Space brewing saccharomyces cerevisiae cegf-tkj-008, roxburgh rose pomace ferment and application thereof

Abstract

The application discloses space Saccharomyces cerevisiae CEGF-TKJ-008, a roxburgh rose residue ferment and application thereof, the space Saccharomyces cerevisiae CEGF-TKJ-008 is preserved with the number CCTCC NO:M 2025504, the preserved bacteria have good acid resistance and acid reduction effect, can be used as roxburgh rose residue fermentation bacteria for fermenting roxburgh rose residue, and the obtained roxburgh rose residue ferment has the effect of stimulating appetite, can be applied to the preparation of roxburgh rose residue fermented feed with the effect of stimulating appetite, and is beneficial to improving the resource utilization value of roxburgh rose residue.

Description

Technical Field

[0001] This invention belongs to the field of preservation microorganisms and fermentation technology, and more specifically, relates to a space brewing yeast CEGF-TKJ-008, prickly pear residue fermentation product and its application. Background Technology

[0002] The prickly pear (scientific name *Rosarox burghii* Tratt.), also known as the wild pear, is a perennial deciduous or semi-evergreen shrub belonging to the genus *Ross* in the family Rosaceae. Its fruit turns yellow or reddish when ripe. The flesh of the prickly pear is crisp and fragrant, rich in vitamins C, E, and B vitamins, as well as minerals such as calcium, phosphorus, potassium, iron, and zinc. Its vitamin C content is 10 times that of kiwifruit, earning it the title of "King of Vitamin C." Due to its sweet and sour taste, high nutritional value, and both edible and medicinal properties, it has been widely used in health foods and functional beverages in recent years.

[0003] Currently, the development and utilization of prickly pear mainly focuses on prickly pear juice as the primary raw material. However, processing prickly pear produces a large amount of prickly pear pomace, which accounts for approximately 45-50% of the fresh fruit weight. This pomace accumulation causes environmental pollution and resource waste. Prickly pear pomace contains numerous functional components, such as total phenols, total flavonoids, total dietary fiber, and vitamin C. How to utilize prickly pear pomace for resource recovery, processing and reprocessing, industrial chain extension, agricultural recycling, and environmental pollution reduction is a hot research topic for the future. However, prickly pear pomace has high acidity, making it difficult for general microorganisms to ferment and utilize. Therefore, researching probiotics and fermentation processes that can utilize prickly pear pomace for fermentation is beneficial for improving resource utilization and reducing environmental pollution. Summary of the Invention

[0004] To address the aforementioned technical deficiencies or improvement needs, this invention provides a space-brewed brewing yeast CEGF-TKJ-008, prickly pear pomace fermentation product, and their applications. The aim is to discover a new brewing yeast strain, CESWGF002, with good acid resistance and acid-lowering properties, and its space-mutated strain, space-brewed brewing yeast CEGF-TKJ-008. These can be used as fermentation agents for prickly pear pomace, improving its palatability and producing a prickly pear pomace fermentation product that stimulates appetite. This product can be applied to the preparation of fermented prickly pear pomace feed, thereby solving the technical problem of high acidity in prickly pear pomace, which makes it difficult for general microorganisms to utilize, resulting in resource waste.

[0005] To achieve the above objectives, according to the first aspect of the present invention, a space-brewed yeast CEGF-TKJ-008 is provided, with accession number CCTCCNO:M2025504, classification name Saccharomyces cerevisiae CEGF-TKJ-008, and accession date March 17, 2025.

[0006] According to a second aspect of the present invention, a prickly pear pomace fermentation inoculant is provided, comprising the space-brewed yeast CEGF-TKJ-008 and / or brewer's yeast CESWGF002 as described in the present invention, wherein the brewer's yeast CESWGF002 has the accession number CCTCCNO:M20231513, is classified as SaccharomycescerevisiaeCESWGF002, and has been accessed on August 21, 2023.

[0007] According to a third aspect of the present invention, a prickly pear residue fermentation product is provided, which is obtained by fermenting a substrate comprising prickly pear residue as described in the present invention.

[0008] Preferably, the substrate of the prickly pear residue fermentation product includes prickly pear residue and a nitrogen source, wherein the nitrogen source includes chickpeas.

[0009] Preferably, the prickly pear residue fermentation product is prepared according to the following method: The substrate is prepared by mixing a nitrogen source at a ratio of 10% to 50% of the total mass of prickly pear residue and water, and then fermenting the substrate with the prickly pear residue fermentation agent as described in claim 2 at a temperature of 30 to 40°C.

[0010] Preferably, the nitrogen source of the prickly pear residue fermentation product is chickpea, and the fermentation agent of the prickly pear residue is the space brewing yeast CEGF-TKJ-008 as described in this invention.

[0011] Preferably, the prickly pear residue fermentation product is obtained by inoculating with 8% to 10% of space brewing yeast CEGF-TKJ-008 and fermenting at 30 to 40°C for 40 to 72 hours.

[0012] According to a fourth aspect of the present invention, an application of the prickly pear residue fermentation inoculant as described in the present invention is provided in the preparation of prickly pear residue fermented feed.

[0013] Preferably, the application is used to prepare prickly pear residue fermented feed that stimulates appetite.

[0014] Preferably, in the application, the prickly pear residue fermented feed includes prickly pear residue fermented material and a base feed. The prickly pear residue fermented material is obtained using a fermentation substrate such as the space brewing yeast CEGF-TKJ-008 described in this invention, and the substrate includes prickly pear residue.

