A liver cell model with silenced or overexpressed lcmt1 and a construction method thereof

Abstract

This invention discloses a hepatocyte model with silencing or overexpression of LCMT1 and its construction method, comprising: passage and seeding cells in logarithmic growth phase into well plates; diluting plasmid siRNA1 or siRNA2 or an overexpression plasmid to an appropriate concentration, and then mixing it with transfection reagent dilution to obtain a transfection mixture; washing the cells in each well of the plate and adding another culture medium, then gently dripping the transfection mixture into the well plate, shaking well, and culturing in a cell culture incubator for a period of time; replacing the culture medium with complete culture medium without antibiotics to obtain the constructed hepatocyte model with silencing or overexpression of LCMT1. This invention, by constructing a hepatocyte model with silencing or overexpression of LCMT1 in the liver, allows for validation experiments to be conducted to study the development mechanism of liver fibrosis. It is suitable for widespread application in various laboratories and provides an experimental model basis for research on liver fibrosis and drug trials.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a hepatocyte model with LCMT1 silencing or high expression and a method for constructing the same. Background Technology

[0002] Hepatic fibrosis (HF) is a key pathological stage in the progression of chronic liver disease caused by various factors. It is characterized by excessive deposition of extracellular matrix in the liver, hepatocellular damage, and changes in vascular structure, ultimately affecting liver function. It is caused by a variety of chronic liver diseases, including genetically related disorders, alcoholic hepatitis, chronic viral hepatitis, drug-induced liver injury, and cholestasis. The mechanisms of HF development are related to hepatic stellate cells (HSCs), hepatic macrophages, endoplasmic reticulum stress (ERs), and autophagy. HF is a dynamic process that, without intervention, can progress to cirrhosis and even hepatocellular carcinoma.

[0003] Hepatic stellate cell activation is an essential molecular event in liver fibrosis. Leucine carboxyl methyltransferase 1 (LCMT1) is a 38 × 10⁻⁶ enzyme. 3 LCMT1, a protein containing 334 amino acids with a highly conserved sequence, is widely found in animals, plants, and yeast. It is an important methyltransferase in mammals and is abundant in hepatocytes. Hepatic stellate cells (HSCs) play a crucial role in the development and progression of liver fibrosis; persistent activation of HSCs leads to further progression of liver fibrosis. Therefore, understanding the mechanisms leading to the development of liver fibrosis, reversing its occurrence, and achieving remission are of great significance. Summary of the Invention

[0004] The purpose of this invention is to provide a hepatocyte model with LCMT1 silencing or high expression and a method for constructing the same, so as to solve the technical problems mentioned in the background art.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: A method for constructing a hepatocyte model with LCMT1 silencing or high expression, the method comprising the following steps: (1) Passage cells in the logarithmic growth phase into well plates; (2) Dilute plasmid siRNA1 or siRNA2 or high expression plasmid to an appropriate concentration to obtain siRNA1 dilution, siRNA2 dilution or high expression plasmid dilution; (3) Dilute the liposome transfection reagent in the culture medium to obtain a diluted transfection reagent solution; (4) Mix the transfection reagent dilution with siRNA1 dilution, siRNA2 dilution, or high expression plasmid dilution thoroughly and let stand at room temperature to obtain the transfection mixture; (5) Wash the cells in each well of the plate to remove residual culture medium, add another culture medium, then gently drop the transfection mixture into the well plate, shake well, and incubate in a cell culture incubator for a period of time. (6) Replace the culture medium in the cultured plate with a complete culture medium without antibiotics to obtain a well constructed hepatocyte model with silencing or high expression of LCMT1.

[0006] Preferably, in step (1), the cells used are MIHA cells or Hep3B cell lines. MIHA cells are used to silence LCMT1 with siRNA1 or siRNA2 to obtain a hepatocyte model with LCMT1 silencing; Hep3B cells are used to overexpress LCMT1 to obtain a hepatocyte model with LCMT1 high expression.

[0007] Preferably, the primer sequences of siRNA1 are shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the primer sequences of siRNA2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0008] Preferably, the high expression plasmid is constructed by amplifying cDNA using primers SEQ ID NO: 5 and SEQ ID NO: 6, purifying it, and then using pEGFP-N1 plasmid as a template for enzyme digestion and religation.

