Methods and compositions for altering gene expression
By employing an expression system combining silencing and synthesis modules, and utilizing modified U7 small nuclear RNA and antisense nucleic acid sequences, the expression of endogenous target proteins is reduced and recombinant forms are generated. This addresses the overexpression toxicity problem caused by chimeric expression in gene therapy, achieving uniform target gene expression and effective disease treatment.
Patent Information
- Application Number
- CN202480077910.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-10-11
- Filing Date
- 2024-10-10
- Publication Date
- 2026-07-10
Smart Images

Figure CN122374047A_ABST
Abstract
Description
[0001] Cross-referencing This application claims the benefit of U.S. Provisional Application No. 63 / 589,516, filed October 11, 2023, which is incorporated herein by reference.
[0002] By referencing the merged sequence list This application is submitted together with a sequence list in electronic format. The sequence list is provided as a file named 062692-507001WO.xml, created on October 9, 2024, with a file size of 1,436,838 bytes. Information in the electronic format of the sequence list is incorporated herein by reference in its entirety. Background Technology
[0003] Some conditions, such as X-linked disorders, may be caused by insufficient gene haploidy. In some cases, tissues exhibit chimeric gene expression. This chimeric expression may be due to random X chromosome inactivation, which can result in approximately 50% of the cells in the tissue expressing the gene at normal levels, while another 50% of the cells in the tissue completely lack gene expression. This can pose problems for gene therapy using gene replacement, especially when gene overexpression is toxic and some cells have maintained normal gene expression. Therefore, it may be useful not only to restore gene expression in cells lacking gene expression, but also to avoid overexpression in all cells, especially those expressing the gene at wild-type levels. This article provides solutions to these and other problems in the art in particular. Summary of the Invention
[0004] In some implementations, this document discloses systems for altering target expression. Some implementations include silencing modules and expression modules.
[0005] In some implementations, this document discloses an expression system for altering gene expression, comprising: A silencing module deoxyribonucleic acid (DNA) sequence comprising: a first promoter sequence, an optional exon splicing silencer (ESS) sequence, an antisense sequence of the target ribonucleic acid (RNA), an Sm binding site sequence, a 3' hairpin sequence, and a 3' terminator sequence, wherein the silencing module encodes a modified U7 small nuclear RNA (snRNA) that silences or reduces the expression of an endogenous target protein; and The target synthesis module DNA sequence comprises: a second promoter sequence, a 5' untranslated region (UTR) sequence, a target-coding sequence (CDS), and a 3' UTR sequence, wherein the target synthesis module encodes a recombinant messenger RNA (mRNA) that generates the target protein.
[0006] In some implementations, the DNA molecule of the silencing module contains an array of arrayed silencing modules. In some embodiments, the first promoter comprises the mouse U1 snRNA (“MmU1”) promoter, mouse U2 snRNA (“MmU2”) promoter, mouse U3 snRNA (“MmU3”) promoter, mouse U4 snRNA (“MmU4”) promoter, mouse U5 snRNA (“MmU5”) promoter, mouse U6 snRNA (“MmU6”) promoter, mouse U7 snRNA (“MmU7”) promoter, mouse U11 snRNA (“MmU11”) promoter, mouse U12 snRNA (“MmU12”) promoter, mouse U7SK snRNA (“MmU7SK”) promoter, human U1 snRNA (“HsU1”) promoter, human U2 snRNA (“HsU2”) promoter, human U3 snRNA (“HsU3”) promoter, human U4 snRNA (“HsU4”) promoter, and human U5 snRNA. Functional combinations of the following promoters: (“HsU5”) promoter, human U6 snRNA (“HsU6”) promoter, human U7 snRNA (“HsU7”) promoter, human U11 snRNA (“HsU11”) promoter, human U12 snRNA (“HsU12”) promoter, human U7SK snRNA (“HsU7SK”) promoter, or fragments thereof. In some embodiments, the silencing module comprises an ESS. In some embodiments, the ESS recruits a protein factor or a group of protein factors that reduce or silence splicing of the endogenous target RNA. In some embodiments, the antisense nucleic acid sequence is completely or partially anticomplementary to the targeted region. In some embodiments, the antisense nucleic acid sequence is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 100% anticomplementary to the targeted region. In some embodiments, the targeted region is within an intron of the endogenous target RNA. In some embodiments, the targeted region is within an exon of the endogenous target RNA. In some embodiments, the antisense nucleic acid sequence targets an alternative splicing exon of an endogenous target RNA. In some embodiments, the targeted region is within 100 nucleotides at the intron / exon junction. In some embodiments, the antisense nucleic acid sequence is 10-60 nucleotides in length. In some embodiments, the silencing module further includes an Sm binding site sequence. In some embodiments, the hairpin sequence includes a 3' hairpin sequence of U7 small nuclear RNA (snRNA).In some implementations, the 3' terminator sequence includes the following 3' terminator sequences: mouse U1 snRNA (“MmU1”), mouse U2 snRNA (“MmU2”), mouse U3 snRNA (“MmU3”), mouse U4 snRNA (“MmU4”), mouse U5 snRNA (“MmU5”), mouse U6 snRNA (“MmU6”), mouse U7 snRNA (“MmU7”), mouse U11 snRNA (“MmU11”), mouse U12 snRNA (“MmU12”), mouse U7SK snRNA (“MmU7SK”), human U1 snRNA (“HsU1”), and human U2 snRNA. The functional combination of the following sequences: (“HsU2”) 3' terminator sequence, human U3 snRNA (“HsU3”) 3' terminator sequence, human U4 snRNA (“HsU4”) 3' terminator sequence, human U5 snRNA (“HsU5”) 3' terminator sequence, human U6 snRNA (“HsU6”) 3' terminator sequence, human U7 snRNA (“HsU7”) 3' terminator sequence, human U11 snRNA (“HsU11”) 3' terminator sequence, human U12 snRNA (“HsU12”) 3' terminator sequence, human U7SK snRNA (“HsU7SK”) 3' terminator sequence, or fragments thereof. In some embodiments, the second promoter sequence contains a weak promoter that drives mRNA molecule expression at a rate no greater than that of the endogenous target promoter. In some embodiments, the second promoter sequence comprises a promoter sequence of the -Ubc promoter, PGK promoter, or EF1a-core promoter. In some embodiments, the synthesis module further comprises an SV40 intron sequence. In some embodiments, the synthesis module further comprises a 5' untranslated region (UTR) sequence of the target RNA. In some embodiments, the synthesis module further comprises a Kozak sequence. In some embodiments, the CDS contains introns. In some embodiments, the CDS does not contain introns. In some embodiments, the synthesis module comprises a polyA signal sequence. In some embodiments, the polyA signal sequence includes a -bGH signal sequence, an SV40 signal sequence, or an hGH polyA signal sequence.In some implementations, the silencing module reduces the measurement of a target (e.g., protein or RNA, such as MECP2 protein or RNA) in cells or cell populations by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% relative to a baseline target measurement. In some embodiments, the synthesis module increases the target (e.g., protein or RNA, such as MECP2 protein or RNA) measurement in cells or cell populations by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240%, or at least 250% relative to a control. In some embodiments, contact of the system with cells or cell populations or expression therein results in a target (e.g., protein or RNA, such as MECP2 protein or RNA) measurement between 1x and 2x relative to a control.
[0007] In some implementations, this document discloses a dual RNA system for altering gene expression, comprising: The U7 small nuclear RNA (snRNA) silencing module comprises: an exon splice silencer (ESS) nucleic acid sequence, an antisense nucleic acid sequence binding to target ribonucleic acid (RNA), an Sm binding site sequence, and a 3' hairpin sequence; and The target messenger RNA (mRNA) synthesis module includes: a 5' untranslated region (UTR) sequence, a target-coding sequence (CDS), and a 3' UTR sequence; The U7 snRNA silencing module silences or reduces the expression of endogenous target proteins, and the target mRNA synthesis module generates target proteins.
[0008] In some implementations, this document discloses a system for altering gene expression, which comprises: A silencing module comprising an exon splicing silencer (ESS) nucleic acid sequence coupled to an antisense nucleic acid sequence that targets an endogenous target ribonucleic acid (RNA); and A synthesis module containing a nucleic acid coding sequence (CDS) that encodes a recombinant form of a target RNA.
[0009] In some embodiments, this document discloses pharmaceutical compositions comprising the systemically and pharmaceutically acceptable carriers described herein. In some embodiments, this document discloses methods comprising administering the pharmaceutical composition to a subject. In some embodiments, the subject has been identified as having a hereditary disease prior to treatment. In some embodiments, the hereditary disease is associated with haploid deficiency of endogenous target RNA. In some embodiments, the hereditary disease is associated with tissue chimeric expression of endogenous target RNA. In some embodiments, the hereditary disease includes Rett syndrome.
[0010] In some embodiments, methods are disclosed herein that include: inhibiting protein expression of endogenous target RNA in a first cell expressing endogenous target RNA; and synthesizing or enhancing protein expression of a recombinant form of the target RNA in a second cell that otherwise does not express endogenous target RNA, or expresses endogenous target RNA at a low level. Some embodiments include synthesizing or enhancing protein expression of a recombinant form of the target RNA in the first cell.
[0011] In some embodiments, inhibition is performed after contacting the first cell with the silencing module or with a vector encoding the silencing module. In some embodiments, inhibiting protein expression comprises inhibiting the expression of an endogenous target protein by at least 10%. In some embodiments, the synthetic or enhanced recombinant target protein expression is performed after contacting the second cell with the synthetic module or with a vector encoding the synthetic module. In some embodiments, enhancing recombinant target protein expression comprises enhancing protein expression by at least 10%. In some embodiments, the low expression level of endogenous target RNA in the second cell comprises an undetectable level, a level below the desired level, a level below the level of wild-type cells, or a level below the expression in the first cell. In some embodiments, the low expression level of endogenous target RNA in the second cell comprises a level at least 10% lower than that in the first cell. In some embodiments, the silencing module and the synthetic module are encoded together in a nucleic acid construct. In some embodiments, the nucleic acid construct is delivered to the first and second cells using one or more viral vectors. In some embodiments, the silencing module and the synthetic module are encoded in separate nucleic acid constructs. In some embodiments, the nucleic acid construct or separate nucleic acid constructs are delivered to the cells using one or more viral vectors. Attached Figure Description
[0012] Figure 1A This is a schematic diagram of a nucleic acid vector encoding RNA, which is used to simultaneously deplete endogenous targets and express targets.
[0013] Figure 1B This is a schematic diagram of a nucleic acid vector encoding RNA, which is used to simultaneously deplete an endogenous target containing methyl CpG binding protein 2 (MECP2 or Mecp2) and express a regulated target transgene containing the MECP2 transgene.
[0014] Figure 2 This is a schematic diagram of a modified 3' UTR, which includes endogenous human 3' UTRs, here... MECP2 A fragment array of 3' UTRs.
[0015] Figure 3 The figure shows the experimental results, where candidate U7 constructs were screened in quadruplicate, and ranked by their merge order and target within each experiment. Mecp2 The overall level was reduced and sorted.
[0016] Figure 4 The figure shows the experimental results, where U7 candidates 1 and 2 were transfected into Neuro-2a cells, and their reduction of the target marker (here) was confirmed by qRT-PCR. Mecp2 (Level of ability)
[0017] Figure 5 This is a graph showing the experimental results, where candidate U7 1 or 2 and those containing Mecp2 Intron 1 and 3 segments Mecp2 Co-expression of the transgene together reduced total [expression] in Neuro-2a cells. Mecp2 Express.
[0018] Figure 6 This shows the effects of different amounts of AAV expressing U7 candidate 1 in primary mouse cortical neurons. Mecp2 A graph showing the dose-dependent decrease in RNA levels.
[0019] Figure 7 This figure shows the reduction in MECP2 protein levels in transduced cells after delivery of AAV expressing U7 candidate 1 or 2 to adult C57Bl / 6J mice. The figure includes groups with three bars. In each group, the left bar corresponds to U7-Scram, the middle bar to U7-01, and the right bar to U7-02.
[0020] Figure 8 Images including immunohistochemical images of MECP2, showing reduced MECP2 protein levels in animals injected with AAV expressing Ubc-Mecp2 along with U7 candidate 1 or 2 compared to animals expressing Ubc-Mecp2 alone.
[0021] Figure 9 The figure shows the immunohistochemical results including MECP2, which demonstrates reduced MECP2 protein levels in animals injected with AAV expressing Ubc-Mecp2 along with U7 candidate 1 or 2 compared to animals expressing Ubc-Mecp2 alone.
[0022] Figure 10 The figure shows the results, in which the total MECP2 protein level of each thalamic cell was normalized in wild-type female mice injected with Ubc-Mecp2-U7-01 or Ubc-Mecp2-U7-02 compared with animals expressing Ubc-Mecp2 with out-of-order U7 boxes.
[0023] Figure 11 It is a female heterozygous type Mecp2 Violin plots of MECP2 protein expression levels in thalamic cells in mutant mice, showing the normalization of MECP2 protein expression patterns in animals injected with Ubc-Mecp2-U7-01 or Ubc-Mecp2-U7-02 compared to animals expressing Ubc-Mecp2 with out-of-order U7 boxes.
[0024] Figure 12 The image is a violin plot showing the MECP2 protein level in each cell of the cortex of wild-type mice that received a systemic injection of the unregulated vector or candidate 2 at P28.
[0025] Figure 13 The image is a violin plot showing the MECP2 protein level in each cell of the thalamus of wild-type mice that received a systemic injection of the unregulated vector or candidate 2 at P28.
[0026] Figure 14 This is a violin plot of the logarithmic transformation, showing the wild-type and [uncontrolled] cells at P28 after systemic injection of the uncontrolled carrier or candidate 2. Mecp2 + / - MECP2 protein levels in each cell of the thalamus of mice.
[0027] Figure 15 These are Kaplan-Meier curves, showing the survival curves of male mice with noted genotypes and dosages, injected with saline or candidate-02. Animals were given systemic injections at P28.
[0028] Figure 16 This is a graph showing the weekly phenotypic “Bird” score, a commonly used scoring system for evaluating phenotypic progression in a mouse model of Rett syndrome. Mice with the genotype were administered saline or the stated dose of virus via IV injection at P28.
[0029] Figure 17 These are Kaplan-Meier curves, showing the survival curves of male mice with noted genotypes and dosages, injected with saline or candidate-02. Animals were given systemic injections at P14.
[0030] Figure 18 This is a graph showing the weekly phenotypic “Bird” score, a commonly used scoring system for evaluating phenotypic progression in a mouse model of Rett syndrome. Mice with the genotype were administered saline or the stated dose of virus via IV injection at P14.
[0031] Figure 19 This shows the wild-type and heterozygous types at P28, administered with saline or the stated dose of AAV. Mecp2 A graph showing the weekly weight of mutant female mice.
[0032] Figure 20 This is a quantification of total MECP2 protein levels in ReNcell CX cultures differentiated with two candidate U7 constructs. Cells were transduced with 1e10vg AAV, which yielded ~70% transduction efficiency, or cells were treated with formulation buffer for 1 week before analysis.
[0033] Figure 21 This is a schematic diagram of a fully humanized therapeutic carrier.
[0034] Figure 22 This is a quantification of total MECP2 protein levels in differentiated ReNcell CX cultures treated with the following: formulation buffer, mouse therapeutic vector used in mouse studies, or [other treatments]. Figure 21 One of two different humanized therapeutic vector candidates corresponding to the U7 sequence used. Cells were transduced with the stated dose of AAV or treated with formulation buffer for one week, followed by analysis.
[0035] Figure 23 This includes a schematic diagram of the luciferase reporter gene, which contains a pervasive promoter (Ubc-SV40pA), a canonical Kozak sequence, and a mouse... Scn2a Fragment of exon 13, mouse Scn2a Fragment of intron 13, mouse Scn2a Exon 13N, mouse Scn2a Another fragment of intron 13 and mice Scn2a A fragment of exon 14 is fused within the firefly luciferase frame.
[0036] Figure 24(Top) Includes endpoint RT-PCR results for NMD isotype (upper band) and productive isotype (lower band), and (Bottom) analysis of relative NMD and productive isotype transcript levels of Scn2a exon 13 in mouse Neuro-2a cells expressing candidate ESS and U7 antisense sequences, driven by a combination of the mu1a1 promoter and HU1 terminator.
[0037] Figure 25 The relative levels of NaV1.2 in differentiated ReNcell CX cultures transduced using three different U7 targeting sequences identified by this system (scrambled or otherwise). NaV1.2 levels in the figure have been normalized to the protein levels of actin in each sample. Detailed Implementation
[0038] A method has been developed that avoids toxic overexpression of target genes such as MECP2 by depleting the endogenous gene product expressed by the wild-type X chromosome in cells while simultaneously expressing the wild-type form of the gene under the control of constitutively expressed promoters and endogenous regulatory elements. The method can include gene therapy methods that can be used to treat hereditary conditions such as Rett syndrome, without toxic transgene overexpression, comprising multiple functional units. The method can include a silencing module and a synthesis module. The silencing module can utilize modified U7 small nuclear RNA (snRNA) that silences or reduces the expression of endogenous targets. The synthesis module can use recombinant target genes or target mRNA to produce the target.
[0039] In some embodiments, this document discloses systems for altering target expression. The system may include a dual system for reducing endogenous target expression while simultaneously expressing a recombinant form of the target. This can be performed in separate cells or in the same cell, depending on, for example, the level of endogenous target expression in the cell. Some embodiments include RNA that reduces endogenous target expression, such as modified U7 small nuclear RNA (snRNA). Some embodiments include RNA encoding a recombinant target. Some embodiments include an expression construct encoding RNA. Methods for using the system to modify target expression are also included. These methods can be used to treat conditions associated with target expression.
[0040] Some embodiments relate to systems for altering gene expression. The system may include a silencing module. The silencing module may include an exon splice silencer (ESS) nucleic acid sequence. The ESS may be coupled to an antisense nucleic acid sequence targeting an endogenous target ribonucleic acid (RNA). The system may include a synthesis module. The synthesis module may include a nucleic acid coding sequence (CDS). The CDS may encode a recombinant form of the target RNA. Some embodiments relate to systems for altering gene expression comprising: a silencing module containing an exon splice silencer (ESS) nucleic acid sequence coupled to an antisense nucleic acid sequence targeting an endogenous target ribonucleic acid (RNA); and a synthesis module containing a nucleic acid coding sequence (CDS) encoding a recombinant form of the target RNA. Examples of target RNA may include RNA encoding a target such as MECP2. For the systems provided herein, in embodiments, components are combined together within a single nucleic acid. For example, components may be in a single viral vector or plasmid. In embodiments, individual components are in separate nucleic acids. In embodiments, some components are separated into multiple nucleic acids. In the implementation, the synthesis module and the silencing module are included in separate nucleic acids. For example, the synthesis module may be in a first expression cassette, and the silencing module may be in a second expression cassette. The system may include an expression construct. The system may include RNA such as U7 sRNA and mRNA. The RNA may be encoded by the expression construct. The system may be included in a method, such as a treatment method. Examples of treatable diseases may include Dravet syndrome. Other examples may include other haploid deficiency diseases or conditions characterized by chimeric expression of the target gene. X-linked diseases or duplication syndromes may also be treated using the methods and compositions described herein. Examples of duplication syndromes may include Mecp2 duplication syndrome. The target gene may include target RNA or target protein encoded by the target gene.
[0041] This disclosure includes therapies in which the expression of a target gene is both knocked down and increased within cells. Due to random X chromosome inactivation, cells in patients with the disease may have some or no expression of the target gene. AAV can be delivered to a variety of cells, and in cells expressing endogenous transcripts of the target gene, the target gene is suppressed and then replaced by expression from the AAV. In some embodiments, in cells lacking target gene expression, knockdown of the endogenous target gene does not occur, but expression of the target gene from the AAV does.
[0042] This article describes compositions and methods for treating neurodevelopmental disorders in subjects with this need. The compositions and methods described herein address an unmet need for safe and effective treatment of neurodevelopmental disorders. Neurodevelopmental disorders can be caused, for example, by mutations in genes encoding targets (e.g., MECP2 For example, leading to MECP2 Haploid deficiency is genetically caused. This article describes compositions and methods for treating conditions such as Rett syndrome or MECP2 duplication syndrome in subjects with this need. The compositions and methods described herein address the unmet need for safe and effective treatment of conditions such as Rett syndrome and MECP2 duplication syndrome.
[0043] The compositions and methods provided herein can improve upon previous methods and systems. Some of the previous systems are described at Sinnett et al., Brain, 29 November 2021; 144(10):3005-3019; Gadala et al., Mol Therapy, 22 April 2017:5:180-190; Sinnett et al., Mol Therapy, 19 April 2017:5:106-115; and Luoni et al., eLife, 24 March 2020:9:e52629, all of which are incorporated herein by reference in their entirety.
[0044] In some implementations, contact with or expression of the system in cells or cell populations results in a target (e.g., protein or RNA, such as MECP2 protein or RNA) measurement of at least 0.5x, at least 0.6x, at least 0.7x, at least 0.8x, at least 0.9x, at least 1x, at least 1.1x, at least 1.2x, at least 1.3x, at least 1.4x, at least 1.5x, at least 1.6x, at least 1.7x, at least 1.8x, at least 1.9x, at least 2x, at least 2.1x, at least 2.2x, at least 2.3x, at least 2.4x, or at least 2.5x relative to a control. In some embodiments, contact with or expression of the system in cells or cell populations results in target (e.g., protein or RNA, such as MECP2 protein or RNA) measurements that are less than 0.5x, 0.6x, 0.7x, 0.8x, 0.9x, 1x, 1.1x, 1.2x, 1.3x, 1.4x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 2.1x, 2.2x, 2.3x, 2.4x, or 2.5x relative to a control. In some embodiments, contact with or expression of the system in cells or cell populations results in target (e.g., protein or RNA, such as MECP2 protein or RNA) measurements that are between 0.5x and 2.5x relative to a control. In some implementations, contact of the system with cells or cell populations, or expression therein, results in a target (e.g., protein or RNA, such as MECP2 protein or RNA) measurement between 1x and 2x relative to a control. A control may be or include cells or cell populations that have not been contacted with the system. A control may be or include cells or cell populations that do not express the system.
[0045] Expression system This document provides, in particular, an expression system. This system may be able to silence the expression of endogenous genes (e.g., genes affected by hereditary diseases) and synthesize or enhance the expression of recombinant forms of those genes. For example, in one embodiment, the expression system provided herein silences the expression of an endogenous form of a target protein encoded by an endogenous gene (e.g., an endogenous target RNA) and simultaneously generates a recombinant form of the target protein encoded by a recombinant form of that gene (e.g., a nucleic acid coding sequence encoding the target protein, or recombinant mRNA). The expression system provided herein includes, in embodiments thereof, a modified U7 small nuclear RNA (snRNA) capable of specifically targeting endogenous mRNA or a portion thereof, upregulating or downregulating the splicing of exons in endogenous mRNA (e.g., precursor mRNA), thereby inhibiting or downregulating the expression of endogenous genes (e.g., genes affected by hereditary diseases). For example, an expression system may include an exon splice silencer (ESS) sequence capable of downregulating or inhibiting splicing or inducing exon jumping, and an antisense nucleic acid sequence targeting an endogenous target ribonucleic acid (RNA), thereby silencing the expression of an endogenous protein encoded by that RNA. Thus, in embodiments, the expression system downregulates or inhibits the expression of an endogenous form of a target protein. The expression system provided herein, including its embodiments, also includes a synthetic module DNA sequence that allows the expression of a recombinant form of the target gene. In embodiments, the expression system thus induces or facilitates the generation of a recombinant form of the target protein. For example, the synthetic module DNA sequence may include a nucleic acid-coding sequence encoding a recombinant form of the target protein, which has at least 80% identity with the endogenous form of the target protein. The expression system may be or include a DNA construct encoding one or more RNAs.