[0015] In summary, compared with the prior art, the above-described technical solutions conceived by this invention can achieve the following beneficial effects: The new strain of Saccharomyces cerevisiae, Saccharomyces cerevisiae CESWGF002, and its space-mutated strain, Saccharomyces cerevisiae CEGF-TKJ-008, screened by this invention have good acid resistance and acid-lowering effects. They can be used as fermentation agents for prickly pear residue. The fermented prickly pear residue obtained has a certain appetite-stimulating effect and can be used to prepare fermented prickly pear residue feed, which is beneficial to improving the resource utilization value of prickly pear residue. Attached Figure Description

[0016] Figure 1 It is the morphology of the original strain (Saccharomyces cerevisiae CESWGF002); Figure 2 The effect of nitrogen source on the activity of space-brewed Saccharomyces cerevisiae strain CEGF-TKJ-008; Figure 3 The effect of the ratio of chickpea and prickly pear pomace on the activity of the space-brewed brewer's yeast strain CEGF-TKJ-008; Figure 4 The effect of inoculum size on the activity of space-brewed Saccharomyces cerevisiae strain CEGF-TKJ-008; Figure 5 The effect of fermentation temperature on the activity of the space-brewed brewer's yeast strain CEGF-TKJ-008; Figure 6 The effect of fermentation time on the activity of the space-brewed brewer's yeast strain CEGF-TKJ-008; Figure 7 It includes response surfaces and contour plots; Figure 8 It includes response surfaces and contour plots; Figure 9 It includes response surfaces and contour plots; Figure 10 This refers to the food intake of mice in different feed groups; Figure 11 This is a comparison of the body weight of mice in different feed groups. Detailed Implementation

[0017] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Furthermore, the technical features involved in the various embodiments of this invention described below can be combined with each other as long as they do not conflict with each other.

[0018] The inventors isolated and purified bacterial strains from aged Chinese herbal extracts from the Yeren Valley region. From the nine isolated Saccharomyces cerevisiae strains, they screened out a strain with high acid resistance and good acid-lowering effect. This strain was deposited on August 21, 2023, at the China Center for Type Culture Collection (Wuhan University Collection Center), located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province. Its accession number is CCTCCNO:M20231513, the deposit date is August 21, 2023, and its classification name is Saccharomyces cerevisiae CESWGF002.

[0019] Furthermore, using the *Saccharomyces cerevisiae* CESWGF002 with accession number CCTCCNO:M20231513 as the original strain, the cultured *Saccharomyces cerevisiae* CESWGF002 was streaked on a slant culture medium, the cap was tightened, and the sample was sent into space aboard the "Shijian-19" spacecraft for mutagenesis. After space mutagenesis, the sample was retrieved and stored in a 4°C refrigerator for later use. A space-mutated strain was obtained through isolation and screening and was deposited on March 17, 2025, at the China Center for Type Culture Collection (Wuhan University Collection Center), located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province. Its accession number is CCTCCNO:M2025504, and its classification name is *Saccharomyces cerevisiae* CEGF-TKJ-008. The deposit date is March 17, 2025.

[0020] This study investigated the effects of different nitrogen sources, inoculum sizes, fermentation temperatures, and fermentation times on the activity of Saccharomyces cerevisiae CEGF-TKJ-008. A biomass prediction model was constructed based on fermentation temperature, inoculum size, and fermentation time: Y = 35.32 - 1.17X1 - 0.21X2 - 0.6X3 - 3.36X1X2 + 2.66X1X3 + 2.71X2X3 - 12.38X1 2 -13.87X2 2 -14.3X3 2 In the formula: Y is the predicted response value, i.e., viable cell count; X1 is the temperature, °C; X2 is the inoculum size, %; and X3 is the fermentation time, h. Based on the constructed prediction model, the optimal fermentation conditions are a fermentation temperature of 30 °C, an inoculum size of 7%~8%, and a fermentation time of 45~46 h.

[0021] Based on this discovery, the present invention provides a space-brewed brewing yeast CEGF-TKJ-008, with accession number CCTCCNO:M2025504, classified as Saccharomyces cerevisiae CEGF-TKJ-008, and accession date of March 17, 2025.

[0022] In addition, the present invention also provides a prickly pear pomace fermentation inoculant, which includes the space-brewed yeast CEGF-TKJ-008 (Saccharomyces cerevisiae CEGF-TKJ-008, accession number CCTCC NO: M2025504) and / or brewing yeast CESWGF002 as described in the present invention. The accession number of the brewing yeast CESWGF002 is CCTCC NO: M20231513, the accession date is August 21, 2023, and the classification name is Saccharomyces cerevisiae CESWGF002. It can be used to ferment prickly pear pomace.

[0023] This invention also provides a prickly pear pomace fermented product, obtained by fermenting a substrate comprising prickly pear pomace, using either the space brewing yeast CEGF-TKJ-008 as described in this invention or a prickly pear pomace fermentation agent. In some embodiments, the substrate comprises prickly pear pomace and a nitrogen source, wherein the nitrogen source comprises chickpeas. In some embodiments, the prickly pear pomace fermentation agent is the space brewing yeast CEGF-TKJ-008 as described in this invention, and the substrate comprises prickly pear pomace and chickpeas.

[0024] In some embodiments, the prickly pear pomace fermentation product is prepared according to the following method: The substrate is prepared by mixing nitrogen source in a ratio of 10% to 50% of the total mass of prickly pear residue and water. The substrate is fermented at 30 to 40°C using space brewing yeast CEGF-TKJ-008 or prickly pear residue fermentation agent as described in this invention as the fermentation strain. The nitrogen source includes chickpeas.

[0025] The nitrogen source is chickpeas. Inoculation is performed at 8%–10% of the prickly pear residue fermentation inoculant, and fermentation is carried out at 30–40°C for 40–72 hours to obtain the prickly pear residue fermented product. In some embodiments, chickpea powder is added at 10% of the prickly pear residue mass, and the space brewing yeast CEGF-TKJ-008 described in this invention is used as the fermentation strain. Inoculation is performed at 8%–10%, and fermentation is carried out at 30–40°C for 40–72 hours to obtain the prickly pear residue fermented product.

[0026] In addition, the present invention also provides the application of space brewing yeast CEGF-TKJ-008 or prickly pear residue fermentation agent as described in the present invention in the preparation of prickly pear residue fermented feed.

[0027] In some embodiments, this method is applied to prepare a prickly pear residue fermented feed that stimulates appetite. The prickly pear residue fermented feed comprises prickly pear residue fermented material and a base feed. The prickly pear residue fermented material is obtained using a fermentation substrate including space brewing yeast CEGF-TKJ-008 as described in this invention or a prickly pear fermentation agent, wherein the substrate includes prickly pear residue.

