Method for monitoring and evaluating the transmission risk of pathogenic bacteria in poultry farm manure

By using a multi-dimensional monitoring system, combined with crystal violet staining, PCR technology, and 16S rRNA function prediction, the risk sources of pathogenic bacteria in poultry farm feces are accurately identified, and the composting process is dynamically monitored. This solves the problems of inaccurate risk identification and drug resistance rebound in existing technologies, and achieves precise control and biosafety control of pathogenic bacteria in feces.

CN122357748APending Publication Date: 2026-07-10ZHEJIANG UNIV ZHONGYUAN INST
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-16
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Existing technologies cannot accurately identify the sources of pathogenic bacteria in poultry farm manure, have limited monitoring dimensions, and the composting process can easily lead to a rebound in drug resistance. They also lack dynamic assessment and graded early warning throughout the entire life cycle, making it impossible to effectively control the risk of transmission of pathogenic bacteria in manure.

Method used

A multi-dimensional monitoring system was adopted, including Salmonella transmission risk assessment in poultry physiological cycles, anti-drug resistance warning associated with drug administration behavior, and functional monitoring of the composting process. The amount of biofilm formation, virulence gene carrying and microbial diversity were detected by crystal violet staining, PCR technology and 16S rRNA function prediction method. A three-dimensional evaluation system of phenotype-molecule-function was constructed to dynamically monitor the changes of pathogens during composting.

Benefits of technology

It enables accurate early warning and effective control of the risk of pathogenic bacteria transmission in poultry farm feces, avoids missed risk assessment and drug resistance rebound, and reduces the safety risks of poultry product contamination and the spread of antibiotic resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention provides a method for monitoring and evaluating the risk of pathogenic bacteria transmission in poultry farm feces, belonging to the field of livestock and poultry biosecurity control technology. The method includes evaluating the risk of Salmonella transmission during the poultry physiological cycle, assessing the risk of antibiotic resistance associated with drug administration behavior, and monitoring the function during composting based on microbial community structure and metabolic function. This invention can accurately locate the highest-risk nodes of pathogen contamination and antibiotic resistance evolution during the breeding cycle, solving the problem of inaccurate identification of risk sources in existing technologies and avoiding poultry product contamination due to missed risk assessments. It overcomes the single-dimensional limitation of existing technologies that only detect the quantity of pathogens, comprehensively evaluating pathogen risk from phenotypic, molecular, and functional levels. The assessment results are more in line with the actual biosecurity needs of poultry farming, ultimately reducing the safety risks of poultry product contamination and the spread of antibiotic resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biosafety control technology in livestock and poultry farming, specifically relating to a method for monitoring and evaluating the risk of transmission of pathogenic bacteria in poultry farm feces. Background Technology

[0002] Foodborne pathogen contamination and the spread of antibiotic resistance (AMR) are core biosafety issues that urgently need to be addressed in the livestock and poultry farming sector, directly impacting the quality and safety of livestock and poultry products and public health. Poultry farms are a major source of Salmonella (…). Salmonella Poultry and livestock manure is an important natural source of foodborne pathogens such as SARS-CoV-2. As the main waste in the breeding and production process, it is not only the core carrier for the spread and diffusion of pathogens in the breeding environment, but also a key node for the cross-media transmission of antibiotic resistance genes and multidrug-resistant bacteria (MDR). Its biosafety management has become an important part of the biosafety system for poultry farming.

[0003] Currently, domestic and international safety monitoring technology systems for pathogenic bacteria from livestock and poultry sources have been initially established. Core technologies focus on the sampling and drug resistance testing of pathogenic bacteria in end products such as eggs and poultry meat, playing a certain role in controlling the quality of livestock and poultry products. In the field of livestock waste treatment, composting has become the mainstream process for treating poultry farm manure due to its dual advantages of resource utilization and harmless treatment. The industry has established a set of routine composting operation standards based on physical parameters such as temperature and humidity. However, existing technology systems do not consider manure as a core target for pathogen risk control, nor have they established a biosafety monitoring system that links the entire life cycle of livestock farming with the entire manure treatment process. They lack dynamic assessment and graded early warning of the risk of pathogenic bacteria from manure throughout the entire life cycle of livestock farming, resulting in the inability to effectively control the safety risks of pathogenic bacteria transmission from poultry farm manure at the source. Specifically, the following core technical problems exist: Inaccurate identification of risk sources and lack of dynamic hierarchical assessment: Existing technologies do not systematically monitor fecal pathogen contamination and drug resistance evolution based on the physiological characteristics of poultry at different physiological cycles. They cannot accurately locate the highest risk nodes of pathogen contamination, virulence expression and drug resistance evolution during the breeding cycle. Relying solely on experience for extensive prevention and control can easily lead to the omission of high-risk feces and the creation of hidden dangers for the subsequent spread of pathogens. The monitoring dimensions are too narrow and the evaluation system lacks scientific rigor: Existing pathogen risk assessment methods only focus on the quantitative detection of pathogen quantity, ignoring the biological characteristics of pathogens such as biofilm formation ability and virulence gene expression, as well as the intrinsic relationship between changes in microbial functional pathways (such as aerobic respiration) and the biosafety of pathogens. The evaluation results of a single dimension cannot comprehensively and truthfully reflect the risk of pathogen transmission in feces, cannot achieve precise prevention and control of pathogen risk, and the judgment conclusions lack scientific basis. Improper management of composting processes poses a risk of drug resistance rebound: Existing manure composting processes all adopt uniform physical parameter control standards, without considering the inducing effect of environmental pressure on the virulence characteristics and drug resistance of pathogens during composting. This can easily lead to a significant increase in the proportion of MDR in the composting system, resulting in drug resistance rebound. Even after composting, manure still poses a high risk of biosafety transmission, and may even cause further spread of drug-resistant genes in downstream environments such as soil and crops.