[0046] In the implementation scheme, the expression of a silenced gene refers to the suppression or downregulation of gene expression levels. For example, the expression of a silenced gene includes suppressing or downregulating precursor mRNA processing. In another example, the expression of a silenced gene includes downregulating or suppressing the production of a protein encoded by the gene. In the implementation scheme, the expression system reduces the expression of an endogenous gene by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% relative to the endogenous target protein level in the absence of an expression system. For example, the expression system can reduce the level of an endogenous target protein by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% relative to the endogenous target protein level in the absence of an expression system.
[0047] Some embodiments include synthesizing a target protein (e.g., from mRNA encoding the target protein). The mRNA encoding the target protein may be encoded by a synthetic construct. In embodiments, the recombinant form of the synthetic gene or the recombinant mRNA comprises a gene expressed for an extracellular nucleic acid (e.g., a gene affected by a hereditary condition). In embodiments, the expression system provided herein produces a recombinant form of the target protein (e.g., a protein produced from recombinant mRNA, or a protein encoded by recombinant mRNA), wherein the level of the recombinant form of the target protein is at least 10% of the level of the endogenous form of the protein in healthy cells (e.g., cells not affected by the hereditary condition Rett syndrome). In some embodiments, the level of the recombinant form is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, or at least 120% of the level in healthy cells. In some implementations, the level of the recombinant form is no more than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, or 120% of the level in healthy cells.
[0048] The protein encoded by mRNA can be recombinant. In some embodiments, the protein is considered recombinant because it is produced by recombinant nucleic acid or by mRNA encoded by recombinant nucleic acid. In some embodiments, the protein is further considered recombinant because it includes modifications relative to the endogenous form of the protein. In one embodiment, the recombinant form of the target protein produced by recombinant mRNA has at least 80% sequence identity with the endogenous form of the target protein. In another embodiment, the recombinant form of the target protein produced by recombinant mRNA has at least 85% sequence identity with the endogenous form of the target protein. In yet another embodiment, the recombinant form of the target protein produced by recombinant mRNA has at least 90% sequence identity with the endogenous form of the target protein. In yet another embodiment, the recombinant form of the target protein produced by recombinant mRNA has at least 91% sequence identity with the endogenous form of the target protein. In yet another embodiment, the recombinant form of the target protein produced by recombinant mRNA has at least 92% sequence identity with the endogenous form of the target protein. In one implementation scheme, the recombinant form of the target protein generated from recombinant mRNA shares at least 93% sequence identity with the endogenous form of the target protein. In another implementation scheme, the recombinant form of the target protein generated from recombinant mRNA shares at least 94% sequence identity with the endogenous form of the target protein. In yet another implementation scheme, the recombinant form of the target protein generated from recombinant mRNA shares at least 95% sequence identity with the endogenous target protein. In yet another implementation scheme, the recombinant form of the target protein generated from recombinant mRNA shares at least 96% sequence identity with the endogenous target protein. In yet another implementation scheme, the recombinant form of the target protein generated from recombinant mRNA shares at least 97% sequence identity with the endogenous form of the target protein. In yet another implementation scheme, the recombinant form of the target protein generated from recombinant mRNA shares at least 98% sequence identity with the endogenous form of the target protein. In yet another implementation scheme, the recombinant form of the target protein generated from recombinant mRNA shares at least 99% sequence identity with the endogenous form of the target protein. In some embodiments, the recombinant form of the target protein generated from the recombinant mRNA includes the sequence of the endogenous form of the target protein. In some embodiments, the recombinant form of the target protein has less than 100%, less than 99%, less than 98%, less than 97%, less than 96%, less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, or less than 85% sequence identity with the endogenous form of the target protein.
[0049] In some aspects, an expression system is provided. The system can be used to alter gene expression. The system may include a silencing module. The silencing module may include a silencing module deoxyribonucleic acid (DNA) sequence. The silencing module may include a first promoter sequence. The silencing module may include an exon splice silencer (ESS) nucleic acid sequence. The silencing module may include an antisense nucleic acid sequence targeting an endogenous target ribonucleic acid (RNA). The silencing module may include an Sm binding site sequence. The silencing module may include a 3' hairpin sequence. The silencing module may include a 3' terminator sequence. The system may include a target synthesis module. The synthesis module may include a synthesis module DNA sequence. The synthesis module may include a second promoter sequence. The synthesis module may include a 5' untranslated region (UTR) sequence. The synthesis module may include a nucleic acid coding sequence (CDS) encoding a target protein. The synthesis module may include a 3' UTR sequence. In some aspects, the silencing module encodes a modified U7 small nuclear RNA (snRNA) that silences or reduces the expression of an endogenous target protein. In some aspects, the synthesis module encodes recombinant messenger RNA (mRNA) that generates a recombinant target protein.
[0050] In one aspect, an expression system for altering gene expression is provided, comprising: a silencing module DNA sequence comprising: a first promoter sequence, an exon splicing silencer (ESS) nucleic acid sequence, an antisense nucleic acid sequence targeting an endogenous target RNA, an Sm binding site sequence, a 3' hairpin sequence, and a 3' terminator sequence; and a synthesis module DNA sequence comprising: a second promoter sequence, a 5' untranslated region (UTR) sequence, a nucleic acid coding sequence (CDS) encoding a target protein, and a 3' UTR sequence; wherein the silencing module encodes a modified U7 small nuclear RNA (snRNA) that silences or reduces the expression of the endogenous target protein, and the target synthesis module encodes recombinant messenger RNA (mRNA) that generates a recombinant form of the target protein.
[0051] As examples, some aspects include expression systems for altering gene expression, comprising: a silencing module deoxyribonucleic acid (DNA) sequence comprising: a first promoter sequence, an exon splicing silencer (ESS) nucleic acid sequence, an antisense nucleic acid sequence targeting an endogenous target such as MECP2 ribonucleic acid (RNA), an Sm binding site sequence, a 3' hairpin sequence, and a 3' terminator sequence; and a target synthesis module DNA sequence comprising: a second promoter sequence, a 5' untranslated region (UTR) sequence, a target-coding nucleic acid sequence (CDS), and a 3' UTR sequence; wherein the silencing module encodes a modified U7 small nuclear RNA (snRNA) that silences or reduces the expression of the endogenous target, and the target synthesis module encodes recombinant messenger RNA (mRNA) that generates a recombinant target protein. In some aspects, an expression system is provided. The system can be used to alter gene expression. The system may include a silencing module. The silencing module may include a silencing module deoxyribonucleic acid (DNA) sequence. The silencing module may include a first promoter sequence. The silencing module may include an exon splicing silencer (ESS) nucleic acid sequence. The silencing module may include an antisense nucleic acid sequence targeting an endogenous target ribonucleic acid (RNA). The silencing module may include an Sm binding site sequence. The silencing module may include a 3' hairpin sequence. The silencing module may include a 3' terminator sequence. The system may include a target synthesis module (e.g., a MECP2 synthesis module). The synthesis module may include a synthesis module DNA sequence. The synthesis module may include a second promoter sequence. The synthesis module may include a 5' untranslated region (UTR) sequence. The synthesis module may include a nucleic acid coding sequence (CDS) encoding the target. The synthesis module may include a 3' UTR sequence. In some aspects, the silencing module encodes a modified U7 small nuclear RNA (snRNA) that silences or reduces the expression of an endogenous target protein. In some aspects, the target synthesis module encodes recombinant messenger RNA (mRNA) that generates a recombinant target protein.
[0052] The terms "snRNA" and "small nuclear RNA" can include RNA molecules that are typically involved in the processing of other RNA molecules, such as precursor mRNA, histone RNA, etc. For example, snRNA can function in the splicing of precursor mRNA molecules. For example, snRNA can bind to and / or recruit proteins involved in RNA processing. The snRNA / protein complex can be referred to as a small nuclear ribonucleoprotein (snRNP). For example, snRNA can bind to one or more Sm proteins, which are typically regulated and involved in precursor mRNA processing. In embodiments, the snRNA is about 40 to 200 nt in length. In embodiments, the snRNA is U7 snRNA.
[0053] The terms “U7 small nucleus snRNA” and “U7 snRNA” can refer to RNA molecules that may constitute part of a small nucleus ribonucleoprotein complex (U7 snRNP) or may play a role in mRNA processing. “Modified U7 small nucleus snRNA” or “modified snRNA” can refer to U7 snRNA that includes one or more sequence modifications to affect the splicing of target RNA. Modified snRNA may also include backbone modifications. In embodiments, the U7 snRNA is modified to target a portion of the target mRNA. In embodiments, the modified U7 snRNA may target or bind to endogenous target RNA (e.g., endogenous target precursor mRNA, or endogenous target mRNA). In embodiments, the U7 snRNA is modified to be at least partially complementary to the endogenous target RNA (e.g., an exon of the target RNA). In embodiments, the modification of the U7 snRNA sequence inhibits the binding of splicing factors. Therefore, in embodiments, the modified U7 snRNA does not bind splicing factors. In the implementation scheme, modification of U7 snRNA allows for the recruitment of splicing proteins capable of splicing endogenous target RNAs (e.g., target precursor mRNA).
[0054] "Exon splicing silencer" or "ESS" sequence can refer to a nucleic acid sequence that can inhibit or downregulate the splicing of endogenous target RNA (e.g., target precursor mRNA or target mRNA). In embodiments, ESS inhibits or downregulates the splicing of endogenous target precursor mRNA by inhibiting the binding or recruitment of one or more components of the splicing complex to the endogenous target RNA. In embodiments, ESS inhibits or downregulates the splicing of endogenous target precursor mRNA by inducing exon skipping. Therefore, in embodiments, ESS inhibits or downregulates the splicing of endogenous target RNA. Examples of ESS sequences may include 5'-ATGATAGGGACTTAGGGTGA-3' (SEQ ID NO: 240), 5'-TTTGTTCCGTGGGTGGTTTA-3' (SEQ ID NO: 241), or 5'-TGGGGGGAGGTAGGTAGGTA-3' (SEQ ID NO: 242). The ESS sequence may have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with any of the above-described ESS sequences or their inverse complements. When the sequence is an RNA sequence (as opposed to, for example, a DNA sequence), T may be replaced by U.
[0055] The antisense nucleic acid sequence targeting a target RNA can refer to a nucleic acid sequence capable of recruiting a silencing module to the target RNA or a portion thereof. In embodiments, the antisense nucleic acid sequence targeting the target RNA includes a sequence at least partially complementary to a portion of the target RNA. In embodiments, the antisense nucleic acid sequence targeting the target RNA includes a sequence at least partially complementary to a splicing site of the target RNA. In embodiments, the antisense nucleic acid sequence targeting endogenous target RNA binds to the endogenous target RNA or a portion thereof. In embodiments, the target endogenous RNA encodes an endogenous form of the target protein. For example, the target endogenous RNA can be an endogenous mRNA containing introns and exons. Therefore, in embodiments, the target endogenous RNA is RNA involved in the production of endogenous proteins.
[0056] The term "target protein" can refer to a protein whose expression level is altered or sought to be altered by the methods or systems provided herein. Some aspects of this article include reducing the endogenous form of the target protein and increasing the expression of the recombinant form of the target protein.
[0057] The “Sm binding site sequence” may include a sequence that binds to or recruits one or more proteins involved in RNA splicing. In embodiments, the Sm binding site sequence binds to or recruits one or more Sm proteins. “Sm proteins” may include one or more proteins found in the spliceosome small nucleoribonucleoprotein complex. In embodiments, the Sm binding site binds to or recruits one or more of SmB / B0, SmD3, SmE, SmF, and SmG. In embodiments, the Sm binding site sequence binds to or recruits Lsm proteins (e.g., Lsm10, Lsm11). In embodiments, the Sm binding site sequence does not bind to or recruit Lsm proteins (e.g., Lsm10, Lsm11). In embodiments, the Sm binding site binds to or recruits one or more precursor mRNA spliceosome proteins.
[0058] The terms "hairpin sequence," "stem-loop sequence," and "hairpin-loop sequence" are interchangeable and can refer to a region of an RNA oligonucleotide (e.g., an RNA stem-loop oligonucleotide) comprising two nucleotide sequences, base-paired to form a double-stranded (e.g., RNA double helix) structure (e.g., a stem), accompanied by a non-base-paired structure (e.g., a loop) at one end of the double-stranded structure. The double-stranded structure (e.g., a stem) in an RNA stem-loop can be referred to as an "RNA double helix." In an embodiment, the hairpin sequence can form part of a modified U7 snRNA. In an embodiment, the hairpin sequence can increase the stability of the modified U7 small RNA. In an embodiment, the hairpin sequence is located at the 3' of an antisense nucleic acid sequence targeting an endogenous target RNA.
[0059] The term "terminator sequence" or "terminator" can include sequences that regulate RNA production. For example, a terminator sequence can mark the end of an RNA molecule. In embodiments, a terminator sequence refers to the sequence located at the 3' end of a snRNA silencing module. In embodiments, the terminator sequence regulates the stability of the RNA molecule. For example, a terminator sequence can increase the stability of U7 snRNA.
[0060] Systems for altering target expression In some respects, systems for altering gene expression are provided. These systems may include one or more RNAs, such as U7 RNA or silencing modules, and RNA synthesis modules. The systems may be encoded by the expression systems or expression constructs described herein. The systems can alter the expression of targets. Some examples of targets are MECP2 and SCN2A.
[0061] Figure 1A An example of such a system is provided, comprising a synthesis module having a weak promoter driving a target coding sequence and a UTR surrounding the coding sequence; and a silencing module having an snRNA box containing an antisense nucleic acid sequence that binds to the target mRNA and a snRNA regulatory sequence. Any aspect included in Figure 1 can be used in the methods, compositions, or systems described herein.
[0062] In some aspects, systems for altering gene expression are provided. The system may include a dual RNA system. The system may include a silencing module. The silencing module may include a U7 small nuclear RNA (snRNA) silencing module. The silencing module may include an exon splice silencer (ESS) nucleic acid sequence. The silencing module may include an antisense nucleic acid sequence. The antisense nucleic acid sequence can bind to an endogenous target ribonucleic acid (RNA). The silencing module may include an Sm binding site sequence. The silencing module may include a 3' hairpin sequence. The system may include a synthesis module. The synthesis module may include a target messenger RNA (mRNA) synthesis module. The synthesis module may include a 5' untranslated region (UTR) sequence. The synthesis module may include a nucleic acid coding sequence (CDS). The CDS may encode a target protein (e.g., a recombinant form of the target protein). The synthesis module may include a 3' UTR. In some aspects, the U7 snRNA silencing module silences or reduces the expression of an endogenous target protein. In some aspects, the target mRNA synthesis module generates a recombinant form of the target protein.
[0063] In some aspects, a dual RNA system for altering gene expression is provided, comprising: a U7 small nuclear RNA (snRNA) silencing module comprising: an exon splice silencer (ESS) nucleic acid sequence, an antisense nucleic acid sequence binding to an endogenous target ribonucleic acid (RNA), an Sm binding site sequence, and a 3' hairpin sequence; and a target messenger RNA (mRNA) synthesis module comprising: a 5' untranslated region (UTR) sequence, a nucleic acid coding sequence (CDS) encoding a target protein, and a 3' UTR sequence; wherein the U7 snRNA silencing module silences or reduces the expression of the endogenous target protein, and the target mRNA synthesis module generates a recombinant form of the target protein.
[0064] As an example, in some aspects, a dual RNA system for altering gene expression is provided, comprising: a U7 small nuclear RNA (snRNA) silencing module comprising: an exon splice silencer (ESS) nucleic acid sequence, an antisense nucleic acid sequence binding to an endogenous target ribonucleic acid (RNA) (e.g., MECP2 RNA), an Sm binding site sequence, and a 3' hairpin sequence; and a target messenger RNA (mRNA) synthesis module comprising: a 5' untranslated region (UTR) sequence, a target-coding nucleic acid sequence (CDS), and a 3' UTR sequence; wherein the U7 snRNA silencing module silences or reduces the expression of an endogenous target protein, and the target mRNA synthesis module generates a recombinant target protein. In some aspects, a system for altering gene expression is provided. The system may include a dual RNA system. The system may include a silencing module. The silencing module may include a U7 small nuclear RNA (snRNA) silencing module. The silencing module may include an exon splice silencer (ESS) nucleic acid sequence. The silencing module may include an antisense nucleic acid sequence. The antisense nucleic acid sequence may bind to an endogenous target ribonucleic acid (RNA). The silencing module may include an Sm binding site sequence. The silencing module may include a 3' hairpin sequence. The system may include a synthesis module. The synthesis module may include a target messenger RNA (mRNA) synthesis module. The synthesis module may include a 5' untranslated region (UTR) sequence. The synthesis module may include a nucleic acid coding sequence (CDS). The CDS may encode a target protein (e.g., recombinant MECP2 protein). The synthesis module may include a 3' UTR. In some aspects, the U7 snRNA silencing module silences or reduces the expression of endogenous target proteins. In some aspects, the target mRNA synthesis module generates a recombinant form of the target protein.
[0065] This article specifically provides a system for regulating the expression levels of target genes in cells. 。For example, the system provided herein includes embodiments of which are intended to produce recombinant forms of target proteins (e.g., proteins affected by a hereditary condition) in cells, wherein the expression level of the recombinant form of said protein is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 95%, 95%, 96%, 97%, 98%, 99%, or 100% of the endogenous protein expression level in healthy cells (e.g., cells not affected by a hereditary condition, such as Rett syndrome). In embodiments, the expression level of the recombinant gene is at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 times the endogenous gene expression level in healthy cells (e.g., cells not affected by a hereditary condition, cells not affected by Rett syndrome). In the implementation scheme, the expression level of the recombinant protein is less than 4, 3, 2, 1.8, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, or 0.5 times that of the endogenous protein expression level in healthy cells (e.g., cells without Rett syndrome).
[0066] Therefore, in one aspect, a system for altering gene expression is provided, comprising: a silencing module including an exon splice silencer (ESS) nucleic acid sequence coupled to an antisense nucleic acid sequence targeting an endogenous target ribonucleic acid (RNA); and a synthesis module including a nucleic acid coding sequence (CDS) encoding a recombinant form of the target RNA. In embodiments of the system provided herein, the target RNA encodes a target protein. In embodiments, the endogenous target RNA includes an mRNA splicing site.
[0067] In embodiments, the system provided herein is capable of synthesizing or generating recombinant forms of target proteins at levels comparable to the expression levels of endogenous target proteins in healthy cells (e.g., cells without hereditary diseases). For the system provided herein, in embodiments, the expression level of the recombinant form of the target protein is approximately 0.2 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In embodiments, the expression level of the recombinant form of the target protein is approximately 0.3 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In embodiments, the expression level of the recombinant form of the target protein is approximately 0.4 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In embodiments, the expression level of the recombinant form of the target protein is approximately 0.5 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In one embodiment, the expression level of the recombinant form of the target protein is about 0.6 to about 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In another embodiment, the expression level of the recombinant form of the target protein is about 0.7 to about 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is about 0.8 to about 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is about 0.9 to about 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is about 1 to about 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases).
[0068] In one embodiment, the expression level of the recombinant form of the target protein is about 1.1 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In another embodiment, the expression level of the recombinant form of the target protein is about 1.2 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is about 1.3 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is about 1.4 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is about 1.5 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is about 1.6 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In one embodiment, the expression level of the recombinant form of the target protein is about 1.7 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In another embodiment, the expression level of the recombinant form of the target protein is about 1.8 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is about 1.9 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is about 2 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is about 2.1 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is about 2.2 to 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In one embodiment, the expression level of the recombinant form of the target protein is approximately 2.3 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In another embodiment, the expression level of the recombinant form of the target protein is approximately 2.4 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is approximately 2.5 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is approximately 2.6 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases).In one embodiment, the expression level of the recombinant form of the target protein is approximately 2.7 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In another embodiment, the expression level of the recombinant form of the target protein is approximately 2.8 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is approximately 2.9 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is approximately 3 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is approximately 3.1 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is approximately 3.2 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In one embodiment, the expression level of the recombinant form of the target protein is approximately 3.3 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In another embodiment, the expression level of the recombinant form of the target protein is approximately 3.4 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is approximately 3.5 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is approximately 3.6 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is approximately 3.7 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In yet another embodiment, the expression level of the recombinant form of the target protein is approximately 3.8 to 4 times that of the endogenous protein in healthy cells (e.g., cells without hereditary diseases). In the implementation scheme, the expression level of the recombinant form of the target protein is approximately 3.9 to 4 times that of the endogenous protein expression level in healthy cells (e.g., cells without hereditary diseases).In the implementation scheme, the expression level of the recombinant form of the target protein is approximately 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, or 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases or Rett syndrome). In the implementation plan, the expression level of the recombinant form of the target protein is no greater than 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, or 4 times the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases or Rett syndrome). In the implementation plan, the expression level of the recombinant form of the target protein is no greater than the expression level of the endogenous protein in healthy cells (e.g., cells without hereditary diseases or Rett syndrome).
[0069] The system provided herein is further capable of silencing (e.g., suppressing, reducing, or downregulating) the expression levels of endogenous target genes (e.g., genes affected by hereditary diseases) in cells. In embodiments, the system reduces the expression level of endogenous genes by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 95%, 95%, 96%, 97%, 98%, 99%, or 100% compared to the expression level of endogenous genes in the absence of the system. In embodiments, the system reduces the expression level of endogenous genes in cells where the expression level of endogenous genes is undetectable. In embodiments, the expression level of endogenous genes is measured by the level of endogenous target proteins produced via the endogenous genes.
[0070] In one implementation, the system reduces the expression level of endogenous genes by approximately 20% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In another implementation, the system reduces the expression level of endogenous genes by approximately 25% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In yet another implementation, the system reduces the expression level of endogenous genes by approximately 30% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In yet another implementation, the system reduces the expression level of endogenous genes by approximately 35% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In yet another implementation, the system reduces the expression level of endogenous genes by approximately 40% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In yet another implementation, the system reduces the expression level of endogenous genes by approximately 45% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In one implementation, the system reduces the expression level of endogenous genes by approximately 50% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In another implementation, the system reduces the expression level of endogenous genes by approximately 55% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In yet another implementation, the system reduces the expression level of endogenous genes by approximately 60% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In yet another implementation, the system reduces the expression level of endogenous genes by approximately 65% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In yet another implementation, the system reduces the expression level of endogenous genes by approximately 70% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In yet another implementation, the system reduces the expression level of endogenous genes by approximately 75% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In one implementation, the system reduces the expression level of endogenous genes by approximately 80% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In another implementation, the system reduces the expression level of endogenous genes by approximately 85% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In yet another implementation, the system reduces the expression level of endogenous genes by approximately 90% to approximately 100% compared to the expression level of endogenous genes in the absence of the system. In yet another implementation, the system reduces the expression level of endogenous genes by approximately 95% to approximately 100% compared to the expression level of endogenous genes in the absence of the system.
[0071] In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 95% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 90% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 85% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 80% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 75% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 70% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 65% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 60% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 55% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 50% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 45% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 40% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 35% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 30% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20% to approximately 25% compared to the expression level of endogenous genes in the absence of the system. In the implementation scheme, the system reduces the expression level of endogenous genes by approximately 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the expression level of endogenous genes in the absence of the system.In the implementation scheme, the system reduces the expression level of endogenous genes by at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the expression level of endogenous genes in the absence of the system.
[0072] In one implementation, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of the genes in the cells, wherein the total expression level of the genes (including endogenous and recombinant forms) is approximately the same as the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases). In another implementation, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of the genes in the cells, wherein the total expression level of the genes (including endogenous and recombinant forms) is less than 4, 3, 2, 1.8, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, or 0.5 times the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases). In one implementation, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of the genes in the cells, wherein the total expression level of the genes (including endogenous and recombinant forms) is at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 times the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases). In another implementation, the total expression level of the genes (including endogenous and recombinant forms) is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases).