[0028] In some embodiments of the application, the fermentation substrate includes prickly pear pomace and chickpeas, which are fermented using the space brewing yeast CEGF-TKJ-008 as described in this invention to obtain prickly pear pomace fermentation powder. The obtained prickly pear pomace fermentation powder is added to animal feed as a feed additive to prepare prickly pear pomace fermented feed that stimulates appetite.

[0029] The following are examples. Example 1: Isolation and Identification of the Original Strains Twenty strains of bacteria were isolated from aged Chinese herbal extracts from the Yeren Valley region (taken from Hu Kaiqing's home in Xinzhou), and morphological, physiological and biochemical, and molecular biological identifications were conducted in the laboratory.

[0030] (1) Isolation and identification of strains Take 1g of the herbal extract and perform serial dilutions with sterile physiological saline, with a dilution gradient of 10. -1 10 -2 10 -3 10 -4 10 -5 Take 50 μl of diluted sample and spread it on YPD solid medium. Invert the medium and incubate it in a 37℃ constant temperature incubator for 2-5 days. Pick single colonies on solid medium for further culture. Repeat streak until pure strain is obtained.

[0031] YPD medium: 10.0g yeast extract, 20.0g peptone, 20.0g glucose, 1000mL distilled water, pH: 6.5±0.2 (25℃) (2) Molecular biological identification Genomic DNA was extracted from the isolated strain strictly following the steps of the bacterial DNA extraction kit. Using this DNA as a template, PCR amplification was performed using primers ITS4 (5′-TCCTCCGCTTATTGATATGC-3) and ITS5 (5′-GGAAGTAAAAGTCGTAACAAGG-3). The PCR reaction system consisted of 25 μL of 2×EcoTaqPCRSuper-Mix, 1 μL each of forward and reverse primers, 1 μL of genomic DNA, and ddH2O to a final volume of 50 μL. The PCR program was as follows: 95℃ for 10 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 90 s, for a total of 30 cycles; final extension at 72℃ for 10 min. The PCR products were directly sequenced by Qingke Biotechnology Co., Ltd. The gene sequences were BLAST compared with those in NCBI, and the strain with the highest homology was identified in GenBank for further confirmation of the isolated strain.

[0032] The identification results showed that the strains isolated from the herbal extract included 2 strains of Bacillus subtilis, 1 strain of Paenibacillus, 2 strains of Lactobacillus plantarum, 1 strain of Citrobacter farmeri, 1 strain of Escherichia coli, 2 strains of Clostridium, 2 strains of Oceanobacillus sojae, 1 strain of xanthan gum degrading bacteria, and 9 strains of Saccharomyces cerevisiae. The strains isolated and purified in this example were stored at -80°C. The strains of Saccharomyces cerevisiae obtained are shown in Table 1.

[0033] Table 1. Isolated Saccharomyces cerevisiae strains

[0034] The *Saccharomyces cerevisiae* strain B4-10 has been identified as a new strain. The morphology of this strain is as follows: Figure 1 As shown, its 16S rDNA sequence is shown in SEQ ID NO. 1: CGGGGTAGTCTACTTGATTTGAGGAAAAAATGAGCGTACTGACGGTACCGTTTTGTAGAGTACTGTCGTCATTATTTTCGTGCAAACACAATACAATCCGTGAGGATTAGGGAAGTATTCGCTCAAACAAGCATACCATTGGGAATACCCAATGGTGCAATGTGCGTTCAAAGATTCGATGATTCCGAGAGCTGCGATTCG TATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAAGAATTTTAAAACGTAGATTTATAGATTAGATATGTTTGTTTTGTTGTAAAAAAACAGTGTGTAAGAATATTATGTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCA.

[0035] Example 2: Screening of acid-lowering and acid-resistant Saccharomyces cerevisiae strains 2.1 Comparison of acid tolerance activities among different Saccharomyces cerevisiae strains (1) Preparation of culture medium using prickly pear pomace as raw material: Weigh 50g of dried prickly pear pomace, add 300ml of water, and sterilize at 121℃ for 20min. This is recorded as prickly pear pomace culture medium (pH 3.0 after sterilization). The prickly pear pomace collection base is: Photosynthetic Biotechnology Prickly Pear Collection Base, located at Bailong Village, Duijiang Town, Dafang County, Bijie City, Guizhou Province (1000 mu). The processing plant is Guizhou Photosynthetic Biotechnology Co., Ltd.

[0036] (2) Activation of strains: The yeast strain to be screened obtained in Example 1 was taken out from the -80℃ freezer, inoculated into YPD liquid medium for activation, and cultured at 37℃ for 3 generations at an inoculation rate of 4% as fresh fermentation broth.

[0037] (3) Acid resistance test: Fresh fermentation broths corresponding to 9 strains of Saccharomyces cerevisiae were inoculated into prickly pear pomace culture medium at a 6% inoculation rate and stirred evenly. The mixtures were then placed in a 37℃ incubator and incubated for 5 days. Periodically (e.g., every 2 days), 1g of fermentation material was placed into 9mL of PBS containing steel beads, vortexed for 1min, and 1mL was taken for serial dilution at a dilution gradient of 10. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 A certain amount of the diluted solution was spread onto YPD solid plates and incubated at 37°C for 3 days. The number of colonies on the plates was then counted. Based on the dilution and the volume of liquid used to spread the solution, the number of viable cells in the Saccharomyces cerevisiae fermentation product was calculated. The results are shown in the table below.

[0038] Table 2 Comparison of acid tolerance activities of different Saccharomyces cerevisiae strains

[0039] As shown in Table 2, the nine isolated Saccharomyces cerevisiae strains exhibited different acid tolerances. Among them, strain B4-10 showed the strongest overall acid tolerance and exhibited the highest activity after culturing on prickly pear pomace medium for 5 days.

