A high-efficiency heart-specific promoter, a recombinant vector containing the same and use thereof

By tandemly linking the mouse troponin 2 motif CS-CRM4 upstream of the chicken-derived cardiac troponin T promoter, the cTnTplus promoter was constructed, solving the problems of low transcriptional activity and liver leakage of the cTnT promoter and achieving efficient and safe gene expression in cardiomyocytes.

CN122357553APending Publication Date: 2026-07-10SHANDONG VIGENE BIOSCI INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610805936.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-05
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

The existing cardiac troponin T promoter (cTnT) has problems such as low transcriptional activity and leakage of the target gene in non-target tissues such as the liver when high doses are injected, which cannot meet the requirements for efficient and safe gene expression.

Method used

By tandemly linking the cis-regulatory motif CS-CRM4 of the mouse myotropin 2 gene upstream of the chicken cardiac troponin T promoter core sequence, a chimeric promoter cTnTplus was constructed, which enhanced the recruitment efficiency and transcription initiation frequency of the cardiomyocyte transcription factor complex, while reducing ectopic expression in the liver.

Benefits of technology

It significantly improves transcriptional activity in cardiomyocytes, reduces liver leakage, and provides a more efficient and safer heart-specific gene expression tool, suitable for gene therapy of heart disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122357553A_ABST
    Figure CN122357553A_ABST
Patent Text Reader

Abstract

This invention discloses a highly efficient heart-specific promoter, a recombinant vector containing this promoter, and their applications. The highly efficient heart-specific promoter cTnTplus provided by this invention contains the core sequence of the chicken-derived cardiac troponin T promoter and the mouse troponin 2 gene cis-regulatory motif CS-CRM4 tandemly upstream of it. This motif functions as an enhancer element. In vitro infection of rat H9C2 cardiomyocytes showed that the eGFP fluorescence intensity driven by the cTnTplus promoter was significantly higher than that of the original cTnT promoter. In vivo, after tail vein injection of AAV virus, the eGFP expression of the cTnTplus promoter in mouse hearts was significantly increased compared to the cTnT promoter, and no obvious fluorescence was observed in liver tissue, indicating a significant reduction in liver leakage. The promoter provided by this invention possesses both high transcriptional activity and myocardial specificity, providing a safe and efficient tool for cardiac gene therapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a highly efficient heart-specific promoter, a recombinant vector containing the promoter, and their applications. Background Technology

[0002] Promoters are core elements of gene transcription regulation. They precisely locate transcription initiation sites by containing specific binding sites for RNA polymerases and transcription factors, thereby regulating the efficiency of gene transcription initiation. In the fields of cardiac research and gene therapy, achieving efficient and specific expression of exogenous genes in cardiomyocytes is a key prerequisite for the successful treatment of heart diseases.

[0003] Currently, the most widely used cardiomyocyte-specific promoter is the cardiac troponin T promoter (cTnT). This promoter can drive the efficient and specific expression of the target gene in cardiomyocytes, while its expression level is extremely low or non-existent in other tissues such as liver and skeletal muscle. Therefore, it is widely used in cardiac development research, disease model construction, and gene therapy vector design.

[0004] However, the cTnT promoter has inherent defects. Prasad et al. (see [Prasad KM, Xu Y, Yang Z, et al. Robust cardiomyocyte-specific gene expression following systemic injection of AAV: in vivo gene delivery follows a Poisson distribution. GeneTher., 2011, 18(1): 43-52.]) showed that even with an AAV vector system driven by the cTnT promoter, target gene expression could still be detected in non-myocardial tissues (especially the liver) after intravenous injection, indicating ectopic expression (liver leakage). Furthermore, the transcriptional activity of the cTnT promoter is relatively low, and for therapeutic genes requiring high levels of expression (such as gene editing enzymes, ion channel proteins, or growth factors), the cTnT promoter often cannot provide sufficient transcriptional efficiency.