[0073] In one embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is about 0.2 to about 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is about 0.3 to about 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In yet another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is about 0.4 to about 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In one embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is about 0.5 to about 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is about 0.6 to about 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In yet another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is about 0.7 to about 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In one embodiment, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of the genes in the cells, wherein the total expression level of the genes (including endogenous and recombinant forms) is about 0.8 to about 4 times the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases). In another embodiment, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of the genes in the cells, wherein the total expression level of the genes (including endogenous and recombinant forms) is about 0.9 to about 4 times the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases).In one embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 1 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 1.1 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In yet another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 1.2 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In one embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 1.3 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 1.4 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In yet another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 1.5 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In one embodiment, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of the genes in the cells, wherein the total expression level of the genes (including endogenous and recombinant forms) is approximately 1.6 to 4 times the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases). In another embodiment, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of the genes in the cells, wherein the total expression level of the genes (including endogenous and recombinant forms) is approximately 1.7 to 4 times the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases).In one embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 1.8 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 1.9 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In yet another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 2 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In one embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 2.1 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 2.2 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In yet another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 2.3 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In one embodiment, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of the genes in the cells, wherein the total expression level of the genes (including endogenous and recombinant forms) is approximately 2.4 to 4 times the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases). In another embodiment, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of the genes in the cells, wherein the total expression level of the genes (including endogenous and recombinant forms) is approximately 2.5 to 4 times the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases).In one embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 2.6 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 2.7 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In yet another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 2.8 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In one embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 2.9 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 3 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In yet another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 3.1 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In one embodiment, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of the genes in the cells, wherein the total expression level of the genes (including endogenous and recombinant forms) is approximately 3.2 to 4 times the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases). In another embodiment, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of the genes in the cells, wherein the total expression level of the genes (including endogenous and recombinant forms) is approximately 3.3 to 4 times the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases).In one embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 3.4 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 3.5 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In yet another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 3.6 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In one embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 3.7 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 3.8 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease). In yet another embodiment, the expression level of an endogenous gene in cells is systematically silenced (e.g., downregulated, reduced, or suppressed), and a recombinant form of the gene is expressed in the cells, wherein the total expression level of the gene (including both endogenous and recombinant forms) is approximately 3.9 to 4 times the expression level of the endogenous gene in healthy cells (e.g., cells without a hereditary disease).In the implementation scheme, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of genes in cells, wherein the total expression level of said genes (including endogenous and recombinant forms of genes) is approximately 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, or [missing information] times that of endogenous genes in healthy cells (e.g., cells without hereditary diseases). 0.9x, 1x, 1.1x, 1.2x, 1.3x, 1.4x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 2.1x, 2.2x, 2.3x, 2.4x, 2.5x, 2.6x, 2.7x, 2.8x, 2.9x, 3x, 3.1x, 3.2x, 3.3x, 3.4x, 3.5x, 3.6x, 3.7x, 3.8x, 3.9x, or 4x. In the implementation scheme, the system silences (e.g., downregulates, reduces, or suppresses) the expression level of endogenous genes in cells and expresses recombinant forms of genes in cells, wherein the total expression level of said genes (including endogenous and recombinant forms of genes) is less than about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, and 0.8 times the expression level of endogenous genes in healthy cells (e.g., cells without hereditary diseases). 0.9x, 1x, 1.1x, 1.2x, 1.3x, 1.4x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 2.1x, 2.2x, 2.3x, 2.4x, 2.5x, 2.6x, 2.7x, 2.8x, 2.9x, 3x, 3.1x, 3.2x, 3.3x, 3.4x, 3.5x, 3.6x, 3.7x, 3.8x, 3.9x, or 4x.
[0074] Synthesis Module Some embodiments involve a synthesis module. The synthesis module may include a system for increasing the expression of a target nucleic acid (e.g., target RNA or target mRNA). For the systems provided herein, in embodiments, the synthesis module includes an RNA molecule. In embodiments, the RNA molecule includes messenger RNA (mRNA). In embodiments, the mRNA encodes a target protein or a fragment thereof. In embodiments, the mRNA of the synthesis module does not include an mRNA splicing site.
[0075] In one embodiment, the synthesis module includes a DNA molecule. In another embodiment, the DNA molecule encodes a target protein or a fragment thereof. In yet another embodiment, the DNA molecule of the synthesis module encodes mRNA. In yet another embodiment, the mRNA encodes a target protein or a fragment thereof. In yet another embodiment, the mRNA does not include an mRNA splicing site.
[0076] Some implementations of the synthesis module include any one or all of the following: • Weak and ubiquitous promoters (e.g., -Ubc, PGK, EF1a-core); (In some implementations, the promoter is enhanced via the SV40 intron.) • Endogenous 5' UTR and Kozak sequences; (In some implementations, the vector lacks a 5' UTR and / or uses the Kozak sequence (GCC(RCC)ATG, where R is any nucleotide and ATG is the start codon)) • The full-length coding sequence of the target; and • A modified 3' UTR consisting of multiple segments of the 3' UTR and a distal polyacrylated A signal. (In some implementations, the carrier lacks the element and contains only poly-A signals (e.g., -bGH, SV40, hGH)).
[0077] In some implementations, the synthesis module increases the target measurement (e.g., protein or RNA, such as MECP2 protein or RNA) in cells or cell populations by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240%, or at least 250% relative to the baseline target measurement. In some implementations, relative to baseline target measurements, the synthesis module increases the target measurements (e.g., proteins or RNA, such as MECP2 protein or RNA) in cells or cell populations by less than 5%, less than 10%, less than 15%, less than 20%, less than 25%, less than 30%, less than 35%, less than 40%, less than 45%, less than 50%, less than 55%, less than 60%, less than 65%, less than 70%, less than 75%, less than 80%, less than 90%, less than 100%, less than 110%, less than 120%, less than 130%, less than 140%, less than 150%, less than 160%, less than 170%, less than 180%, less than 190%, less than 200%, less than 210%, less than 220%, less than 230%, less than 240%, or less than 250%.
[0078] Synthesis module promoter For the system provided herein, in embodiments, the synthesis module further includes a synthesis module promoter sequence, or is encoded by a nucleic acid including a synthesis module promoter sequence. In embodiments, the synthesis module includes a synthesis module promoter sequence. In embodiments, the synthesis module is encoded by a nucleic acid including a synthesis module promoter sequence. In embodiments, the mRNA of the synthesis module excludes mRNA splicing sites.
[0079] In one implementation, the promoter sequence of the synthetic module includes a mouse or human promoter sequence. In another implementation, the promoter sequence of the synthetic module includes a mouse promoter sequence. In yet another implementation, the promoter sequence of the synthetic module includes a human promoter sequence.
[0080] In this embodiment, the synthetic module promoter includes a ubiquitous promoter. The term "ubiquitous promoter" refers to a promoter that is active under a wide range of cellular conditions. For example, a ubiquitous promoter can allow sustained expression of a gene in a cell. In this embodiment, the ubiquitous promoter allows gene expression in various cells or multiple stages of the cell cycle. In this embodiment, the ubiquitous promoter is active in a wide range of tissue types. In this embodiment, the ubiquitous promoter allows constitutive expression of recombinant forms of target RNA. In this embodiment, the recombinant forms of target RNA can be expressed in a wide range of cells. In this embodiment, the recombinant forms of target RNA can be expressed during multiple stages of the cell cycle.
[0081] In the implementation scheme, the synthetic module promoter includes a weak promoter. For example, a weak promoter can regulate the transcription of a recombinant form of a target gene or RNA, wherein the expression level of the recombinant form of the gene is no greater than the expression level of an endogenous gene in healthy cells (e.g., cells without a hereditary disease). In the implementation scheme, the weak promoter drives mRNA molecule expression at a rate no greater than that of an endogenous target gene promoter.
[0082] In the implementation scheme, the rate at which the weak promoter drives mRNA molecule expression is 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the endogenous promoter, or a range thereof. In the implementation scheme, the endogenous promoter is a target gene promoter. In the implementation scheme, the rate at which the weak promoter drives mRNA molecule expression is 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 105%, 110%, 115%, 120%, 125%, 130%, 140%, or 150% of the endogenous promoter, or a range thereof. In the implementation scheme, the endogenous promoter is a target gene promoter.
[0083] In the implementation scheme, the rate at which the weak promoter drives mRNA molecule expression is less than 2, 1.8, 1.6, 1.4, 1.2, 1, 0.8, 0.6, 0.4, or 0.2 times that of the endogenous promoter. In the implementation scheme, the endogenous promoter is an endogenous target gene promoter.
[0084] In the implementation scheme, the synthetic module promoter sequence includes a Ubc promoter, a PGK promoter, or an EF1a-core promoter sequence. In the implementation scheme, the synthetic module promoter sequence includes a Ubc promoter sequence, a PGK promoter sequence, or an EF1a-core promoter sequence. In the implementation scheme, the synthetic module promoter sequence includes a Ubc promoter sequence. In the implementation scheme, the synthetic module promoter sequence includes a PGK promoter sequence. In the implementation scheme, the synthetic module promoter sequence includes an EF1a-core promoter sequence. In the implementation scheme, the synthetic module promoter sequence is a Ubc promoter sequence. In the implementation scheme, the synthetic module promoter sequence is a PGK promoter sequence. In the implementation scheme, the synthetic module promoter sequence is an EF1a-core promoter sequence.
[0085] In one implementation, the synthesized module promoter sequence has at least 90% identity with the promoter sequences shown in Table 1. In another implementation, the synthesized module promoter sequence has at least 91% identity with the promoter sequences shown in Table 1. In another implementation, the synthesized module promoter sequence has at least 92% identity with the promoter sequences shown in Table 1. In another implementation, the synthesized module promoter sequence has at least 93% identity with the promoter sequences shown in Table 1. In another implementation, the synthesized module promoter sequence has at least 94% identity with the promoter sequences shown in Table 1. In another implementation, the synthesized module promoter sequence has at least 94% identity with the promoter sequences shown in Table 1. In another implementation, the synthesized module promoter sequence has at least 96% identity with the promoter sequences shown in Table 1. In another implementation, the synthesized module promoter sequence has at least 97% identity with the promoter sequences shown in Table 1. In another implementation, the synthesized module promoter sequence has at least 98% identity with the promoter sequences shown in Table 1. In the implementation, the synthesized module promoter sequence has at least 99% identity with the promoter sequences shown in Table 1. In the implementation, the synthesized module promoter sequence includes the promoter sequences shown in Table 1. In the implementation, the synthesized module promoter sequence is the promoter sequence shown in Table 1.
[0086] In the embodiments, the synthesized promoter sequence has at least 90% identity with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, or SEQ ID NO:22. In the embodiments, the synthesized promoter sequence has at least 90% identity with SEQ ID NO:1. In the embodiments, the synthesized promoter sequence has at least 90% identity with SEQ ID NO:2. In the embodiments, the synthesized promoter sequence has at least 90% identity with SEQ ID NO:3. In the embodiments, the synthesized promoter sequence has at least 90% identity with SEQ ID NO:19. In the embodiments, the synthesized promoter sequence has at least 90% identity with SEQ ID NO:20. In the embodiments, the synthesized promoter sequence has at least 90% identity with SEQ ID NO:21. In the embodiments, the synthesized promoter sequence has at least 90% identity with SEQ ID NO:22. In the embodiments, the synthesized promoter sequence includes SEQ ID NO:1. In one embodiment, the synthesized promoter sequence includes SEQ ID NO:2. In another embodiment, the synthesized promoter sequence includes SEQ ID NO:3. In another embodiment, the synthesized promoter sequence includes SEQ ID NO:19. In another embodiment, the synthesized promoter sequence includes SEQ ID NO:20. In another embodiment, the synthesized promoter sequence includes SEQ ID NO:21. In another embodiment, the synthesized promoter sequence includes SEQ ID NO:22.
[0087] In this embodiment, the promoter sequence of the synthesis module is 5' or upstream of the coding sequence (CDS). In this embodiment, the promoter sequence of the synthesis module is 5' of the coding sequence (CDS). In this embodiment, the promoter sequence of the synthesis module is upstream of the coding sequence (CDS). In this embodiment, the CDS encodes a target protein or a fragment thereof.
[0088] Some include weak and ubiquitous promoters (e.g., -Ubc, PGK, EF1a-core). In some implementations, the promoter is strengthened via the SV40 intron.
[0089] SV40 intron The synthesis module provided herein, including its embodiments, may further include one or more nucleic acid sequences that increase or upregulate the expression level of recombinant genes (e.g., recombinant forms of target RNA). In embodiments, the synthesis module includes nucleic acid sequences that increase the stability of recombinant genes (e.g., recombinant forms of target RNA). In embodiments, the synthesis module includes nucleic acid sequences that regulate the processing of recombinant genes (e.g., recombinant forms of target RNA).
[0090] In one embodiment, the synthesis module further includes the SV40 intron sequence. In another embodiment, the SV40 intron sequence has at least 90% identity with the SV40 intron sequences shown in Table 1. In yet another embodiment, the SV40 intron sequence has at least 91% identity with the SV40 intron sequences shown in Table 1. In yet another embodiment, the SV40 intron sequence has at least 92% identity with the SV40 intron sequences shown in Table 1. In yet another embodiment, the SV40 intron sequence has at least 93% identity with the SV40 intron sequences shown in Table 1. In yet another embodiment, the SV40 intron sequence has at least 94% identity with the SV40 intron sequences shown in Table 1. In yet another embodiment, the SV40 intron sequence has at least 95% identity with the SV40 intron sequences shown in Table 1. In yet another embodiment, the SV40 intron sequence has at least 96% identity with the SV40 intron sequences shown in Table 1. In one implementation, the SV40 intron sequence has at least 97% identity with the SV40 intron sequences shown in Table 1. In another implementation, the SV40 intron sequence has at least 98% identity with the SV40 intron sequences shown in Table 1. In yet another implementation, the SV40 intron sequence has at least 99% identity with the SV40 intron sequences shown in Table 1. In one implementation, the SV40 intron sequence includes the SV40 intron sequences shown in Table 1. In another implementation, the SV40 intron sequence is the SV40 intron sequence shown in Table 1.
[0091] In one embodiment, the SV40 intron sequence has at least 80% identity with SEQ ID NO:4. In another embodiment, the SV40 intron sequence has at least 85% identity with SEQ ID NO:4. In another embodiment, the SV40 intron sequence has at least 90% identity with SEQ ID NO:4. In another embodiment, the SV40 intron sequence has at least 91% identity with SEQ ID NO:4. In another embodiment, the SV40 intron sequence has at least 92% identity with SEQ ID NO:4. In another embodiment, the SV40 intron sequence has at least 93% identity with SEQ ID NO:4. In another embodiment, the SV40 intron sequence has at least 94% identity with SEQ ID NO:4. In another embodiment, the SV40 intron sequence has at least 95% identity with SEQ ID NO:4. In another embodiment, the SV40 intron sequence has at least 96% identity with SEQ ID NO:4. In one embodiment, the SV40 intron sequence has at least 97% identity with SEQ ID NO:4. In another embodiment, the SV40 intron sequence has at least 98% identity with SEQ ID NO:4. In yet another embodiment, the SV40 intron sequence has at least 99% identity with SEQ ID NO:4. In one embodiment, the SV40 intron sequence includes SEQ ID NO:4. In another embodiment, the SV40 intron sequence is SEQ ID NO:4.
[0092] In the implementation, the SV40 intron sequence is the 3' or downstream of the synthesis module promoter sequence. In the implementation, the SV40 intron sequence is the 3' of the synthesis module promoter sequence. In the implementation, the SV40 intron sequence is downstream of the synthesis module promoter sequence.
[0093] In one implementation, the SV40 intron sequence is 5' or upstream of the CDS. In one implementation, the SV40 intron sequence is 5' relative to the CDS. In one implementation, the SV40 intron sequence is upstream of the CDS.
[0094] 5' UTR and Kozak sequences In embodiments, the system provided herein may include one or more nucleic acid sequences capable of regulating the expression of a target RNA (e.g., a recombinant form of the target RNA). For example, the system module may include a sequence capable of regulating the translation of the target RNA. Thus, in embodiments, the synthesis module further includes a 5' untranslated region (UTR) sequence of the target RNA.
[0095] In one implementation, the 5' UTR sequence has at least 90% identity with the 5' UTR sequences shown in Table 1. In another implementation, the 5' UTR sequence has at least 91% identity with the 5' UTR sequences shown in Table 1. In another implementation, the 5' UTR sequence has at least 92% identity with the 5' UTR sequences shown in Table 1. In another implementation, the 5' UTR sequence has at least 93% identity with the 5' UTR sequences shown in Table 1. In another implementation, the 5' UTR sequence has at least 94% identity with the 5' UTR sequences shown in Table 1. In another implementation, the 5' UTR sequence has at least 95% identity with the 5' UTR sequences shown in Table 1. In another implementation, the 5' UTR sequence has at least 96% identity with the 5' UTR sequences shown in Table 1. In another implementation, the 5' UTR sequence has at least 97% identity with the 5' UTR sequences shown in Table 1. In another implementation, the 5' UTR sequence has at least 98% identity with the 5' UTR sequences shown in Table 1. In this embodiment, the 5' UTR sequence has at least 99% identity with the 5' UTR sequences shown in Table 1. In this embodiment, the 5' UTR sequence includes the 5' UTR sequences shown in Table 1. In this embodiment, the 5' UTR sequence is the 5' UTR sequence shown in Table 1.
[0096] In the embodiments, the synthesis module further includes a Kozak sequence. In the embodiments, the Kozak sequence has at least 90% identity with 5'-GCCNCCATG-3', where N is A, T, C, or G, and ATG is the start codon; or where the Kozak sequence has at least 90% identity with 5'-GCCNCCAUG-3', where N is A, U, C, or G, and AUG is the start codon. In the embodiments, the Kozak sequence has at least 90% identity with 5'-GCCNCCATG-3', where N is A, T, C, or G, and ATG is the start codon. In the embodiments, the Kozak sequence has at least 90% identity with 5'-GCCNCCAUG-3', where N is A, U, C, or G, and AUG is the start codon. In the embodiments, the Kozak sequence is an endogenous Kozak sequence. For example, the Kozak sequence can be a naturally occurring Kozak sequence found in an endogenous gene encoding a target protein. In this implementation, the Kozak sequence shares at least 90% identity with the 5'-CGGAAAATG-3' sequence. As used herein, "Kozak sequence" refers to a nucleic acid sequence in mRNA that guides proteins involved in translation to the translation initiation site. For example, the Kozak sequence can guide the pre-initiation complex and ribosomes to the translation initiation site. In this implementation, the Kozak sequence participates in ribosome assembly.
[0097] In one embodiment, the 5' UTR sequence or the Kozak sequence is upstream or 5' relative to the CDS within the synthesis module. (This text is repeated four times in the original.)
[0098] Some implementations include an endogenous target 5' UTR (e.g., an endogenous 5' UTR such as MECP2 5' UTR) and a Kozak sequence. In some implementations, the vector lacks a 5' UTR and / or uses a Kozak sequence (GCC(RCC)ATG, where R is any nucleotide and ATG is the start codon).
[0099] Nucleic acid coding sequence In some embodiments, this document discloses a synthesis module that includes a nucleic acid coding sequence (CDS). The CDS can be a CDS of a target, such as a target mRNA. The nucleic acid coding sequence may include or exclude introns. For the systems provided herein, in embodiments, the nucleic acid coding sequence (CDS) includes introns and exons. In embodiments, the CDS includes exons spaced by introns. In embodiments, the CDS includes exons without introns. Some embodiments include or encode an open reading frame (ORF) of a target mRNA, such as MECP2 mRNA.
[0100] In some implementations, the CDS excludes one or more exons or introns of the target gene. In some implementations, the CDS does not include introns. Therefore, in some implementations, the CDS includes exons that are adjacent to each other, but without intervening introns.
[0101] An example of a CDS is a CDS encoding a target protein (e.g., MECP2). In one embodiment, the CDS includes exons 1, 3, and 4 of MECP2. In another embodiment, the CDS excludes exon 2 of MECP2. In yet another embodiment, the CDS encodes the e1 isotype of MECP2. In yet another embodiment, the e1 isotype of MECP2 includes exons 1, 3, and 4 of MECP2 or fragments thereof. In yet another embodiment, the e1 isotype of MECP2 does not include exon 2 of MECP2. Similar strategies can be used for different targets.
[0102] In some embodiments, the CDS includes exon 1 of MECP2. An example of a MECP2 exon 1 sequence is included as SEQ ID NO: 924. The sequence of SEQ ID NO: 924 is the murine form of MECP2 exon 1. The target exon may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 924. An example of a MECP2 exon 1 sequence is included as SEQ ID NO: 927. The sequence of SEQ ID NO: 927 is the human form of MECP2 exon 1. The target exon may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 927.
[0103] In some embodiments, the CDS includes exon 3 of MECP2. An example of a MECP2 exon 3 sequence is included as SEQ ID NO: 925. The sequence of SEQ ID NO: 925 is the murine form of MECP2 exon 3. The target exon may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 925. An example of a MECP2 exon 3 sequence is included as SEQ ID NO: 928. The sequence of SEQ ID NO: 928 is the human form of MECP2 exon 3. The target exon may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 928.
[0104] In some embodiments, the CDS includes exon 4 of MECP2. An example of a MECP2 exon 4 sequence is included as SEQ ID NO: 926. The sequence of SEQ ID NO: 926 is the murine form of MECP2 exon 4. The target exon may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 926. An example of a MECP2 exon 4 sequence is included as SEQ ID NO: 929. The sequence of SEQ ID NO: 929 is the human form of MECP2 exon 4. The target exon may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 929.
[0105] In one implementation, the CDS sequence has at least 90% identity with the CDS sequences shown in Table 1. In another implementation, the CDS sequence has at least 91% identity with the CDS sequences shown in Table 1. In another implementation, the CDS sequence has at least 92% identity with the CDS sequences shown in Table 1. In another implementation, the CDS sequence has at least 93% identity with the CDS sequences shown in Table 1. In another implementation, the CDS sequence has at least 94% identity with the CDS sequences shown in Table 1. In another implementation, the CDS sequence has at least 95% identity with the CDS sequences shown in Table 1. In another implementation, the CDS sequence has at least 96% identity with the CDS sequences shown in Table 1. In another implementation, the CDS sequence has at least 97% identity with the CDS sequences shown in Table 1. In another implementation, the CDS sequence has at least 98% identity with the CDS sequences shown in Table 1. In another implementation, the CDS sequence has at least 99% identity with the CDS sequences shown in Table 1. In another implementation, the CDS sequence includes the CDS sequences shown in Table 1. In the implementation scheme, the CDS sequence is the CDS sequence shown in Table 1.
[0106] In one embodiment, the CDS sequence has at least 90% identity with SEQ ID NO: 6. In another embodiment, the CDS sequence has at least 91% identity with SEQ ID NO: 6. In another embodiment, the CDS sequence has at least 92% identity with SEQ ID NO: 6. In another embodiment, the CDS sequence has at least 93% identity with SEQ ID NO: 6. In another embodiment, the CDS sequence has at least 94% identity with SEQ ID NO: 6. In another embodiment, the CDS sequence has at least 95% identity with SEQ ID NO: 6. In another embodiment, the CDS sequence has at least 96% identity with SEQ ID NO: 6. In another embodiment, the CDS sequence has at least 97% identity with SEQ ID NO: 6. In another embodiment, the CDS sequence has at least 98% identity with SEQ ID NO: 6. In another embodiment, the CDS sequence has at least 99% identity with SEQ ID NO: 6. In another embodiment, the CDS sequence includes SEQ ID NO: 6. In the implementation scheme, the CDS sequence is SEQ ID NO: 6.
[0107] In one embodiment, the CDS sequence has at least 90% identity with SEQ ID NO: 7. In another embodiment, the CDS sequence has at least 91% identity with SEQ ID NO: 7. In another embodiment, the CDS sequence has at least 92% identity with SEQ ID NO: 7. In another embodiment, the CDS sequence has at least 93% identity with SEQ ID NO: 7. In another embodiment, the CDS sequence has at least 94% identity with SEQ ID NO: 7. In another embodiment, the CDS sequence has at least 95% identity with SEQ ID NO: 7. In another embodiment, the CDS sequence has at least 96% identity with SEQ ID NO: 7. In another embodiment, the CDS sequence has at least 97% identity with SEQ ID NO: 7. In another embodiment, the CDS sequence has at least 98% identity with SEQ ID NO: 7. In another embodiment, the CDS sequence has at least 99% identity with SEQ ID NO: 7. In another embodiment, the CDS sequence includes SEQ ID NO: 7. In the implementation scheme, the CDS sequence is SEQ ID NO: 7.