[0040] 2.2 Comparison of acid-reducing functions of different Saccharomyces cerevisiae strains (1) Prepare culture medium using prickly pear pomace as raw material: Weigh 50g of dry prickly pear pomace, add 300ml of water, sterilize at 121℃ for 20min, and record it as prickly pear pomace culture medium.

[0041] (2) Activation of strains: The strains to be screened obtained in Example 1 were taken out of the -80℃ freezer, inoculated with YPD liquid medium for activation, and cultured at 37℃ for 3 generations at an inoculation rate of 4% to obtain fresh fermentation broth.

[0042] (3) Acid-reducing function test: Using the prickly pear residue culture medium without fermentation strains as the blank group, fresh fermentation broth corresponding to 9 strains of Saccharomyces cerevisiae were inoculated into the prickly pear residue culture medium at an inoculation rate of 6%, stirred evenly, and placed in a 37℃ incubator for static culture for 5 days. During fermentation, every 2 days (1 day, 3 days and 5 days of fermentation culture), 50 mL of fermentation material was taken and placed in an Erlenmeyer flask, heated to boiling in a water bath for 10 min (to remove CO2), removed and allowed to cool naturally to room temperature, and then made up to 50 mL with distilled water. After mixing, 10 mL was pipetted into a 250 mL Erlenmeyer flask, 50 mL of distilled water was added, and the flask was heated to boiling on an electric stove. After cooling, 2 drops of phenolphthalein indicator were added and shaken well. The solution was titrated to the endpoint with 0.1 mol / L NaOH standard solution, and the volume of NaOH (mL) was recorded. The total acid content was calculated according to the following formula: Calculation formula: ; Where: X—the number of grams of total acid per kilogram (or per liter) of sample, g / kg (or g / L); C—Concentration of sodium hydroxide standard titration solution, mol / L; V1—The volume of sodium hydroxide standard titration solution consumed during the titration of the test solution, in mL; V2—The volume of sodium hydroxide standard titration solution consumed in the blank test, in mL; V3—Total volume of sample diluent, mL; V4 — The volume of sample solution taken during titration (mL); m—sample mass (or volume), g (mL); K-Acid Conversion Factors: The conversion factors for various acids are as follows: for analysis of apple fruits and their products, malic acid is represented by 0.067; for analysis of alcoholic beverages and condiments, acetic acid is represented by 0.060; for analysis of grapes and their products, tartaric acid is represented by 0.075; for analysis of citrus fruits and their products, citric acid is represented by 0.064; citric acid (containing water of crystallization) is represented by 0.070; for analysis of dairy products, meat, aquatic products and their products, lactic acid is represented by 0.090; hydrochloric acid, 0.036; phosphoric acid, 0.033; in this example, citric acid is used.

[0043] The acid-reducing effects of different Saccharomyces cerevisiae strains were compared, and the results are shown in Table 3.

[0044] Table 3. Acid-reducing effects of different Saccharomyces cerevisiae strains

[0045] Note: The percentage decrease in total acidity = (total acidity in the sample - total acidity in the control group) / total acidity in the sample × 100. The total acidity in the blank group was 0.012 g / mL.

[0046] As shown in Table 3, when using prickly pear residue as fermentation material, there are significant differences in the acid-reducing effects of different brewing yeast strains. Among them, compared with other brewing yeasts, the brewing yeast strain corresponding to B4-10 not only has good acid resistance, but also has a significant acid-reducing effect. As the fermentation time increases, the proportion of total acid reduction shows an increasing trend.

[0047] The newly isolated strain of Saccharomyces cerevisiae (numbered B4-10) was deposited on August 21, 2023, at the China Center for Type Culture Collection (Wuhan University Collection Center), located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province. Its accession number is CCTCCNO:M20231513, the deposit date is August 21, 2023, and its classification name is Saccharomyces cerevisiae CESWGF002.

[0048] Example 3: Space Mutagenesis of Saccharomyces cerevisiae 1. Experimental Materials 1.1 The original strain was Saccharomyces cerevisiae CESWGF002, with accession number CCTCCNO:M20231513, accession date August 21, 2023, and classification name Saccharomyces cerevisiae CESWGF002.

[0049] 1.2 Culture medium (YPD medium): 10.0g yeast extract, 20.0g peptone, 20.0g glucose, 1000mL distilled water, pH: 6.5±0.2 (25℃), autoclaved at 121℃ for 20min.

[0050] 2. Experimental Methods 2.1 Space-induced mutagenesis treatment of Saccharomyces cerevisiae The freshly cultured brewer's yeast CESWGF002 was streaked on a culture medium slant, the cap was tightened, and it was carried into space aboard the "Shijian-19" spacecraft for mutagenesis. After space mutagenesis, the sample was retrieved and stored in a 4°C refrigerator for later use.

[0051] 2.2 Isolation and Screening of Space-Based Saccharomyces The samples induced by space mutagenesis were isolated and screened to obtain 200 space-mutated strains. The 16S rDNA sequence of one space-mutated Saccharomyces cerevisiae strain is shown in SEQ ID NO.2. This space-mutated strain was identified as a new species and named Saccharomyces cerevisiae CEGF-TKJ-008. It was deposited on March 17, 2025, at the China Center for Type Culture Collection (Wuhan University Collection Center), located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province. Its accession number is CCTCC NO: M2025504, and its classification name is Saccharomyces cerevisiae CEGF-TKJ-008. The deposit date is March 17, 2025.

[0052] 2.3 Comparison of acid resistance activities (1) Prepare culture medium using prickly pear pomace as raw material: Weigh 50g of dry prickly pear pomace, add 300ml of water, sterilize at 121℃ for 20min, and record it as prickly pear pomace culture medium.

[0053] (2) Activation of strains: The original strain of Saccharomyces cerevisiae CESWGF002 (accession number CCTCCNO:M20231513), the space-mutated strain (Saccharomyces cerevisiae CEGF-TKJ-008), and the commercially available Saccharomyces cerevisiae (Dalian Y4) were inoculated into YPD liquid medium for activation. After three generations of static culture at 37°C, the inoculation amount was 4%, and the culture was used as fresh fermentation broth.