[0004] The aforementioned technical problems prevent existing technologies from accurately and efficiently controlling the risk of pathogenic bacteria transmission in poultry farm feces, which also hinders the green and healthy development of the poultry farming industry. Developing a set of safety risk assessment and monitoring methods for the transmission of pathogenic bacteria in feces covering the entire breeding and treatment process has become an urgent need for the industry's development. Summary of the Invention

[0005] In view of this, the present invention aims to overcome the technical defects of existing poultry farm pathogen safety monitoring technologies, such as inaccurate identification of risk sources, single monitoring dimensions, and easy occurrence of drug resistance rebound during composting. It provides a set of monitoring and evaluation methods for the safety risks of fecal pathogen transmission that cover the entire life cycle of poultry farming and the entire composting process.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a method for monitoring and evaluating the risk of pathogenic bacteria transmission in poultry farm feces, including the evaluation of the risk of Salmonella transmission during the poultry physiological cycle. The evaluation includes the following steps: collecting feces from poultry at eight different stages: initial defecation, chick stage, initial egg-laying stage, peak egg-laying stage, cessation of egg-laying stage, sick poultry, antibiotic administration stage, and composting stage; isolating Salmonella from the feces at each stage; detecting the biofilm formation and virulence gene carrying status of Salmonella in the feces at each stage; and identifying the presence of Salmonella and the OD (dryness) of the biofilm. 590nm Stool samples with a concentration ≥2.0 and / or containing Salmonella and carrying virulence genes are defined as high-risk; stool samples with other concentrations are defined as low-to-medium risk. The virulence genes include... rpoS, avrA and cdtB At least one of them.

[0007] Preferably, the method for detecting the amount of Salmonella biofilm formation includes crystal violet staining or laser confocal microscopy; the crystal violet staining method includes the following steps: inoculating Salmonella into a culture plate, staining with crystal violet, eluting with ethanol, and then detecting the OD using an enzyme-linked immunosorbent assay (ELISA) reader. 590nm value.

[0008] Preferably, the method for detecting virulence gene carriage includes PCR method for detecting virulence genes. rpoS The primer sets are shown in SEQ ID NO.1 and SEQ ID NO.2, for detecting virulence genes. avrA The primer sets are shown in SEQ ID NO.3 and SEQ ID NO.4, for detecting virulence genes. cdtB The primer sets are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0009] Preferably, the method further includes a drug resistance warning risk assessment associated with drug administration behavior. The drug resistance warning risk assessment associated with drug administration behavior includes the following steps: taking feces during the drug administration period and after the drug administration period, and detecting the proportion of multidrug-resistant bacteria in the fecal samples at different times. If the proportion of multidrug-resistant bacteria in the fecal samples is >30%, it is judged as a high risk of drug resistance warning. If the proportion of multidrug-resistant bacteria in the fecal samples is ≤30%, it is judged as a medium-low risk of drug resistance warning.

[0010] Preferably, the method for detecting the proportion of multidrug-resistant bacteria in fecal samples at different time periods includes the following steps: Fecal samples are serially diluted 10-fold with physiological saline, and equal aliquots are inoculated onto Mueller Hinton agar plates containing antibiotics. Simultaneously, equal aliquots are inoculated onto Mueller Hinton agar plates without antibiotics. After incubation at 37°C for 24-48 hours, the colonies on the plates are counted. The proportion of multidrug-resistant bacteria is calculated as: (number of colonies on Mueller Hinton agar plates containing antibiotics / number of colonies on Mueller Hinton agar plates without antibiotics) × 100%.

[0011] Preferably, the added antibiotic is tetracycline, oxytetracycline, neomycin sulfate, or tylosin tartrate.

[0012] Preferably, in the Mueller Hinton agar plates containing antibiotics, the concentrations are as follows: tetracycline 40 IU / mL, oxytetracycline 200 IU / mL, neomycin sulfate 680 IU / mL, and tylosin tartrate 680 IU / mL.

[0013] Preferably, the method also includes functional monitoring during the composting process, which includes monitoring of microbial community structure and metabolic function. In the results of the metabolic function monitoring, PWY-3781 is used as a positive monitoring indicator and the activity of the sucrose degradation pathway is used as a negative monitoring indicator. If the relative abundance of PWY-3781 is ≥40% and the activity of the sucrose degradation pathway shows a decreasing trend, it indicates that the composting meets the standards.

[0014] Preferably, the metabolic function monitoring is performed by using a 16S rRNA-based functional prediction method combined with the MetaCyc database to dynamically track changes in the metabolic pathways of composting microorganisms.

[0015] Preferably, the monitoring of the microbial community structure includes detecting changes in microbial alpha diversity and actinomycete abundance during composting. If the number of observed species in the microbial community is more than 200 and the relative abundance of actinomycetes is ≥30%, it indicates that the composting meets the standards.