[0009] Preferably, in step (2), siRNA1 or siRNA2 is completely dissolved to 20 pmol / mL; the high expression plasmid is diluted to 5 μg / μL.

[0010] Preferably, in step (3), the liposome transfection reagent is diluted with 7.5 μL Lipofectamine 3000 added to 125 μL Opti-MEM culture medium.

[0011] Preferably, in step (2), 7.5 μL of siRNA1 or siRNA2 at a concentration of 20 pmol / mL is added to 125 μL of Opti-MEM culture medium for dilution; or 7.5 μL of high expression plasmid at a concentration of 5 μg / μL and 10 μL of P3000 are added to 125 μL of Opti-MEM culture medium for dilution.

[0012] Preferably, in step (4), the mixture is left to stand at room temperature for 15 minutes.

[0013] Preferably, in step (5), the culture medium is 1250 μL of Opti-MEM medium, and then 250 μL of transfection mixture is gently dropped into the well plate, gently shaken, and placed in a cell culture incubator for 6 h.

[0014] This invention also provides a hepatocyte model with LCMT1 silencing or high expression, which is constructed by the above-described construction method.

[0015] This invention, through in vivo and in vitro experiments, clarifies that hepatic LCMT1 is a therapeutic target for liver fibrosis. It also demonstrates a mechanism by which LCMT1 in hepatocytes regulates CYP2E1 expression to reduce oxidative stress and inhibit hepatic stellate cell activation.

[0016] The advantages of this invention compared to the prior art are as follows: This invention constructs a model of LCMT1 silencing and overexpression in the liver. Validation experiments using this model can be conducted to study the mechanism of liver fibrosis development. It is suitable for widespread application in various laboratories and provides an experimental model basis for liver fibrosis research and drug trials. Co-culturing this model with activated hepatic stellate cells showed that downregulating LCMT1 in hepatocytes can inhibit hepatic stellate cell activation, suggesting that it can inhibit liver fibrosis associated with hepatic stellate cell activation.

[0017] This invention activates hepatic stellate cells with TGFβ, then co-cultures hepatocytes with silenced or overexpressing LCMT1 with activated hepatic stellate cells, and detects indicators of hepatic stellate cell activation (Col1a1, α-SMA). The results showed that when hepatocytes with silenced LCMT1 were co-cultured with activated hepatic stellate cells, the expression of Col1a1 and α-SMA decreased; conversely, when hepatocytes with overexpressing LCMT1 were co-cultured with activated hepatic stellate cells, the expression of Col1a1 and α-SMA increased. Attached Figure Description

[0018] Figure 1 The study investigated the effect of silencing LCMT1 on CYP2E1 expression in MIHA cells (n=3 per group). (A) RT-qPCR was used to detect the effect of silencing LCMT1 on CYP2E1 gene expression in MIHA cells; (B) Western blotting was used to detect the effect of silencing LCMT1 on CYP2E1 protein expression in MIHA cells; and (C) semi-quantitative analysis of LCMT1 and CYP2E1 protein expression levels was performed.

[0019] Figure 2 The effects of silencing LCMT1 on oxidative stress levels in MIHA cells (n=3 per group) were investigated, including (A) the effect of silencing LCMT1 on SOD activity in MIHA cells; and (B) the effect of silencing LCMT1 on MDA levels in MIHA cells.

[0020] Figure 3 The study investigated the effect of high LCMT1 expression on CYP2E1 expression levels in Hep3B cells (n=3 per group). (A) RT-qPCR was used to detect the effect of high LCMT1 expression on CYP2E1 gene expression in Hep3B cells; (B) Western blotting was used to detect the effect of high LCMT1 expression on CYP2E1 protein expression in Hep3B cells; and (C) semi-quantitative analysis of protein expression levels was performed.

[0021] Figure 4 The effects of high LCMT1 expression on oxidative stress levels in Hep3B cells (n=3 per group) were investigated, including (A) the effect of high LCMT1 expression on SOD activity in Hep3B cells; and (B) the effect of high LCMT1 expression on MDA levels in Hep3B cells.