[0054] (3) Acid resistance test: The colony counts of the original strain, the space-mutated strain, and the fresh fermentation broth of commercially available brewing yeast were adjusted to 1×10⁻⁶. 8 CFU / mL, inoculated at a 6% inoculum into prickly pear pomace culture medium, stirred thoroughly, and incubated statically at 37℃ for 5 days. Periodically (every 3 days after fermentation), 1g of fermentation product was added to 9mL of PBS containing steel beads, vortexed for 1 minute, and 1mL was then serially diluted in 10⁻¹⁰ increments. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 A certain amount of the diluted solution was spread onto YPD solid plates and incubated at 37°C for 3 days. The number of colonies on the plates was then counted. Based on the dilution and the volume of liquid used to spread the solution, the number of viable cells in the Saccharomyces cerevisiae fermentation product was calculated. The results are shown in the table below.

[0055] Table 4 Comparison of acid tolerance activities of different brewing yeasts

[0056] As shown in Table 4, compared with the original strain (Saccharomyces cerevisiae CESWGF002), the acid resistance of the space-maligned Saccharomyces cerevisiae CEGF-TKJ-008 was significantly improved (by 8 times); compared with the existing commercially available Saccharomyces cerevisiae (Dalian Y4), the acid resistance of the space-maligned Saccharomyces cerevisiae CEGF-TKJ-008 was improved by 4 times.

[0057] 2.4 Comparison of acid-lowering functions (1) Prepare culture medium using prickly pear pomace as raw material: Weigh 50g of dry prickly pear pomace, add 300ml of water, sterilize at 121℃ for 20min, and record it as prickly pear pomace culture medium.

[0058] (2) Activation of strains: The original strain of Saccharomyces cerevisiae CESWGF002 (accession number CCTCCNO:M20231513), the space-mutated strain (Saccharomyces cerevisiae CEGF-TKJ-008), and the commercially available Saccharomyces cerevisiae (Dalian Y4) were inoculated into YPD liquid medium for activation. After three generations of static culture at 37°C, the inoculation amount was 4%, and the culture was used as fresh fermentation broth.

[0059] (3) Acid-reducing function test: The original strain, the space-mutated strain and the fresh fermentation broth corresponding to the commercially available brewing yeast were inoculated into the prickly pear residue culture medium at an inoculation rate of 6% and stirred evenly. The mixture was placed in a 37℃ incubator and cultured for 5 days. At regular intervals (0 days, 1 day, 3 days and 5 days of fermentation), 50 mL of fermentation material was taken and placed in an Erlenmeyer flask. The flask was heated to boiling in a water bath for 10 minutes (to remove CO2). The mixture was then removed and allowed to cool naturally to room temperature. Distilled water was added to make up to 50 mL. After mixing, 10 mL of the mixture was pipetted into a 250 mL Erlenmeyer flask, 50 mL of distilled water was added, and the mixture was heated to boiling on an electric stove. After cooling, 2 drops of phenolphthalein indicator were added and the mixture was shaken well. The mixture was titrated to the endpoint with 0.1 mol / L NaOH standard solution. The volume of NaOH (mL) was recorded. The total acid content was calculated according to the formula. In this example, citric acid was used. The acid-reducing effects of different brewing yeasts were compared in the following table.

[0060] Table 5 Comparison of acid-reducing effects of different brewing yeasts

[0061] As shown in Table 5, the proportion of total acid reduction of the original strain (Saccharomyces cerevisiae CESWGF002) and the space-brewed Saccharomyces cerevisiae CEGF-TKJ-008 showed an increasing trend with the extension of fermentation time. Among them, under the same treatment period, the acid reduction effect of space-brewed Saccharomyces cerevisiae CEGF-TKJ-008 was better than that of the original strain (Saccharomyces cerevisiae CESWGF002) and the existing commercially available Saccharomyces cerevisiae Y4.

[0062] Example 4: Process Study on Fermentation of Prickly Pear Residue Based on Space-Based Saccharomyces CEGF-TKJ-008 (1) Optimization of nitrogen source by single factor Preparation of seed culture of space-bred Saccharomyces cerevisiae CEGF-TKJ-008: The glycerol tubes of space-bred Saccharomyces cerevisiae CEGF-TKJ-008 strain were removed at -80°C. Using an inoculation loop, three zones were streaked on a YPD medium plate, and the plate was incubated upside down at 37°C for 2 days. Single colonies were then picked and inoculated into YPD liquid medium, and incubated statically at 37°C for 1-2 days.

[0063] Preparation of fermentation medium: Water was added at a mass ratio of 1:6 between dried prickly pear residue and water. Soybean meal, yeast powder, chickpea flour, and peptone were used as nitrogen sources. Nitrogen sources were added at 10% of the total mass of prickly pear residue and water. The mixture was autoclaved at 121℃ and 0.1MPa for 20 minutes.

[0064] Inoculation and Fermentation: A 6% inoculum of the space-bred *Saccharomyces cerevisiae* CEGF-TKJ-008 seed culture was inoculated and fermented at 37℃ for 40 hours. The effect of nitrogen source on the activity of the space-bred *Saccharomyces cerevisiae* CEGF-TKJ-008 strain was studied. The results are as follows: Figure 2 As shown, suitable nitrogen sources for the fermentation of space-brewed brewer's yeast CEGF-TKJ-008 were screened.

[0065] Depend on Figure 2 The results showed that adding different nitrogen sources to the prickly pear pomace significantly affected the activity of the space-brewed brewer's yeast CEGF-TKJ-008. Compared with conventional nitrogen sources (soybean meal, yeast powder, peptone), when chickpeas were used as the nitrogen source, the viable count of the space-brewed brewer's yeast CEGF-TKJ-008 reached 4×10⁻⁶ after static fermentation at 37℃ for 40 hours. 7 Under the same fermentation conditions using yeast powder as the nitrogen source, the viable count of space-brewed brewing yeast CEGF-TKJ-008 was only 2×10⁻⁶ CFU / g. 7 CFU / g, while using soybean meal or peptone as nitrogen source, the viable count of space-brewed brewer's yeast CEGF-TKJ-008 was less than 0.5×10⁻⁶. 7 CFU / g. Therefore, when using space-brewed brewing yeast CEGF-TKJ-008 to ferment prickly pear pomace, chickpeas are a better nitrogen source.

