Method for improving the combining ability of rice subspecies and breeding method

Abstract

The application provides a method for improving the hybridity of inter-subspecies combination of rice and a breeding method, and belongs to the technical field of genetic engineering breeding. The application provides a method for improving the hybridity of inter-subspecies combination of rice, which comprises the following steps: knocking out at least one site in the sterility site of inter-subspecies hybrid of D. subsp. non-cultivated rice S1 - OsORF6 and knocking out at least one site in the wide compatibility gene of rice S5 - ORF5 . The application finds that the gene knockout of each at least one site in the two genes of the sterility site of inter-subspecies hybrid of D. subsp. non-cultivated rice S1 - OsORF6 and the wide compatibility gene of rice S5 - ORF5 can improve the hybridity of inter-subspecies combination, thereby improving the hybrid seed setting rate of inter-subspecies, and has no influence on other traits.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering breeding technology, specifically relating to a method and breeding method for improving the fertility of interspecific combinations of rice subspecies. Background Technology

[0002] Cultivated rice is divided into Asian cultivated rice ( Oryza sativa L.) and African cultivated rice (L.) Oryza glaberrima There are two species of rice (Steus davidii) in Asia, including Indica and Japonica. Hybridization between Indica and Japonica rice produces strong heterosis, but due to reproductive isolation between the subspecies, the seed setting rate of the first-generation hybrids is low, severely impacting the application of heterosis in rice yield. Overcoming hybrid sterility between Indica and Japonica subspecies is crucial for utilizing heterosis in this field. Therefore, many scientists both domestically and internationally have conducted in-depth research on hybrid sterility, and more than 50 hybrid sterility loci have been identified, including 30 major and minor sterility loci; 11 genes have been cloned.

[0003] Rice hybrid sterility is influenced by a combination of factors, including male gamete abortion, female gamete abortion, and simultaneous abortion of both male and female gametes. To date, 11 genes regulating hybrid sterility in rice have been cloned, and the localization and cloning of these genes have laid a solid foundation for better utilizing heterosis.

[0004] S5 It is an important site for regulating the embryo sac fertility of indica-japonica hybrid rice. S5 Located between the pigmentogen gene C and the glutinous gene Wx on chromosome 6, this gene encodes an aspartic protease. Two SNPs in the coding regions of indica and japonica rice are the main causes of hybrid F1 sterility. Subsequent research has shown that the S5 locus is composed of three genes: ORF3, ORF4, and ORF5, which work together to regulate hybrid embryo sac fertility through a unique "killer-protector" system. In the F1 generation of indica-japonica hybrids, ORF4+ and ORF5+ work together to selectively kill japonica female gametes containing ORF3-, while indica female gametes are protected from sterility by ORF3+. Transcriptome analysis revealed that ORF5+, located in the intercellular space, can disrupt cell wall integrity and transduce a certain signaling molecule into the cell via ORF4+ located in the cell membrane, causing endoplasmic reticulum stress. The product HSP70, encoded by ORF3+, can eliminate endoplasmic reticulum stress and protect normal female gamete development. However, ORF3-, due to its loss of function, cannot play a role, leading to embryo sac abortion. A 136bp deletion at the N-terminus of the wide-compatibility gene S5-n alters its subcellular localization, thus enabling fertile offspring from hybridizations of wide-compatibility varieties with both indica and japonica rice.

[0005] S1 Gene loci are crucial sites for inducing simultaneous sterility of female and male gametes in hybrids of Asian and African rice, and their mechanism of action constitutes a "killer-protector" system. Studies have found that in F1 hybrids, the African rice allele (S1-g) leads to simultaneous sterility of female and male gametes carrying the Asian rice allele (S1-s). In 2017, a team pioneered the discovery and cloning of a key gene at the S1 locus in African rice that induces sterility. OgTPR1 (Subsequently named) S1TPR The gene encodes a protein containing a trypsin-like domain and a ribosomal biogenesis regulatory domain. Asian cultivated rice has a CA SNP in its fifth exon, causing premature translation termination and resulting in a protein containing only a trypsin-like polypeptide domain, named OgTP1. Subsequently, Japanese scientist Koide cloned it in 2018. S1 Another important gene at this site SSP He discovered that when S1mut Allele mutation, that is SSP When a 5bp deletion is present, the heterozygote S1mut / S1s There will be no sterility, complete SSP It is crucial for hybrid abortion. A 2019 study discovered alleles in African cultivated rice. S1-g Composed of three closely linked genes S1A4 , S1TPR and S1A6 ( SSP This forms a "killer-protector" system, where the three components work together to function as the killer, while... S1TPR It also plays a role in protecting African rice varieties. S1-g The role of type A in preventing gametes from aborting exhibits asymmetric genetic interactions.