[0022] Figure 5 This involves using quantitative real-time PCR to detect the expression level of α-SMA mRNA, a molecule associated with liver fibrosis.

[0023] Figure 6 The liver LCMT1-specific knockout improves the increase in serum ALT and AST levels caused by CCl4 treatment; (A) serum ALT level; (B) serum AST level. Figure 7 Liver fibrosis staining in wild-type mice and liver LCMT1-specific knockout mice treated with CCl4; (A) Sirius Red staining (×200, 50 μm); (B) Masson staining (×200, 50 μm); (C) Semi-quantitative comparison of liver fibrosis staining.

[0024] Figure 8 The increased expression levels of hepatic α-SMA, Col1a1, and TGF-β1 mRNA were caused by specific knockout of LCMT1 in the liver, which inhibited CCl4. RT-qPCR was used to detect (A) α-SMA; (B) Col1a1; (C) TGF-β1.

[0025] Figure 9The effects of co-culturing LCMT1-silenced MIHA cells with activated LX-2 cells on the expression levels of liver fibrosis markers α-SMA and Col1a1 in activated LX-2 cells were investigated (n=3 per group). (A) RT-qPCR was used to detect the effect of co-culturing LCMT1 siRNA-silenced MIHA cells with activated LX-2 cells on the expression of α-SMA and Col1a1 genes in activated LX-2 cells. (B) Western blotting was used to detect the effect of co-culturing LCMT1 siRNA-silenced MIHA cells with activated LX-2 cells on the expression of α-SMA and Col1a1 proteins in activated LX-2 cells. (C) Semi-quantitative analysis of α-SMA and Col1a1 protein expression levels was performed.

[0026] Figure 10 The study investigated the effects of co-culturing Hep3B cells with high LCMT1 expression and activated LX-2 cells on the expression levels of liver fibrosis markers in activated LX-2 cells (n=3 per group); (A) RT-qPCR detection of the effects of co-culturing Hep3B cells with high LCMT1 expression and activated LX-2 cells on the expression of α-SMA and Col1a1 genes in activated LX-2 cells; (B) Western blotting detection of the effects of co-culturing Hep3B cells with high LCMT1 expression and activated LX-2 cells on the expression of α-SMA and Col1a1 proteins in activated LX-2 cells; and (C) Semi-quantitative analysis of α-SMA and Col1a1 protein expression levels. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings and preferred embodiments. However, it should be noted that many details listed in the specification are merely to provide the reader with a thorough understanding of one or more aspects of the present invention, and these aspects of the invention can be implemented even without these specific details.

[0028] A method for constructing a hepatocyte model with LCMT1 silencing or high expression, the method comprising the following steps: (1) Passage the logarithmic growth phase cells into 6-well plates; (2) Dilute siRNA1 or siRNA2 or the overexpression plasmid to a suitable concentration using ddH2O; (3) Dilute Lipofectamine 3000 in Opti-MEM culture medium to obtain Lipofectamine 3000 diluted solution. (4) Add siRNA1 or siRNA2 to Opti-MEM culture medium to dilute and obtain siRNA1 dilution or siRNA2 dilution; The high expression plasmid and P3000 were added to Opti-MEM culture medium and diluted to obtain the high expression plasmid dilution solution.

[0029] (5) Mix the Lipofectamine 3000 dilution with the high expression plasmid dilution, siRNA1 dilution, or siRNA2 dilution thoroughly and let stand at room temperature to obtain the transfection mixture; (6) Wash the cells in the 6-well plate twice with PBS solution to remove residual complete culture medium, then add Opti-MEM culture medium, then gently drop the transfection mixture into the well plate, gently shake it, and incubate it in a cell culture incubator for a period of time. (7) Replace the Opti-MEM medium with DMEM complete medium without antibiotics to obtain the constructed LCMT1 siRNA1 and LCMT1 siRNA2 cell silent hepatocyte models.

[0030] In one embodiment, in step (1), the cells used are MIHA cells or Hep3B cell lines. MIHA cells are used to silence LCMT1 with siRNA1 or siRNA2 to obtain a hepatocyte model with LCMT1 silence; Hep3B cells are used to overexpress LCMT1 to obtain a hepatocyte model with high LCMT1 expression.