[0066] (2) Effect of chickpea flour to prickly pear pomace ratio on the activity of space-brewed brewer's yeast strain CEGF-TKJ-008 Water was added to the dried prickly pear residue at a mass-to-volume ratio of 1:6. Chickpea flour was added as a nitrogen source at proportions of 0%, 1%, 10%, 17%, 25%, and 50% of the total mass of the prickly pear residue and water. The mixture was then autoclaved at 121℃ and 0.1MPa for 20 minutes to prepare the fermentation medium.

[0067] The seed culture of space-brewed Saccharomyces cerevisiae CEGF-TKJ-008 was inoculated at a rate of 6% and fermented at 37℃ for 40 hours. The effect of the ratio of chickpea and prickly pear residue on the activity of the space-brewed Saccharomyces cerevisiae CEGF-TKJ-008 strain was studied. The results are as follows: Figure 3 As shown.

[0068] Depend on Figure 3 The results showed that the ratio of chickpeas to prickly pear pomace significantly affected the activity of the space-brewed brewer's yeast strain CEGF-TKJ-008. Compared with no chickpeas, adding chickpeas was beneficial in improving the activity of the space-brewed brewer's yeast strain CEGF-TKJ-008. Specifically, when the ratio of chickpea powder to the total mass of prickly pear pomace and water was 10%, and the mixture was fermented at 37℃ for 40 hours, the viable count of the space-brewed brewer's yeast CEGF-TKJ-008 was 4 × 10⁻⁶. 7 CFU / g; The mixture was prepared with chickpea flour accounting for 50% of the total mass of prickly pear residue and water. After fermentation at 37℃ for 40 hours, the viable count of the space-brewed brewing yeast CEGF-TKJ-008 was approximately 2.5 × 10⁻⁶ CFU / g. 7 CFU / g. Therefore, when using space brewing yeast CEGF-TKJ-008 to ferment prickly pear pomace, chickpeas should be used as the nitrogen source, and the ratio of prickly pear pomace to water should be 10% to 50% of the total mass. In particular, adding CEGF-TKJ-008 will result in higher fermentation activity.

[0069] (3) Optimization of inoculum size of space-brewed brewer's yeast CEGF-TKJ-008 Preparation of fermentation medium: Chickpea powder was mixed with prickly pear residue at a mass ratio of 10%. Chickpea powder and prickly pear residue were added to a 250mL Erlenmeyer flask, and water was added to a substrate moisture content of 83%. The mixture was then pressure-cooked at 121℃ and 0.1MPa for 20min to obtain the fermentation medium.

[0070] The seed culture of *Saccharomyces cerevisiae* CEGF-TKJ-008 was inoculated at inoculum rates of 2%, 4%, 6%, 8%, and 10%, respectively, and fermented at 37℃ for 40 hours. The effect of inoculum rate on the *Saccharomyces cerevisiae* CEGF-TKJ-008 strain was studied, and the results are as follows: Figure 4 As shown.

[0071] Depend on Figure 4 The results showed that there was no significant dose-response relationship between the inoculum size and the activity of the space-brewed Saccharomyces CEGF-TKJ-008 strain. With an inoculum size of 8%–10% and static fermentation at 37℃ for 40 hours, the viable count of the space-brewed Saccharomyces CEGF-TKJ-008 strain was approximately 1 × 10⁻⁶. 8 CFU / g ~1.5×10 8Compared to a 10% inoculum, an 8% inoculum resulted in a higher viable count of the space-brewed brewing yeast CEGF-TKJ-008 after fermentation. Therefore, an 8% inoculum is the preferred inoculum size for fermenting prickly pear pomace using space-brewed brewing yeast CEGF-TKJ-008.

[0072] (4) Optimization of fermentation temperature of space brewing yeast CEGF-TKJ-008 Preparation of fermentation medium: Chickpea powder was mixed with prickly pear residue at a mass ratio of 10%. Chickpea powder and prickly pear residue were added to a 250mL Erlenmeyer flask, and water was added to a substrate moisture content of 83%. The mixture was then pressure-cooked at 121℃ and 0.1MPa for 20min to obtain the fermentation medium.

[0073] The seed culture of *Saccharomyces cerevisiae* CEGF-TKJ-008 was inoculated at a 6% inoculum and fermented statically at 30℃, 37℃, 40℃, and 44℃ for 40 h, respectively. The effect of fermentation temperature on the activity of the *Saccharomyces cerevisiae* CEGF-TKJ-008 strain was studied. The total bacterial count was determined according to GB4789.2-2022 National Food Safety Standard. The results are as follows: Figure 5 As shown.

[0074] Figure 3 and Figure 5 The discrepancy between the two counts falls within the normal acceptable error range of the standard methodology for viable microbial cell counting. The reasons are as follows: According to GB4789.2-2022 National Food Safety Standard for Determination of Total Colony Count and ISO7218 standard, the colony count results follow a Poisson distribution. At higher CFU levels, the standard deviation is approximately the square root of the count result. Calculations show that the 95% confidence interval for the mean of these results is wide, and both of our results fall within this interval, indicating no statistically significant difference.

[0075] Depend on Figure 5 The results showed that the suitable temperature for fermenting prickly pear residue with space brewing yeast CEGF-TKJ-008 was 30~40℃, preferably 30~37℃.

[0076] (5) Effect of fermentation time on the activity of space-brewed brewer's yeast CEGF-TKJ-008 Preparation of fermentation medium: Chickpea powder was prepared at a ratio of 10% of the total mass of prickly pear residue and water. Chickpea powder and prickly pear residue were added to a 250mL Erlenmeyer flask, and water was added to a substrate moisture content of 83%. The mixture was then pressure-cooked at 121℃ and 0.1MPa for 20 minutes to obtain the fermentation medium.