[0006] Currently, there is limited research on the application of sterility loci, especially on using sterility loci to improve fertility. Summary of the Invention

[0007] This invention provides a method and breeding method for improving the fertility of hybrid combinations among rice subspecies, creating multi-gene directed mutations to achieve the cumulative effect of different gene loci, effectively improving hybrid seed setting.

[0008] This invention provides a method for improving interspecific hybrid fertility in rice, comprising the following steps: knocking out interspecific hybrid sterility loci in rice cultivated in sub-African regions. S1-OsORF6 At least one site in the gene, and knocking out the rice wide affinity gene S5-ORF5 At least one site in it.

[0009] In one specific embodiment of the present invention, the interspecific hybrid sterility locus of rice cultivated in sub-African regions is... S1-OsORF6 The knockout target sites include at least S1-OsORF6 Target site 1 and S1-OsORF6 Target site 2; The S1-OsORF6 The nucleotide sequence of target site 1 is shown in SEQ ID No. 1; The S1-OsORF6 The nucleotide sequence of target site 2 is shown in SEQ ID No. 2.

[0010] In one specific embodiment of the present invention, a rice wide-compatibility gene S5-ORF5 The knockout target sites include at least S5- ORF5 Target site 1 and S5-ORF5 Target site 2; The S5-ORF5 The nucleotide sequence of target site 1 is shown in SEQ ID No. 3; The S5-ORF5 The nucleotide sequence of target site 2 is shown in SEQ ID No. 4.

[0011] In one specific embodiment of the present invention, the heterosis locus between rice species in Asian and African rice cultivation is knocked out. S1-OsORF6 Two loci in the gene, and knocking out the rice broad affinity gene. S5-ORF5 Two sites in the middle.

[0012] In one specific embodiment of the present invention, the knockout includes two operations, each time knocking out one site of two genes.

[0013] This invention also provides an sgRNA genome, including loci targeting interspecific hybrid sterility in rice cultivated in Asia and Africa. S1- OsORF6 sgRNAs designed to knock out at least one target site in rice, and sgRNAs targeting broad-affinity genes in rice. S5-ORF5 sgRNA designed with at least one knockout target site.

[0014] In one specific embodiment of the present invention, for S1-OsORF6 The nucleotide sequences of the sgRNA designed for target site 1 are shown in SEQ ID No. 5 and SEQ ID No. 6; against S1-OsORF6 The nucleotide sequences of the sgRNA designed for target site 2 are shown in SEQ ID No. 7 and SEQ ID No. 8; The S1-OsORF6 The nucleotide sequence of target site 1 is shown in SEQ ID No. 1; The S1-OsORF6The nucleotide sequence of target site 2 is shown in SEQ ID No. 2.

[0015] In one specific embodiment of the present invention, for S5-ORF5 The nucleotide sequences of the sgRNA designed for target site 1 are shown in SEQ ID No. 9 and SEQ ID No. 10; against S5-ORF5 The nucleotide sequences of the sgRNA designed for target site 2 are shown in SEQ ID No. 11 and SEQ ID No. 12; The S5-ORF5 The nucleotide sequence of target site 1 is shown in SEQ ID No. 3; The S5-ORF5 The nucleotide sequence of target site 2 is shown in SEQ ID No. 4.

[0016] The present invention also provides a method for constructing rice parents, which includes knocking out two genes in the target rice using the above-mentioned sgRNA group to obtain rice parents.

[0017] The present invention also provides a rice breeding method, wherein the rice parent obtained by the above construction method is used to carry out rice breeding with a second rice parent.