[0016] The beneficial effects of this invention are: Compared with existing methods for monitoring pathogens in poultry farms, this invention has the advantages of precise graded early warning and accurate identification of risk sources. Based on the correlation study of the amount of fecal Salmonella biofilm formation and the virulence gene carrying rate at different physiological stages, this invention can accurately locate the highest risk nodes of pathogen contamination and drug resistance evolution in the breeding cycle, solving the problem of inaccurate identification of risk sources in existing technologies and avoiding poultry product contamination due to missed risk assessment.

[0017] The monitoring and evaluation method provided by this invention employs multi-indicator correlation monitoring, resulting in a more scientific risk assessment. This invention constructs a three-dimensional evaluation and monitoring system encompassing phenotype (biofilm / drug resistance phenotype), molecule (virulence gene), and function (metabolic pathway), combining multi-indicator detection results from crystal violet staining, PCR technology, and 16S rRNA function prediction methods. It overcomes the limitation of existing technologies that only detect the quantity of pathogens, comprehensively evaluating pathogen risk from phenotypic, molecular, and functional levels, resulting in assessments that better align with actual biosafety needs in aquaculture.

[0018] The monitoring and evaluation method provided by this invention also has the advantage of dynamic control during the composting process, effectively avoiding drug resistance rebound. This invention uses the evolution of core microbial communities (microbial alpha diversity (Ace index), actinomycete abundance) and specific metabolic pathways (PWY-3781 aerobic respiration pathway I) as core monitoring indicators during composting. This technology is based on metabolic pathway analysis and microbial diversity detection from the MetaCyc database. It can dynamically monitor changes in multidrug-resistant bacteria during composting, thus guiding whether the composting process has ended. This solves the problem that existing composting processes with uniform parameters easily lead to drug resistance rebound, achieving biosafety and controllable harmless treatment of feces.

[0019] This invention achieves precise early warning of the risk of pathogenic bacteria transmission in poultry farm manure and effective prevention and control of drug resistance by accurately identifying high-risk nodes of pathogenic bacteria in the breeding cycle, constructing a multi-dimensional correlation monitoring system, and establishing dynamic functional monitoring of composting processes. Ultimately, it reduces the safety risks of poultry product contamination and the spread of antibiotic resistance, providing technical support for biosecurity control in poultry farming. Attached Figure Description

[0020] Figure 1 The proportion of multidrug-resistant bacteria in feces of different groups is shown. Different letters on the column indicate p < 0.05.

[0021] Figure 2 To compare the microbial metabolic pathways in different fecal samples.

[0022] Figure 3 This is a comparison chart of Salmonella biofilm formation in different fecal samples. Different letters on the column indicate p < 0.05. Detailed Implementation

[0023] This invention provides a method for monitoring and evaluating the risk of pathogenic bacteria transmission in poultry farm feces, including the evaluation of the risk of Salmonella transmission during the poultry physiological cycle. The evaluation includes the following steps: collecting feces from poultry at eight different stages: initial defecation, chick stage, initial egg-laying stage, peak egg-laying stage, cessation of egg-laying stage, sick poultry, antibiotic administration stage, and composting stage; isolating Salmonella from the feces at each stage; detecting the biofilm formation and virulence gene carrying status of Salmonella in the feces at each stage; and identifying the presence of Salmonella and the OD (dryness) of the biofilm. 590nm Stool samples with a concentration ≥2.0 and / or containing Salmonella and carrying virulence genes are defined as high-risk; stool samples with other concentrations are defined as low-to-medium risk. The virulence genes include... rpoS, avrA and cdtB At least one of them.

[0024] In this invention, the design of the evaluation steps for the risk of Salmonella transmission during the poultry physiological cycle is intended to accurately pinpoint high-risk nodes for fecal pathogens within the breeding cycle. Specifically, this includes three steps: node division, risk indicator detection, and risk level determination. For node division, chickens are preferred as the poultry. The chicken growth process is divided into eight monitoring nodes based on age: first defecation (Day 0), chick stage (Day 1-Day 40), initial egg production stage (Day 108-Day 110), peak egg production stage (Day 180-Day 190, optimal at 185 days old), cessation of egg production (after Day 230), sick chickens, antibiotic administration period, and composting period. In this invention, the preferred method for isolating Salmonella from feces at various stages includes the following steps: placing fecal samples in a sterile container, adding 0.1% buffered peptone water, and incubating at 37°C for 18 hours for pre-enrichment culture; then, spreading three copies of the pre-enriched culture onto a selective solid medium, xylose-lysine deoxycholate agar (XLD), and incubating at 37°C for 24 hours; selecting pink colonies, with or without black cores, from the XLD plates. Identification of the isolates is performed using 16S rRNA amplification and sequencing analysis, followed by 16S rRNA polymerase chain reaction (PCR).

[0025] In this invention, the preferred method for detecting the amount of Salmonella biofilm formation includes crystal violet staining or laser confocal microscopy; the preferred method for crystal violet staining includes the following steps: inoculating Salmonella into a culture plate, staining with crystal violet, eluting with ethanol, and then detecting the OD using an enzyme-linked immunosorbent assay (ELISA) reader. 590nm The culture temperature is preferably 37℃, and the culture time is preferably 24h; the crystal violet staining time is preferably 5min; the ethanol used for elution is preferably a 95% ethanol solution by volume.