[0077] The seed culture of space-brewed Saccharomyces cerevisiae CEGF-TKJ-008 was inoculated at a rate of 6%, and fermented at 37℃ for 30h, 36h, 42h, 48h, and 54h, respectively. The effect of fermentation time on the activity of space-brewed Saccharomyces cerevisiae CEGF-TKJ-008 was studied, and the results are as follows: Figure 6 As shown.

[0078] Figure 3 and Figure 6 The difference in viable cell count under the same fermentation conditions may be due to slight differences in the raw materials of prickly pear residue and the activation state of the strains between the two batches of experiments. However, this is a common and acceptable batch-to-batch fluctuation in microbial fermentation experiments.

[0079] Depend on Figure 6 The results showed that the optimal fermentation temperature for prickly pear residue using space-brewed brewing yeast CEGF-TKJ-008 was 37℃, and the suitable fermentation time was 42h~54h, with 37℃ fermentation for 48h being the preferred temperature.

[0080] Example 5: Process optimization of prickly pear residue fermentation based on space-brewed brewing yeast CEGF-TKJ-008 In this embodiment, three factors with significant influence were selected: inoculum size (factor A), fermentation temperature (factor B), and fermentation time (factor C) for response surface optimization experiments. Space-brewed brewing yeast CEGF-TKJ-008 was used as the fermentation strain for prickly pear pomace, and the activity of space-brewed brewing yeast CEGF-TKJ-008 was used as the indicator. The Box-Behnken response surface optimization experimental design with 3 factors and 3 levels was carried out using DesignExpert 8.0.6 software, as shown in the table below.

[0081] Table 6. Factor Levels in the Box-Behnken Experiment

[0082] The experimental design based on Design-ExpertVersion 8.0.6, a 3-factor, 3-level Box-Behnken response surface methodology was conducted, and the results are shown in the table below.

[0083] Table 7 Box-Behnken test protocol and results

[0084] In response surface methodology experimental design, the center point is the point at which all variables take the middle level. Typically, the center point is repeated multiple times, for example, 3 to 5 times. The main purpose of this repetition is to estimate experimental error. By repeating the observations at the center point, we can calculate the random error of the experiment, which is crucial for subsequent model fitting and significance testing. The table above contains 17 experimental points, of which the center point experiment was repeated 5 times to detect experimental error. Then, standard polynomial regression was used for analysis and fitting. Response surface methodology analysis was performed on the response values ​​obtained from the above 17 experimental points, resulting in the Box-Behnken ANOVA table and the quadratic polynomial relating the response values ​​to the independent variables, as detailed below: Table 8. Analysis of Variance of the Box-Behnken Trial

[0085] Note: The difference was extremely significant (P < 0.01); the difference was significant (P < 0.05).

[0086] Obtain the quadratic polynomial relating the response value to the independent variable: Y=35.32-1.17X1-0.21X2-0.6X3-3.36X1X2+2.66X1X3+2.71X2X3-12.38X1 2 -13.87X2 2 -14.3X3 2 In the formula: Y is the predicted response value, i.e., biomass, in units of 10. 7 CFU / g, X1 is temperature (°C), X2 is inoculum size (%), X3 is fermentation time (h).

[0087] As shown in the table above, the model R 2 =0.9502>0.9, indicating that the model fits well and the linear relationship between the independent variable and the response value reaches a significant level. The optimal fermentation conditions for fermenting prickly pear residue with space brewing yeast CEGF-TKJ-008 can be determined using this regression equation.

[0088] Response surface and contour plot as follows Figures 7 to 9 As shown, based on the response surface and contour plot, when the temperature remains constant, the biomass will first increase and then decrease with the increase of inoculum size and fermentation time; when the fermentation time remains constant, the biomass will increase and then decrease with the increase of temperature and inoculum size; when the inoculum size remains constant, the biomass will first increase and then decrease with the increase of temperature and fermentation time.

[0089] Setting the first-order partial derivatives of each variable (X1, X2, X3) to zero, and differentiating the fitted system of three linear equations, we obtain the model's predicted optimal points as follows: inoculum size 7.98%, fermentation time 45.74 h, and temperature 29.5 °C. Substituting these values ​​into the regression equation, we obtain the theoretical viable cell count Y = 35.36 × 10⁻⁶. 7 CFU / g.

[0090] Validation of the prediction model: Fermentation was carried out using the optimal fermentation conditions obtained above to test the reliability of the model prediction. The results are shown in the table below.

[0091] Table 9 Model Validation Results

[0092] Fermentation was carried out under optimized conditions, and the measured biomass was in 95.41% agreement with the model prediction, indicating that the prediction model is highly accurate and reliable in predicting biomass.

[0093] Example 6: Application of Space Saccharomyces CEGF-TKJ-008 in the Preparation of Prickly Pear Residue Fermented Feed (1) Preparation of prickly pear pomace fermentation powder: Prickly pear pomace culture medium was prepared using prickly pear pomace as raw material. Chickpea flour was added at 10% of the prickly pear culture medium mass and mixed. Water was added to a substrate moisture content of 83%. The mixture was then pressure-cooked at 121℃ and 0.1MPa for 20 minutes to obtain the fermentation medium. 6% of the space brewing yeast CEGF-TKJ-008 seed liquid was inoculated and fermented at 37℃ for 40 hours to obtain prickly pear pomace fermented product. After fermentation, the prickly pear pomace fermented product was dried at 60℃ to constant weight, pulverized, and passed through an 80-mesh sieve to obtain prickly pear pomace fermentation powder.

[0094] (2) Preparation of fermented prickly pear residue feed: The fermented prickly pear residue powder and the basic feed powder (maintenance feed for rats and mice from Wuhan Wanqianjiaxing Biotechnology Co., Ltd.) are mixed according to the feeding amount of the mice (the daily food intake of the mice is weighed in advance, and the fermented prickly pear residue is prepared according to the food intake of the mice and the preset concentration of fermented prickly pear residue to be ingested by the mice). After uniform mixing, an appropriate amount of water is added, and the mixture is made into pellets of uniform shape and size through a small feed pelleting machine. After low-temperature drying, it is ready for use, which is the fermented prickly pear residue feed. Note that the prepared fermented prickly pear residue feed should not have significant differences in appearance and physical properties from the basic feed.