[0018] Beneficial effects: This invention discovers the heterosis locus in interspecific hybrid rice cultivated in Asia and Africa. S1-OsORF6 Rice broad affinity genes S5-ORF5 Knocking out at least one site of each of the two genes can improve interspecific fertility, thereby increasing the fruit set rate of interspecific hybridization. This invention, through design... S1-OsORF6 and S5-ORF5 Gene knockout vectors were constructed based on the gene knockout target sites and genetically transformed into the water-saving and drought-resistant rice variety Huhan 7B. It was found that the loss of function of one or both of the above two genes could improve the seed setting rate of inter-subspecies hybridization. A total of 62 T0 generation transgenic plants were obtained, including 18 wild-type plants, 31 single mutant plants, and 13 double mutant plants, with a mutation rate of 71% and a total of 42 mutation types. Six T2 generation materials without hygromycin resistance were crossed with the typical japonica rice C418, and the seed setting rate of the F1 generation was investigated. The results showed that the seed setting rate of the F1 generation of C418 crossed with the two mutant types WN06-27 and WN07-31 was nearly 10% higher than that of the F1 generation of Huhan 7B crossed with C418. In response, the self-pollination seed setting rate of the two mutant plants and Huhan 7B was investigated. The results showed that there was no significant difference between the self-pollination seed setting rate of the two mutant plants and that of Huhan 7B, indicating that the two mutant types caused by knocking out this site can effectively improve the seed setting rate of the first generation of hybrids without causing other effects on the material. Attached Figure Description

[0019] Picture 1 Schematic diagram of the target site of the gene of the present invention; Picture 2 Iodine staining map of C418 / WN07-31 pollen; Picture 3 Iodine staining map of C418 / WNO6-27 pollen; Picture 4 Iodine staining map of C418 / HuHan 7B pollen; Picture 5 Summary sequence comparison map of the first group of WN06 numbered mutation types; Picture 6 Summary sequence comparison map of the second group of WN07 numbered mutation types. Detailed implementation manners

[0020] The present invention provides a method for improving the fertility of inter-subspecies combinations of rice, comprising the following steps: knocking out at least one site in the interspecific sterility locus between Asian and African cultivated rice subspecies, and knocking out at least one site in the wide compatibility gene of rice. S1-OsORF6 in S5-ORF5 in

[0021] As described in the present invention S1-OsORF6 The genomic sequence is as shown in SEQ ID No.21.

[0022] In one embodiment of the present invention, gene knockout is performed using target site 1 and S1-OsORF6 in the genomic sequence of S1-OsORF6 target site 1 and S1-OsORF6 target site 2 as target sites, wherein the nucleotide sequence of S1-OsORF6 target site 1 is as shown in SEQ ID No.1; the nucleotide sequence of S1-OsORF6 target site 2 is as shown in SEQ ID No.2.

[0023] S1-OsORF6 Target site 1 (SEQ ID No.1): CGAAATAATGGTCGAGACTG; S1-OsORF6 Target site 2 (SEQ ID No.2): AAATCGCAATGTTGTCGCAC.

[0024] As described in the present invention S5-ORF5 The genomic sequence is as shown in SEQ ID No.22.

[0025] In one embodiment of the present invention, gene knockout is performed using target site 1 and S5-ORF5 in the genomic sequence of S5-ORF5 target site 1 and S5- ORF5 target site 2 as target sites, wherein S5-ORF5 The nucleotide sequence of target site 1 is shown in SEQ ID No. 3; S5-ORF5 The nucleotide sequence of target site 2 is shown in SEQ ID No. 4.

[0026] S5-ORF5 Target site 1 (SEQ ID No. 3): GTAGCAGCTGCAGCTGCAAC; S5-ORF5 Target site 2 (SEQ ID No. 4): TGGTGCTTCTTGTGGAACAC.

[0027] This invention can knock out the simultaneous S1-OsORF6 and S5-ORF5, Each gene may have at least one knockout site. For example, in one embodiment of the present invention, two sites are knocked out of each gene. The present invention does not specifically limit the gene knockout method; conventional gene editing methods in the art can be used for gene knockout. In one embodiment, the CRISPR-Cas9 method is used for gene knockout, with two rounds of knockout, in which one site in each of the two genes is knocked out in each round.