[0026] In this invention, the preferred method for detecting virulence gene carrier status includes a PCR method for detecting virulence genes. rpoS The preferred primer sets are TTGAGTCAGAATACGCTGAAAGTT (SEQ ID NO.1) and TTACTCGCGGAACAGCG (SEQ ID NO.2) for detecting virulence genes. avrA The preferred primer sets are AGCCTGGCGCTCGCCAAAAA (SEQ ID NO. 3) and GCGGTCTGCTTTATCGGACGGG (SEQ ID NO. 4) for detecting virulence genes. cdtBThe preferred primer sets are ACAACTGTCGCATCTCGCCCCGTCATT (SEQ ID NO.5) and CAATTTGCGTGGGTTCTGTAGGTGCGAGT (SEQ ID NO.6). In this invention, the detection of Salmonella virulence gene carriage preferably includes the following steps: extracting genomic DNA from Salmonella isolates using a bacterial genomic DNA kit, performing a double polymerase chain reaction (PCR). The PCR reaction system, in 25 µL increments, includes 12 µL of stock solution (Thermo Science PCRMasterMix 2X), 1 µL of forward primer, 1 µL of reverse primer, 4 µL of template DNA, and 7 µL of nucleic acid-free water. The preferred PCR reaction program includes initial denaturation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 1 min, primer annealing at different temperatures for 1 min, extension at 72 °C for 1 min; and a final 10 min extension at 72 °C. After the PCR reaction, agarose gel electrophoresis is performed.

[0027] In the monitoring and evaluation method of this invention, a preferred additional method is to include a drug resistance early warning risk assessment associated with drug administration behavior. The purpose is to monitor the drug resistance of pathogenic bacteria in feces during and after drug administration, prevent the spread of drug-resistant bacteria through feces, and clarify the early warning judgment rules. The preferred method for the drug resistance early warning risk assessment associated with drug administration behavior includes the following steps: taking feces during and after the drug administration period, and detecting the proportion of multidrug-resistant bacteria in the fecal samples at different times. If the proportion of multidrug-resistant bacteria in the fecal samples is >30%, it is judged as a high-risk drug resistance warning; if the proportion of multidrug-resistant bacteria in the fecal samples is ≤30%, it is judged as a medium-low risk drug resistance warning.

[0028] In this invention, the preferred method for detecting the proportion of multidrug-resistant bacteria in fecal samples at different time periods includes the following steps: Fecal samples are serially diluted 10-fold with physiological saline, and equal aliquots are inoculated onto Mueller Hinton agar plates containing antibiotics. Simultaneously, equal aliquots are inoculated onto Mueller Hinton agar plates without antibiotics. After incubation at 37°C for 24-48 hours, the colonies on the plates are counted. The proportion of multidrug-resistant bacteria is calculated as: (Number of colonies on the Mueller Hinton agar plate containing antibiotics / Number of colonies on the Mueller Hinton agar plate without antibiotics) × 100%. In this invention, the antibiotics added are preferably tetracycline, oxytetracycline, neomycin sulfate, and tylosin tartrate. In the Mueller Hinton agar plates containing antibiotics, the preferred concentrations are: tetracycline 40 IU / mL, oxytetracycline 200 IU / mL, neomycin sulfate 680 IU / mL, and tylosin tartrate 680 IU / mL. This invention does not specifically limit the source of the above-mentioned antibiotics; commercially available products commonly used in the field are acceptable.

[0029] In the monitoring and evaluation method of this invention, functional monitoring during the composting process is preferably included to avoid drug resistance rebound. The functional monitoring during the composting process preferably includes monitoring of microbial community structure and metabolic function. In the results of the metabolic function monitoring, PWY-3781 is used as a positive monitoring indicator, and sucrose degradation pathway activity is used as a negative monitoring indicator. If the relative abundance of PWY-3781 is ≥40% and the sucrose degradation pathway activity shows a decreasing trend, it indicates that the composting meets the standards. The metabolic function monitoring is preferably based on a 16S rRNA functional prediction method, combined with dynamic tracking of changes in the metabolic pathways of composting microorganisms using the MetaCyc database.

[0030] In this invention, the monitoring of the microbial community structure preferably includes detecting changes in microbial alpha diversity and actinomycete abundance during composting. If the number of observed species (Observed OTUs) in the microbial community is not less than 200 and the relative abundance of Actinobacteriota is ≥30%, the composting is considered to meet the standards. The preferred method for detecting changes in microbial alpha diversity and actinomycete abundance during composting includes the following steps: collecting compost samples using a five-point sampling method and pre-treating them at low temperature; entrusting a qualified professional sequencing company to extract total microbial DNA using a kit method; performing high-throughput sequencing on the hypervariable region of the 16S rRNA gene; completing bioinformatics analyses such as species counting and Actinomycete relative abundance testing; and compiling the test results to clarify changes in microbial alpha diversity and actinomycete abundance.

[0031] In the functional monitoring of the composting process of this invention, if the metabolic function monitoring shows that the standard is met, then regardless of whether the microbial community structure monitoring meets the standard, it indicates that the composting has met the standard. If both the metabolic function monitoring and the microbial community structure monitoring meet the standard, it indicates that the composting effect is even better.