[0095] (3) Animal experiments Laboratory animals: SPF-grade healthy male C57BL / 6J mice, 6-8 weeks old, weighing 18-22g. Standard SPF-grade animal room (temperature 22±2℃, humidity 50±10%, 12 / 12-hour light / dark cycle), with free access to water.

[0096] After a one-week acclimatization period, the mice were weighed and their initial weight was recorded. They were fed according to the experimental group design, with 12 mice in each group for 14 days. The experimental groups are as follows: Control group: Mice were fed a standard diet (maintenance diet for rats and mice from Wuhan Wanqianjiaxing Biotechnology Co., Ltd.); Based on the mice's food intake, the fermentation group mixed prickly pear residue fermentation powder into the mice's regular feed (maintenance feed for rats and mice from Wuhan Wanqianjiaxing Biotechnology Co., Ltd.) and fed them daily. The fermented prickly pear residue feed was prepared according to the mice's daily food intake and the predetermined concentration of fermented prickly pear residue ingested by the mice, ensuring that the daily concentration of prickly pear residue fermentation powder ingested by the mice reached 1g / kg, 2g / kg, and 4g / kg. The mice's food intake was re-weighed weekly, and new feed containing prickly pear residue fermentation powder was prepared to ensure the accuracy of the concentration of prickly pear residue fermentation powder ingested by the mice.

[0097] Long-term observation of feeding behavior was conducted from the start of the experiment, and the food intake of mice was measured at fixed times each week. The average food intake of each mouse was recorded weekly and calculated using the following formula: Average food intake (g / d) = (AB) / (C × D); In the formula: A is the total feed weight in a week, g; B is the feed weight remaining on the day of recording, g; C is the feeding time, d; D is the number of mice per cage, mice.

[0098] Independent samples t-tests were used to compare whether there were significant differences in average daily feed intake and weight gain between the control and fermentation groups of mice, with a significance level set at P < 0.05. During the experiment, the body weight of mice in each group was measured on days 0, 7, and 14, and weight change curves were plotted using the average body weight. The results are shown below. Figure 10 As shown, the average daily food intake of mice in different groups is as follows: Figure 11 As shown.

[0099] Depend on Figure 10 and Figure 11It was observed that after a 14-day long-term feeding observation, mice fed with feed supplemented with prickly pear residue fermented powder showed significantly higher daily food intake and weight gain than mice fed with ordinary feed in the control group. Furthermore, their weight increased with increasing amounts of prickly pear residue fermented powder. Compared to the control group, the food intake of mice in each fermentation group was significantly increased (p < 0.01), and the food intake also increased with increasing concentration of the prickly pear residue fermented powder, indicating that adding the prickly pear residue fermented powder to the feed significantly improves the food intake of mice. This suggests that the prickly pear residue fermented product has a certain appetite-stimulating effect, and adding it as a feed additive can promote appetite and increase the food intake of mice. The speculated reason may be that fermentation of the prickly pear residue using space-brewed brewing yeast CEGF-TKJ-008 reduces the acidity of the prickly pear residue, effectively improving its palatability, thereby improving the taste of the feed, stimulating appetite, and leading to increased food intake in mice.

[0100] Those skilled in the art will readily understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A space-brewed brewing yeast CEGF-TKJ-008, characterized in that, Its accession number is CCTCC NO: M 2025504, and its classification name is... Saccharomyces cerevisiae CEGF-TKJ-008, deposited on March 17, 2025.

2. A fermentation agent for prickly pear residue, characterized in that, Includes the space-brewed brewing yeast CEGF-TKJ-008 as described in claim 1, wherein the space-brewed brewing yeast CEGF-TKJ-008 is obtained by space mutagenesis of brewing yeast CESWGF002 with accession number CCTCC NO: M 20231513.

3. A fermented product of prickly pear residue, characterized in that, The substrate was obtained by fermenting prickly pear pomace using the space brewing yeast CEGF-TKJ-008 as described in claim 1 as the fermentation agent. The substrate included prickly pear pomace and a nitrogen source, wherein the nitrogen source included chickpeas.

4. The prickly pear residue fermented product as described in claim 3, characterized in that, The chickpeas account for 10% to 50% of the mass of the prickly pear pomace culture medium.

5. The prickly pear residue fermented product as described in claim 4, characterized in that, It is prepared according to the following method: The substrate was prepared by mixing nitrogen source in a ratio of 10% to 50% of the total mass of prickly pear residue and water. The substrate was then fermented using the space brewing yeast CEGF-TKJ-008 as described in claim 1 as the fermentation agent. The fermentation temperature was 30 to 40°C.

6. The prickly pear residue fermented product as described in claim 5, characterized in that, The nitrogen source is chickpeas, which account for 10% of the mass of the prickly pear pomace culture medium. The prickly pear pomace fermentation agent is the space brewing yeast CEGF-TKJ-008 as described in claim 1.

7. The prickly pear residue fermented product as described in claim 6, characterized in that, Inoculate with 8%~10% of the space-brewed brewing yeast CEGF-TKJ-008 and ferment at 30~40℃ for 40h~72h to obtain the product.

8. The application of the space brewing yeast CEGF-TKJ-008 as described in claim 1 in the preparation of prickly pear residue fermented feed.

9. The application as described in claim 8, characterized in that, It is used to prepare fermented prickly pear residue feed that stimulates appetite.

10. The application as described in claim 9, characterized in that, The prickly pear residue fermented feed includes prickly pear residue fermented material and basic feed. The prickly pear residue fermented material is obtained using the space brewing yeast CEGF-TKJ-008 fermentation substrate as described in claim 1. The substrate includes prickly pear residue and chickpeas. The chickpeas account for 10% to 50% of the mass of the prickly pear residue culture medium.

Images