[0108] In one implementation, the CDS includes exon 2 of MECP2. In another implementation, the CDS encodes the e2 isotype of MECP2. In yet another implementation, the CDS does not include exon 1 of MECP2.
[0109] In one embodiment, the CDS includes exons 1 and 3 of MECP2, having introns between exons 1 and 3. In another embodiment, the CDS includes a sequence of intron fragments between exons 1 and 3. In yet another embodiment, the sequence of intron fragments between exons 1 and 3 includes a sequence of intron 1 fragments from MECP1.
[0110] In one implementation, the MECP1 intron 1 fragment sequence has at least 90% identity with the intron 1 fragment sequences shown in Table 1. In another implementation, the MECP1 intron 1 fragment sequence has at least 91% identity with the intron 1 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 1 fragment sequence has at least 92% identity with the intron 1 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 1 fragment sequence has at least 93% identity with the intron 1 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 1 fragment sequence has at least 94% identity with the intron 1 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 1 fragment sequence has at least 95% identity with the intron 1 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 1 fragment sequence has at least 96% identity with the intron 1 fragment sequences shown in Table 1. In one implementation, the MECP1 intron 1 fragment sequence has at least 97% identity with the intron 1 fragment sequences shown in Table 1. In another implementation, the MECP1 intron 1 fragment sequence has at least 98% identity with the intron 1 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 1 fragment sequence has at least 99% identity with the intron 1 fragment sequences shown in Table 1. In one implementation, the MECP1 intron 1 fragment sequence includes the intron 1 fragment sequences shown in Table 1. In another implementation, the MECP1 intron 1 fragment sequence is the intron 1 fragment sequence shown in Table 1.
[0111] In one embodiment, the CDS includes exons 1 and 3 of MECP2, with no introns between exons 1 and 3. In another embodiment, the CDS includes exons 3 and 4 of MECP2, with an intron between exons 3 and 4. In yet another embodiment, the CDS includes a sequence of intron fragments between exons 3 and 4. In yet another embodiment, the sequence of intron fragments between exons 3 and 4 includes a sequence of intron 3 fragments from MECP1.
[0112] In one implementation, the MECP1 intron 3 fragment sequence has at least 90% identity with the intron 3 fragment sequences shown in Table 1. In another implementation, the MECP1 intron 3 fragment sequence has at least 91% identity with the intron 3 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 3 fragment sequence has at least 92% identity with the intron 3 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 3 fragment sequence has at least 93% identity with the intron 3 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 3 fragment sequence has at least 94% identity with the intron 3 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 3 fragment sequence has at least 95% identity with the intron 3 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 3 fragment sequence has at least 96% identity with the intron 3 fragment sequences shown in Table 1. In one implementation, the MECP1 intron 3 fragment sequence has at least 97% identity with the intron 3 fragment sequences shown in Table 1. In another implementation, the MECP1 intron 3 fragment sequence has at least 98% identity with the intron 3 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 3 fragment sequence has at least 99% identity with the intron 3 fragment sequences shown in Table 1. In one implementation, the MECP1 intron 3 fragment sequence includes the intron 3 fragment sequences shown in Table 1. In yet another implementation, the MECP1 intron 3 fragment sequence is the intron 3 fragment sequence shown in Table 1.
[0113] In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 8. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 8. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 8. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 8. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 8. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 8. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 8. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 8. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 8. In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 8. In another embodiment, the intron fragment sequence comprises SEQ ID NO: 8. In yet another embodiment, the intron fragment sequence is SEQ ID NO: 8.
[0114] In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 9. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 9. In yet another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 9. In yet another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 9. In yet another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 9. In yet another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 9. In yet another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 9. In yet another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 9. In yet another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 9. In the implementation scheme, the intron fragment sequence comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 9. In the implementation scheme, the intron fragment sequence comprises SEQ ID NO: 9. In the implementation scheme, the intron fragment sequence is SEQ ID NO: 9.
[0115] In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 10. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 10. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 10. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 10. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 10. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 10. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 10. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 10. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 10. In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 10. In another embodiment, the intron fragment sequence comprises SEQ ID NO: 10. In yet another embodiment, the intron fragment sequence is SEQ ID NO: 10.
[0116] In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 11. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 11. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 11. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 11. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 11. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 11. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 11. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 11. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 11. In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 11. In another embodiment, the intron fragment sequence comprises SEQ ID NO: 11. In yet another embodiment, the intron fragment sequence is SEQ ID NO: 11.
[0117] In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 12. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 12. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 12. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 12. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 12. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 12. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 12. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 12. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 12. In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 12. In another embodiment, the intron fragment sequence comprises SEQ ID NO: 12. In yet another embodiment, the intron fragment sequence is SEQ ID NO: 12.
[0118] In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 13. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 13. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 13. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 13. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 13. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 13. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 13. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 13. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 13. In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 13. In another embodiment, the intron fragment sequence comprises SEQ ID NO: 13. In yet another embodiment, the intron fragment sequence is SEQ ID NO: 13.
[0119] In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 14. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 14. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 14. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 14. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 14. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 14. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 14. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 14. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 14. In the implementation scheme, the intron fragment sequence comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 14. In the implementation scheme, the intron fragment sequence comprises SEQ ID NO: 14. In the implementation scheme, the intron fragment sequence is SEQ ID NO: 14.
[0120] In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 15. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 15. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 15. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 15. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 15. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 15. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 15. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 15. In another embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 15. In one embodiment, the intron fragment sequence comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 15. In another embodiment, the intron fragment sequence comprises SEQ ID NO: 15. In yet another embodiment, the intron fragment sequence is SEQ ID NO: 15.
[0121] In some embodiments, the CDS includes exons 3 and 4 of MECP2, with no introns between exons 3 and 4. Some embodiments include a full-length MECP2 coding sequence containing exons 1, 3, and 4 of MECP2 RNA. Some embodiments include a full-length MECP2 coding sequence consisting of exons 1, 3, and 4 of MECP2 RNA. In some embodiments, this contains an endogenous intron fragment between exons 1 and 3 or 3 and 4.
[0122] 3' UTR In embodiments, the expression system provided herein may include a sequence regulating the expression of a recombinant form of target RNA. For example, the expression system may include a sequence regulating the expression of a nucleic acid-coding sequence (CDS) encoding a recombinant form of a target protein. For example, the expression system may include a sequence regulating the translation or post-translational modification of a CDS encoding a target protein (e.g., a recombinant form of the target protein). The expression sequence may include a sequence regulating the stability of a CDS encoding a target protein (e.g., a recombinant form of the target protein). Therefore, in embodiments, the synthesis module further includes a 3' untranslated region (UTR) sequence of the target RNA. In embodiments, the 3' UTR sequence includes an endogenous target RNA 3' UTR sequence or a fragment thereof. In embodiments, the 3' UTR sequence includes an endogenous target RNA 3' UTR sequence or a fragment thereof.
[0123] In the implementation scheme, the 3' UTR includes multiple fragments of the endogenous target RNA 3' UTR sequence. For example, the 3' UTR may include multiple fragments of the endogenous target RNA 3' UTR sequence, each of which includes an endogenous miRNA binding site.
[0124] In the embodiments, the 3' UTR is downstream or 3' of the promoter sequence, SV40 intron sequence, 5' UTR sequence, Kozak sequence, or CDS within the synthesis module. In the embodiments, the 3' UTR is downstream or 3' of the promoter sequence within the synthesis module. In the embodiments, the 3' UTR is downstream or 3' of the SV40 intron sequence within the synthesis module. In the embodiments, the 3' UTR is downstream or 3' of the 5' UTR sequence within the synthesis module. In the embodiments, the 3' UTR is downstream or 3' of the Kozak sequence within the synthesis module. In the embodiments, the 3' UTR is downstream or 3' of the CDS within the synthesis module.
[0125] In one embodiment, the synthesis module includes a polyA signal sequence. In another embodiment, the 3' UTR sequence includes a polyA signal sequence. In yet another embodiment, the synthesis module further includes a sequence regulating polyadenylation and / or termination of the target RNA. In one embodiment, the polyA signal sequence includes a -bGH signal sequence, an SV40 signal sequence, or an hGH polyA signal sequence. In one embodiment, the polyA signal sequence includes a -bGH signal sequence. In one embodiment, the polyA signal sequence includes an SV40 signal sequence. In one embodiment, the polyA signal sequence includes an hGH polyA signal sequence.
[0126] In one implementation, the 3' UTR sequence or polyA signal sequence has at least 90% identity with the 3' UTR or polyA sequences shown in Table 1. In another implementation, the 3' UTR sequence or polyA signal sequence has at least 91% identity with the 3' UTR or polyA sequences shown in Table 1. In yet another implementation, the 3' UTR sequence or polyA signal sequence has at least 92% identity with the 3' UTR or polyA sequences shown in Table 1. In yet another implementation, the 3' UTR sequence or polyA signal sequence has at least 93% identity with the 3' UTR or polyA sequences shown in Table 1. In yet another implementation, the 3' UTR sequence or polyA signal sequence has at least 94% identity with the 3' UTR or polyA sequences shown in Table 1. In yet another implementation, the 3' UTR sequence or polyA signal sequence has at least 95% identity with the 3' UTR or polyA sequences shown in Table 1. In one embodiment, the 3' UTR sequence or polyA signal sequence has at least 96% identity with the 3' UTR or polyA sequences shown in Table 1. In another embodiment, the 3' UTR sequence or polyA signal sequence has at least 97% identity with the 3' UTR or polyA sequences shown in Table 1. In yet another embodiment, the 3' UTR sequence or polyA signal sequence has at least 98% identity with the 3' UTR or polyA sequences shown in Table 1. In yet another embodiment, the 3' UTR sequence or polyA signal sequence has at least 99% identity with the 3' UTR or polyA sequences shown in Table 1. In yet another embodiment, the 3' UTR sequence or polyA signal sequence includes the 3' UTR or polyA sequences shown in Table 1. In yet another embodiment, the 3' UTR sequence or polyA signal sequence is the 3' UTR or polyA sequence shown in Table 1.
[0127] Some embodiments include a modified 3' UTR comprising multiple fragments of an endogenous 3' UTR (e.g., an endogenous target 3' UTR such as MECP2 3' UTR). Some embodiments include a poly-A signal (e.g., a distal target poly-A signal or a MECP2 poly-A signal). Some embodiments include a modified 3' UTR consisting of multiple fragments of an endogenous target 3' UTR and a distal target poly-A signal. In some embodiments, the vector lacks this element and contains only a poly-A signal (e.g., -bGH, SV40, hGH).
[0128] Silent Module Some implementations involve a silencing module. The silencing module may include a system for reducing nucleic acid expression through modified nucleic acid splicing, which may include: a modified U7 snRNA containing an antisense nucleic acid sequence that targets an alternative splicing region of a target RNA, such as an RNA encoding the MECP2 protein. In some implementations, the modified U7 snRNA further contains an ESS nucleic acid sequence. In some implementations, the modified U7 snRNA does not contain an ESS nucleic acid sequence.
[0129] In some embodiments, recombinant small nuclear RNA (snRNA) or snRNA sequences are disclosed herein. In some embodiments, modified or recombinant U7 small nuclear RNA (snRNA) or modified or recombinant U7 snRNA sequences are disclosed herein. Modified or recombinant U7 snRNA or modified or recombinant U7 snRNA sequences may be included as part of a system or may be used in the methods described herein. In some embodiments, systems comprising modified or recombinant U7 snRNA or comprising modified or recombinant U7 snRNA sequences are disclosed herein. Modified or recombinant U7 snRNA may be or may include engineered U7 snRNA. The terms modified, recombinant, and engineered are used interchangeably herein. U7 snRNA sequences may be used to modify nucleic acid splicing. In some embodiments, U7 snRNA sequences may include exon splicing silencer (ESS) nucleic acid sequences. Some embodiments do not include ESS nucleic acid sequences. In some embodiments, U7 snRNA sequences may include antisense nucleic acid sequences targeting alternative splicing regions of ribonucleic acid (RNA). In some embodiments, the targeted RNA may encode a target protein (e.g., the MECP2 protein). U7 snRNA sequences may include smOPT sequences. U7 snRNA sequences may include hairpins.
[0130] In some implementations, this document describes effects on target RNA, such as MECP2 Methods or systems for RNA splicing. Target RNA may be referred to as the targeted RNA. Target RNA may include the targeted region. The targeted region may bind to or be bound by an antisense nucleic acid sequence. The targeted region may include exon sequences. The targeted region may include... MECP2The target region may include exons of mRNA. The target region may include exon splicing sites (e.g., intron / exon junctions). The target region may include regions near exons, such as intron sequences. The target region may include intron sequences. The target region may exclude introns. The target region may exclude exon sequences. The target region may include portions of intron sequences. The target region may include portions of exon sequences. The target region may exclude portions of intron sequences. The target region may exclude portions of exon sequences. The target region may encompass both regions near exons and at least a portion of exons.
[0131] The targeted region may include sequences or regions within mRNA sequences selected from the following NCBI reference sequences: NM_001110792, NM_004992, NM_001316337, NM_001369391, and NM_001369392.
[0132] For the system provided herein, in an embodiment, the silencing module comprises an RNA molecule. In an embodiment, the RNA molecule of the silencing module comprises a modified U7 small nuclear RNA (snRNA). In an embodiment, the modified U7 snRNA comprises a U7 core sequence having at least 90% identity with the U7 core sequences shown in Table 1. In an embodiment, the modified U7 snRNA comprises a U7 core sequence having at least 91% identity with the U7 core sequences shown in Table 1. In an embodiment, the modified U7 snRNA comprises a U7 core sequence having at least 92% identity with the U7 core sequences shown in Table 1. In an embodiment, the modified U7 snRNA comprises a U7 core sequence having at least 93% identity with the U7 core sequences shown in Table 1. In an embodiment, the modified U7 snRNA comprises a U7 core sequence having at least 94% identity with the U7 core sequences shown in Table 1. In an embodiment, the modified U7 snRNA comprises a U7 core sequence having at least 95% identity with the U7 core sequences shown in Table 1. In one embodiment, the modified U7 snRNA comprises a U7 core sequence having at least 96% identity with the U7 core sequence shown in Table 1. In another embodiment, the modified U7 snRNA comprises a U7 core sequence having at least 97% identity with the U7 core sequence shown in Table 1. In yet another embodiment, the modified U7 snRNA comprises a U7 core sequence having at least 98% identity with the U7 core sequence shown in Table 1. In yet another embodiment, the modified U7 snRNA comprises the U7 core sequence shown in Table 1. In yet another embodiment, the modified U7 snRNA is the U7 core sequence shown in Table 1.
[0133] In the system provided herein, in some embodiments, the silencing module comprises a DNA molecule. In some embodiments, the DNA molecule of the silencing module encodes a modified U7 snRNA. In some embodiments, the DNA molecule of the silencing module comprises a single silencing module. In some embodiments, the DNA molecule of the silencing module comprises an array of arrayed silencing modules. For example, the DNA molecule of the silencing module may comprise multiple silencing modules. In some embodiments, the DNA molecule of the silencing module may comprise 1, 2, 3, 4, 5, 6, 8, 8, 9, or 10 silencing modules. In some embodiments, the DNA molecule of the silencing module comprises four silencing modules.
[0134] In some implementations, the silencing module comprises an array of modified U7 snRNAs. In some implementations, the array comprises multiple U7 modules. Each module may include a target sequence. The target sequences of multiple modules may be the same. The target sequences of some modules may be different.
[0135] In the system provided herein, in an embodiment, the silencing module comprises siRNA targeting an endogenous target RNA. Therefore, in an embodiment, the antisense nucleic acid sequence targeting the endogenous target RNA is siRNA. In an embodiment, the silencing module does not include U7 snRNA or modified U7 snRNA. As used herein, “siRNA,” “small interfering RNA,” “small RNA,” or “RNAi” refers to a nucleic acid forming a double-stranded RNA that has the ability to reduce or suppress the expression of a gene or target gene (e.g., when expressed in cells identical to the gene or target gene). The complementary portions of the nucleic acids that hybridize to form a double-stranded molecule typically have substantially or completely identical identity. In one embodiment, siRNA or RNAi is a nucleic acid that has substantially or completely identical identity to a target gene and forms a double-stranded siRNA. In an embodiment, siRNA suppresses gene expression by interacting with complementary cellular mRNA, thereby interfering with the expression of the complementary mRNA. Typically, the nucleic acid is at least about 15-50 nucleotides long (e.g., each complementary sequence of the double-stranded siRNA is 15-50 nucleotides long, and the double-stranded siRNA is about 15-50 base pairs long). In other embodiments, the length is 20-30 nucleotides, preferably about 20-25 or about 24-29 nucleotides, for example, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.
[0136] In some embodiments, this document discloses a system for modifying nucleic acid splicing, comprising: an exon splice silencer (ESS) nucleic acid sequence; and an antisense nucleic acid sequence targeting a ribonucleic acid (RNA) region encoding a target RNA. The target RNA region may include an exon or a region near an exon.
[0137] The modified U7 snRNA from 5' to 3' may include the following in the following order: (1) an optional exon splicing silencer, (2) a target sequence (e.g., an antisense sequence) that is complementary to the target mRNA region, (4) an smOPT sequence, and (5) a hairpin sequence.
[0138] In some embodiments, the modified U7 snRNA includes a U7 core sequence or a portion thereof. In some embodiments, the recombinant U7 snRNA includes a U7 core sequence or a portion thereof. Table 1 includes examples of U7 core sequences. For the U7 core sequences shown in Table 1, antisense sequences are enclosed in parentheses, smOPT is capitalized, and hairpins are enclosed in square brackets. Antisense sequences may be or include the target sequence described herein.
[0139] Some implementations of the silencing module include a U7 module to inhibit the splicing of endogenous target transcripts. In some implementations, the U7 module contains or includes a single U7 expression cassette or array. In some implementations, the U7 module contains or includes a single U7 expression cassette. In some implementations, the U7 module contains or includes an array of U7 expression cassettes. The U7 module may contain or include U7 regulatory sequences such as promoters and 3' elements. The U7 module may contain or include altered regulatory sequences. The U7 module may contain or include altered or modified promoter sequences from another small RNA. The U7 module may contain or include altered or modified 3' elements from another small RNA.
[0140] In some embodiments, the silencing module reduces the measurement of a target (e.g., protein or RNA, such as MECP2 protein or RNA) in cells or cell populations by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% relative to baseline target measurements. In some embodiments, the silencing module reduces the measurement of a target (e.g., protein or RNA, such as MECP2 protein or RNA) in cells or cell populations by less than 5%, less than 10%, less than 15%, less than 20%, less than 25%, less than 30%, less than 35%, less than 40%, less than 45%, less than 50%, less than 55%, less than 60%, less than 65%, less than 70%, less than 75%, or less than 80% relative to baseline target measurements.
[0141] Silent module starter In the system provided herein, in embodiments, the silencing module further includes a silencing module promoter sequence, or the silencing module is encoded by a nucleic acid including a silencing module promoter sequence. In embodiments, the silencing module further includes a silencing module promoter sequence. In embodiments, the silencing module is encoded by a nucleic acid including a silencing module promoter sequence. The silencing module promoter may include or may be the recombination regulatory element described herein, which includes a promoter or a silencing module.
[0142] The promoter can be operatively linked to an ESS sequence, a U7 targeting sequence, an Sm binding site, or a U7 3' hairpin, or a combination thereof. For example, the promoter can be operatively linked to an ESS sequence, a U7 targeting sequence, an Sm binding site, and a U7 3' hairpin in the expression construct. In one embodiment, the silencing module promoter sequence includes a human promoter sequence. In another embodiment, the silencing module promoter sequence includes a mouse promoter sequence.
[0143] In some implementations, the silencing module promoters include the mouse U1 snRNA (“MmU1”) promoter, mouse U2 snRNA (“MmU2”) promoter, mouse U3 snRNA (“MmU3”) promoter, mouse U4 snRNA (“MmU4”) promoter, mouse U5 snRNA (“MmU5”) promoter, mouse U6 snRNA (“MmU6”) promoter, mouse U7 snRNA (“MmU7”) promoter, mouse U11 snRNA (“MmU11”) promoter, mouse U12 snRNA (“MmU12”) promoter, mouse U7SK snRNA (“MmU7SK”) promoter, human U1 snRNA (“HsU1”) promoter, human U2 snRNA (“HsU2”) promoter, human U3 snRNA (“HsU3”) promoter, human U4 snRNA (“HsU4”) promoter, and human U5 snRNA. Functional combinations of the following promoters: (“HsU5”) promoter, human U6 snRNA (“HsU6”) promoter, human U7 snRNA (“HsU7”) promoter, human U11 snRNA (“HsU11”) promoter, human U12 snRNA (“HsU12”) promoter, human U7SK snRNA (“HsU7SK”) promoter, or fragments thereof.
[0144] The silent module promoter can include the MmU1 promoter. The silent module promoter can include the MmU2 promoter. The silent module promoter can include the MmU3 promoter. The silent module promoter can include the MmU4 promoter. The silent module promoter can include the MmU5 promoter. The silent module promoter can include the MmU6 promoter. The silent module promoter can include the MmU7 promoter. The silent module promoter can include the MmU11 promoter. The silent module promoter can include the MmU12 promoter. The silent module promoter can include the MmU7SK promoter. The silent module promoter can include the HsU1 promoter. The silent module promoter can include the HsU2 promoter. The silent module promoter can include the HsU3 promoter. The silent module promoter can include the HsU4 promoter. The silent module promoter can include the HsU5 promoter. The silent module promoter can include the HsU6 promoter. The silent module promoter can include the HsU7 promoter. The silent module promoter can include the HsU11 promoter. Silent module promoters can include the HsU12 promoter. Silent module promoters can also include the HsU7SK promoter.
[0145] A silent module promoter may include promoter segments or combinations of promoter segments. A silent module promoter may include the MmU1 promoter segment. A silent module promoter segment may include the MmU2 promoter segment. A silent module promoter segment may include the MmU3 promoter segment. A silent module promoter segment may include the MmU4 promoter segment. A silent module promoter segment may include the MmU5 promoter segment. A silent module promoter segment may include the MmU6 promoter segment. A silent module promoter segment may include the MmU7 promoter segment. A silent module promoter segment may include the MmU11 promoter segment. A silent module promoter segment may include the MmU12 promoter segment. A silent module promoter segment may include the MmU7SK promoter segment. A silent module promoter segment may include the HsU1 promoter segment. A silent module promoter segment may include the HsU2 promoter segment. A silent module promoter segment may include the HsU3 promoter segment. A silent module promoter segment may include the HsU4 promoter segment. A silent module promoter segment may include the HsU5 promoter segment. The silent module startup segment can include the HsU6 startup segment. The silent module startup segment can include the HsU7 startup segment. The silent module startup segment can include the HsU11 startup segment. The silent module startup segment can include the HsU12 startup segment. The silent module startup segment can include the HsU7SK startup segment.
[0146] The silent module promoter may include a proximal segment of the promoter. The proximal segment of the silent module promoter may include a proximal segment of the MmU1 promoter. The proximal segment of the silent module promoter may include a proximal segment of the MmU2 promoter. The proximal segment of the silent module promoter may include a proximal segment of the MmU3 promoter. The proximal segment of the silent module promoter may include a proximal segment of the MmU4 promoter. The proximal segment of the silent module promoter may include a proximal segment of the MmU5 promoter. The proximal segment of the silent module promoter may include a proximal segment of the MmU6 promoter. The proximal segment of the silent module promoter may include a proximal segment of the MmU7 promoter. The proximal segment of the silent module promoter may include a proximal segment of the MmU11 promoter. The proximal segment of the silent module promoter may include a proximal segment of the MmU12 promoter. The proximal segment of the silent module promoter may include a proximal segment of the MmU7SK promoter. The proximal segment of the silent module promoter may include a proximal segment of the HsU1 promoter. The proximal segment of the silent module promoter may include a proximal segment of the HsU2 promoter. The silent module promoter proximal segment may include the HsU3 promoter proximal segment. The silent module promoter proximal segment may include the HsU4 promoter proximal segment. The silent module promoter proximal segment may include the HsU5 promoter proximal segment. The silent module promoter proximal segment may include the HsU6 promoter proximal segment. The silent module promoter proximal segment may include the HsU7 promoter proximal segment. The silent module promoter proximal segment may include the HsU11 promoter proximal segment. The silent module promoter proximal segment may include the HsU12 promoter proximal segment. The silent module promoter proximal segment may include the HsU7SK promoter proximal segment.