[0005] To overcome these shortcomings, researchers have attempted to enhance promoter expression intensity and tissue specificity by optimizing promoter sequences. Rincon et al. (see [Rincon MY, Sarcar S, Danso-Abeam D, et al. Genome-wide computational analysis reveals cardiomyocyte-specific transcriptional cis-regulatory motifs that enable efficient cardiac gene therapy. Mol. Ther.,2015, 23(1): 43-52.]) identified cardiomyocyte-specific transcriptional cis-regulatory motifs through genome-wide computational analysis and combined them with heart-specific promoters, resulting in a significant enhancement of cardiac gene expression. However, the enhancer elements used in this strategy still exhibit some degree of liver leakage, failing to completely resolve the issue of non-target tissue expression under high-dose injections. Furthermore, the introduction of exogenous enhancer elements increases the complexity of the vector sequence, and improper selection may introduce additional off-target risks.

[0006] Therefore, developing an enhancer element that combines high transcriptional activity with strict heart specificity and does not increase the risk of liver leakage remains a technical problem that urgently needs to be solved in this field. Summary of the Invention

[0007] The purpose of this invention is to provide a highly efficient heart-specific promoter, a recombinant vector containing this promoter, and their applications. The highly efficient heart-specific promoter obtained through this invention can solve the technical problems of insufficient expression intensity and liver leakage of existing cTnT promoters.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: The first objective of this invention is to provide a highly efficient heart-specific promoter, named cTnTplus, which contains a chicken-derived cardiac troponin T promoter core sequence and a cis-regulatory motif CS-CRM4 of the mouse myotropin 2 gene tandemly upstream therefrom, wherein the cis-regulatory motif CS-CRM4 functions as an enhancer element. The core sequence of the chicken cardiac troponin T promoter is the full-length sequence of the wild-type chicken cardiac troponin T promoter, or a truncated version derived from it that maintains promoter activity.

[0009] A second objective of the present invention is to provide a recombinant expression cassette comprising the promoter described above, and a target gene operatively linked to the promoter.

[0010] Preferably, the target gene is a reporter gene or a therapeutic gene.

[0011] Preferably, it also includes a chimeric intron located downstream of the promoter.

[0012] Preferably, the chimeric intron is a β-globin / IgG chimeric intron.

[0013] Preferably, the nucleotide sequence of the recombinant expression cassette is shown in SEQ ID NO.4.

[0014] Another object of the present invention is to provide a recombinant expression vector comprising the above-described recombinant expression cassette.

[0015] Preferably, the recombinant expression vector is an AAV vector, and the serotype of the AAV vector is AAV2-Myo2A, MYO, AAV9, or AAV-Myo1A.

[0016] Another object of the present invention is to provide an AAV virus particle, which is obtained by packaging the above-described recombinant vector.

[0017] Another object of the present invention is to provide the application of the above-mentioned highly efficient heart-specific promoter, recombinant expression cassette, recombinant expression vector or AAV viral particles in the preparation of gene drugs for treating heart diseases.

[0018] The design concept or principle of this invention: To address two major technical challenges in cardiac gene therapy—low transcriptional activity of the existing cardiac troponin T promoter (cTnT) and leakage of the target gene in non-target tissues such as the liver during high-dose injection—the inventors conducted a systematic sequence optimization study. Through bioinformatics analysis of cardiac-specific cis-regulatory modules in the genome, combined with in vitro cardiomyocyte reporter gene screening, the inventors discovered a non-coding conserved sequence located between 92535 bp and 192722 bp on mouse chromosome 3. This sequence is rich in GATA4 and NKX2. It binds to myocardial-enriched transcription factors such as 5 and MEF2, and exhibits almost no transcriptional activation ability in liver-derived cell lines, demonstrating a strict cardiomyocyte preference.

