in that, The fusion protein is composed of nuclear localization signal NLS1, adenine deaminase TadA8e, flexible linker peptide Linker1, R-loop binding domain RHBD1, flexible linker peptide Linker2, nuclease-inactivated Cas12C9 protein, and nuclear localization signal NLS2 connected sequentially from the N-terminus to the C-terminus. The amino acid sequence of the nuclear localization signal NLS1 is shown in SEQ ID NO. 1, the amino acid sequence of the adenine deaminase TadA8e is shown in SEQ ID NO. 2, the amino acid sequence of the flexible linker peptide Linker1 is shown in SEQ ID NO. 3, the amino acid sequence of the R-ring binding domain RHBD1 is shown in SEQ ID NO. 4, the amino acid sequence of the flexible linker peptide Linker2 is shown in SEQ ID NO. 5, the amino acid sequence of the nuclease-inactivated Cas12C9 protein is shown in SEQ ID NO. 6, and the amino acid sequence of the nuclear localization signal NLS2 is shown in SEQ ID NO.
7.
2. The fusion protein according to claim 1, characterized in that, The nucleic acid sequence encoding the nuclear localization signal NLS1 is shown in SEQ ID NO. 8; the nucleic acid sequence encoding the adenine deaminase TadA8e is shown in SEQ ID NO. 9; the nucleic acid sequence encoding the flexible linker peptide Linker1 is shown in SEQ ID NO. 10; the nucleic acid sequence encoding the R-loop binding domain RHBD1 is shown in SEQ ID NO. 11; the nucleic acid sequence encoding the flexible linker peptide Linker2 is shown in SEQ ID NO. 12; the nucleic acid sequence encoding the nuclease-inactivated Cas12C9 protein is shown in SEQ ID NO. 13; and the nucleic acid sequence encoding the nuclear localization signal NLS2 is shown in SEQ ID NO.
14.
3. A gene characterized by, The gene encodes the fusion protein of claim 1.
4. A recombinant plasmid, characterized in that, It contains the gene described in claim 3.
5. A recombinant cell, characterized in that, It contains the fusion protein of claim 1 or the gene of claim 3.
6. A recombinant bacterium, characterized in that, It contains the fusion protein of claim 1 or the gene of claim 3.
7. An adenine base editing system, characterized in that, The fusion protein of claim 1, the gene of claim 3, the recombinant plasmid of claim 4, the recombinant cell of claim 5 or the recombinant bacterium of claim 6, and sgRNA; wherein the sgRNA is used to guide the fusion protein to edit the adenine gene of the target sequence in the target cell.
8. The application of the fusion protein of claim 1, the gene of claim 3, the recombinant plasmid of claim 4, the recombinant cell of claim 5, the recombinant bacteria of claim 6, or the adenine base editing system of claim 7 in rice genome editing, characterized in that, The application involves site-directed mutation of adenine to guanine in the rice genome.
9. The use of the fusion protein of claim 1, the gene of claim 3, the recombinant plasmid of claim 4, the recombinant cell of claim 5, the recombinant bacteria of claim 6, or the adenine base editing system of claim 7 in the preparation of gene editing products.
Citation Information
Patent Citations
Cas12i3-based fusion protein and application thereof in mediating gene editing
CN119684470A