[0147] The silent module starter may include a remote segment of the starter. The silent module starter remote segment may include the MmU1 starter remote segment. The silent module starter remote segment may include the MmU2 starter remote segment. The silent module starter remote segment may include the MmU3 starter remote segment. The silent module starter remote segment may include the MmU4 starter remote segment. The silent module starter remote segment may include the MmU5 starter remote segment. The silent module starter remote segment may include the MmU6 starter remote segment. The silent module starter remote segment may include the MmU7 starter remote segment. The silent module starter remote segment may include the MmU11 starter remote segment. The silent module starter remote segment may include the MmU12 starter remote segment. The silent module starter remote segment may include the MmU7SK starter remote segment. The silent module starter remote segment may include the HsU1 starter remote segment. The silent module starter remote segment may include the HsU2 starter remote segment. The silent module startup remote segment may include the HsU3 startup remote segment. The silent module startup remote segment may include the HsU4 startup remote segment. The silent module startup remote segment may include the HsU5 startup remote segment. The silent module startup remote segment may include the HsU6 startup remote segment. The silent module startup remote segment may include the HsU7 startup remote segment. The silent module startup remote segment may include the HsU11 startup remote segment. The silent module startup remote segment may include the HsU12 startup remote segment. The silent module startup remote segment may include the HsU7SK startup remote segment.
[0148] In one embodiment, the silencing module promoter includes a U7 snRNA promoter sequence. In another embodiment, the silencing module promoter sequence includes a U1 snRNA promoter sequence. In yet another embodiment, the silencing module promoter sequence includes a mouse U7 snRNA (“Mm U7”) promoter sequence, a human U7 snRNA (“Hs U7”) promoter sequence, a mouse U1a1 (“mu1a1” or “Mm U1a1”) promoter sequence, or a human U1-1 (“HU1” or “Hs U1-1”) promoter sequence, or a fragment or combination thereof. In one embodiment, the silencing module promoter sequence includes a mouse U7 snRNA promoter sequence or a fragment thereof. In another embodiment, the silencing module promoter sequence includes a human U7 snRNA promoter sequence or a fragment thereof. In yet another embodiment, the silencing module promoter sequence includes a mouse U1a1 promoter sequence or a fragment thereof. In yet another embodiment, the silencing module promoter sequence includes a human U1-1 promoter sequence or a fragment thereof.
[0149] In one implementation, the silencing module promoter sequence comprises a U7 snRNA promoter sequence having its distal sequence element (DSE) replaced by the DSE of the U1-1 or U1a1 promoter sequence. In another implementation, the DSE is replaced by the DSE of the U1-1 promoter sequence. In yet another implementation, the DSE is replaced by the DSE of the U1a1 promoter sequence.
[0150] For the modified Mm U7 promoter of SEQ ID NO: 8, the distal U7 sequence element has been replaced by the distal sequence element of human U1-1, while the proximal U7 sequence element has been replaced by the proximal sequence element of mouse U1a1. In an embodiment, the silencing module promoter sequence comprises a mouse U7 promoter sequence having its proximal sequence element (PSE) replaced by the PSE of the U1-1 or U1a1 promoter sequence. In an embodiment, the PSE is replaced by the PSE of the U1-1 promoter sequence. In an embodiment, the PSE is replaced by the PSE of the U1a1 promoter sequence.
[0151] In one implementation, the silent module promoter sequence has at least 90% identity with the promoter sequences shown in Table 8. In another implementation, the silent module promoter sequence has at least 91% identity with the promoter sequences shown in Table 8. In another implementation, the silent module promoter sequence has at least 92% identity with the promoter sequences shown in Table 8. In another implementation, the silent module promoter sequence has at least 93% identity with the promoter sequences shown in Table 8. In another implementation, the silent module promoter sequence has at least 94% identity with the promoter sequences shown in Table 8. In another implementation, the silent module promoter sequence has at least 95% identity with the promoter sequences shown in Table 8. In another implementation, the silent module promoter sequence has at least 96% identity with the promoter sequences shown in Table 8. In another implementation, the silent module promoter sequence has at least 97% identity with the promoter sequences shown in Table 8. In another implementation, the silent module promoter sequence has at least 98% identity with the promoter sequences shown in Table 8. In the implementation, the silent module promoter sequence has at least 99% identity with the promoter sequences shown in Table 8. In the implementation, the silent module promoter sequence includes the promoter sequences shown in Table 8. In the implementation, the silent module promoter sequence is the promoter sequence shown in Table 8.
[0152] In the implementation scheme, the silent module promoter sequence is 5' or upstream of the ESS nucleic acid sequence or antisense nucleic acid sequence.
[0153] In one implementation, the silencing module is operatively coupled to its promoter. In another implementation, the silencing module is operatively coupled to its synthesizing module promoter. In yet another implementation, the synthesizing module is operatively coupled to its promoter. In yet another implementation, the synthesizing module is operatively coupled to its silencing module promoter.
[0154] Exon splicing silencer In some implementations, this document describes exon splice silencer (ESS) sequences. ESS can be or is included in a 10-20 nt sequence at the 5' end of snRNA (e.g., modified snRNA) that enhances splicing repression. ESS can be included in modified or recombinant snRNA or U7 snRNA. ESS can recruit protein factors that reduce splicing of RNA encoding target proteins (e.g., MECP2 protein). ESS sequences can refer to ESS or sequences encoding ESS. ESS can include short regions of exons and is a cis-regulatory element (CRE). CREs are non-coding DNA regions that regulate the transcription of neighboring genes. CREs can include components of a genetic regulatory network that control the timing and amount of expression of specific genes. ESS can be bound by negatively acting factors such as heterogeneous ribonucleoproteins (hnRNPs).
[0155] In the implementation scheme, the ESS recruits protein factors or a group of factors that reduce or silence the splicing of endogenous target RNA. In the implementation scheme, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 90% identity with ATGATAGGGACTTAGGGTGA (SEQ ID NO: 240), a nucleic acid sequence having at least 90% identity with TTTGTTCCGTGGGTGGTTTA (SEQ ID NO: 241), or a nucleic acid sequence having at least 90% identity with TGGGGGGAGGTAGGTAGGTA (SEQ ID NO: 242). In the implementation scheme, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 240. In the implementation scheme, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 240. In the implementation scheme, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 240. In the implementation scheme, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 240. In one embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 240. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 240. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 240. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 240. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 240. In another embodiment, the ESS nucleic acid sequence comprises SEQ ID NO: 240. In another embodiment, the ESS nucleic acid sequence is SEQ ID NO: 240.
[0156] In one embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 241. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 241. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 241. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 241. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 241. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 241. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 241. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 241. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 241. In the implementation scheme, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 241. In the implementation scheme, the ESS nucleic acid sequence comprises SEQ ID NO: 241. In the implementation scheme, the ESS nucleic acid sequence is SEQ ID NO: 241.
[0157] In one embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 242. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 242. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 242. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 242. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 242. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 242. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 242. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 242. In another embodiment, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 242. In the implementation scheme, the ESS nucleic acid sequence comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 242. In the implementation scheme, the ESS nucleic acid sequence comprises SEQ ID NO: 242. In the implementation scheme, the ESS nucleic acid sequence is SEQ ID NO: 242.
[0158] U7 Target Sequence In some embodiments, this document describes targeting nucleic acid sequences such as snRNA targeting sequences or U7 targeting sequences. Targeting nucleic acid sequences may be or include antisense nucleic acid sequences. U7 targeting nucleic acid sequences may be or include U7 antisense nucleic acid sequences. snRNA targeting nucleic acid sequences may be or include snRNA antisense nucleic acid sequences. In some embodiments, this document describes antisense nucleic acid sequences such as snRNA antisense sequences or U7 antisense sequences. Antisense sequences may be referred to as targeting sequences. Antisense nucleic acid sequences may be included in modified or recombinant snRNA or U7 snRNA. Antisense nucleic acid sequences may target (e.g., bind to or be inversely complementary to) target RNA, such as RNA encoding the MECP2 protein. Antisense nucleic acid sequences may bind to target RNA. In some embodiments, the antisense nucleic acid sequence is encoded by a DNA sequence (e.g., a DNA expression construct).
[0159] In the system provided herein, in an implementation, the antisense nucleic acid sequence targets a targeted region of the endogenous target RNA. In an implementation, the antisense nucleic acid sequence binds to the targeted region of the endogenous target RNA. In an implementation, the antisense nucleic acid sequence is completely or partially anticomplementary (e.g., at least 90% anticomplementary) to the targeted region. For example, in an implementation, the antisense nucleic acid is at least partially complementary to the targeted region of the endogenous target RNA.
[0160] In one implementation, the targeted region is located within an intron of the endogenous target RNA. In another implementation, the endogenous target RNA is a target mRNA (e.g., a precursor mRNA). In yet another implementation, the targeted region is located within an intron of the target mRNA. In yet another implementation, the targeted region is at least partially complementary to the splicing site of the endogenous target RNA.
[0161] In one embodiment, the intron comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 8. In another embodiment, the intron comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 8. In another embodiment, the intron comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 8. In another embodiment, the intron comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 8. In another embodiment, the intron comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 8. In another embodiment, the intron comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 8. In another embodiment, the intron comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 8. In another embodiment, the intron comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 8. In another embodiment, the intron comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 8. In another embodiment, the intron comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 8. In the implementation scheme, the intron includes SEQ ID NO: 8.
[0162] In one embodiment, the intron comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 9. In another embodiment, the intron comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 9. In another embodiment, the intron comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 9. In another embodiment, the intron comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 9. In another embodiment, the intron comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 9. In another embodiment, the intron comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 9. In another embodiment, the intron comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 9. In another embodiment, the intron comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 9. In another embodiment, the intron comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 9. In another embodiment, the intron comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 9. In the implementation scheme, the intron includes SEQ ID NO: 9.
[0163] In one embodiment, the intron comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 10. In another embodiment, the intron comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 10. In another embodiment, the intron comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 10. In another embodiment, the intron comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 10. In another embodiment, the intron comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 10. In another embodiment, the intron comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 10. In another embodiment, the intron comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 10. In another embodiment, the intron comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 10. In another embodiment, the intron comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 10. In the implementation scheme, the intron comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 10. In the implementation scheme, the intron comprises SEQ ID NO: 10.
[0164] In one embodiment, the intron comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 11. In another embodiment, the intron comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 11. In another embodiment, the intron comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 11. In another embodiment, the intron comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 11. In another embodiment, the intron comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 11. In another embodiment, the intron comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 11. In another embodiment, the intron comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 11. In another embodiment, the intron comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 11. In another embodiment, the intron comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 11. In the implementation scheme, the intron comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 11. In the implementation scheme, the intron comprises SEQ ID NO: 11.
[0165] In one embodiment, the intron comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 12. In another embodiment, the intron comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 12. In another embodiment, the intron comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 12. In another embodiment, the intron comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 12. In another embodiment, the intron comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 12. In another embodiment, the intron comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 12. In another embodiment, the intron comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 12. In another embodiment, the intron comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 12. In another embodiment, the intron comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 12. In the implementation scheme, the intron comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 12. In the implementation scheme, the intron comprises SEQ ID NO: 12.
[0166] In one embodiment, the intron comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 13. In another embodiment, the intron comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 13. In another embodiment, the intron comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 13. In another embodiment, the intron comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 13. In another embodiment, the intron comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 13. In another embodiment, the intron comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 13. In another embodiment, the intron comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 13. In another embodiment, the intron comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 13. In another embodiment, the intron comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 13. In the implementation scheme, the intron comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 13. In the implementation scheme, the intron comprises SEQ ID NO: 13.
[0167] In one embodiment, the intron comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 14. In another embodiment, the intron comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 14. In another embodiment, the intron comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 14. In another embodiment, the intron comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 14. In another embodiment, the intron comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 14. In another embodiment, the intron comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 14. In another embodiment, the intron comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 14. In another embodiment, the intron comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 14. In another embodiment, the intron comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 14. In the implementation scheme, the intron comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 14. In the implementation scheme, the intron comprises SEQ ID NO: 14.
[0168] In one embodiment, the intron comprises a nucleic acid sequence having at least 90% identity with SEQ ID NO: 15. In another embodiment, the intron comprises a nucleic acid sequence having at least 91% identity with SEQ ID NO: 15. In another embodiment, the intron comprises a nucleic acid sequence having at least 92% identity with SEQ ID NO: 15. In another embodiment, the intron comprises a nucleic acid sequence having at least 93% identity with SEQ ID NO: 15. In another embodiment, the intron comprises a nucleic acid sequence having at least 94% identity with SEQ ID NO: 15. In another embodiment, the intron comprises a nucleic acid sequence having at least 95% identity with SEQ ID NO: 15. In another embodiment, the intron comprises a nucleic acid sequence having at least 96% identity with SEQ ID NO: 15. In another embodiment, the intron comprises a nucleic acid sequence having at least 97% identity with SEQ ID NO: 15. In another embodiment, the intron comprises a nucleic acid sequence having at least 98% identity with SEQ ID NO: 15. In the implementation scheme, the intron comprises a nucleic acid sequence having at least 99% identity with SEQ ID NO: 15. In the implementation scheme, the intron comprises SEQ ID NO: 15.
[0169] Antisense nucleic acid sequences can bind to or target target RNA. Target RNA (e.g., MECP2 RNA) can be or include target mRNA (e.g., MECP2 mRNA). Target mRNA can be or include target precursor mRNA (e.g., MECP2 precursor mRNA). For example, target RNA can include precursor mRNA. Precursor mRNA can include mRNA that is present before splicing or before splicing is complete. When mRNA has undergone complete splicing, it can be referred to as mature mRNA.
[0170] In some embodiments, the target RNA (e.g., MECP2 RNA) comprises mammalian target RNA. In some embodiments, the target RNA comprises primate target RNA. In some embodiments, the target RNA comprises human target RNA. In some embodiments, the target RNA comprises rodent or mouse target RNA.
[0171] Target RNA, such as MECP2 RNA, may include a targeted region. In one embodiment, the targeted region is located within an exon of the endogenous target RNA. In another embodiment, the targeted region is located within an exon of the target mRNA. In yet another embodiment, the antisense nucleic acid sequence targets the alternative splicing exon of the endogenous target RNA.
[0172] In some implementations, the targeted region is located within the 5' half or 5' end of an intron or exon of the endogenous target RNA. For example, in some implementations, the targeted region may be closer to the 5' end of an intron of the endogenous target RNA. In some implementations, the targeted region includes the 5' end of an intron of the endogenous target RNA. In some implementations, the targeted region may be closer to the 5' end of an exon of the endogenous target RNA. In some implementations, the targeted region includes the 5' end of an exon of the endogenous target RNA.
[0173] In some implementations, the targeted region is located within the 3' half or 3' end of an intron or exon of the endogenous target RNA. For example, in some implementations, the targeted region may be closer to the 3' end of an intron of the endogenous target RNA. In some implementations, the targeted region includes the 3' end of an intron of the endogenous target RNA. In some implementations, the targeted region may be closer to the 3' end of an exon of the endogenous target RNA. In some implementations, the targeted region includes the 3' end of an exon of the endogenous target RNA.
[0174] In one implementation, the targeted region of the endogenous target RNA (e.g., MECP2 RNA) includes the intron-exon junction of the endogenous RNA. The intron-exon junction refers to the boundary between an intron and an exon, and includes the splicing site that separates the intron and exon during precursor mRNA splicing. In one implementation, the targeted region of the endogenous target RNA is within 0 nt to 150 nt at the intron-exon junction. In another implementation, the targeted region of the endogenous target RNA is within 10 nt to 150 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 20 nt to 150 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 30 nt to 150 nt at the intron-exon junction. In one implementation, the targeted region of the endogenous target RNA is within 40 to 150 nt at the intron-exon junction. In another implementation, the targeted region of the endogenous target RNA is within 40 to 150 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 60 to 150 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 70 to 150 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 80 to 150 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 90 to 150 nt at the intron-exon junction. In one implementation, the targeted region of the endogenous target RNA is within 100 to 150 nt at the intron-exon junction. In another implementation, the targeted region of the endogenous target RNA is within 110 to 150 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 120 to 150 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 130 to 150 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 140 to 150 nt at the intron-exon junction.
[0175] In one implementation, the targeted region of the endogenous target RNA is within 0 nt to 140 nt at the intron-exon junction. In another implementation, the targeted region of the endogenous target RNA is within 0 nt to 130 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 0 nt to 120 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 0 nt to 110 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 0 nt to 100 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 0 nt to 90 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 0 nt to 80 nt at the intron-exon junction. In one implementation, the targeted region of the endogenous target RNA is within 0 nt to 70 nt at the intron-exon junction. In another implementation, the targeted region of the endogenous target RNA is within 0 nt to 60 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 0 nt to 50 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 0 nt to 40 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 0 nt to 30 nt at the intron-exon junction. In yet another implementation, the targeted region of the endogenous target RNA is within 0 nt to 20 nt at the intron-exon junction.
[0176] In the implementation scheme, the targeted region of the endogenous target RNA is within 0 nt, 10 nt, 20 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, 110 nt, 120 nt, 130 nt, 140 nt, or 150 nt at the intron-exon junction. In the implementation scheme, the targeted region of the endogenous target RNA includes the intron-exon junction.
[0177] The targeted region can be or contains a nucleotide of a certain length. For example, the length of the targeted region can be about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, or about 150 nucleotides, or a length range defined by any two of the above lengths. In some embodiments, the length is at least 10 nucleotides. In some embodiments, the length is at least 15 nucleotides. In some embodiments, the length is at least 20 nucleotides. In some embodiments, the length is at least 25 nucleotides. In some embodiments, the length is at least 30 nucleotides. In some embodiments, the length is at least 35 nucleotides. In some embodiments, the length is at least 40 nucleotides. In some embodiments, the length is at least 45 nucleotides. In some embodiments, the length is at least 50 nucleotides. In some embodiments, the length is at least 60 nucleotides. In some embodiments, the length is at least 70 nucleotides. In some embodiments, the length is at least 80 nucleotides. In some embodiments, the length is at least 90 nucleotides. In some embodiments, the length is at least 100 nucleotides. In some embodiments, the length is at least 110 nucleotides. In some embodiments, the length is at least 120 nucleotides. In some embodiments, the length is at least 130 nucleotides. In some embodiments, the length is at least 140 nucleotides. In some embodiments, the length is at least 150 nucleotides. In some embodiments, the length is less than 15 nucleotides. In some embodiments, the length is less than 20 nucleotides. In some embodiments, the length is less than 25 nucleotides. In some embodiments, the length is less than 30 nucleotides. In some embodiments, the length is less than 35 nucleotides. In some embodiments, the length is less than 40 nucleotides. In some embodiments, the length is less than 45 nucleotides. In some embodiments, the length is less than 50 nucleotides. In some embodiments, the length is less than 60 nucleotides. In some embodiments, the length is less than 70 nucleotides. In some embodiments, the length is less than 80 nucleotides. In some embodiments, the length is less than 90 nucleotides. In some embodiments, the length is less than 100 nucleotides. In some embodiments, the length is less than 110 nucleotides. In some embodiments, the length is less than 120 nucleotides. In some embodiments, the length is less than 130 nucleotides. In some embodiments, the length is less than 140 nucleotides. In some embodiments, the length is less than 150 nucleotides.
[0178] In one implementation, the antisense nucleic acid sequence (the antisense nucleic acid sequence targeting endogenous target RNA) is 10-60 nucleotides in length. In another implementation, the antisense nucleic acid sequence is 15-60 nucleotides in length. In yet another implementation, the antisense nucleic acid sequence is 20-60 nucleotides in length. In yet another implementation, the antisense nucleic acid sequence is 25-60 nucleotides in length. In yet another implementation, the antisense nucleic acid sequence is 30-60 nucleotides in length. In yet another implementation, the antisense nucleic acid sequence is 35-60 nucleotides in length. In yet another implementation, the antisense nucleic acid sequence is 40-60 nucleotides in length. In yet another implementation, the antisense nucleic acid sequence is 45-60 nucleotides in length. In yet another implementation, the antisense nucleic acid sequence is 50-60 nucleotides in length. In yet another implementation, the antisense nucleic acid sequence is 55-60 nucleotides in length.
[0179] In one embodiment, the antisense nucleic acid sequence is 10-55 nucleotides in length. In another embodiment, the antisense nucleic acid sequence is 10-50 nucleotides in length. In another embodiment, the antisense nucleic acid sequence is 10-45 nucleotides in length. In another embodiment, the antisense nucleic acid sequence is 10-40 nucleotides in length. In another embodiment, the antisense nucleic acid sequence is 10-35 nucleotides in length. In another embodiment, the antisense nucleic acid sequence is 10-30 nucleotides in length. In another embodiment, the antisense nucleic acid sequence is 10-25 nucleotides in length. In another embodiment, the antisense nucleic acid sequence is 10-20 nucleotides in length. In another embodiment, the antisense nucleic acid sequence is 10-15 nucleotides in length. In another embodiment, the antisense nucleic acid sequence is about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length, or a range defined by any two of the above nucleotide lengths.
[0180] In some embodiments, the nucleic acid targeting sequence targets or binds to exon 1 of MECP2. In some embodiments, the nucleic acid targeting sequence targets or binds to SEQ ID NO: 924. In some embodiments, the nucleic acid targeting sequence targets or binds to a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 924. In some embodiments, the nucleic acid targeting sequence targets or binds to SEQ ID NO: 927. In some embodiments, the nucleic acid targeting sequence targets or binds to a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 927.
[0181] In some embodiments, the nucleic acid targeting sequence targets or binds to exon 3 of MECP2. In some embodiments, the nucleic acid targeting sequence targets or binds to SEQ ID NO: 925. In some embodiments, the nucleic acid targeting sequence targets or binds to a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 925. In some embodiments, the nucleic acid targeting sequence targets or binds to SEQ ID NO: 928. In some embodiments, the nucleic acid targeting sequence targets or binds to a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 928.
[0182] In some embodiments, the nucleic acid targeting sequence targets or binds to exon 4 of MECP2. In some embodiments, the nucleic acid targeting sequence targets or binds to SEQ ID NO: 926. In some embodiments, the nucleic acid targeting sequence targets or binds to a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 926. In some embodiments, the nucleic acid targeting sequence targets or binds to SEQ ID NO: 929. In some embodiments, the nucleic acid targeting sequence targets or binds to a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 929.
[0183] In one implementation, the antisense nucleic acid sequence comprises a nucleic acid sequence having at least 90% identity with the antisense nucleic acid sequences shown in Table 2. In another implementation, the antisense nucleic acid sequence comprises a nucleic acid sequence having at least 91% identity with the antisense nucleic acid sequences shown in Table 2. In another implementation, the antisense nucleic acid sequence comprises a nucleic acid sequence having at least 92% identity with the antisense nucleic acid sequences shown in Table 2. In another implementation, the antisense nucleic acid sequence comprises a nucleic acid sequence having at least 93% identity with the antisense nucleic acid sequences shown in Table 2. In another implementation, the antisense nucleic acid sequence comprises a nucleic acid sequence having at least 94% identity with the antisense nucleic acid sequences shown in Table 2. In another implementation, the antisense nucleic acid sequence comprises a nucleic acid sequence having at least 95% identity with the antisense nucleic acid sequences shown in Table 2. In another implementation, the antisense nucleic acid sequence comprises a nucleic acid sequence having at least 96% identity with the antisense nucleic acid sequences shown in Table 2. In another implementation, the antisense nucleic acid sequence comprises a nucleic acid sequence having at least 97% identity with the antisense nucleic acid sequences shown in Table 2. In another implementation, the antisense nucleic acid sequence comprises a nucleic acid sequence having at least 98% identity with the antisense nucleic acid sequences shown in Table 2. In the implementation scheme, the antisense nucleic acid sequence comprises a nucleic acid sequence having at least 98% identity with the antisense nucleic acid sequences shown in Table 2. In the implementation scheme, the antisense nucleic acid sequence comprises the antisense nucleic acid sequences shown in Table 2. In the implementation scheme, the antisense nucleic acid sequence is the antisense nucleic acid sequence shown in Table 2.