[0019] Based on the above findings, the inventors directly fused the aforementioned enhancer element upstream of the chicken-derived cTnT core promoter to construct a chimeric promoter. Its mechanism of action is as follows: the enhancer element recruits cardiomyocyte-specific transcription factor complexes, which interact with the cTnT core promoter through chromatin cyclization, thereby significantly increasing the recruitment efficiency of RNA polymerase II and the transcription initiation frequency. Simultaneously, since the enhancer element itself is inactive in hepatocytes, it does not additionally increase ectopic expression in the liver. Experimental results show that, compared with the wild-type cTnT promoter, the promoter modified in this invention exhibits significantly enhanced transcriptional activity in cardiomyocytes. In vivo, after AAV tail vein injection, expression in cardiac tissue is significantly enhanced, with extremely low liver leakage.

[0020] In summary, this invention, by fusing a myocardial-specific enhancer element with a chicken-derived cTnT core promoter, simultaneously enhances transcriptional activity and significantly reduces ectopic expression in the liver, providing a more efficient and safer promoter tool for cardiac gene therapy.

[0021] Compared with the prior art, the present invention has the following beneficial effects: (1) The transcriptional activity of the highly efficient heart-specific promoter of the present invention is significantly improved. In cardiomyocytes, the expression intensity of the eGFP reporter gene driven by the modified cTnTplus promoter of the present invention is significantly improved compared with the wild-type cTnT promoter.

[0022] (2) The efficient heart-specific promoter adenovirus vector constructed in this invention has enhanced tissue specificity. In vivo functional verification experiments show that after the AAV vector is injected via the tail vein, the leakage expression in the liver is significantly reduced, and the heart / liver expression ratio is significantly increased compared with the cTnT promoter.

[0023] (3) The modified cTnTplus promoter of this invention can reduce the risk of hepatotoxicity and off-target effects caused by high-dose injection, improve safety, and is more suitable for clinical translation. Attached Figure Description

[0024] Figure 1 This is a schematic diagram of the structure of the highly efficient heart-specific promoter cTnTplus of the present invention; Figure 2 The plasmid map of the adeno-associated virus (AAV) vector pAAV-promoter-eGFP-WPRE-SV40; Figure 3 This is a plasmid map of the adenovirus (ADV) vector pADM-promoter-eGFP; Figure 4 These are fluorescence micrographs of rat cardiomyocytes infected with pADM-cTnT-eGFP adenovirus; among them, Figure 4(A) in the image is an eGFP fluorescence diagram. Figure 4 (B) in the diagram represents the state of bright-field cells; Figure 5 This is an image of eGFP fluorescence in rat cardiomyocytes after infection with pADM-cTnTplus-eGFP adenovirus; Figure 6 The image shows a fluorescence micrograph of pAAV-cTnT-eGFP-WPRE-SV40 AAV virus injected into the heart of a mouse via the tail vein; where, Figure 6 (A) in the image is the eGFP fluorescence diagram. Figure 6 (B) in the diagram is a bright-field diagram; Figure 7 The image shows a fluorescence micrograph of the pAAV-cTnTplus-eGFP-WPRE-SV40 AAV virus injected into the heart of a mouse via the tail vein; among them, Figure 7 (A) in the image is the eGFP fluorescence diagram. Figure 7 (B) in the diagram is a bright-field diagram; Figure 8 Bar chart showing the quantitative analysis of eGFP fluorescence intensity of pAAV-cTnT-eGFP-WPRE-SV40 and pAAV-cTnTplus-eGFP-WPRE-SV40 AAV viruses in cardiac tissue; Figure 9 The image shows a fluorescence micrograph of the pAAV-cTnT-eGFP-WPRE-SV40 AAV virus injected into the liver of mice via the tail vein; among them, Figure 9 (A) in the image is an eGFP fluorescence diagram. Figure 9 (B) in the diagram is a bright-field diagram; Figure 10 The images show fluorescence micrographs of pAAV-cTnTplus-eGFP-WPRE-SV40 AAV virus injected into mouse livers via the tail vein; among them, Figure 10 (A) in the image is an eGFP fluorescence diagram. Figure 10 (B) in the diagram is the bright field diagram. Detailed Implementation

[0025] Unless otherwise specified, the experimental methods described in the following embodiments of the present invention are generally performed under conventional conditions or as recommended by the manufacturer. All commonly used chemical reagents used in the embodiments are commercially available products.