[0032] In this invention, suggestions for adjusting the composting process can be made based on the functional monitoring results during the composting process. For example, the following process adjustment suggestions are made based on changes in the microbial metabolic pathway to avoid the spread of drug resistance: First, precisely control the oxygen supply. Combining the enrichment characteristics of the aerobic respiration pathway I, a segmented aeration strategy is adopted. In the early stage of composting, the oxygen volume fraction is maintained at >15%, and in the high-temperature period, it is controlled at 14%~17%. This ensures the activity of aerobic microorganisms while avoiding energy waste and simultaneously inhibiting the proliferation of drug-resistant bacteria caused by anaerobic environment. Second, optimize the carbon source supply and material ratio. In response to the consumption characteristics of easily degradable organic components reflected by the reduced activity of the sucrose degradation pathway, an appropriate amount of easily degradable carbon sources such as molasses is added in the early stage of composting, and supplemented in the later stage. The composting process involves several steps. First, it incorporates lignocellulosic materials such as corn stalks to promote the orderly decomposition of complex organic matter, while balancing the carbon-nitrogen ratio and reducing the factors that induce the accumulation of drug-resistant genes. Second, it employs a combination of biofortification and microecological regulation, inoculating synthetic microbial communities containing thermophilic cellulose bacteria and actinomycetes to enhance the degradation capacity of complex organic matter. Simultaneously, it introduces low-resistance sensitive bacteria to seize ecological niches, inhibiting the resurgence and spread of drug-resistant bacteria and curbing the rebound of drug-resistant genes during the composting period. Third, it uses functional additives, such as appropriate amounts of persulfate, which utilizes the active free radicals generated after activation to degrade drug-resistant genes and mobile genetic elements. Alternatively, it can add humus to enhance the colonization capacity of sensitive bacteria, further reducing the risk of drug resistance accumulation.

[0033] The monitoring and evaluation method provided by this invention consists of three core stages: evaluation of the risk of Salmonella transmission during the poultry physiological cycle, risk assessment of drug resistance warning associated with drug administration behavior, and multi-dimensional functional monitoring during composting. Taking poultry breeds such as Taihe black-bone chicken as research objects, the invention conducted monitoring of fecal pathogens during different physiological cycles of poultry, the impact of drug administration behavior on drug resistance of pathogens, and the correlation between composting process and metabolic pathways of pathogens. For the first time, the diseased chicken stage and the chicken manure composting period were identified as high-risk periods for fecal pathogens. A multi-dimensional risk assessment and monitoring system was constructed, and the invention ultimately developed a monitoring and evaluation method for the safety risk of fecal pathogen transmission in poultry farms, filling a gap in the existing technology.

[0034] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0035] Unless otherwise specified, the following embodiments are all conventional methods.

[0036] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0037] Example 1 A method for monitoring and evaluating the risk of transmission of pathogenic bacteria from poultry farm feces, including the evaluation of the risk of transmission of Salmonella during the poultry physiological cycle, wherein the evaluation of the risk of transmission of Salmonella during the poultry physiological cycle includes the following steps: Feces were collected from poultry at eight different stages: initial defecation, chick stage, initial laying stage, peak laying stage, cessation of laying, sick poultry, antibiotic administration stage, and composting stage. Salmonella was isolated from the feces at each stage. The method for Salmonella isolation and identification was as follows: 25g of each fecal sample was placed in a sterile container with a plastic cap, and 225mL of 0.1% buffered peptone water (BPW) (Oxoid Ltd, UK) was added. The samples were incubated at 37°C for 18h for pre-enrichment culture. Then, 0.1mL of the pre-enriched culture was spread in triplicate on a selective solid medium, xylose-lysine deoxycholate agar (XLD) (Oxoid Ltd, UK), and incubated at 37°C for 24h. Pink colonies, with or without black cores, were selected from the XLD plates to confirm the presence of suspected colonies. The isolates were identified by 16S rRNA amplification and sequencing analysis, and 16S rRNA polymerase chain reaction (PCR) was used to determine whether Salmonella was isolated from feces.

[0038] The biofilm formation and virulence gene carriage of Salmonella in feces at different time points were detected. The biofilm formation was detected using crystal violet staining. The procedure was as follows: 100 μL of Salmonella bacterial suspension isolated from feces at each time point was inoculated into a 96-well plate, incubated at 37°C for 24 h, stained with crystal violet for 5 min, eluted with 95% ethanol, and the OD was measured using a microplate reader. 590nm The biofilm formation rate was evaluated using a value. The method for detecting virulence gene carriage was PCR, with the following steps: Genomic DNA was extracted from Salmonella isolates using a bacterial genomic DNA kit (Beijing CWBIO, China). Double polymerase chain reaction (PCR) was employed, using a 25µL reaction mixture comprising 12µL stock solution (Thermo Scientific PCR Master Mix 2X), 1µL forward primer, 1µL reverse primer, 4µL template DNA, and 7µL nucleic acid-free water. The primer set is shown in Table 1.

[0039] Table 1 Primer sequence information for the three virulence genes The PCR reaction procedure was as follows: initial denaturation at 95℃ for 5 min; 40 cycles of 95℃ denaturation for 1 min, primer annealing at different temperatures for 1 min, and extension at 72℃ for 1 min; final extension at 72℃ for 10 min. After the PCR reaction, agarose gel electrophoresis was performed. The procedure was as follows: 1.5 g of agarose was placed in a conical flask containing 100 mL of 1×TBE gel buffer to prepare an agarose gel. The agarose was heated for 2 minutes, then cooled (55℃), and Goldview I nucleic acid staining dye (0.1 μg / mL; Sorapio, Beijing, China) was added to the gel and poured onto a plate until the agarose was completely dissolved. The gel was electrophoresed at 120V for 30 minutes and then observed using a P1-1002 gel electrophoresis system.