[0184] In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 30. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 31. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 32. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 33. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 34. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 35. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 36. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 37. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 38. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 39. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 40. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 41. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 42. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 43. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 44. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 45. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 46. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 47. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 48. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 49. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 50. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 51. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 52. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 53. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 54.In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 55. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 56. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 57. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 58. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 59. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 60. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 61. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 62. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 63. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 64. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 65. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 66. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 67. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 68. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 69. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 70. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 71. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 72. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 73. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 74. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 75. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 76. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 77. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 78. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 79.In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 80. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 81. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 82. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 83. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 84. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 84. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 85. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 86. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 87. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 88. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 89. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 90. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 91. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 92. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 93. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 94. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 95. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 96. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 97. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 98. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 99. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 100. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 101. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 102. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 103.In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 104. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 105. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 106. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 107. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 108. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 109. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 110. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 111. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 112. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 113. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 114. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 115. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 116. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 117. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 118. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 119. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 120. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 121. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 126. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 127. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 128. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 129. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 130. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 131. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 132.In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 133. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 134. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 135. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 136. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 137. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 138. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 139. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 140. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 141. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 142. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 143. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 144. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 145. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 146. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 147. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 148. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 149. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 150. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 151. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 152. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 153. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 154. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 155. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 156. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 157.In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 158. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 159. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 160. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 161. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 162. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 163. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 164. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 165. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 166. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 167. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 168. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 169. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 170. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 171. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 172. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 173. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 174. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 175. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 176. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 176. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 177. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 178. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 179. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 180. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 181.In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 182. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 183. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 184. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 184. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 185. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 186. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 187. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 188. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 189. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 190. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 191. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 192. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 193. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 194. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 195. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 196. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 197. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 198. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 199. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 200. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 201. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 202. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 203. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 204. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 205.In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 206. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 207. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 208. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 209. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 210. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 211. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 212. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 213. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 214. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 215. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 216. In the implementation scheme, the antisense nucleic acid sequence has at least 90% identity with SEQ ID NO: 217.
[0185] In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 30. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 31. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 32. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 33. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 34. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 35. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 36. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 37. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 38. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 39. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 40. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 41. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 42. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 43. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 44. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 45. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 46. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 47. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 48. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 49. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 50. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 51. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 52. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 53. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 54. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 55. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 56. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 57. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 58. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 59. In one implementation, the antisense nucleic acid sequence includes SEQ ID NO: 60. In another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 61. In yet another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 62. In yet another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 63.In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 64. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 65. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 66. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 67. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 68. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 69. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 70. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 71. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 72. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 73. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 74. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 75. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 76. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 76. In the implementation scheme, the antisense nucleic acid sequence includes SEQ ID NO: 77. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 78. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 79. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 80. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 81. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 82. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 83. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 84. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 84. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 85. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 86. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 87. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 88. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 89. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 90. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 91. In one implementation, the antisense nucleic acid sequence includes SEQ ID NO: 92. In another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 93. In yet another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 94. In yet another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 95.In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 96. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 97. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 98. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 99. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 100. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 101. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 102. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 103. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 104. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 105. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 106. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 107. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 108. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 109. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 110. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 111. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 112. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 113. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 114. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 115. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 116. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 117. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 118. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 119. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 120. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 121. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 126. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 127. In one embodiment, the antisense nucleic acid sequence includes SEQ ID NO: 128. In another embodiment, the antisense nucleic acid sequence includes SEQ ID NO: 129. In another embodiment, the antisense nucleic acid sequence includes SEQ ID NO: 130. In another embodiment, the antisense nucleic acid sequence includes SEQ ID NO: 131. In another embodiment, the antisense nucleic acid sequence includes SEQ ID NO: 132.In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 133. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 134. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 135. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 136. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 137. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 138. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 139. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 140. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 141. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 142. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 143. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 144. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 145. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 146. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 147. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 148. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 149. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 150. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 151. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 152. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 153. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 154. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 155. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 156. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 157. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 158. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 159. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 160. In one implementation, the antisense nucleic acid sequence includes SEQ ID NO: 161. In another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 162. In another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 163. In another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 164. In another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 165.In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 166. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 167. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 168. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 169. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 170. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 171. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 172. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 173. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 174. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 175. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 176. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 177. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 178. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 179. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 180. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 181. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 182. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 183. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 184. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 184. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 185. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 186. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 187. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 188. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 189. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 190. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 191. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 192. In one implementation, the antisense nucleic acid sequence includes SEQ ID NO: 193. In another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 194. In another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 195. In another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 196. In another implementation, the antisense nucleic acid sequence includes SEQ ID NO: 197.In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 198. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 199. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 200. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 201. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 202. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 203. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 204. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 205. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 206. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 207. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 208. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 209. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 210. In the embodiments, the antisense nucleic acid sequence includes SEQ ID NO: 211. In one embodiment, the antisense nucleic acid sequence includes SEQ ID NO: 212. In one embodiment, the antisense nucleic acid sequence includes SEQ ID NO: 213. In one embodiment, the antisense nucleic acid sequence includes SEQ ID NO: 214. In one embodiment, the antisense nucleic acid sequence includes SEQ ID NO: 215. In one embodiment, the antisense nucleic acid sequence includes SEQ ID NO: 216. In one embodiment, the antisense nucleic acid sequence includes SEQ ID NO: 217.
[0186] The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 141. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 191. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 250. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 251. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 252. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 253. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 254. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 255. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 256. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 257. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 258. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 259. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 260.The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 261. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 262. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 263. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 264. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 265. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 266. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 267. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 268. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 269. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 270. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 271. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 272. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 273.The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 274. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 275. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 276. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 277. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 278. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 279. The antisense nucleic acid sequence may include a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 280.
[0187] In the implementation plan, the antisense nucleic acid sequence is 3 / or downstream of the ESS nucleic acid sequence within the silencing module.
[0188] SMOPT In some embodiments, this document describes a system that includes an Sm binding site. The Sm binding site may be included in a modified or recombinant snRNA or U7 snRNA. Sm proteins may bind to U7 snRNA via the Sm binding site. Once Sm proteins bind to U7 snRNA in the cytoplasm, they can bind to precursor mRNA and regulate splicing. In some embodiments, the system contains an Sm-like binding site. The modified or recombinant U7 snRNA sequence may include the Sm binding site. The system may encode a modified or recombinant U7 snRNA sequence that includes the Sm binding site.
[0189] In the system provided herein, in embodiments, the silencing module includes a sequence capable of binding to or recruiting one or more proteins capable of splicing RNA. In embodiments, the silencing module further includes an Sm binding site sequence. The term "Sm binding site sequence" refers to a nucleic acid sequence commonly found in U snRNAs capable of binding and / or recruiting Sm proteins. Binding of Sm proteins to U snRNAs leads to the formation of a snRNP complex, which is typically involved in RNA processing. In embodiments, U7-specific proteins (e.g., Lsm10 and Lsm11) bind to the Sm binding site of U7 snRNA to form a U7 snRNP, allowing histone RNA processing.
[0190] In one embodiment, the Sm binding site sequence includes AAUUUGUCUAG (SEQ ID NO: 243) or AAUUUUUGGAG (SEQ ID NO: 244; smOPT). In another embodiment, the Sm binding site sequence includes SEQ ID NO: 243. In yet another embodiment, the Sm binding site sequence is SEQ ID NO: 243. In yet another embodiment, the Sm binding site sequence includes SEQ ID NO: 244. In yet another embodiment, the Sm binding site sequence is SEQ ID NO: 244.
[0191] In this embodiment, the Sm binding site sequence includes the smOPT sequence. In this embodiment, the smOPT sequence includes SEQ ID NO: 244. As used herein, the term "smOPT sequence" refers to a nucleic acid sequence that binds to and / or recruits proteins involved in non-histone RNA splicing. Therefore, in this embodiment, the smOPT sequence does not bind to and / or recruit spliceosome proteins specifically involved in histone processing. In this embodiment, the smOPT sequence does not bind to proteins that specifically bind to U7 snRNA. In this embodiment, the smOPT sequence binds to and / or recruits proteins involved in non-histone mRNA processing. In this embodiment, the smOPT sequence does not bind to and / or recruit Lsm10 or Lsm11. In this embodiment, the smOPT sequence does not bind to and / or recruit Lsm10. In this embodiment, the smOPT sequence does not bind to and / or recruit Lsm11.
[0192] In this implementation, the smOPT sequence includes a common sequence found in various snRNAs. In this implementation, the common sequence includes SEQ ID NO: 244. The smOPT sequence can bind to proteins to form a structure comprising a heptamer protein core.
[0193] In the implementation scheme, the Sm binding site sequence is 3' or downstream of the silencing module promoter sequence, ESS nucleic acid sequence, or antisense nucleic acid sequence within the silencing module. In the implementation scheme, the Sm binding site sequence is 3' or downstream of the silencing module promoter sequence. In the implementation scheme, the Sm binding site sequence is 3' or downstream of the ESS nucleic acid sequence. In the implementation scheme, the Sm binding site sequence is 3' or downstream of the antisense nucleic acid sequence within the silencing module.
[0194] U7 3' hair clip In some embodiments, a system comprising a hairpin sequence is described herein. The hairpin sequence may be included in a modified or recombinant snRNA or U7 snRNA. The hairpin sequence may include a U7 hairpin sequence. The U7 hairpin sequence may be a 3' U7 hairpin sequence. The modified or recombinant U7 snRNA sequence may include a hairpin sequence. The system may encode a modified or recombinant U7 snRNA sequence comprising a hairpin sequence.
[0195] In the system provided herein, in an embodiment, the silencing module further includes a hairpin sequence. In an embodiment, the hairpin sequence includes a 3' hairpin sequence of U7 small nuclear RNA (snRNA). For example, the hairpin sequence may be a hairpin sequence found in naturally occurring U7 snRNA. In an embodiment, the hairpin sequence is 3' or downstream of the silencing module promoter sequence, ESS nucleic acid sequence, antisense nucleic acid sequence, or Sm binding site sequence within the silencing module. In an embodiment, the hairpin sequence is 3' or downstream of the silencing module promoter sequence within the silencing module. In an embodiment, the hairpin sequence is 3' or downstream of the ESS nucleic acid sequence within the silencing module. In an embodiment, the hairpin sequence is 3' or downstream of the antisense nucleic acid sequence within the silencing module. In an embodiment, the hairpin sequence is 3' or downstream of the Sm binding site sequence within the silencing module.
[0196] 3' Termination Subsequence In embodiments of the system provided herein, the silencing module further includes a termination subsequence. In embodiments, the termination subsequence includes a mouse or human termination subsequence. In embodiments, the termination subsequence includes a mouse termination subsequence. In embodiments, the termination subsequence includes a human termination subsequence. The silencing module termination subsequence may include or may be the recombination regulatory element described herein, which includes a termination subsequence or a termination subsequence.
[0197] In some implementations, the silencing module terminators include mouse U1 snRNA (“MmU1”) terminator, mouse U2 snRNA (“MmU2”) terminator, mouse U3 snRNA (“MmU3”) terminator, mouse U4 snRNA (“MmU4”) terminator, mouse U5 snRNA (“MmU5”) terminator, mouse U6 snRNA (“MmU6”) terminator, mouse U7 snRNA (“MmU7”) terminator, mouse U11 snRNA (“MmU11”) terminator, mouse U12 snRNA (“MmU12”) terminator, mouse U7SK snRNA (“MmU7SK”) terminator, human U1 snRNA (“HsU1”) terminator, human U2 snRNA (“HsU2”) terminator, human U3 snRNA (“HsU3”) terminator, human U4 snRNA (“HsU4”) terminator, and human U5 snRNA. Functional combinations of the following terminator fragments: (“HsU5”) terminator, human U6 snRNA (“HsU6”) terminator, human U7 snRNA (“HsU7”) terminator, human U11 snRNA (“HsU11”) terminator, human U12 snRNA (“HsU12”) terminator, human U7SK snRNA (“HsU7SK”) terminator, or fragments thereof.
[0198] The silent module terminator can include the MmU1 terminator. The silent module terminator can include the MmU2 terminator. The silent module terminator can include the MmU3 terminator. The silent module terminator can include the MmU4 terminator. The silent module terminator can include the MmU5 terminator. The silent module terminator can include the MmU6 terminator. The silent module terminator can include the MmU7 terminator. The silent module terminator can include the MmU11 terminator. The silent module terminator can include the MmU12 terminator. The silent module terminator can include the MmU7SK terminator. The silent module terminator can include the HsU1 terminator. The silent module terminator can include the HsU2 terminator. The silent module terminator can include the HsU3 terminator. The silent module terminator can include the HsU4 terminator. The silent module terminator can include the HsU5 terminator. The silent module terminator can include the HsU6 terminator. The silent module terminator can include the HsU7 terminator. The silent module terminator can include the HsU11 terminator. The silent module terminator can include the HsU12 terminator. The silent module terminator can also include the HsU7SK terminator.
[0199] A silent module terminator may include a terminator segment or a combination of terminator segments. A silent module terminator may include the MmU1 terminator segment. A silent module terminator segment may include the MmU2 terminator segment. A silent module terminator segment may include the MmU3 terminator segment. A silent module terminator segment may include the MmU4 terminator segment. A silent module terminator segment may include the MmU5 terminator segment. A silent module terminator segment may include the MmU6 terminator segment. A silent module terminator segment may include the MmU7 terminator segment. A silent module terminator segment may include the MmU11 terminator segment. A silent module terminator segment may include the MmU12 terminator segment. A silent module terminator segment may include the MmU7SK terminator segment. A silent module terminator segment may include the HsU1 terminator segment. A silent module terminator segment may include the HsU2 terminator segment. A silent module terminator segment may include the HsU3 terminator segment. A silent module terminator segment may include the HsU4 terminator segment. A silent module terminator segment may include the HsU5 terminator segment. The silent module termination sub-fragment may include the HsU6 termination sub-fragment. The silent module termination sub-fragment may include the HsU7 termination sub-fragment. The silent module termination sub-fragment may include the HsU11 termination sub-fragment. The silent module termination sub-fragment may include the HsU12 termination sub-fragment. The silent module termination sub-fragment may include the HsU7SK termination sub-fragment.
[0200] The silent module terminator may include the proximal end of the terminator. The proximal end of the silent module terminator may include the MmU1 terminator proximal segment. The proximal segment of the silent module terminator may include the MmU2 terminator proximal segment. The proximal segment of the silent module terminator may include the MmU3 terminator proximal segment. The proximal segment of the silent module terminator may include the MmU4 terminator proximal segment. The proximal segment of the silent module terminator may include the MmU5 terminator proximal segment. The proximal segment of the silent module terminator may include the MmU6 terminator proximal segment. The proximal segment of the silent module terminator may include the MmU7 terminator proximal segment. The proximal segment of the silent module terminator may include the MmU11 terminator proximal segment. The proximal segment of the silent module terminator may include the MmU12 terminator proximal segment. The proximal segment of the silent module terminator may include the MmU7SK terminator proximal segment. The proximal segment of the silent module terminator may include the HsU1 terminator proximal segment. The proximal segment of the silent module terminator may include the HsU2 terminator proximal segment. The silencing module's terminating sub-proximal fragment may include the HsU3 terminating sub-proximal fragment. The silencing module's terminating sub-proximal fragment may include the HsU4 terminating sub-proximal fragment. The silencing module's terminating sub-proximal fragment may include the HsU5 terminating sub-proximal fragment. The silencing module's terminating sub-proximal fragment may include the HsU6 terminating sub-proximal fragment. The silencing module's terminating sub-proximal fragment may include the HsU7 terminating sub-proximal fragment. The silencing module's terminating sub-proximal fragment may include the HsU11 terminating sub-proximal fragment. The silencing module's terminating sub-proximal fragment may include the HsU12 terminating sub-proximal fragment. The silencing module's terminating sub-proximal fragment may include the HsU7SK terminating sub-proximal fragment.
[0201] The silent module terminator may include a remote segment of the terminator. The remote segment of the silent module terminator may include the MmU1 terminator remote segment. The remote segment of the silent module terminator may include the MmU2 terminator remote segment. The remote segment of the silent module terminator may include the MmU3 terminator remote segment. The remote segment of the silent module terminator may include the MmU4 terminator remote segment. The remote segment of the silent module terminator may include the MmU5 terminator remote segment. The remote segment of the silent module terminator may include the MmU6 terminator remote segment. The remote segment of the silent module terminator may include the MmU7 terminator remote segment. The remote segment of the silent module terminator may include the MmU11 terminator remote segment. The remote segment of the silent module terminator may include the MmU12 terminator remote segment. The remote segment of the silent module terminator may include the MmU7SK terminator remote segment. The remote segment of the silent module terminator may include the HsU1 terminator remote segment. The remote segment of the silent module terminator may include the HsU2 terminator remote segment. The silence module termination sub-remote segment may include HsU3 termination sub-remote segment. The silence module termination sub-remote segment may include HsU4 termination sub-remote segment. The silence module termination sub-remote segment may include HsU5 termination sub-remote segment. The silence module termination sub-remote segment may include HsU6 termination sub-remote segment. The silence module termination sub-remote segment may include HsU7 termination sub-remote segment. The silence module termination sub-remote segment may include HsU11 termination sub-remote segment. The silence module termination sub-remote segment may include HsU12 termination sub-remote segment. The silence module termination sub-remote segment may include HsU7SK termination sub-remote segment.
[0202] In some embodiments, the termination sequence may include a nucleic acid sequence. In some embodiments, the termination sequence may include the same nucleic acid sequence as the termination sequence in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 99% identity with the termination sequence in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 98% identity with the termination sequence in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 97% identity with the termination sequence in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 96% identity with the termination sequence in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 95% identity with the termination sequence in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 94% identity with the termination sequence in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 93% identity with the termination sequence in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 92% identity with the termination sequence in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 91% identity with the termination sequences in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 90% identity with the termination sequences in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 85% identity with the termination sequences in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 80% identity with the termination sequences in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 75% identity with the termination sequences in Table 8. In some embodiments, the termination sequence may include a nucleic acid sequence having at least 70% identity with the termination sequences in Table 8.
[0203] The termination sequence can be operatively linked to an ESS sequence, a U7 targeting sequence, an Sm binding site, or a U7 3' hairpin, or a combination thereof. For example, the termination sequence can be operatively linked to an ESS sequence, a U7 targeting sequence, an Sm binding site, and a U7 3' hairpin in the expression construct.
[0204] In some embodiments, the termination sequence includes a U7 snRNA termination sequence. In some embodiments, the termination sequence includes a U1 termination sequence. In some embodiments, the termination sequence includes an Mm U7 termination sequence, an Hs U7 termination sequence, a mu1a1 termination sequence, or a HU1 termination sequence, or fragments or combinations thereof. In some embodiments, the termination sequence includes an Mm U7 termination sequence or a fragment thereof. In some embodiments, the termination sequence includes an Hs U7 termination sequence or a fragment thereof. In some embodiments, the termination sequence includes a mu1a1 termination sequence or a fragment thereof. In some embodiments, the termination sequence includes a HU1 termination sequence or a fragment thereof.
[0205] In this embodiment, the termination sequence comprises a U7 snRNA termination sequence having a distal sequence element (DSE) replaced by a DSE of the U1-1 or U1a1 termination sequence. In this embodiment, the termination sequence comprises a U7 snRNA termination sequence having a DSE replaced by a DSE of the U1-1 termination sequence. In this embodiment, the termination sequence comprises a U7 snRNA termination sequence having a DSE replaced by a DSE of the U1a1 termination sequence. A “distal sequence element” or “DSE” refers to a nucleic acid sequence that regulates snRNA gene expression. In this embodiment, the distal sequence element may be found upstream of the snRNA promoter. The DSE may include one or more transcription factor binding sites and / or one or more proteins that activate snRNA transcription.
[0206] In this embodiment, the termination sequence comprises a mouse U7 snRNA termination sequence having a proximal sequence element (PSE) replaced by a U1-1 or U1a1 termination sequence. In this embodiment, the termination sequence comprises a mouse U7 snRNA termination sequence having a PSE replaced by a U1-1 termination sequence. In this embodiment, the termination sequence comprises a mouse U7 snRNA termination sequence having a PSE replaced by a U1a1 termination sequence. "Proximal sequence element" or "PSE" refers to a sequence commonly found in snRNA genes that regulate snRNA gene expression. PSEs are typically found in snRNA genes transcribed by RNA Pol II and RNA Pol III. In this embodiment, the PSE includes a binding site for a PSE-binding transcription factor (PTF).
[0207] In the implementation scheme, the termination sequence is 3' or downstream of the silencing module promoter sequence, ESS nucleic acid sequence, antisense nucleic acid sequence, Sm binding site sequence or hairpin sequence.
[0208] In the implementation scheme, the termination sequence is 3' or downstream of the silencing module promoter sequence, ESS nucleic acid sequence, antisense nucleic acid sequence, Sm binding site sequence, or hairpin sequence. In the implementation scheme, the termination sequence is 3' or downstream of the silencing module promoter sequence. In the implementation scheme, the termination sequence is 3' or downstream of the ESS nucleic acid sequence. In the implementation scheme, the termination sequence is 3' or downstream of the antisense nucleic acid sequence. In the implementation scheme, the termination sequence is 3' or downstream of the hairpin sequence.
[0209] Reorganization of regulatory elements In some embodiments, recombination regulatory elements are described herein. Recombination regulatory elements may be included in the silencing modules described herein. For example, the promoter of the silencing module may contain a promoter sequence of the regulatory elements described herein. The terminator of the silencing module may contain a terminator sequence of the regulatory elements described herein.
[0210] In some implementations, this document describes a nucleic acid system that may contain one or more regulatory elements, such as promoter sequences or terminator sequences. The promoter or terminator sequence may be part of an expression construct. The expression construct may mix and match regulatory sequences, such as promoter or terminator sequences, from various biological species or from various genes of a species. Regulatory sequences may mix and match elements, such as distal or proximal sequences, from various biological species or from various genes of a species.
[0211] In some embodiments, a nucleic acid expression system is described herein. In some embodiments, the nucleic acid expression system may contain a regulatory sequence operatively coupled to a transcribed region of the nucleic acid. In some embodiments, the regulatory sequence may comprise a proximal regulatory sequence element (PSE). In some embodiments, the regulatory sequence may comprise a distal regulatory sequence element (DSE). In some embodiments, the regulatory sequence may comprise both a PSE and a DSE. In some embodiments, the PSE may consist of a PSE sequence of a first small nuclear RNA (snRNA) of a first biological species. In some embodiments, the DSE may comprise a DSE sequence of a second small nuclear RNA (snRNA) of a second biological species. In some embodiments, the first and second snRNAs may be different. In some embodiments, the first and second snRNAs may be the same. In some embodiments, the first and second biological species may be different. In some embodiments, the first and second biological species may be the same. In some implementations, this document describes a nucleic acid system comprising a regulatory sequence operatively coupled to a transcribed region of a nucleic acid, wherein the regulatory sequence comprises a proximal regulatory sequence element (PSE) and a distal regulatory sequence element (DSE), wherein the PSE comprises a PSE sequence of a first small nuclear RNA (snRNA) of a first biological species, wherein the DSE comprises a DSE sequence of a second small nuclear RNA (snRNA) of a second biological species, and wherein the first and second snRNAs are different from each other or wherein the first and second biological species are different.
[0212] In some embodiments, the first snRNA may be snRNA U1. In some embodiments, the first snRNA may be snRNA U2. In some embodiments, the first snRNA may be snRNA U3. In some embodiments, the first snRNA may be snRNA U4. In some embodiments, the first snRNA may be snRNA U5. In some embodiments, the first snRNA may be snRNA U6. In some embodiments, the first snRNA may be snRNA U7. In some embodiments, the first snRNA may be snRNA U11. In some embodiments, the first snRNA may be snRNA U12. In some embodiments, the first snRNA may be snRNA 7SK. In some embodiments, the first snRNA is selected from snRNA U1, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U7, snRNA U11, and snRNA 7SK. In some implementations, the first snRNA is selected from snRNA U1, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U7, snRNA U11, snRNA U12 and snRNA 7SK.