[0026] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that these descriptions are merely exemplary and not intended to limit the scope of the invention. Furthermore, descriptions of well-known structures and technologies are omitted in the following description to avoid unnecessarily obscuring the concepts of the invention.

[0028] The following embodiments further describe the present invention, but these embodiments are not intended to limit the scope of protection of the present invention.

[0029] 1. Raw materials and reagents: The restriction endonuclease BcuI was purchased from Thermo Fisher Scientific, model FD1254; the restriction endonuclease KpnI was purchased from Thermo Fisher Scientific, model FD0524; the agarose gel recovery kit was purchased from OMEGA, model D2500-02; the high-fidelity amplification enzyme was purchased from Nanjing Novizan Biotechnology Co., Ltd., model P521-d1; the T4... DNA ligase was purchased from Thermo Fisher Scientific, model EL0012; ampicillin sodium was purchased from Beijing Solarbio Science & Technology Co., Ltd., model A8180; the *E. coli* DH5α chemocompetent cells were prepared in-house by Weizhen Biotechnology; the 24-well culture plate was purchased from NEST Biotechnology, model 702001; the rat cardiomyocytes H9C2 were purchased from ATCC; the HEK293T cells were purchased from ATCC; the SPF-grade C57BL / 6J mice were purchased from Spifort (Beijing) Biotechnology Co., Ltd.; the paraformaldehyde (PFA) was purchased from Biosharp, model BL539A; and the sucrose was purchased from Sinopharm Group (Shanghai). The analytical grade (AR) sucrose, model 10021418; the OCT embedding agent was purchased from SAKURA, model 4583; the pAAV-promoter-eGFP-WPRE-SV40 vector backbone was purchased from Weizhen Biotechnology Co., Ltd., model pAV100004-OE; the pADM-promoter-eGFP vector backbone was purchased from Weizhen Biotechnology Co., Ltd., model pAD100009-OE; the helper plasmid AD5F35 was owned by Weizhen Biotechnology Co., Ltd.; and the AAV capsid plasmid (Myo2A serotype) was owned by Weizhen Biotechnology Co., Ltd.

[0030] 2. Equipment and Instruments: The cryostat was purchased from Leica Biosystems, model Leica CM1950 (1405201950); the fluorescence microscope was purchased from Nikon, model TS2R-FL.

[0031] Example 1: Construction of the promoter and recombinant expression cassette 1.1 Enhancer element: The enhancer element used in this invention is derived from the cis-regulatory motif CS-CRM4 of the mouse myocalcin 2 gene in the region from 92535bp to 192722bp on mouse chromosome 3. It functions as an enhancer element, and its nucleotide sequence is shown in SEQ ID NO.1.

[0032] ACAGAGCAAGAGCCAGGCACGGGCTGGGAGGCCAAGCCCTAGATACCTTACATAGCTCTCCCAGCCTCTGTCTCATTAAGAACTCCATTTTTAGGATGCAGTTGTTTCGAGCTAAAAATAAATCATGCAATGAATAATAATTTTTTTTAAAAAAAAAGTCAGATATGACACTGTTGAGGGATTTGTCC (SEQ ID NO. 1).

[0033] 1.2 cTnT core promoter: The core sequence of the chicken cardiac troponin T promoter used in this invention is derived from the region from -269bp upstream to +38bp downstream of its gene transcription start site, corresponding to the sequence shown at positions 612310 to 612620 on chromosome 26 in GenBank accession number NC_052557.1 (reference: Characterization of a Promoter Element Required for Transcription in Myocardial Cell, PMID:1993702), and its nucleotide sequence is shown in SEQ ID NO.2.

[0034] (SEQ ID NO.2).

[0035] 1.3 Chimeric Intron Element: The recombinant expression cassette of this invention also includes a chimeric intron, which is a β-globin / IgG chimeric intron derived from the pCI mammalian expression vector from Promega. This intron is located downstream of the aforementioned chicken cTnT core promoter sequence and is used to enhance the post-transcriptional processing and expression level of downstream genes. Its nucleotide sequence is shown in SEQ ID NO.3.