[0040] Salmonella will be detected and biofilm OD 590nm Stools with a concentration ≥2.0 and / or containing Salmonella and carrying virulence genes are defined as high-risk, while stools in other cases are defined as medium- or low-risk.

[0041] Example 2 A method for monitoring and evaluating the risk of transmission of pathogenic bacteria from poultry farm feces, based on Example 1, further includes an assessment of drug resistance early warning risk associated with drug administration behavior, the steps of which are as follows: Fecal samples were collected during and after the drug administration period to determine the proportion of multidrug-resistant bacteria (MDRs) at different time points. The method for determining the proportion of MDRs in fecal samples at different time points included the following steps: Fecal samples were serially diluted 10-fold with physiological saline, and aliquots were inoculated onto Mueller Hinton agar (MHA, Difco) plates supplemented with tetracycline, oxytetracycline, neomycin sulfate, and tylosin tartrate (Taiwaning). The antibiotic concentrations were all at clinically effective levels: tetracycline 40 IU / mL, oxytetracycline 200 IU / mL, neomycin sulfate 680 IU / mL, and tylosin tartrate 680 IU / mL. Simultaneously, 100 μL aliquots were triple-inoculated onto MHA plates without antibiotics to estimate the total colony count. After incubation at 37°C for 36 hours, the colonies on the plates were counted. The MDR ratio is calculated as follows: (number of colonies on Mueller Hinton agar plates with antibiotics / number of colonies on Mueller Hinton agar plates without antibiotics) × 100%.

[0042] If the proportion of multidrug-resistant bacteria (MDR) in a fecal sample is >30%, it is considered a high-risk case of drug resistance warning; if the proportion of multidrug-resistant bacteria (MDR) in a fecal sample is ≤30%, it is considered a low-to-medium risk case of drug resistance warning.

[0043] Example 3 A method for monitoring and evaluating the risk of pathogenic bacteria transmission from poultry farm feces, based on Example 2, further includes functional monitoring during the composting process. This functional monitoring includes monitoring of microbial community structure and metabolic function. The steps for monitoring microbial community structure are as follows: Compost samples are collected using a five-point sampling method, preserved at low temperature, and pretreated. A qualified professional sequencing company is commissioned to extract total microbial DNA using a kit method and perform metagenomic shotgun high-throughput sequencing (read length not less than 150 bp, sequencing depth not less than 10 G). Bioinformatics analysis, such as microbial community functional gene annotation, is completed. The test results are compiled to obtain the number of observed species in the microbial community and the relative abundance changes of Actinobacteriota during the composting process. If the number of observed species (Observed OTUs) in the microbial community is not less than 200 and the abundance of Actinobacteriota is ≥30%, then the composting meets the standards. The metabolic function monitoring is based on a 16S rRNA functional prediction method, combined with the MetaCyc database to dynamically track changes in the metabolic pathways of composting microorganisms. PWY-3781 (aerobic respiration pathway I) is a positive monitoring indicator, while sucrose degradation pathway activity is a negative monitoring indicator. A relative abundance of PWY-3781 ≥ 40% (the gene family abundance corresponding to this pathway accounts for ≥ 40% of the total abundance of all predicted metabolic pathways) and a decreasing trend in sucrose degradation pathway activity indicate that composting is up to standard (strong and high proportion of aerobic respiration-related functions in the compost microorganisms indicate good aeration, high microbial activity, and normal maturation process). In the functional monitoring of the composting process of this invention, as long as the metabolic function monitoring meets the standard, the composting is considered up to standard.

[0044] For composted manure that does not meet composting standards, any of the following optimizations can be made: First, precisely control the oxygen supply. Considering the enrichment characteristics of the aerobic respiration pathway I, adopt a segmented aeration strategy, maintaining an oxygen volume fraction >15% in the early stages of composting and controlling it at 14%~17% during the high-temperature period. This ensures the activity of aerobic microorganisms while avoiding energy waste and simultaneously inhibiting the proliferation of drug-resistant bacteria caused by anaerobic environments. Second, optimize the carbon source supply and material ratio. Addressing the reduced activity of the sucrose degradation pathway, which reflects the consumption of easily degradable organic components, add an appropriate amount of easily degradable carbon sources such as molasses in the early stages of composting, and supplement with lignocellulosic materials such as corn stalks in the later stages to promote composting. The process involves four main steps: First, orderly advancement towards the decomposition of complex organic matter while balancing the carbon-nitrogen ratio to reduce the factors inducing the accumulation of drug-resistant genes. Second, a combination of bioaugmentation and microecological regulation is employed, including inoculation with synthetic microbial communities containing thermophilic cellulose-degrading bacteria and actinomycetes to enhance the degradation capacity of complex organic matter. Simultaneously, low-resistance sensitive bacteria are introduced to seize ecological niches, inhibiting the resurgence and spread of drug-resistant bacteria and curbing the rebound of drug-resistant genes during the decomposition period. Third, functional additives are used as supplementary agents, such as adding appropriate amounts of persulfate to utilize the active free radicals generated after its activation to degrade drug-resistant genes and mobile genetic elements, or adding humus soil to enhance the colonization capacity of sensitive bacteria, further reducing the risk of drug resistance accumulation.