[0213] In some embodiments, the second snRNA may be snRNA U1. In some embodiments, the second snRNA may be snRNA U2. In some embodiments, the second snRNA may be snRNA U3. In some embodiments, the second snRNA may be snRNA U4. In some embodiments, the second snRNA may be snRNA U5. In some embodiments, the second snRNA may be snRNA U6. In some embodiments, the second snRNA may be snRNA U7. In some embodiments, the second snRNA may be snRNA U11. In some embodiments, the second snRNA may be snRNA U12. In some embodiments, the second snRNA may be snRNA 7SK. In some embodiments, the second snRNA is selected from snRNA U1, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U7, snRNA U11, and snRNA 7SK. In some implementations, the second snRNA is selected from snRNA U1, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U7, snRNA U11, snRNA U12 and snRNA 7SK.
[0214] In some embodiments, the first biological species may be a human. In some embodiments, the first biological species may be a mouse. In some embodiments, the second biological species may be a human. In some embodiments, the second biological species may be a mouse.
[0215] In some embodiments, this document describes a nucleic acid expression system comprising: a regulatory sequence operatively coupled to a transcribed region of a nucleic acid, said regulatory sequence comprising a proximal regulatory sequence element (PSE) and a distal regulatory sequence element (DSE); wherein the PSE comprises mouse U1 snRNA (“MmU1”) PSE, mouse U2 snRNA (“MmU2”) PSE, mouse U3 snRNA (“MmU3”) PSE, mouse U4 snRNA (“MmU4”) PSE, mouse U5 snRNA (“MmU5”) PSE, mouse U6 snRNA (“MmU6”) PSE, mouse U7 snRNA (“MmU7”) PSE, mouse U11 snRNA (“MmU11”) PSE, mouse U12 snRNA (“MmU12”) PSE, mouse U7SK snRNA (“MmU7SK”) PSE, human U1 snRNA (“HsU1”) PSE, and human U2 snRNA. (“HsU2”)PSE, human U3 snRNA (“HsU3”)PSE, human U4 snRNA (“HsU4”)PSE, human U5 snRNA (“HsU5”)PSE, human U6 snRNA (“HsU6”)PSE, human U7 snRNA (“HsU7”)PSE, human U11 snRNA (“HsU11”)PSE, human U12 snRNA (“HsU12”)PSE or human U7SK snRNA (“HsU7SK”)PSE;The DSE includes mouse U1 snRNA (“MmU1”) DSE, mouse U2 snRNA (“MmU2”) DSE, mouse U3 snRNA (“MmU3”) DSE, mouse U4 snRNA (“MmU4”) DSE, mouse U5 snRNA (“MmU5”) DSE, mouse U6 snRNA (“MmU6”) DSE, mouse U7 snRNA (“MmU7”) DSE, mouse U11 snRNA (“MmU11”) DSE, mouse U12 snRNA (“MmU12”) DSE, mouse U7SK snRNA (“MmU7SK”) DSE, human U1 snRNA (“HsU1”) DSE, human U2 snRNA (“HsU2”) DSE, human U3 snRNA (“HsU3”) DSE, human U4 snRNA (“HsU4”) DSE, and human U5 snRNA (“HsU4”) DSE. human U6 snRNA (“HsU5”) DSE, human U7 snRNA (“HsU7”) DSE, human U11 snRNA (“HsU11”) DSE, human U12 snRNA (“HsU12”) DSE, or human U7SK snRNA (“HsU7SK”) DSE; and where PSE and DSE originate from different species or from different snRNAs.
[0216] In some embodiments, a nucleic acid expression system is described herein. In some embodiments, the nucleic acid expression system may contain a regulatory sequence operatively coupled to a transcribed region of the nucleic acid. In some embodiments, the regulatory sequence may include a proximal regulatory sequence element (PSE). In some embodiments, the regulatory sequence may include a distal regulatory sequence element (DSE). In some embodiments, the regulatory sequence may include both a PSE and a DSE. In some embodiments, the PSE may include a mouse U7 snRNA (“Mm U7”) PSE. In some embodiments, the PSE may include a human U7 snRNA (“Hs U7”) PSE. In some embodiments, the PSE may include a mouse U1a1 (“mu1a1”) PSE. In some embodiments, the PSE may include a human U1-1 (“HU1” or “Hs U1-1”) PSE.
[0217] In some embodiments, PSE includes MmU1 PSE. In some embodiments, PSE includes MmU2 PSE. In some embodiments, PSE includes MmU3 PSE. In some embodiments, PSE includes MmU4 PSE. In some embodiments, PSE includes MmU5 PSE. In some embodiments, PSE includes MmU6 PSE. In some embodiments, PSE includes MmU7 PSE. In some embodiments, PSE includes MmU11 PSE. In some embodiments, PSE includes MmU12 PSE. In some embodiments, PSE includes MmU7SK PSE. In some embodiments, PSE includes HsU1 PSE. In some embodiments, PSE includes HsU2 PSE. In some embodiments, PSE includes HsU3 PSE. In some embodiments, PSE includes HsU4 PSE. In some embodiments, PSE includes HsU5 PSE. In some embodiments, PSE includes HsU6 PSE. In some embodiments, PSE includes HsU7 PSE. In some embodiments, the PSE includes HsU11 PSE. In some embodiments, the PSE includes HsU12 PSE. In some embodiments, the PSE includes HsU7SK PSE. In some embodiments, the PSE includes the PSE of the control element in Table 8, or a variant thereof.
[0218] In some embodiments, the DSE includes MmU1 DSE. In some embodiments, the DSE includes MmU2 DSE. In some embodiments, the DSE includes MmU3 DSE. In some embodiments, the DSE includes MmU4 DSE. In some embodiments, the DSE includes MmU5 DSE. In some embodiments, the DSE includes MmU6 DSE. In some embodiments, the DSE includes MmU7 DSE. In some embodiments, the DSE includes MmU11 DSE. In some embodiments, the DSE includes MmU12 DSE. In some embodiments, the DSE includes MmU7SK DSE. In some embodiments, the DSE includes HsU1 DSE. In some embodiments, the DSE includes HsU2 DSE. In some embodiments, the DSE includes HsU3 DSE. In some embodiments, the DSE includes HsU4 DSE. In some embodiments, the DSE includes HsU5 DSE. In some embodiments, the DSE includes HsU6 DSE. In some embodiments, the DSE includes HsU7 DSE. In some embodiments, the DSE includes HsU11 DSE. In some embodiments, the DSE includes HsU12 DSE. In some embodiments, the DSE includes HsU7SK DSE. In some embodiments, the DSE includes the PSE of the control element in Table 8, or a variant thereof.
[0219] In some embodiments, the DSE may include Mm U7 DSE. In some embodiments, the DSE may include HsU7 DSE. In some embodiments, the DSE may include mu1a1 DSE. In some embodiments, the DSE may include HU1DSE. In some embodiments, when the PSE includes MmU7PSE, the DSE does not include Mm U7 DSE. In some embodiments, when the PSE includes Hs U7PSE, the DSE does not include Hs U7 DSE. In some embodiments, when the PSE includes mu1a1PSE, the DSE does not include mu1a1 DSE. In some embodiments, when the PSE includes HU1 PSE, the DSE does not include HU1 DSE.
[0220] In some implementations, this document describes a nucleic acid system comprising a regulatory sequence operatively coupled to a transcribed region of a nucleic acid, wherein the regulatory sequence comprises a proximal regulatory sequence element (PSE) and a distal regulatory sequence element (DSE), wherein the PSE comprises a mouse U7 snRNA (“Mm U7”) PSE, a human U7 snRNA (“Hs U7”) PSE, a mouse U1a1 (“mu1a1”) PSE, or a human U1-1 (“HU1” or “Hs U1-1”) PSE; and wherein the DSE comprises a MmU7 DSE, a Hs U7 DSE, a mu1a1 DSE, or a HU1 DSE, wherein when the PSE contains a Mm U7 PSE, the DSE does not contain a Mm U7 DSE; when the PSE contains a Hs U7 PSE, the DSE does not contain a Hs U7 DSE; when the PSE contains a mu1a1 PSE, the DSE does not contain a mu1a1 DSE; and when the PSE contains a HU1 PSE, the DSE does not contain a HU1 DSE. DSE.
[0221] In some embodiments, the regulatory sequence may include a promoter sequence. In some embodiments, the regulatory sequence may not include a promoter sequence. In some embodiments, the regulatory sequence may include a termination subsequence. In some embodiments, the regulatory sequence may not include a termination subsequence.
[0222] In some implementations, this document describes a nucleic acid expression system comprising: a promoter sequence including a proximal promoter sequence element (PSE) and a distal promoter sequence element (DSE); wherein the PSE comprises the mouse U1 snRNA (“MmU1”) promoter PSE, the mouse U2 snRNA (“MmU2”) promoter PSE, the mouse U3 snRNA (“MmU3”) promoter PSE, the mouse U4 snRNA (“MmU4”) promoter PSE, the mouse U5 snRNA (“MmU5”) promoter PSE, the mouse U6 snRNA (“MmU6”) promoter PSE, the mouse U7 snRNA (“MmU7”) promoter PSE, the mouse U11 snRNA (“MmU11”) promoter PSE, the mouse U12 snRNA (“MmU12”) promoter PSE, and the mouse U7SK snRNA. The promoters of the following human snRNAs are: (“MmU7SK”) promoter PSE, human U1 snRNA (“HsU1”) promoter PSE, human U2 snRNA (“HsU2”) promoter PSE, human U3 snRNA (“HsU3”) promoter PSE, human U4 snRNA (“HsU4”) promoter PSE, human U5 snRNA (“HsU5”) promoter PSE, human U6 snRNA (“HsU6”) promoter PSE, human U7 snRNA (“HsU7”) promoter PSE, human U11 snRNA (“HsU11”) promoter PSE, human U12 snRNA (“HsU12”) promoter PSE, or human U7SK snRNA (“HsU7SK”) promoter PSE.The DSE includes the mouse U1 snRNA (“MmU1”) promoter DSE, mouse U2 snRNA (“MmU2”) promoter DSE, mouse U3 snRNA (“MmU3”) promoter DSE, mouse U4 snRNA (“MmU4”) promoter DSE, mouse U5 snRNA (“MmU5”) promoter DSE, mouse U6 snRNA (“MmU6”) promoter DSE, mouse U7 snRNA (“MmU7”) promoter DSE, mouse U11 snRNA (“MmU11”) promoter DSE, mouse U12 snRNA (“MmU12”) promoter DSE, mouse U7SK snRNA (“MmU7SK”) promoter DSE, human U1 snRNA (“HsU1”) promoter DSE, human U2 snRNA (“HsU2”) promoter DSE, and human U3 snRNA. The following are promoter DSEs: human U4 snRNA (“HsU4”) promoter DSE, human U5 snRNA (“HsU5”) promoter DSE, human U6 snRNA (“HsU6”) promoter DSE, human U7 snRNA (“HsU7”) promoter DSE, human U11 snRNA (“HsU11”) promoter DSE, human U12 snRNA (“HsU12”) promoter DSE, or human U7SK snRNA (“HsU7SK”) promoter DSE; and wherein promoter PSE and promoter DSE are derived from different species or from different snRNAs. In some embodiments, promoter PSE and promoter DSE are derived from different species or from different snRNAs. Some embodiments include a transcribed region operatively coupled to the promoter sequence. Some embodiments include a terminator sequence at the 3' end of the transcribed region.
[0223] In some embodiments, the promoter PSE includes the MmU1 promoter PSE. In some embodiments, the promoter PSE includes the MmU2 promoter PSE. In some embodiments, the promoter PSE includes the MmU3 promoter PSE. In some embodiments, the promoter PSE includes the MmU4 promoter PSE. In some embodiments, the promoter PSE includes the MmU5 promoter PSE. In some embodiments, the promoter PSE includes the MmU6 promoter PSE. In some embodiments, the promoter PSE includes the MmU7 promoter PSE. In some embodiments, the promoter PSE includes the MmU11 promoter PSE. In some embodiments, the promoter PSE includes the MmU12 promoter PSE. In some embodiments, the promoter PSE includes the MmU7SK promoter PSE. In some embodiments, the promoter PSE includes the HsU1 promoter PSE. In some embodiments, the promoter PSE includes the HsU2 promoter PSE. In some embodiments, the promoter PSE includes the HsU3 promoter PSE. In some embodiments, the promoter PSE includes the HsU4 promoter PSE. In some embodiments, the promoter PSE includes the HsU5 promoter PSE. In some embodiments, the promoter PSE includes the HsU6 promoter PSE. In some embodiments, the promoter PSE includes the HsU7 promoter PSE. In some embodiments, the promoter PSE includes the HsU11 promoter PSE. In some embodiments, the promoter PSE includes the HsU12 promoter PSE. In some embodiments, the promoter PSE includes the HsU7SK promoter PSE. In some embodiments, the promoter PSE includes the promoter PSE of the regulating element in Table 8, or a variant thereof.
[0224] In some embodiments, the promoter DSE includes the MmU1 promoter DSE. In some embodiments, the promoter DSE includes the MmU2 promoter DSE. In some embodiments, the promoter DSE includes the MmU3 promoter DSE. In some embodiments, the promoter DSE includes the MmU4 promoter DSE. In some embodiments, the promoter DSE includes the MmU5 promoter DSE. In some embodiments, the promoter DSE includes the MmU6 promoter DSE. In some embodiments, the promoter DSE includes the MmU7 promoter DSE. In some embodiments, the promoter DSE includes the MmU11 promoter DSE. In some embodiments, the promoter DSE includes the MmU12 promoter DSE. In some embodiments, the promoter DSE includes the MmU7SK promoter DSE. In some embodiments, the promoter DSE includes the HsU1 promoter DSE. In some embodiments, the promoter DSE includes the HsU2 promoter DSE. In some embodiments, the promoter DSE includes the HsU3 promoter DSE. In some embodiments, the promoter DSE includes the HsU4 promoter DSE. In some embodiments, the promoter DSE includes the HsU5 promoter DSE. In some embodiments, the promoter DSE includes the HsU6 promoter DSE. In some embodiments, the promoter DSE includes the HsU7 promoter DSE. In some embodiments, the promoter DSE includes the HsU11 promoter DSE. In some embodiments, the promoter DSE includes the HsU12 promoter DSE. In some embodiments, the promoter DSE includes the HsU7SK promoter DSE. In some embodiments, the promoter DSE includes the promoter DSE of the regulating element in Table 8, or a variant thereof.
[0225] In some embodiments, a nucleic acid expression system is described herein. In some embodiments, the nucleic acid expression system may include a promoter sequence. In some embodiments, the promoter sequence may include a proximal promoter sequence element (PSE). In some embodiments, the promoter sequence may include a distal promoter sequence element (DSE). In some embodiments, the promoter sequence may include both a PSE and a DSE. In some embodiments, the promoter PSE may include a mouse U7 snRNA (“Mm U7”) promoter PSE. In some embodiments, the promoter PSE may include a human U7 snRNA (“HsU7”) promoter PSE. In some embodiments, the promoter PSE may include a mouse U1a1 (“mu1a1”) promoter PSE. In some embodiments, the promoter PSE may include a human U1-1 (“HU1” or “Hs U1-1”) promoter PSE. In some embodiments, the promoter DSE may include an Mm U7 promoter DSE. In some embodiments, the promoter DSE may include an HsU7 promoter DSE. In some embodiments, the promoter DSE may include a mu1a1 promoter DSE. In some embodiments, the promoter DSE may include the HU1 promoter DSE. In some embodiments, when the promoter PSE includes the Mm U7 promoter PSE, the promoter DSE does not include the Mm U7 promoter DSE. In some embodiments, when the promoter PSE includes the Hs U7 promoter PSE, the promoter DSE does not include the Hs U7 promoter DSE. In some embodiments, when the promoter PSE includes the mu1a1 promoter PSE, the promoter DSE does not include the mu1a1 promoter DSE. In some embodiments, when the promoter PSE includes the HU1 promoter PSE, the promoter DSE does not include the HU1 promoter DSE.
[0226] In some embodiments, this document describes a nucleic acid system composed of promoter sequences, said promoter sequences being composed of proximal promoter sequence elements (PSEs) and distal promoter sequence elements (DSEs), wherein the promoter PSE is composed of a mouse U7 snRNA (“Mm U7”) promoter PSE, a human U7 snRNA (“Hs U7”) promoter PSE, a mouse U1a1 (“mu1a1”) promoter PSE, or a human U1-1 (“HU1” or “Hs U1-1”) promoter PSE; and wherein the promoter DSE is composed of an Mm U7 promoter DSE, an Hs U7 promoter DSE, a mu1a1 promoter DSE, or a HU1 promoter DSE, wherein when the promoter PSE contains an Mm U7 promoter PSE, the promoter DSE does not contain an Mm U7 promoter DSE, and when the promoter PSE contains an Hs U7 promoter PSE, the promoter DSE does not contain an Hs U7 promoter DSE. The U7 promoter DSE, when the promoter PSE contains the mu1a1 promoter PSE, the promoter DSE does not contain the mu1a1 promoter DSE, and when the promoter PSE contains the HU1 promoter PSE, the promoter DSE does not contain the HU1 promoter DSE.
[0227] In some embodiments, the system may further include a transcribed region operatively coupled to the promoter sequence. In some embodiments, the system may further include a terminator sequence at the 3' end of the transcribed region. In some embodiments, the system may further include a transcribed region operatively coupled to the promoter sequence and a terminator sequence at the 3' end of the transcribed region.
[0228] In some embodiments, this document describes a nucleic acid expression system comprising: a terminator sequence at the 3' of a transcribed region, said terminator sequence comprising a proximal terminator sequence element (PSE) and a distal terminator sequence element (DSE); wherein the PSE comprises the mouse U1 snRNA (“MmU1”) terminator PSE, the mouse U2 snRNA (“MmU2”) terminator PSE, the mouse U3 snRNA (“MmU3”) terminator PSE, the mouse U4 snRNA (“MmU4”) terminator PSE, the mouse U5 snRNA (“MmU5”) terminator PSE, the mouse U6 snRNA (“MmU6”) terminator PSE, the mouse U7 snRNA (“MmU7”) terminator PSE, the mouse U11 snRNA (“MmU11”) terminator PSE, the mouse U12 snRNA (“MmU12”) terminator PSE, the mouse U7SK snRNA (“MmU7SK”) terminator PSE, and the human U1 The following are the terminators for the human snRNA (“HsU1”) terminator PSE, human U2 snRNA (“HsU2”) terminator PSE, human U3 snRNA (“HsU3”) terminator PSE, human U4 snRNA (“HsU4”) terminator PSE, human U5 snRNA (“HsU5”) terminator PSE, human U6 snRNA (“HsU6”) terminator PSE, human U7 snRNA (“HsU7”) terminator PSE, human U11 snRNA (“HsU11”) terminator PSE, human U12 snRNA (“HsU12”) terminator PSE, or human U7SK snRNA (“HsU7SK”) terminator PSE.The DSE includes the mouse U1 snRNA (“MmU1”) terminator DSE, mouse U2 snRNA (“MmU2”) terminator DSE, mouse U3 snRNA (“MmU3”) terminator DSE, mouse U4 snRNA (“MmU4”) terminator DSE, mouse U5 snRNA (“MmU5”) terminator DSE, mouse U6 snRNA (“MmU6”) terminator DSE, mouse U7 snRNA (“MmU7”) terminator DSE, mouse U11 snRNA (“MmU11”) terminator DSE, mouse U12 snRNA (“MmU12”) terminator DSE, mouse U7SK snRNA (“MmU7SK”) terminator DSE, human U1 snRNA (“HsU1”) terminator DSE, human U2 snRNA (“HsU2”) terminator DSE, and human U3 snRNA. The terminator DSE is derived from different species or from different snRNAs. In some embodiments, the terminator PSE and terminator DSE are derived from different species or from different snRNAs. Some embodiments include a promoter sequence in which a transcribed region is operatively coupled to the promoter sequence.
[0229] In some embodiments, the termination sub-PSE includes MmU1 termination sub-PSE. In some embodiments, the termination sub-PSE includes MmU2 termination sub-PSE. In some embodiments, the termination sub-PSE includes MmU3 termination sub-PSE. In some embodiments, the termination sub-PSE includes MmU4 termination sub-PSE. In some embodiments, the termination sub-PSE includes MmU5 termination sub-PSE. In some embodiments, the termination sub-PSE includes MmU6 termination sub-PSE. In some embodiments, the termination sub-PSE includes MmU7 termination sub-PSE. In some embodiments, the termination sub-PSE includes MmU11 termination sub-PSE. In some embodiments, the termination sub-PSE includes MmU12 termination sub-PSE. In some embodiments, the termination sub-PSE includes MmU7SK termination sub-PSE. In some embodiments, the termination sub-PSE includes HsU1 termination sub-PSE. In some embodiments, the termination sub-PSE includes HsU2 termination sub-PSE. In some embodiments, the termination sub-PSE includes HsU3 termination sub-PSE. In some embodiments, the termination sub-PSE includes HsU4 termination sub-PSE. In some embodiments, the termination sub-PSE includes HsU5 termination sub-PSE. In some embodiments, the termination sub-PSE includes HsU6 termination sub-PSE. In some embodiments, the termination sub-PSE includes HsU7 termination sub-PSE. In some embodiments, the termination sub-PSE includes HsU11 termination sub-PSE. In some embodiments, the termination sub-PSE includes HsU12 termination sub-PSE. In some embodiments, the termination sub-PSE includes HsU7SK termination sub-PSE. In some embodiments, the termination sub-PSE includes the termination sub-PSE of the control element in Table 8, or a variant thereof.
[0230] In some embodiments, the termination sub-DSE includes MmU1 termination sub-DSE. In some embodiments, the termination sub-DSE includes MmU2 termination sub-DSE. In some embodiments, the termination sub-DSE includes MmU3 termination sub-DSE. In some embodiments, the termination sub-DSE includes MmU4 termination sub-DSE. In some embodiments, the termination sub-DSE includes MmU5 termination sub-DSE. In some embodiments, the termination sub-DSE includes MmU6 termination sub-DSE. In some embodiments, the termination sub-DSE includes MmU7 termination sub-DSE. In some embodiments, the termination sub-DSE includes MmU11 termination sub-DSE. In some embodiments, the termination sub-DSE includes MmU12 termination sub-DSE. In some embodiments, the termination sub-DSE includes MmU7SK termination sub-DSE. In some embodiments, the termination sub-DSE includes HsU1 termination sub-DSE. In some embodiments, the termination sub-DSE includes HsU2 termination sub-DSE. In some embodiments, the termination sub-DSE includes HsU3 termination sub-DSE. In some embodiments, the termination sub-DSE includes HsU4 termination sub-DSE. In some embodiments, the termination sub-DSE includes HsU5 termination sub-DSE. In some embodiments, the termination sub-DSE includes HsU6 termination sub-DSE. In some embodiments, the termination sub-DSE includes HsU7 termination sub-DSE. In some embodiments, the termination sub-DSE includes HsU11 termination sub-DSE. In some embodiments, the termination sub-DSE includes HsU12 termination sub-DSE. In some embodiments, the termination sub-DSE includes HsU7SK termination sub-DSE. In some embodiments, the termination sub-DSE includes the termination sub-DSE of the control element in Table 8, or a variation thereof.