[0028] This invention also provides an sgRNA genome, including loci targeting interspecific hybrid sterility in rice cultivated in Asia and Africa. S1- OsORF6 sgRNAs designed to knock out at least one target site in rice, and sgRNAs targeting broad-affinity genes in rice. S5-ORF5 sgRNA designed with at least one knockout target site.

[0029] This invention is aimed at S1-OsORF6 The nucleotide sequence of the sgRNA designed for target site 1 is shown in SEQ ID No. 5 and SEQ ID No. 6; targeting S1-OsORF6 The nucleotide sequence of the sgRNA designed for target site 2 is shown in SEQ ID No. 7 and SEQ ID No. 8. This invention targets... S5-ORF5 The nucleotide sequence of the sgRNA designed for target site 1 is shown in SEQ ID No. 9 and SEQ ID No. 10; targeting S5-ORF5 The nucleotide sequences of the sgRNA designed for target site 2 are shown in SEQ ID No. 11 and SEQ ID No. 12.

[0030] S1-OsORF6- 1F (SEQ ID No. 5): 5'-ggcaCGAAATAATGGTCGAGACTG-3'; S1-OsORF6- 1R (SEQ ID No. 6): 5'-aaacCAGTCTCGACCATTATTTCG-3'; S1-OsORF6- 2F (SEQ ID No. 7): 5'-ggcaAAATCGCAATGTTGTCGCAC-3'; S1-OsORF6- 2R (SEQ ID No. 8): 5'-aaacGTGCGACAACATTGCGATTT-3'.

[0031] S5-ORF5 -1F (SEQ ID No.9): 5'-ggcaGTAGCAGCTGCAGCTGCAAC-3'; S5-ORF5 -1R (SEQ ID No. 10): 5'-aaacGTTGCAGCTGCAGCTGCTAC-3'; S5-ORF5 -2F (SEQ ID No. 11): 5'-ggcaTGGTGCTTCTTGTGGAACAC-3'; S5-ORF5 -2R (SEQ ID No. 12): 5'-aaacGTGTTCCACAAGAAGCACCA-3'.

[0032] To detect the mutation type after knockout of each sgRNA gene, primer pairs for detecting the mutation type were designed, as shown below: S1-OsORF6 -F1 (SEQ ID No.13): TGCTACGACCAAACACCATGA; S1-OsORF6 -R1 (SEQ ID No.14): CCCATCAACAGAAAGAAGCGG; S1-OsORF6 -F2 (SEQ ID No.15): TCCTAAGTTACCATCCTCCATGT; S1-OsORF6 -R2 (SEQ ID No. 16): CAGTGATCAGATTTAAACAGCACCTTA; S5-ORF5 -F1 (SEQ ID No.17):ATGGTGATCTTGGAGCAGCC; S5-ORF5 -R1 (SEQ ID No.18): TACTACTACACGCGGCTTCG; S5-ORF5 -F2 (SEQ ID No.19): TGCTCTGATATTGTAATTGTGGC; S5-ORF5 -R2 (SEQ ID No. 20): GCCATTAGGAACAGGAAGTCGT.

[0033] The present invention also provides a method for constructing rice parents, which includes knocking out two genes in the target rice using the above-mentioned sgRNA group to obtain rice parents.

[0034] This invention involves two rounds of gene knockout. The first round involves knockout... S1-OsORF6 and S5-ORF5 One site from each of the two genes was knocked out in the second round. S1-OsORF6 and S5-ORF5 Another site of the two genes, for example, in the first round of knockout, utilizes S1-OsORF6- 1F (SEQ ID No. 5) S1-OsORF6- 1R (SEQ ID No. 6) S5-ORF5 -1F (SEQ ID No. 9) and S5-ORF5 The combination of -1R (SEQ ID No. 10) is used; during the second round of knockout, the combination of -1R (SEQ ID No. 10) is used. S1-OsORF6- 2F (SEQ ID No. 7) S1-OsORF6- 2R (SEQ ID No. 8) S5-ORF5 -2F (SEQ ID No. 11) and S5-ORF5 The combination of -2R (SEQ ID No. 12) is used.

[0035] In one embodiment of the present invention, water-saving and drought-resistant rice Huhan 7B was used as a host for genetic transformation, and parental materials with improved inter-subspecies fertility were obtained.

[0036] The present invention also provides a rice breeding method, wherein the rice parent obtained by the above construction method is used to carry out rice breeding with a second rice parent.