[0036] GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGTGT (SEQ ID NO. 3).

[0037] 1.4 Construction of Recombinant Expression Cassettes All the above sequences were prepared by Vigen Biotech Co., Ltd. using whole-genome synthesis. The structure of the cTnTplus promoter of this invention is as follows: Figure 1 As shown, the core sequence of the chicken cardiac troponin T promoter was first synthesized, and the CS-CRM4 enhancer sequence was linked upstream of it to obtain the modified promoter fragment, named cTnTplus.

[0038] The promoter fragment described above was linked to a β-globin / IgG chimeric intron to obtain a recombinant expression cassette. The nucleotide sequence of the recombinant expression cassette is shown in SEQ ID NO.4. The intron's function is to enhance the stability and nuclear exit efficiency of downstream gene mRNA, thereby increasing protein expression levels.

[0039] The synthesized recombinant expression cassette was cloned into the AAV backbone vector for subsequent recombinant expression vector construction and functional verification experiments.

[0040] ACAGAGCAAGAGCCAGGCACGGGCTGGGAGGCCAAGCCCTAGATACCTTACATAGCTCTCCCAGCCTCTGTCTCATTAAGAACTCCATTTTTAGGATGCAGTTGTTTCGAGCTAAAAATAAATCATGCAATGAATAATAATTTTTTTTAAAAAAAAAGTCAGATATGACACTGTTGAGGGATTTGTCCGCCCTTACGGGCCCCCCCTCGAGGTCGGGATAAAAGCAGTCTGGGCTTTCACATGACAGCATCTGGGGCTGCGGCAGAGGGTCGGGTCCGAAGCGCTGCCTTATCAGCGTCCCCAGCCCTGGGAGGTGACAGCTGGCTGGCTTGTGTCAGCCCCTCGGGCACTCACGTATCTCCGTCCGACGGGTTTAAAATAGCAAAACTCTGAGGCCACACAATAGCTTGGGCTTATATGGGCTCCTGTGGGGGAAGGGGGAGCACGGAGGGGGCCGGGGCCGCTGCTGCCAAAATAGCAGCTCACAAGTGTTGCATTCCTCTCTGGGCGCCGGGCACATTCCTGCTGGCTCTGCCCGCCCCGGGGTGGGCGCCGGGGGGACCTTAAAGCCTCTGCCCCCCAAGGAGCCCTTCCCAGACAGCCGCCGGCACCCACCGCTCCGTGGGACGATCCCCGAAGCTCTAGAGCTTTATTGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTCGTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGTGT (SEQ ID NO.4).

[0041] 1.5 Construction of Adeno-associated Virus AAV Vector and Adenovirus ADM Vector (1) Vector Digestion The adeno-associated virus (AAV) vector backbone used in this embodiment is pAAV-promoter-eGFP-WPRE-SV40 (see diagram). Figure 2 The adenovirus (ADV) vector backbone is pADM-promoter-eGFP (see diagram). Figure 3 Both vectors mentioned above carry the eGFP reporter gene, with a multiple cloning site upstream of it.

[0042] The two vectors were double-digested using restriction endonucleases BcuI (Thermo Fisher FD1254) and KpnI (Thermo Fisher FD0524), creating two nicks upstream of the eGFP gene to allow for insertion of the cTnTplus promoter fragment.

[0043] The enzyme digestion system is as follows: Table 1 Enzyme digestion system

[0044] The above system was incubated at 37°C for 1 hour. After the reaction, agarose gel electrophoresis was performed, and the band containing the carrier backbone was cut off. The carrier band was recovered using a gel recovery kit (OMEGA, catalog number D2500-02) for later use.

[0045] (2) Amplification and recovery of cTnTplus promoter fragment The cTnTplus promoter fragment was obtained by overlapping extension PCR of the enhancer element and the cTnT core promoter, so that the enhancer is directly tandemly linked to the 5' end of the cTnT promoter to enhance the transcriptional activity of the cTnT promoter, and finally the modified, highly efficient heart-specific promoter fragment cTnTplus was obtained.