[0031] In one embodiment, the primer sequences of siRNA1 are shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the primer sequences of siRNA2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0032] In one embodiment, the high expression plasmid is constructed by amplifying cDNA using primers SEQ ID NO: 5 and SEQ ID NO: 6, purifying it, and then using pEGFP-N1 plasmid as a template for enzyme digestion and religation.

[0033] In one embodiment, in step (2), siRNA1 or siRNA2 is completely dissolved to 20 pmol / mL; the high expression plasmid is diluted to 5 μg / μl.

[0034] In one embodiment, in step (3), 7.5 μL of Lipofectamine 3000 is added to 125 μL of Opti-MEM culture medium for dilution.

[0035] In one embodiment, in step (4), 7.5 μL of siRNA1 or siRNA2 at a concentration of 20 pmol / mL is added to 125 μL of Opti-MEM culture medium for dilution; or 7.5 μL of high expression plasmid at a concentration of 5 μg / μL and 10 μL of LP3000 are added to 125 μL of Opti-MEM culture medium for dilution.

[0036] In one embodiment, in step (5), the room temperature is left to stand for 15 minutes.

[0037] In one embodiment, in step (6), 1250 μL of Opti-MEM medium is added, and then 250 μL of transfection mixture is gently dropped into the well plate and gently shaken. The plate is then placed in a cell culture incubator and cultured for 6 hours.

[0038] In one embodiment, the method for constructing a hepatocyte model with high LCMT1 expression involves amplifying HL60 cell mRNA using SEQ ID NO: 5 and SEQ ID NO: 6 to obtain full-length cDNA, purifying it, relinking it to the pEGFP-N1 plasmid using enzyme digestion, and then transfecting the LCMT1 high expression plasmid into the Hep3B cell line.

[0039] Example 1 siRNA was transfected into MIHA cells using liposomes. The transfection method was as follows: (1) Cells in the logarithmic growth phase were passaged and seeded into 6-well plates (3*10 cells per well). 5(1) Seed the cells at the specified cell density); (2) Dissolve siRNA1 or siRNA2 completely in ddH2O to a concentration of 20 pmol / mL according to the reagent instructions; (3) Prepare the transfection system mixture (1 well); add 7.5 μL of Lipofectamine 3000 to 125 μL of Opti-MEM culture medium to dilute and obtain Lipofectamine 30000 solution; add 7.5 μL of siRNA1 or siRNA2 at a concentration of 20 pmol / mL to 125 μL of Opti-MEM culture medium to dilute and obtain siRNA1 or siRNA2 solution; mix the above Lipofectamine 3000 solution with the siRNA1 solution or siRNA2 solution, mix gently and thoroughly, and let stand at room temperature for 15 min; (4) Wash each well of cells twice with PBS solution during the waiting time to remove residual complete culture medium, and then add 1250 μL of Opti-MEM. The culture medium was prepared, and then 250 μL of the transfection complex was gently dropped into the well plate and gently shaken. The plate was placed in a cell culture incubator. After 6 hours, the Opti-MEM medium was replaced with DMEM complete medium without antibiotics to construct MIHA cell silent hepatocyte models of LCMT1 siRNAI and MIHA cells of LCMT1 siRNA2.

[0040] In the above experiment, two siRNA sequences were used to construct LCMT1 silenced cells. siRNA1 was an existing one in the laboratory, while siRNA2 was newly designed. The silencing efficiency was about 80%.

[0041] The sense (5'-3') sequence of Lcmt1 siRNA1 is as follows: ggcauggauaccaccuucuggagau (SEQ ID NO: 1), The antisense (5'-3') sequence is: aucuccaaggugguauccaugcc (SEQ ID NO: 2).

[0042] The Lcmt1 siRNA2 sense (5'-3') sequence is as follows: gagccauguucauaaacuatt (SEQ ID NO: 3), The antisense (5'-3') sequence is: uaguuuaugaacauggcuctt (SEQ ID NO: 4).