[0037] The present invention does not specifically limit the type of the second rice parent, which can be a conventional japonica rice variety or a japonica rice variety that has undergone the same gene knockout operation as described above.

[0038] The present invention does not specifically limit the specific breeding method of the rice breeding, which can be one or a combination of hybridization, test cross, back cross and self-cross.

[0039] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a method and breeding method for improving inter-subspecies fertility of rice provided by the present invention, should not be construed as limiting the scope of protection of the present invention.

[0040] Unless otherwise specified, the materials used in the embodiments of this invention are all conventional commercially available materials in the art. Among them, SK-gRNA and PC1300 vector have been disclosed in the article (Ren J, Meng X, Hu F, Liu Q, Cao Y, Li H, YanC, Li J, Wang K, Yu H, Wang C. Expanding the scope of genome editing with SpGand SpRY variants in rice. Sci China Life Sci. 2021 Oct;64(10):1784-1787.doi: 10.1007 / s11427-020-1883-5. Epub 2021 Jan 12. PMID: 33443621.).

[0041] Example 1 I. Target sequence selection and primer design A. According to Picture 1 The indicated sites were used to design two target sites for two genes in the rice genome: S1-OsORF6 target site 1 (SEQ ID No. 1), S1-OsORF6 target site 2 (SEQ ID No. 2), S5-ORF5 target site 1 (SEQ ID No. 3), and S5-ORF5 target site 2 (SEQ ID No. 4).

[0042] B. Design two complementary DNA sequences: add GGCA before the forward target sequence and add AAAC before the reverse complementary target sequence, as shown in SEQ ID No. 5~SEQ ID No. 12.

[0043] C. The primer sequences designed to detect mutation types are shown in SEQ ID No. 13 to SEQ ID No. 20.

[0044] II. Specific Test Methods 1. SK-gRNA was digested with AarI enzyme (37℃ for 5 h), and the digestion product was purified using a gel extraction kit to form a linear vector SK-gRNA / AarI with sticky ends.

[0045] AarI digestion system for SK-gRNA vector (50 μL): 5 μL of 10× buffer AarI, 1 μL of 50× oligonucleotide, 1 μL of AarI, 2 μg of vector SK-gRNA, and the remainder ddH2O.

[0046] 2. Primer annealing to form double strands The four pairs of synthesized primers were diluted with water to a concentration of 100 μM. 20 μL of each of F and R were mixed together and incubated at 100 °C for 5 min. After incubation, the mixture was allowed to cool naturally at room temperature.

[0047] 3. Ligation was performed using T4 ligase. The four pairs of products from step two were ligated into the linear vector SK-gRNA / AarI, respectively.

[0048] 10µL ligation system: 30ng linearized vector SK-gRNA / AarI, 1µL 10×T4 ligase buffer, 7µL primer annealing product from step 2, and 0.5µL T4 ligase; ligation at room temperature for 1h, ready for transformation.

[0049] 4. Transformation The ligation product was transformed using Escherichia coli (DH5α).

[0050] 5. Identification of positive clones Six to ten white colonies were selected and shaken for sequencing. Due to the low copy number of the plasmid, a total of 4 mL of bacterial culture was collected for plasmid extraction.

[0051] The primer sequence used for sequencing, T3 (SEQ ID No. 23), is: ATTAACCCTCACTAAAGGGA. The ligation was successful; proceed to the next step of the experiment.

[0052] 6. Extraction of particle size from transformation products The plasmid miniprep kit, Version 2.0 EasyPure PlasmidMinniPrep Kit, was used by Beijing TransGen Biotechnology Co., Ltd. This experiment involved extracting plasmids from transformed bacterial cells using a centrifugal column method. The main steps included: collecting bacterial cells, alkaline lysis, neutralization, centrifugation column adsorption, washing, drying, and finally dissolving and storing the DNA with elution buffer.

[0053] 7. Enzyme digestion The DNA eluted in the previous step consisted of four samples, which were named as follows: gRNA1: SK-SEQ ID No.5 / SEQ ID No.6; gRNA2: SK-SEQ ID No.7 / SEQ ID No.8; gRNA3: SK-SEQ ID No.9 / SEQ ID No.10; gRNA4: SK-SEQ ID No.11 / SEQ ID No.12.