[0046] First, the enhancer fragment was amplified using primer pair F1 / R1, and the cTnT core promoter fragment was amplified using primer pair F2 / R2. The primer sequences are as follows: Sequence information of primer F1 (5'→3'): GAGTACTAGTACAGAGCAAGAGCCAGGCACGGG (SEQ ID NO.5); Sequence information of primer R1 (5'→3'): CGAGGGGGGGCCCGTAAGGGCGGACAAATCCCTCAACAGTGT (SEQ ID NO.6); Sequence information of primer F2 (5'→3'): ACACTGTTGAGGGATTTGTCCGCCCTTACGGGCCCCCCCTCG (SEQ ID NO.7); Sequence information of primer R2 (5'→3'): GAGTGGTACCACACCTGTGGAGAGAAAGGC (SEQ ID NO.8).

[0047] The sequences R1 and F2 are designed to be completely inversely complementary for subsequent overlapping extension.

[0048] After recovering the PCR amplification products from steps (1) and (2), they were mixed in equal molar amounts as templates. Primers F1 and R2 were used as primers for full-length amplification, and a second amplification was performed. The full-length cTnTplus promoter fragment was obtained through an overlap extension reaction.

[0049] The overlap extension PCR products were sent to Qingke Biotechnology for sequencing verification. The cTnTplus fragment with the confirmed correct sequence was used for subsequent experiments.

[0050] All amplifications above used the high-fidelity amplification enzyme Novizan P521-d1. The amplification system and procedure are as follows: Table 2 Amplification System

[0051] Amplification program: pre-denaturation at 98℃ for 30 seconds; then 28-35 cycles, each cycle consisting of denaturation at 98℃ for 10 seconds, annealing at 58℃ for 5 seconds, extension at 72℃ for 15 seconds; after the cycle, complete extension at 72℃ for 1 minute.

[0052] The obtained cTnTplus final product was recovered and then double-digested with BcuI (Thermo Fisher Scientific, FD1254) and KpnI (Thermo Fisher Scientific, FD0524) restriction endonucleases to produce sticky ends identical to those of the vector, which were used for subsequent ligation reactions.

[0053] (3) Connection The AAV vector backbone (pAAV-promoter-eGFP-WPRE-SV40) and adenovirus vector backbone (pADM-promoter-eGFP) recovered after enzyme digestion were ligated with the enzyme-digested cTnTplus fragment, respectively. The ligation system is as follows: Table 3 Connection System

[0054] The connection system was placed at 22°C and reacted for 1 hour.

[0055] (4) Transformation The ligation products obtained above were transformed into Escherichia coli DH5α chemically transformed competent cells and plated on LB plates with the corresponding resistance for screening.

[0056] The specific transformation steps are as follows: Remove the pre-prepared DH5a competent cells from -80℃ and place them in an ice bath. After the DH5a competent cells thaw, add 10 μL of the ligation product to 30 μL of DH5a competent cells, mix gently, and incubate on ice for 20 min. Then, place the centrifuge tube in a 42℃ metal bath for 1 min (do not shake the centrifuge tube during this time), then quickly transfer it to an ice bath and incubate for 2 min. Add 500 μL of sterile LB liquid medium (without antibiotics) to the centrifuge tube, mix well, and place it in a shaker at 37℃ and 200 rpm for 1 hour. The purpose is to express the relevant resistance marker gene on the plasmid and revive the bacteria. Spread an appropriate amount of revived bacteria onto ampicillin-resistant solid medium plates and incubate at 37℃ for 1 day. Clones will grow on the plates.

[0057] (5) Identification Spread the culture onto LB agar plates containing resistant ampicillin sodium (Solarbio, A8180) and incubate overnight at 37°C. Single colonies were picked for colony PCR identification; positive clones were sent for sequencing verification (Beijing Qingke Biotechnology Co., Ltd.). Sequencing primers are as follows: Sequence information of peGFP-N-3 primers: CGTCGCCGTCCAGCTCGACCAG (SEQ ID NO.9).