[0045] Example 4 Identification of high-risk nodes in poultry physiological cycles Experimental subjects: Fecal samples from eight periods at Taihe Black-boned Chicken Farm, including the first defecation (Day 0), chick stage (Day 1-Day 40), initial egg production stage (Day 108-Day 110), peak egg production stage (Day 180-Day 190), egg production cessation stage (after Day 230), sick chickens, antibiotic administration monitoring period, and composting period.

[0046] Experimental Methods: The method for assessing the risk of Salmonella transmission during the poultry physiological cycle as described in Example 1 was used to determine whether Salmonella was detected in feces at each stage and to detect the OD of isolated Salmonella biofilms. 590nm Value and rpoS, avrA and cdtB The carrier rate of at least one of the genes.

[0047] Experimental results: Salmonella was detected in the feces of sick chickens, and the Salmonella bacteria had a strong biofilm-forming ability (OD). 590nm ≥2.0), Salmonella was detected during the composting period and carried by bacteria. avrA and rpoS All genes reached the high-risk level judgment threshold; Salmonella was not detected at other time points, or Salmonella was detected but its biofilm formation ability was weak and it was not carrying Salmonella. avrA , rpoS or cdtB The virulence gene is classified as low to medium risk.

[0048] Example 5 Drug resistance early warning risk assessment associated with drug administration behavior Experimental subjects: Fecal samples from Taihe Black-boned Chicken farms after 3 days of tetracycline administration (Group 2) and 30 days of composting following administration (Group 3). Fecal samples from 40-day-old chickens served as the control group (Group 1). Three replicate experiments were conducted.

[0049] Experimental method: The proportion of multidrug-resistant bacteria (MDR) in the samples was detected using the drug administration behavior-related drug resistance early warning risk assessment method in Example 2.

[0050] Final result: When the MDR ratio in a fecal sample is >30%, it is considered a risk level for drug resistance, and the batch of feces must be marked as high-risk. Figure 1 It can be seen that the composting period after the drug administration period is considered a high-risk period for feces.

[0051] Example 6 Functional monitoring during composting Experimental subjects: pre-composting manure from Taihe Black-boned Chicken Farm (Group 1) and manure after 30 days of composting (Group 3).

[0052] Experimental method: The functional monitoring method in the composting process described in Example 3 was used to detect the abundance and proportion of microbial metabolic pathways in different fecal samples.

[0053] Test results: such as Figure 2 As shown, this invention uses chicken manure from different treatment stages of poultry farms as test samples, employs 16S rRNA-based functional prediction technology, and combines the MetaCyc database to analyze the distribution and abundance changes of microbial core metabolic pathways in the samples, thus successfully enabling multi-dimensional functional monitoring of the composting process.

[0054] Example 7 Feces from chickens at the start of spawning (Day 108-Day 110) (labeled as No. 1), compost samples from 10 days (labeled as No. 2), compost samples from 20 days (labeled as No. 3), compost samples from 30 days (labeled as No. 4), feces from sick chickens (labeled as No. 5), feces from chickens treated with tetracycline (labeled as No. 6), and feces from chickens treated with oxytetracycline (labeled as No. 7) were collected for Salmonella isolation. The biofilm formation of Salmonella in each feces sample was also measured, following the same method as in Example 1. The results are as follows: Figure 3 As shown, Salmonella was successfully isolated from all fecal samples, but the biofilm formation in the feces of diseased chickens was significantly higher than that in other fecal samples.

[0055] Experimental Example 1 Existing method: Random fecal samples from poultry farms; Salmonella levels were not detected using the traditional plate count method, and the samples were classified as "low risk".

[0056] Fecal samples from the poultry farm were tested using the method described in Example 1 of this invention as follows: Fecal samples were collected at the following times: initial defecation (Day 0), chick stage (Day 1-Day 40), initial egg production stage (Day 108-Day 110), peak egg production stage (Day 180-Day 190), cessation of egg production (after Day 230), sick chickens, antibiotic administration monitoring period, and composting period. Salmonella was isolated, and the biofilm formation and virulence gene carrying capacity of Salmonella in the feces at each time period were detected. The specific isolation and detection methods were the same as in Example 1. The results showed that Salmonella was detected in the feces of sick chickens and exhibited a strong biofilm formation ability (biofilm OD). 590nm ≥2.0), Salmonella was detected during the composting stage and carried avrA and rpoS All virulence genes were classified as high-risk.

[0057] The above results show that the risk identification accuracy of the monitoring and evaluation method provided by the present invention is significantly higher than that of existing methods, which have the risk of missed detection.

[0058] The Technical Specification for Harmless Treatment of Livestock and Poultry Manure (GB / T36195-2018) stipulates the basic requirements for the harmless treatment of livestock and poultry manure. For solid livestock and poultry manure treatment, the sanitary requirements are: ascarid egg mortality rate ≥95% and fecal coliform count ≤10. 5 The sample count should be per kg, and there should be no live maggots, pupae, or newly emerged adult flies around the pile. No limits are set for the detection of Salmonella, but livestock and poultry manure is an important source of Salmonella contamination, which can easily lead to pathogen residues and drug resistance accumulation, posing potential risks to the environment and agricultural product safety.