[0043] In the method for constructing the LCMT1 high-expression hepatocyte model, in step (1), the cells used are Hep3B cell lines, and in step (2), the high-expression plasmid cloning primer sense (5'-3') sequence is as follows: cccaagcttatggccactaggcagagggaatc (SEQ ID NO: 5), The antisense (5'-3') sequence is: cgggatccatacagccaggaaacacacactg (SEQ ID NO: 6).

[0044] The full-length LCMT1 cDNA fragment was obtained by amplifying HL60 cell mRNA using this primer. After transformation, it was ligated into the pEGFP-N1 plasmid to construct an LCMT1 high-expression plasmid. In step (3), an additional 10 μL of P3000 reagent needs to be added when diluting the DNA. Other steps are the same as in the silent hepatocyte model.

[0045] Hepatocyte models with LCMT1 silencing and high expression were constructed, and changes in CYP2E1 expression and oxidative stress were detected, respectively. The results are as follows: Figures 1-4 As shown, when LCMT1 is downregulated by siRNA transfection, CYP2E1 expression also decreases accordingly (see...). Figure 1 As shown), oxidative stress decreases (using SOD and MDA as detection indicators) (see... Figure 2 (As shown). When LCMT1 was upregulated by transfection with a high-expression plasmid, CYP2E1 expression subsequently increased (see...). Figure 3 As shown), oxidative stress increases (see...). Figure 4 (As shown).

[0046] By altering the expression level of LCMT1 in cells and observing the changes in CYP2E1 expression, the regulatory role of LCMT1 on CYP2E1 was verified. LCMT1 regulates CYP2E1 expression to reduce oxidative stress and inhibit hepatic stellate cell activation.

[0047] Example 2 In mouse experiments, a liver fibrosis mouse model was established using wild-type mice and liver LCMT1-specific knockout mice, with carbon tetrachloride exposure. Mouse body weight was monitored; serum AST and ALT levels were measured to assess liver function impairment; liver tissue was stained with Masson's Law and Sirius Red to observe collagen deposition; and quantitative real-time PCR was used to detect the mRNA expression levels of liver fibrosis-related molecules α-SMA, Col1a1, and TGF-β1. Results are as follows: Figures 5-8 As shown.

[0048] After discovering that hepatic LCMT1 knockout can alleviate carbon tetrachloride-induced liver fibrosis, further research was conducted on how hepatic LCMT1 knockout exerts its anti-fibrotic effect (see...). Figure 5 (As shown). Since oxidative stress is one of the known mechanisms of hepatic stellate cell activation, experiments have shown that LCMT1 can regulate CYP2E1 and affect the level of hepatic oxidative stress. Therefore, it is believed that this is one of the mechanisms by which hepatic LCMT1 can affect liver fibrosis.

[0049] When LCMT1 is downregulated by transfecting siRNA, CYP2E1 expression also decreases, and oxidative stress decreases (using SOD and MDA as detection indicators); when LCMT1 is upregulated by transfecting high-expression plasmids, CYP2E1 expression increases, and oxidative stress increases.

[0050] Example 3 Hepatic stellate cells were activated with TGFβ. Hepatocytes with silenced or overexpressed LCMT1 were co-cultured with activated hepatic stellate cells. Indicators reflecting hepatic stellate cell activation (Col1a1, α-SMA) were detected. The results are as follows: Figure 9 and Figure 10 As shown in the figure. The experimental results showed that when hepatocytes with silenced LCMT1 were co-cultured with activated hepatic stellate cells, the expression of Col1a1 and α-SMA decreased; when hepatocytes with high LCMT1 expression were co-cultured with activated hepatic stellate cells, the expression of Col1a1 and α-SMA increased.

[0051] In summary, based on the above experimental analysis and in vivo and in vitro experiments, the role and mechanism of hepatic LCMT1 in liver fibrosis were explored. The conclusions are as follows: Hepatic LCMT1 expression is positively correlated with the degree of liver fibrosis and the level of inflammation associated with liver fibrosis, and LCMT1 expression is elevated in diseases related to the progression of liver fibrosis. CCl4 treatment increases liver inflammation, leading to increased hepatic oxidative stress and promoting liver fibrosis, while specific knockout of hepatic LCMT1 improves CCl4-induced liver fibrosis. Hepatic LCMT1 is a potential therapeutic target for liver fibrosis. The protective effect of specific knockout of hepatic LCMT1 against liver fibrosis may be related to its ability to reduce liver inflammation, decrease hepatic CYP2E1 expression, alleviate hepatic oxidative stress damage, inhibit hepatic stellate cell activation, and reduce hepatic Colla1 and α-SMA expression.