[0058] The plasmids that were verified to be correct were named pAAV-cTnTplus-eGFP-WPRE (AAV vector) and pADM-cTnTplus-eGFP (adenovirus vector).

[0059] Example 2: In vitro functional verification 2.1 Adenovirus Preparation 2.1.1 Amplification and purification of pADM-cTnTplus-eGFP adenovirus The constructed pADM-cTnTplus-eGFP recombinant adenovirus vector (carrying the modified cTnTplus promoter) and the control plasmid pADM-cTnT-eGFP (a plasmid owned by Vigen Biotech) carrying the original cTnT promoter were co-transfected with the helper plasmid AD5F35 (also owned by Vigen Biotech) into HEK293A cells (ATCC) for adenovirus packaging and amplification. Cells were collected after 3-5 days of culture, repeatedly lysed by freeze-thaw cycles, and the recombinant adenovirus was purified by CsCl density gradient centrifugation. Recombinant adenoviruses expressing the eGFP reporter gene driven by the cTnTplus promoter and the original cTnT promoter were obtained, respectively, and used for subsequent infection of rat H9C2 cardiomyocytes to compare the transcriptional activity of the two promoters.

[0060] 2.2 Adenovirus infection of rat cardiomyocytes H9C2 Rat cardiomyocytes H9C2 (purchased from ATCC) were routinely cultured in DMEM medium containing 10% fetal bovine serum (FBS) at 37°C in a 5% CO2 incubator. 24 hours before infection, H9C2 cells were cultured at a rate of 1×10⁻⁶ cells / cells. 5 Cells were seeded at a density of 1 cell per well in 24-well culture plates (NEST, 702001) and cultured until the cells reached 50%-60% confluence before adenovirus infection.

[0061] The pADM-cTnTplus-eGFP recombinant adenovirus and pADM-cTnT-eGFP recombinant adenovirus prepared above were added to cell culture wells at a multiplicity of infection (MOI) of 100 and gently mixed. After infection, the cells were cultured for another 48 hours, and the expression of eGFP was observed and photographed under a fluorescence microscope.

[0062] 2.3 Results The results are as follows Figure 4 (pADM-cTnT-eGFP infection group) and Figure 5 As shown in the pADM-cTnTplus-eGFP infection group, the eGFP fluorescence intensity in cardiomyocytes was significantly higher than that of the original cTnT promoter, indicating that the modified cTnTplus promoter has stronger transcriptional and translational activity in cardiomyocytes.

[0063] Example 3: In vivo functional verification 3.1 AAV virus packaging and injection The pAAV-cTnT-eGFP-WPRE (control group) and pAAV-cTnTplus-eGFP-WPRE (experimental group) vectors were co-transfected with helper plasmids and capsid plasmids (Myo2A serotype) into HEK293T cells (ATCC, CRL-3216) to package AAV virus. The virus was purified by iodixanol density gradient centrifugation, and the viral titer was determined by qPCR.

[0064] Six-week-old male SPF-grade C57BL / 6J mice (weighing 20-23g, purchased from Spiford (Beijing) Biotechnology Co., Ltd.) were used, with two mice per group. The experimental group received a tail vein injection of AAV-cTnTplus-eGFP-WPRE virus (5 × 10⁻⁶). 11 (Number of particles / animal), the control group was injected with AAV-cTnT-eGFP-WPRE virus (same dose), and the blank group was injected with an equal volume of PBS.

[0065] 3.2 Tissue sampling and sectioning Three weeks after injection, mice were anesthetized with isoflurane and perfused with 50 mL of physiological saline via the left ventricle, followed by 50 mL of 4% paraformaldehyde (PFA). Heart and liver tissues were harvested and fixed overnight in PFA at 4°C. Subsequently, they were dehydrated sequentially with 20% sucrose and 30% sucrose, embedded in OCT, and frozen at -80°C. The cryostat chamber temperature was -25°C, the freeze head temperature was -20°C, the section thickness was 10 μm, and the sections were stored at -20°C after mounting.