[0231] In some embodiments, a nucleic acid expression system is described herein. In some embodiments, the nucleic acid expression system may include a terminator sequence at the 3' of the transcribed region. In some embodiments, the terminator sequence may include a proximal terminator sequence element (PSE). In some embodiments, the terminator sequence may include a distal terminator sequence element (DSE). In some embodiments, the terminator sequence may include both a terminator PSE and a terminator DSE. In some embodiments, the terminator PSE may include a mouse U7 snRNA (“Mm U7”) terminator PSE. In some embodiments, the terminator PSE may include a human U7 snRNA (“Hs U7”) terminator PSE. In some embodiments, the terminator PSE may include a mouse U1a1 (“mu1a1”) terminator PSE. In some embodiments, the terminator PSE may include a human U1-1 (“HU1” or “Hs U1-1”) terminator PSE. In some embodiments, the terminator DSE may include an Mm U7 terminator DSE. In some embodiments, the terminator DSE may include an Hs U7 terminator DSE. In some embodiments, the terminator DSE may include a mu1a1 terminator DSE. In some embodiments, the terminator DSE may include a HU1 terminator DSE. In some embodiments, when the terminator PSE includes an Mm U7 terminator PSE, the terminator DSE does not include an Mm U7 terminator DSE. In some embodiments, when the terminator PSE includes an Hs U7 terminator PSE, the terminator DSE does not include an Hs U7 terminator DSE. In some embodiments, when the terminator PSE includes a mu1a1 terminator PSE, the terminator DSE does not include a mu1a1 terminator DSE. In some embodiments, when the terminator PSE includes a HU1 terminator PSE, the terminator DSE does not include a HU1 terminator DSE. In some embodiments, the nucleic acid expression system may include a promoter sequence. In some embodiments, the promoter sequence may include a transcribed region operatively coupled to the promoter sequence.
[0232] In some embodiments, this document describes a nucleic acid system consisting of a terminator sequence at the 3' of the transcribed region, said terminator sequence comprising a proximal terminator sequence element (PSE) and a distal terminator sequence element (DSE), wherein the terminator PSE comprises a mouse U7 snRNA (“Mm U7”) terminator PSE, a human U7 snRNA (“Hs U7”) terminator PSE, a mouse U1a1 (“mu1a1”) terminator PSE, or a human U1-1 (“HU1” or “Hs U1-1”) terminator PSE; and wherein the terminator DSE comprises an Mm U7 terminator DSE, an Hs U7 terminator DSE, a mu1a1 terminator DSE, or a HU1 terminator DSE, wherein when the terminator PSE contains an Mm U7 terminator PSE, the terminator DSE does not contain an Mm U7 terminator DSE, and when the terminator PSE contains an HsU7 terminator PSE, the terminator DSE does not contain an HsU7 terminator DSE. The U7 terminator DSE is defined as follows: when the terminator PSE contains the mu1a1 terminator PSE, the terminator DSE does not contain the mu1a1 terminator DSE; and when the terminator PSE contains the HU1 terminator PSE, the terminator DSE does not contain the HU1 terminator DSE.
[0233] In some embodiments, a nucleic acid expression system is described herein. In some embodiments, the nucleic acid expression system may include a promoter sequence operatively coupled to a transcribed region of a nucleic acid. In some embodiments, the nucleic acid expression system may include a terminator sequence coupled to a transcribed region. In some embodiments, the nucleic acid expression system may include a promoter sequence operatively coupled to a transcribed region of a nucleic acid and a terminator sequence coupled to a transcribed region. In some embodiments, the promoter may include a first small nuclear RNA (snRNA) of a first biological species. In some embodiments, the terminator sequence may include a terminator sequence of a second small nuclear RNA (snRNA) of a second biological species. In some embodiments, the first and second snRNAs are different. In some embodiments, the first and second snRNAs are the same. In some embodiments, the first and second biological species are different. In some embodiments, the first and second biological species are the same.
[0234] In some embodiments, this document describes a nucleic acid system comprising a promoter sequence operatively coupled to a transcribed region of a nucleic acid and a terminator sequence coupled to the transcribed region; wherein the promoter sequence comprises a promoter sequence of a first small nuclear RNA (snRNA) of a first biological species, wherein the terminator sequence comprises a terminator sequence of a second small nuclear RNA (snRNA) of a second biological species, and wherein the first and second snRNAs are different or wherein the first and second biological species are different.
[0235] In some embodiments, the first snRNA may be snRNA U1. In some embodiments, the first snRNA may be snRNA U2. In some embodiments, the first snRNA may be snRNA U3. In some embodiments, the first snRNA may be snRNA U4. In some embodiments, the first snRNA may be snRNA U5. In some embodiments, the first snRNA may be snRNA U6. In some embodiments, the first snRNA may be snRNA U7. In some embodiments, the first snRNA may be snRNA U11. In some embodiments, the first snRNA may be snRNA U12. In some embodiments, the first snRNA may be snRNA 7SK. In some embodiments, the first snRNA is selected from snRNA U1, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U7, snRNA U11, and snRNA 7SK. In some implementations, the first snRNA is selected from snRNA U1, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U7, snRNA U11, snRNA U12 and snRNA 7SK.
[0236] In some embodiments, the second snRNA may be snRNA U1. In some embodiments, the second snRNA may be snRNA U2. In some embodiments, the second snRNA may be snRNA U3. In some embodiments, the second snRNA may be snRNA U4. In some embodiments, the second snRNA may be snRNA U5. In some embodiments, the second snRNA may be snRNA U6. In some embodiments, the second snRNA may be snRNA U7. In some embodiments, the second snRNA may be snRNA U11. In some embodiments, the second snRNA may be snRNA U12. In some embodiments, the second snRNA may be snRNA 7SK. In some embodiments, the second snRNA is selected from snRNA U1, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U7, snRNA U11, and snRNA 7SK. In some implementations, the second snRNA is selected from snRNA U1, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U7, snRNA U11, snRNA U12 and snRNA 7SK.
[0237] In some embodiments, the first biological species may be a human. In some embodiments, the first biological species may be a mouse. In some embodiments, the second biological species may be a human. In some embodiments, the second biological species may be a mouse.
[0238] In some embodiments, this document describes a nucleic acid expression system comprising: a promoter sequence operatively coupled to a transcribed region of a nucleic acid and a terminator sequence coupled to the transcribed region; wherein the promoter sequence comprises a promoter sequence of a first small nuclear RNA (snRNA) of a first biological species, wherein the terminator sequence comprises a terminator sequence of a second small nuclear RNA (snRNA) of a second biological species, and wherein the first and second snRNAs are different or wherein the first and second biological species are different. In some embodiments, the first snRNA is selected from snRNA U1, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U7, snRNA U11, snRNA U12, and snRNA 7SK. In some embodiments, the second snRNA is selected from snRNA U7, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U1, snRNA U11, snRNA U12, and snRNA 7SK. In some embodiments, the first snRNA is selected from snRNA U1, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U7, snRNA U11, snRNA U12, and snRNA 7SK; the second snRNA is selected from snRNA U7, snRNA U2, snRNA U3, snRNA U4, snRNA U5, snRNA U6, snRNA U1, snRNA U11, snRNA U12, and snRNA 7SK; the first biological species is selected from humans and mice; and the second biological species is selected from mice and humans. In some embodiments, the promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or promoter DSE originates from a biological species other than the first biological species. In some embodiments, the promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or promoter DSE originates from a snRNA other than the first snRNA. In some embodiments, the promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or promoter DSE originates from a biological species different from the first biological species; and wherein the promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or promoter DSE originates from a snRNA different from the first snRNA. In some embodiments, the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE originates from a biological species different from the second biological species.In some embodiments, the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE originates from an snRNA different from the second snRNA. In some embodiments, the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE originates from a biological species different from the second biological species; and wherein the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE originates from an snRNA different from the second snRNA. In some embodiments, the promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or promoter DSE originates from a biological species different from the first biological species; and wherein the promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or promoter DSE originates from an snRNA different from the first snRNA; wherein the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE originates from a biological species different from the second biological species; and wherein the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE originates from an snRNA different from the second snRNA. In some embodiments, the promoter sequence comprises the promoter sequences in Table 8, or variants thereof. In some embodiments, the terminator sequence comprises the terminator sequences in Table 8, or variants thereof. In some embodiments, the promoter DSE or promoter PSE comprises the promoter DSE or promoter PSE of the promoter in Table 8, or variants thereof. In some implementations, the terminator DSE or terminator PSE includes the terminator DSE or terminator PSE of the terminators in Table 8, or variations thereof.
[0239] In some embodiments, this document describes a nucleic acid expression system comprising: promoter sequences comprising mouse U1 snRNA (“MmU1”) promoter sequences, mouse U2 snRNA (“MmU2”) promoter sequences, mouse U3 snRNA (“MmU3”) promoter sequences, mouse U4 snRNA (“MmU4”) promoter sequences, mouse U5 snRNA (“MmU5”) promoter sequences, mouse U6 snRNA (“MmU6”) promoter sequences, mouse U7 snRNA (“MmU7”) promoter sequences, mouse U11 snRNA (“MmU11”) promoter sequences, mouse U12 snRNA (“MmU12”) promoter sequences, mouse U7SK snRNA (“MmU7SK”) promoter sequences, human U1 snRNA (“HsU1”) promoter sequences, human U2 snRNA (“HsU2”) promoter sequences, and human U3 snRNA (“HsU1”) promoter sequences. The promoter sequence of human U4 snRNA (“HsU4”), human U5 snRNA (“HsU5”), human U6 snRNA (“HsU6”), human U7 snRNA (“HsU7”), human U11 snRNA (“HsU11”), human U12 snRNA (“HsU12”), or human U7SK snRNA (“HsU7SK”), or fragments thereof or combinations thereof;And transcribed regions operatively coupled to promoter and terminator sequences, the terminator sequences comprising mouse U1 snRNA (“MmU1”) terminator sequences, mouse U2 snRNA (“MmU2”) terminator sequences, mouse U3 snRNA (“MmU3”) terminator sequences, mouse U4 snRNA (“MmU4”) terminator sequences, mouse U5 snRNA (“MmU5”) terminator sequences, mouse U6 snRNA (“MmU6”) terminator sequences, mouse U7 snRNA (“MmU7”) terminator sequences, mouse U11 snRNA (“MmU11”) terminator sequences, mouse U12 snRNA (“MmU12”) terminator sequences, mouse U7SK snRNA (“MmU7SK”) terminator sequences, human U1 snRNA (“HsU1”) terminator sequences, human U2 snRNA (“HsU2”) terminator sequences, human U3 The promoter sequence and the terminator sequence may be a fragment or combination of the following: a human U4 snRNA (“HsU3”) terminator sequence, a human U5 snRNA (“HsU5”) terminator sequence, a human U6 snRNA (“HsU6”) terminator sequence, a human U7 snRNA (“HsU7”) terminator sequence, a human U11 snRNA (“HsU11”) terminator sequence, a human U12 snRNA (“HsU12”) terminator sequence, or a human U7SK snRNA (“HsU7SK”) terminator sequence; wherein the promoter sequence and the terminator sequence are at least partially derived from different biological species or from different snRNAs. In some embodiments, the promoter sequence and the terminator sequence are at least partially derived from different biological species or from different snRNAs. In some embodiments, the promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or the promoter DSE is derived from a biological species different from the first biological species. In some embodiments, the promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or promoter DSE is derived from an snRNA different from the first snRNA. In some embodiments, the promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or promoter DSE is derived from an organism different from the first biological species.The promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or promoter DSE is derived from an snRNA different from the first snRNA. In some embodiments, the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE is derived from a biological species different from the second biological species. In some embodiments, the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE is derived from an snRNA different from the second snRNA. In some embodiments, the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE is derived from a biological species different from the second biological species; and wherein the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE is derived from an snRNA different from the second snRNA. In some embodiments, the promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or promoter DSE originates from a biological species different from the first biological species; and wherein the promoter comprises a promoter PSE sequence and a promoter DSE sequence, wherein the promoter PSE or promoter DSE originates from an snRNA different from the first snRNA; wherein the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE originates from a biological species different from the second biological species; and wherein the terminator comprises a terminator PSE sequence and a terminator DSE sequence, wherein the terminator PSE or terminator DSE originates from an snRNA different from the second snRNA. In some embodiments, the promoter sequence comprises the promoter sequences in Table 8, or variants thereof. In some embodiments, the terminator sequence comprises the terminator sequences in Table 8, or variants thereof. In some embodiments, the promoter DSE or promoter PSE comprises the promoter DSE or promoter PSE of the promoter in Table 8, or variants thereof. In some implementations, the terminator DSE or terminator PSE includes the terminator DSE or terminator PSE of the terminators in Table 8, or variations thereof.
[0240] In some embodiments, a nucleic acid expression system is described herein. In some embodiments, the nucleic acid expression system may include a promoter sequence. In some embodiments, the promoter sequence may include a mouse U7 snRNA (“Mm U7”) promoter sequence. In some embodiments, the promoter sequence may include a human U7 snRNA (“Hs U7”) promoter sequence. In some embodiments, the promoter sequence may include a mouse U1a1 (“mu1a1”) promoter sequence. In some embodiments, the promoter sequence may include a human U1-1 (“HU1” or “Hs U1-1”) promoter sequence. In some embodiments, the promoter sequence may include fragments of the promoters listed above. In some embodiments, the promoter sequence may include combinations of the fragments listed above. In some embodiments, the nucleic acid expression system may include a transcribed region operatively coupled to the promoter sequence. In some embodiments, the nucleic acid expression system may include a transcribed region operatively coupled to a terminator sequence. In some embodiments, the nucleic acid expression system may include a transcribed region operatively coupled to both the promoter and terminator sequences. In some embodiments, the terminator sequence may include the Mm U7 terminator sequence. In some embodiments, the termination subsequence may include the Hs U7 termination subsequence. In some embodiments, the termination subsequence may include the mu1a1 termination subsequence. In some embodiments, the termination subsequence may include the HU1 termination subsequence. In some embodiments, the termination subsequence may include fragments of the termination subsequences listed above. In some embodiments, the termination subsequence may include a combination of fragments of the termination subsequences listed above. In some embodiments, when the promoter sequence contains the Mm U7 promoter sequence or a fragment thereof, the termination subsequence does not contain the Mm U7 termination subsequence or a fragment thereof. In some embodiments, when the promoter sequence contains the Hs U7 promoter sequence or a fragment thereof, the termination subsequence does not contain the Hs U7 termination subsequence or a fragment thereof. In some embodiments, when the promoter sequence contains the mu1a1 promoter sequence or a fragment thereof, the termination subsequence does not contain the mu1a1 termination subsequence or a fragment thereof. In some embodiments, when the promoter sequence contains the HU1 promoter sequence or a fragment thereof, the termination subsequence does not contain the HU1 termination subsequence or a fragment thereof.
[0241] In some embodiments, this document describes a nucleic acid system comprising a promoter sequence and a transcribed region operatively coupled to the promoter and terminator sequences, wherein the promoter sequence comprises a mouse U7 snRNA (“Mm U7”) promoter sequence, a human U7 snRNA (“Hs U7”) promoter sequence, a mouse U1a1 (“mu1a1”) promoter sequence, or a human U1-1 (“HU1” or “Hs U1-1”) promoter sequence, or fragments or combinations thereof; and the terminator sequence comprises an Mm U7 terminator sequence, an Hs U7 terminator sequence, a mu1a1 terminator sequence, or a HU1 terminator sequence, or fragments or combinations thereof, wherein: when the promoter sequence contains the Mm U7 promoter sequence or a fragment thereof, the terminator sequence does not contain the Mm U7 terminator sequence or a fragment thereof; and when the promoter sequence contains the Hs U7 promoter sequence or a fragment thereof, the terminator sequence does not contain the Hs U7 terminator sequence. The U7 termination subsequence or a fragment thereof, when the starter subsequence contains the mu1a1 starter subsequence or a fragment thereof, the termination subsequence does not contai...
Claims
1. An expression system for altering gene expression, comprising: A silencing module deoxyribonucleic acid (DNA) sequence comprising: a first promoter sequence, an optional exon splicing silencer (ESS) sequence, an antisense sequence of the target ribonucleic acid (RNA), an Sm binding site sequence, a 3' hairpin sequence, and a 3' terminator sequence, wherein the silencing module encodes a modified U7 small nuclear RNA (snRNA) that silences or reduces the expression of an endogenous target protein; and The target synthesis module DNA sequence comprises: a second promoter sequence, a 5' untranslated region (UTR) sequence, a target-coding sequence (CDS), and a 3' UTR sequence, wherein the target synthesis module encodes a recombinant messenger RNA (mRNA) that generates the target protein.
2. The system of claim 1, wherein the DNA molecule of the silencing module comprises an array of arrayed silencing modules.
3. The system according to claim 1, wherein the first promoter comprises the mouse U1 snRNA ("MmU1") promoter, mouse U2 snRNA ("MmU2") promoter, mouse U3 snRNA ("MmU3") promoter, mouse U4 snRNA ("MmU4") promoter, mouse U5 snRNA ("MmU5") promoter, mouse U6 snRNA ("MmU6") promoter, mouse U7 snRNA ("MmU7") promoter, mouse U11 snRNA ("MmU11") promoter, mouse U12 snRNA ("MmU12") promoter, mouse U7SK snRNA ("MmU7SK") promoter, human U1 snRNA ("HsU1") promoter, human U2 snRNA ("HsU2") promoter, human U3 snRNA ("HsU3") promoter, and human U4 snRNA. Functional combinations of the following promoters: ("HsU4") promoter, human U5 snRNA ("HsU5") promoter, human U6 snRNA ("HsU6") promoter, human U7 snRNA ("HsU7") promoter, human U11 snRNA ("HsU11") promoter, human U12 snRNA ("HsU12") promoter, human U7SK snRNA ("HsU7SK") promoter, or fragments thereof.
4. The system of claim 1, wherein the silent module comprises an ESS.
5. The system of claim 4, wherein the ESS recruits protein factors or a group of protein factors that reduce or silence the splicing of endogenous target RNA.
6. The system according to claim 1, wherein the antisense nucleic acid sequence is completely or partially anticomplementary to the targeted region.
7. The system of claim 1, wherein the targeted region is within an intron of the endogenous target RNA.
8. The system of claim 1, wherein the targeted region is located within an exon of the endogenous target RNA.
9. The system of claim 1, wherein the antisense nucleic acid sequence targets the alternative splicing exon of the endogenous target RNA.
10. The system of claim 1, wherein the targeted region is within 100 nucleotides at the intron / exon junction.
11. The system according to claim 1, wherein the antisense nucleic acid sequence is 10-60 nucleotides in length.
12. The system of claim 1, wherein the silencing module further comprises an Sm binding site sequence.
13. The system of claim 1, wherein the hairpin sequence comprises a U7 small nuclear RNA (snRNA) 3' hairpin sequence.
14. The system of claim 1, wherein the 3' terminator sequence comprises the mouse U1 snRNA ("MmU1") 3' terminator sequence, the mouse U2 snRNA ("MmU2") 3' terminator sequence, the mouse U3 snRNA ("MmU3") 3' terminator sequence, the mouse U4 snRNA ("MmU4") 3' terminator sequence, the mouse U5 snRNA ("MmU5") 3' terminator sequence, the mouse U6 snRNA ("MmU6") 3' terminator sequence, the mouse U7 snRNA ("MmU7") 3' terminator sequence, the mouse U11 snRNA ("MmU11") 3' terminator sequence, the mouse U12 snRNA ("MmU12") 3' terminator sequence, the mouse U7SK snRNA ("MmU7SK") 3' terminator sequence, and the human U1 snRNA ("HsU1"). Functional combinations of 3' stop sequences, human U2 snRNA ("HsU2"), human U3 snRNA ("HsU3"), human U4 snRNA ("HsU4"), human U5 snRNA ("HsU5"), human U6 snRNA ("HsU6"), human U7 snRNA ("HsU7"), human U11 snRNA ("HsU11"), human U12 snRNA ("HsU12"), human U7SK snRNA ("HsU7SK"), or fragments thereof.
15. The system of claim 1, wherein the second promoter sequence comprises a weak promoter that drives the expression of the mRNA molecule at a rate no greater than that of the endogenous target promoter.
16. The system of claim 1, wherein the second promoter sequence comprises a promoter sequence of a -Ubc promoter, a PGK promoter, or an EF1a-core promoter.
17. The system of claim 1, wherein the synthesis module further comprises an SV40 intron sequence.
18. The system of claim 1, wherein the synthesis module further comprises a 5' untranslated region (UTR) sequence of the target RNA.
19. The system of claim 1, wherein the synthesis module further comprises a Kozak sequence.
20. The system of claim 1, wherein the CDS comprises an intron.
21. The system of claim 1, wherein the CDS does not contain introns.
22. The system of claim 1, wherein the synthesis module comprises a polyA signal sequence.
23. The system of claim 22, wherein the poly-A signal sequence comprises a -bGH signal sequence, an SV40 signal sequence, or an hGH poly-A signal sequence.
24. The system of claim 1, wherein, relative to a baseline target measurement, the silencing module reduces the target measurement in cells or cell population by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%.
25. The system of claim 1, wherein, relative to a baseline target measurement, the synthesis module increases the target measurement in the cell or cell population by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, at least 200%, at least 210%, at least 220%, at least 230%, at least 240%, or at least 250%.
26. The system of claim 1, wherein contact with or expression therein with cells or cell populations results in target measurements between 1x and 2x relative to a control.
27. A dual RNA system for altering gene expression, comprising: The U7 small nuclear RNA (snRNA) silencing module comprises: an exon splice silencer (ESS) nucleic acid sequence, an antisense nucleic acid sequence binding to target ribonucleic acid (RNA), an Sm binding site sequence, and a 3' hairpin sequence; and The target messenger RNA (mRNA) synthesis module comprises: a 5' untranslated region (UTR) sequence, a target-coding sequence (CDS), and a 3' UTR sequence; The U7 snRNA silencing module silences or reduces the expression of endogenous target proteins, and the target mRNA synthesis module generates target proteins.
28. A system for altering gene expression, comprising: A silencing module comprising an exon splicing silencer (ESS) nucleic acid sequence coupled to an antisense nucleic acid sequence that targets an endogenous target ribonucleic acid (RNA); and A synthesis module containing a nucleic acid coding sequence (CDS) that encodes a recombinant form of a target RNA.
29. A pharmaceutical composition comprising a system and a pharmaceutically acceptable carrier according to any one of claims 1-28.
30. A method comprising administering the pharmaceutical composition of claim 29 to a subject.
31. The method of claim 30, wherein the subject has been identified as having a genetic disease prior to treatment.
32. The method of claim 31, wherein the genetic disease is associated with haploid deficiency of endogenous target RNA.
33. The method of claim 32, wherein the genetic disease is associated with tissue chimeric expression of endogenous target RNA.
34. The method of claim 32, wherein the hereditary disease comprises Rett syndrome.
35. A method comprising: In the first cell expressing endogenous target RNA, the protein expression of endogenous target RNA was inhibited; and In second cells that otherwise do not express endogenous target RNA or express endogenous target RNA at low levels, the expression of protein in recombinant forms of target RNA is synthesized or enhanced.
36. The method of claim 35, further comprising synthesizing or enhancing the expression of a recombinant form of the target RNA in the first cell.
37. The method of claim 35, wherein the inhibition is performed after the first cell is brought into contact with the silencing module or with a carrier encoding the silencing module.
38. The method of claim 35, wherein inhibiting protein expression comprises inhibiting the expression of an endogenous target protein by at least 10%.
39. The method of claim 35, wherein the synthesis or enhancement of recombinant target protein expression is performed after contacting the second cell with the synthesis module or with a vector encoding the synthesis module.
40. The method of claim 35, wherein enhancing the expression of the recombinant target protein comprises enhancing the protein expression by at least 10%.
41. The method of claim 35, wherein the low expression level of endogenous target RNA in the second cell includes undetectable levels, levels below desired levels, levels below wild-type cell levels, or levels below the expression in the first cell.
42. The method of claim 35, wherein the low expression level of endogenous target RNA in the second cell comprises a level at least 10% lower than that in the first cell.
43. The method of claim 35, wherein the silencing module and the synthesis module are encoded together in the nucleic acid construct.
44. The method of claim 43, wherein the nucleic acid construct is delivered to a first cell and a second cell using one or more viral vectors.
45. The method of claim 35, wherein the silencing module and the synthesis module are encoded in separate nucleic acid constructs.
46. The method of claim 45, wherein the nucleic acid construct or the separate nucleic acid construct is delivered to the cell using one or more viral vectors.