[0052] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for constructing a liver cell model of LCMT1 silencing or overexpression, characterized by, The construction method includes the following steps: (1) Passage cells in the logarithmic growth phase into well plates; (2) Dilute plasmid siRNA1 or siRNA2 or high expression plasmid to an appropriate concentration to obtain siRNA1 dilution, siRNA2 dilution or high expression plasmid dilution; (3) Dilute the liposome transfection reagent in the culture medium to obtain a diluted transfection reagent solution; (4) Mix the transfection reagent dilution with siRNA1 dilution, siRNA2 dilution, or high expression plasmid dilution thoroughly and let stand at room temperature to obtain the transfection mixture; (5) Wash the cells in each well of the plate to remove residual culture medium, add another culture medium, then gently drop the transfection mixture into the well plate, shake well, and incubate in a cell culture incubator for a period of time. (6) Replace the culture medium in the well plate after culture with complete culture medium without antibiotics to obtain the constructed LCMT1 silent or highly expressed hepatocyte model. 2.The method of claim 1, wherein the LCMT1-silenced or overexpressed hepatocyte model is constructed by transfecting a hepatocyte with an LCMT1-silencing or overexpressing vector. In step (1), the cells used are MIHA cells or Hep3B cell lines. MIHA cells are used to silence LCMT1 with siRNA1 or siRNA2 to obtain a hepatocyte model with LCMT1 silence; Hep3B cells are used to overexpress LCMT1 to obtain a hepatocyte model with LCMT1 high expression. 3.The method of claim 1, wherein the LCMT1-silenced or overexpressed hepatocyte model is constructed by transfecting a hepatocyte with an LCMT1-silencing or overexpressing vector. The primer sequences for siRNA1 are shown in SEQ ID NO: 1 and SEQ ID NO: 2; the primer sequences for siRNA2 are shown in SEQ ID NO: 3 and SEQ ID NO:

4.

4. The method for constructing a hepatocyte model with silencing or high expression of LCMT1 according to claim 1, characterized in that, The high-expression plasmid was constructed by amplifying cDNA using primers SEQ ID NO: 5 and SEQ ID NO: 6, purifying it, and then using pEGFP-N1 plasmid as a template for enzyme digestion and religation.

5. The method for constructing a hepatocyte model with silencing or high expression of LCMT1 according to claim 1, characterized in that, In step (2), siRNA1 or siRNA2 is completely dissolved to 20 pmol / mL; the high expression plasmid is diluted to 5 μg / μL.

6. The method for constructing a hepatocyte model with silencing or high expression of LCMT1 according to claim 1, characterized in that, In step (3), the liposome transfection reagent is diluted with 7.5 μL Lipofectamine 3000 added to 125 μL Opti-MEM culture medium.

7. The method for constructing a hepatocyte model with silencing or high expression of LCMT1 according to claim 1, characterized in that, In step (2), 7.5 μL of siRNA1 or siRNA2 at a concentration of 20 pmol / mL is added to 125 μL of Opti-MEM culture medium for dilution; or 7.5 μL of high expression plasmid at a concentration of 5 μg / μL and 10 μL of P3000 are added to 125 μL of Opti-MEM culture medium for dilution.

8. The method for constructing a hepatocyte model with silencing or high expression of LCMT1 according to claim 1, characterized in that, In step (4), let it stand at room temperature for 15 minutes.

9. The method for constructing a hepatocyte model with silencing or high expression of LCMT1 according to claim 1, characterized in that, In step (5), another culture medium is 1250 μL of Opti-MEM medium, and then 250 μL of transfection mixture is gently dropped into the well plate and gently shaken. The plate is then placed in a cell culture incubator for 6 h.

10. A hepatocyte model with LCMT1 silencing or high expression, characterized in that, It is constructed by the construction method described in any one of claims 1-9.

Images