[0054] Taking the construction of gRNA1-gRNA3 as an example, a 30µL enzyme digestion system was prepared: BglⅡ 1µL, KpnⅠ 1µL, gRNA1 25µL and 10×gree buffer 3µL; 30µL restriction enzyme digestion system: BamhⅠ 1µL, KpnⅠ 1µL, gRNA 3 25µL and 10×gree buffer 3µL; The enzyme digestion products were purified by incubating in a water bath at 37°C for 3 hours and then using a gel recovery kit.

[0055] After enzyme digestion, the recovered fragment lengths were as follows: gRNA1-BglⅡ / KpnⅠ 559bp; gRNA3-BamhⅠ / KpnⅠ had only a small opening of 12bp, and the larger fragment was recovered.

[0056] 8. Connection Prepare a 10 μL ligation system: 5 μL gRNA1-BglⅡ / KpnⅠ, 2 μL gRNA3-BamhⅠ / KpnⅠ, 2 μL 5×T4 DNABuffer, and 1 μL ligase; incubate at 25℃ for 30 min.

[0057] The ligation product was transformed into DH5α, and positive clones were detected by colony PCR. The samples were sent to the company for sequencing using primer T3, and the sequencing results were correct. The next step of the experiment was then carried out.

[0058] 9. Enzyme digestion 30µL restriction enzyme digestion system: BglⅡ 1µL, KpnⅠ 1µL, gRNA1-gRNA3 25µL and 10×gree buffer 3µL; 50µL PC1300-Cas9 digestion system: BamhⅠ 1μL, KpnⅠ 1μL, PC1300 (empty vector plasmid) 20μL, 50×gree buffer 5μL and ddH2O 23μL; The enzyme digestion products were purified by incubating in a water bath at 37°C for 3 hours and then using a gel recovery kit.

[0059] The recovered fragment lengths were as follows: gRNA1-gRNA3-BglⅡ / KpnⅠ 559bp; PC1300-Cas9-BamhⅠ / KpnⅠ only had a small opening, and a large fragment was recovered.

[0060] 10. Connection 10 μL ligation system: 5 μL gRNA1-gRNA3-BglⅡ / KpnⅠ, 2 μL PC1300-Cas9-BamhⅠ / KpnⅠ, 2 μL 5×T4 DNA Buffer, and 1 μL ligase. Ligation was performed at 25℃ for 30 min.

[0061] The ligation product was transformed into DH5α, and positive clones were detected by colony PCR. The samples were sent to the company for sequencing, and the sequencing results were correct. The next step, Agrobacterium-mediated transformation, was then performed. (The vector construction method for gRNA2-gRNA4 is the same as above.) Sequencing primer PC1300-F (SEQ ID No. 24): acactttatgcttccggct.

[0062] III. Agrobacterium-mediated transformation experiment Using Huhan 7B as the host, the constructed vector plasmid was sent to Boyuan Biotechnology Co., Ltd. to complete the Agrobacterium transformation experiment and obtain mutant plants.

[0063] IV. Mutation Detection DNA was extracted from the leaves of transgenic T0 generation plants and amplified by PCR. The sequences of the primers used for amplification are shown in SEQ ID No. 13~SEQ ID No. 20. The PCR products were directly sequenced to obtain mutation information. (Mutation information of transgenic plants can be quickly obtained using the webpage http: / / skl.scau.edu.cn / dsdecode / ).

[0064] A total of 62 T0 generation transgenic plants were received, and the identification results are as follows: Picture 5 and Picture 6 As shown, there are wild-type, single mutant, and double mutant plants. Among them, there are 18 wild-type plants, 31 single mutant plants, and 13 double mutant plants, with a mutation rate of 71% and a total of 42 mutation types.