[0066] 3.3 Fluorescence Observation and Quantitative Analysis Tissue sections were observed and photographed under a fluorescence microscope. The mean fluorescence intensity was analyzed using ImageJ software, and the mean and standard deviation of fluorescence intensity for each group were calculated.

[0067] 3.4 Results like Figure 6-8 As shown, this experiment is a preliminary verification. The results show that the eGFP fluorescence intensity in cardiac tissue of the cTnTplus promoter group (102.44±16.03) is significantly higher than that of the cTnT promoter group (42.47±3.19), indicating that the cTnTplus promoter has stronger heart-specific initiation activity. Figure 9-10 As shown, no obvious fluorescence was observed in liver tissue of the cTnTplus promoter group, indicating that the modified promoter has stricter myocardial specificity and significantly reduced liver leakage.

[0068] In summary, this invention successfully constructed a highly efficient heart-specific promoter, cTnTplus, by fusing the cis-regulatory motif CS-CRM4 of the mouse Casq2 gene as an enhancer element upstream of the core sequence of the chicken-derived cardiac troponin T (cTnT) promoter. In vitro functional validation showed that the fluorescence expression intensity of the cTnTplus-driven eGFP reporter gene in rat H9C2 cardiomyocytes was significantly higher than that of the original cTnT promoter, demonstrating stronger transcriptional activity. In vivo AAV-mediated gene delivery experiments further confirmed that, after tail vein injection, the cTnTplus-driven eGFP expression level in mouse heart tissue was approximately 2.4 times higher than that of the cTnT promoter, and no significant fluorescence was detected in liver tissue, indicating a significant reduction in ectopic expression in the liver. Furthermore, the constructed adenovirus vector also exhibited excellent promoter ability in cardiomyocytes. The above results demonstrate that the cTnTplus promoter provided by this invention has higher cardiomyocyte transcriptional activity and more stringent tissue specificity, effectively solving the technical problems of insufficient expression intensity and liver leakage of existing cTnT promoters, and providing a safe and efficient tool for gene therapy of heart disease and basic cardiac research.

[0069] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in the present invention should still be covered by the claims of the present invention.

Claims

1. A highly efficient heart-specific promoter, named cTnTplus, characterized in that, It contains the chicken-derived cardiac troponin T promoter core sequence, and the cis-regulatory motif CS-CRM4 of the mouse myotropin 2 gene tandemly upstream therefrom, which functions as an enhancer element. The core sequence of the chicken cardiac troponin T promoter is the full-length sequence of the wild-type chicken cardiac troponin T promoter, or a truncated version derived from it that maintains promoter activity.

2. A recombinant expression cassette, characterized in that, It includes the promoter of claim 1, and a target gene operatively linked to the promoter.

3. The recombinant expression cassette according to claim 2, characterized in that, The target gene is a reporter gene or a therapeutic gene.

4. The recombinant expression cassette according to claim 2, characterized in that, It also includes a chimeric intron located downstream of the promoter.

5. The recombinant expression cassette according to claim 4, characterized in that, The chimeric intron is a β-globin / IgG chimeric intron.

6. The recombinant expression cassette according to claim 5, characterized in that, The nucleotide sequence of the recombinant expression cassette is shown in SEQ ID NO.

4.

7. A recombinant expression vector, characterized in that, It includes the recombinant expression cassette as described in any one of claims 2-6.

8. The recombinant expression vector according to claim 7, characterized in that, The recombinant expression vector is an AAV vector, and the serotype of the AAV vector is AAV9, AAV-Myo1A, AAV-Myo2A, or MYO.

9. An AAV virus particle, characterized in that, The viral particles are obtained by packaging the recombinant vector as described in claim 7 or 8.

10. The use of the highly efficient heart-specific promoter of claim 1, the recombinant expression cassette of claims 2-6, the recombinant expression vector of claims 7-8, or the AAV virus particle of claim 9 in the preparation of gene drugs for treating heart diseases.