[0059] The livestock and poultry manure compost samples identified as high-risk by this invention were tested and found to have a roundworm egg mortality rate far below 95% and a fecal coliform count >10. 5 The livestock and poultry manure compost samples, deemed high-risk by this invention, were used in plant cultivation trials. These samples contained live maggots, pupae, or newly emerged adult flies around the compost pile. Throughout the growth cycle, continuous monitoring was conducted on plant rhizosphere, soil, and plant samples. Results showed that Salmonella was detected in plant tissues after application of the high-risk compost, indicating that while conventional composting achieves a certain degree of hygienic treatment, it fails to effectively eradicate high-risk pathogens such as Salmonella, posing a potential risk of transmission. This fully demonstrates the accuracy and reliability of the monitoring and evaluation method of this invention.

[0060] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for monitoring and evaluating the risk of transmission of pathogenic bacteria from poultry farm feces, characterized in that, The assessment includes evaluating the risk of Salmonella transmission during the poultry physiological cycle. This evaluation comprises the following steps: collecting feces from poultry at eight different stages: initial defecation, chick stage, initial egg-laying stage, peak egg-laying stage, cessation of egg-laying stage, sick poultry, antibiotic administration stage, and composting stage. Salmonella is isolated from the feces at each stage, and the biofilm formation and virulence gene carriage of Salmonella are detected. The feces containing detected Salmonella and with a biofilm OD (dryness over time) are then analyzed. 590nm Stool samples with a concentration ≥2.0 and / or containing Salmonella and carrying virulence genes are defined as high-risk; stool samples with other concentrations are defined as low-to-medium risk. The virulence genes include... rpoS, avrA and cdtB At least one of them.

2. The monitoring and evaluation method according to claim 1, characterized in that, Methods for detecting the amount of Salmonella biofilm formation include crystal violet staining or laser confocal microscopy. The crystal violet staining method includes the following steps: inoculating Salmonella into a culture plate, staining with crystal violet, eluting with ethanol, and then detecting the OD using a microplate reader. 590nm value.

3. The monitoring and evaluation method according to claim 1, characterized in that, Methods for detecting virulence gene carrier status include PCR methods. rpoS The primer sets are shown in SEQ ID NO.1 and SEQ ID NO.2, for detecting virulence genes. avrA The primer sets are shown in SEQ ID NO.3 and SEQ ID NO.4, for detecting virulence genes. cdtB The primer sets are shown in SEQ ID NO.5 and SEQ ID NO.

6.

4. The monitoring and evaluation method according to claim 1, characterized in that, It also includes a drug resistance warning risk assessment associated with drug administration behavior. The drug resistance warning risk assessment associated with drug administration behavior includes the following steps: taking feces during the drug administration period and after the drug administration period, respectively, and detecting the proportion of multidrug-resistant bacteria in the fecal samples at different times. If the proportion of multidrug-resistant bacteria in the fecal samples is >30%, it is judged as a high risk of drug resistance warning. If the proportion of multidrug-resistant bacteria in the fecal samples is ≤30%, it is judged as a medium-low risk of drug resistance warning.

5. The monitoring and evaluation method according to claim 4, characterized in that, The method for detecting the proportion of multidrug-resistant bacteria in fecal samples at different time periods includes the following steps: Fecal samples are serially diluted 10-fold with physiological saline. Equal aliquots are then inoculated onto Mueller Hinton agar plates containing antibiotics, and simultaneously onto Mueller Hinton agar plates without antibiotics. After incubation at 37°C for 24–48 hours, the colonies on the plates are counted. The proportion of multidrug-resistant bacteria is calculated as: (Number of colonies on Mueller Hinton agar plates containing antibiotics / Number of colonies on Mueller Hinton agar plates without antibiotics) × 100%.

6. The monitoring and evaluation method according to claim 5, characterized in that, The added antibiotics are tetracycline, oxytetracycline, neomycin sulfate, and tylosin tartrate.

7. The monitoring and evaluation method according to claim 6, characterized in that, In Mueller Hinton agar plates containing antibiotics, the concentrations were: tetracycline 40 IU / mL, oxytetracycline 200 IU / mL, neomycin sulfate 680 IU / mL, and tylosin tartrate 680 IU / mL.

8. The monitoring and evaluation method according to claim 1, characterized in that, It also includes functional monitoring during the composting process, which includes monitoring of microbial community structure and metabolic function. In the results of the metabolic function monitoring, PWY-3781 is used as a positive monitoring indicator and the activity of the sucrose degradation pathway is used as a negative monitoring indicator. If the relative abundance of PWY-3781 is ≥40% and the activity of the sucrose degradation pathway shows a decreasing trend, it indicates that the composting meets the standards.

9. The monitoring and evaluation method according to claim 8, characterized in that, The metabolic function monitoring is based on a 16S rRNA-based functional prediction method, combined with the MetaCyc database to dynamically track changes in the metabolic pathways of composting microorganisms.

10. The monitoring and evaluation method according to claim 8, characterized in that, The monitoring of the microbial community structure includes detecting changes in microbial alpha diversity and actinomycete abundance during composting. If the number of observed species in the microbial community is above 200 and the relative abundance of actinomycetes is ≥30%, it indicates that the composting meets the standards.