[0065] The single-plant mutation types that do not possess hygromycin resistance were screened out by hygromycin detection, as shown in Table 1: Table 1. Mutation types of single plants without hygromycin resistance

[0066] V. Test Results Six T2 generation plants without hygromycin resistance were crossed with typical japonica rice C418. The seed setting rate of the F1 generation was investigated. The results showed that the seed setting rate of the F1 generation from the crosses between C418 and the two mutant types WN06-27 and WN07-31 was nearly 10% higher than that of the F1 generation from the cross between Huhan 7B and C418 (Table 2). Pollen iodine staining diagrams are shown below. Picture 2 , Picture 3 and Picture 4As shown, the pollen fertility of the F1 generation of T2 generation plants from these two mutant types crossed with C418 was better than that of the F1 generation of HuHan 7B crossed with C418. Therefore, the self-pollination set rate of these two mutant types and HuHan 7B was investigated. The results showed that there was no significant difference in the self-pollination set rate between these two mutant types and HuHan 7B (Table 3), indicating that the two mutant types caused by knocking out this site can effectively improve the set rate of the first generation of hybrids without causing other effects on the material.

[0067] Table 2. Comparison of seed setting rate between Huhan 7B, T2 generation plants and C418 hybrid F1 generation

[0068] Table 3. Comparison of self-pollination and seed setting rates between Huhan 7B and T2 generation plants

[0069] Table 4. Agronomic traits of Huhan 7B and T2 generation plants

[0070] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for improving interspecific fertility in rice, characterized in that, Includes the following steps: Knockout of interspecific hybrid sterility loci in rice cultivated in Asia and Africa S1-OsORF6 At least one site in the gene, and knocking out the rice wide affinity gene S5-ORF5 At least one site in it.

2. The method according to claim 1, characterized in that, The interspecific hybrid sterility locus of rice cultivated in Asia and Africa S1- OsORF6 The knockout target sites include at least S1-OsORF6 Target site 1 and S1-OsORF6 Target site 2; The S1-OsORF6 The nucleotide sequence of target site 1 is shown in SEQ ID No. 1; The S1-OsORF6 The nucleotide sequence of target site 2 is shown in SEQ ID No.

2.

3. The method according to claim 1, characterized in that, Rice wide affinity genes S5-ORF5 The knockout target sites include at least S5-ORF5 Target site 1 and S5-ORF5 Target site 2; The S5-ORF5 The nucleotide sequence of target site 1 is shown in SEQ ID No. 3; The S5-ORF5 The nucleotide sequence of target site 2 is shown in SEQ ID No.

4.

4. The method according to claim 2 or 3, characterized in that, Knockout of interspecific hybrid sterility loci in rice cultivated in Asia and Africa S1-OsORF6 Two loci in the gene, and knocking out the rice broad affinity gene. S5-ORF5 Two sites in the middle.

5. The method according to claim 4, characterized in that, The knockout process involves two iterations, each knocking out one site of two genes.

6. An sgRNA genome, characterized in that, Including heterosis loci in interspecific hybrid rice varieties cultivated in Asia and Africa. S1-OsORF6 sgRNAs designed to knock out at least one target site in rice, and sgRNAs targeting broad-affinity genes in rice. S5-ORF5 sgRNA designed with at least one knockout target site.

7. The sgRNA group according to claim 6, characterized in that, against S1-OsORF6 The nucleotide sequences of the sgRNA designed for target site 1 are shown in SEQ ID No. 5 and SEQ ID No. 6; against S1-OsORF6 The nucleotide sequences of the sgRNA designed for target site 2 are shown in SEQ ID No. 7 and SEQ ID No. 8; The S1-OsORF6 The nucleotide sequence of target site 1 is shown in SEQ ID No. 1; The S1-OsORF6 The nucleotide sequence of target site 2 is shown in SEQ ID No.

2.

8. The sgRNA group according to claim 6, characterized in that, against S5-ORF5 The nucleotide sequences of the sgRNA designed for target site 1 are shown in SEQ ID No. 9 and SEQ ID No. 10; against S5-ORF5 The nucleotide sequences of the sgRNA designed for target site 2 are shown in SEQ ID No. 11 and SEQ ID No. 12; The S5-ORF5 The nucleotide sequence of target site 1 is shown in SEQ ID No. 3; The S5-ORF5 The nucleotide sequence of target site 2 is shown in SEQ ID No.

4.

9. A method for constructing rice parent lines, characterized in that, This includes using the sgRNA group described in any one of claims 6 to 8 to knock out two genes in the target rice to obtain rice parents.

10. A method for rice breeding, characterized in that, Rice breeding is carried out using the rice parent obtained by the construction method described in claim 9 and the second rice parent.

Images