A method for constructing a high-dha schizochytrium strain and application thereof
By overexpressing multiple elongase and desaturase genes in Schizochytrium HX308 and knocking out PEX10, a high-DHA-content Schizochytrium engineered strain was constructed, solving the problem of low DHA yield in existing technologies and achieving a significant increase in DHA content and yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ZHIHE BIOTECHNOLOGY (CHANGZHOU) CO LTD
- Filing Date
- 2026-03-24
- Publication Date
- 2026-07-14
AI Technical Summary
Existing Schizochytrium strains can only produce DHA via the PKS pathway. The partially extended desaturation pathway results in the inability to fully utilize fatty acids such as C16:0 produced by fatty acid synthase, leading to low DHA content. Metabolic engineering is needed to improve DHA production.
In Schizochytrium HX308, C16/18 elongase, Δ-9 elongase, Δ-5 desaturase, Δ-17 desaturase, Δ-5 elongase and Δ-4 desaturase genes were overexpressed, and the peroxisome synthesis factor PEX10 was knocked out to construct a recombinant engineered strain and establish a complete DHA production pathway synergistically with the elongation-desaturation pathway and the PKS pathway.
A breakthrough in DHA production was achieved, with the DHA content increasing from 45.3% to 70.1% and the yield reaching 67.9 g/L, which is 1.7 times that of the wild-type strain, providing a highly efficient DHA production method.
Smart Images

Figure CN122381933A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of genetic engineering and fermentation engineering, and relates to engineered strains of Schizochytrium, specifically a method for constructing and applying a Schizochytrium strain that produces high DHA content. Background Technology
[0002] Docosahexaenoic acid (DHA, C22:6n-3) is an important long-chain omega-3 polyunsaturated fatty acid (PUFA). DHA is an essential building block for brain cell formation, development, and movement, and has been shown to have therapeutic effects on infant neurodevelopment and the treatment of neurodegenerative diseases such as Alzheimer's and Parkinson's, earning it the nickname "brain gold." Traditionally, DHA is extracted from fish oil; however, the traditional method faces challenges in terms of sustainability and safety due to seasonality, scarcity of marine resources, and unsustainability.
[0003] Microbial fermentation production offers advantages such as stable yield and reliable quality, overcoming bottlenecks in DHA development and utilization, and serving as an important alternative for achieving green and sustainable DHA production. Two natural biosynthetic pathways exist in microorganisms: the extended desaturation pathway and the PKS pathway. The extended desaturation pathway, using C16:0 as a substrate, requires nine enzymatic steps to synthesize DHA, with a clear catalytic mechanism. The PKS pathway, using acetyl-CoA and malonyl-CoA as substrates, directly generates DHA with higher catalytic efficiency. Currently, both pathways are used in microorganisms to produce PUFAs such as EPA, DPA, and DHA.
[0004] Schizochytrium possesses advantages such as strong lipid accumulation capacity, rapid growth rate, and suitability for large-scale fermentation. It has also passed safety certifications from the U.S. Food and Drug Administration (FDA) and the National Health Commission of China, making it an important substrate strain for industrial oil production. Schizochytrium HX308 is a laboratory strain with proprietary intellectual property rights. It naturally contains a complete PKS pathway and a partial extended desaturation pathway. Schizochytrium HX308 synthesizes DHA / DPA via the PKS pathway, with DHA accounting for as much as 40-45% of total fatty acids, and commercial production of DHA has already been achieved.
[0005] However, significant technical bottlenecks remain in this field. Currently, *Schizochytridactylum* can only produce DHA via the PKS pathway. The partially elongated desaturation pathway results in the incomplete utilization of fatty acids such as C16:0 produced by fatty acid synthase (FAS), necessitating further metabolic engineering to increase DHA content. Currently, *Schizochytridactylum* contains reported functional elongation / desaturation enzymes: Δ-12 desaturase, Δ-8 desaturase, and Δ-6 desaturase. The technical problem this invention aims to solve is to overcome the shortcomings of existing technologies by establishing a complete elongated desaturation pathway for DHA co-production in *Schizochytridactylum*, and constructing an engineered strain of *Schizochytridactylum* capable of producing high-DHA content. Summary of the Invention
[0006] The purpose of this invention is to provide a method for constructing and applying a Schizochytrium strain that produces high levels of DHA.
[0007] The technical solution adopted by this invention to solve its technical problem is:
[0008] Overexpression of C16 / 18 elongase gene, Δ-9 elongase gene, Δ-5 desaturase gene, Δ-17 desaturase gene, Δ-5 elongase gene, and Δ-4 desaturase gene in Schizochytrium HX308, and knockout of peroxisome synthesis factor PEX10, along with the above strategies, yielded a recombinant engineered strain capable of producing high-content DHA.
[0009] Furthermore, the Schizochytrium HX-308 strain in this invention has the accession number CCTCC No. M209059. This strain has been deposited at the China Center for Type Culture Collection (CCTCC) and has been published in Chinese invention patent No. 201510417269.4;
[0010] Furthermore, the C16 / 18 elongation enzyme in this invention is derived from *Mortierella alpina*; the Δ-9 elongation enzyme is derived from *Isochrysis galbana*; the Δ-5 desaturase is derived from *Mortierella alpina*; the Δ-17 desaturase and Δ-5 elongation enzyme are derived from *Parietichytrium sp.*; and the Δ-4 desaturase is derived from *Ostreococcus lucimarinus*.
[0011] Further, the nucleotide sequence of the C16 / 18 elongase gene described in this invention is shown in SEQ ID No. 1; the nucleotide sequence of the Δ-9 elongase (IgElo9) is shown in SEQ ID No. 2; the nucleotide sequence of the Δ-5 desaturase (MaDes5) is shown in SEQ ID No. 3; the nucleotide sequence of the Δ-17 desaturase (PaDes17) is shown in SEQ ID No. 4; the nucleotide sequence of the Δ-5 elongase (PaElo5) is shown in SEQ ID No. 5; and the nucleotide sequence of the Δ-4 desaturase (OlDes4) is shown in SEQ ID No. 6.
[0012] Furthermore, the nucleotide sequence of the peroxisome synthesis factor PEX10 gene described in this invention is shown in SEQ ID No. 7.
[0013] Furthermore, the application of the Schizochytrium engineered strain described in this invention in DHA production.
[0014] The method for constructing the engineered strain of Schizochytrium as described above includes the following steps:
[0015] (1) The C16 / 18 elongase gene (MaElo16), Δ-9 elongase gene (IgElo9), Δ-5 desaturase gene (MaDes5), Δ-17 desaturase gene (PaDes17), Δ-5 elongase gene (PaElo5) and Δ-4 desaturase gene (OlDes4) were synthesized after codon optimization. The synthesized genes were used as templates for PCR amplification to obtain the target genes.
[0016] (2) Construction of recombinant plasmid pZPK-G418-Elo16-Elo9-Des5
[0017] Using plasmid pZPK-G418 as the backbone, which contains promoter P1569 and terminator TCYC1, as well as promoter P2902 and terminator TCYC1, the C16 / 18 elongase gene and the Δ-9 elongase gene were inserted between P1569 and TCYC1, and the C16 / 18 elongase gene and the Δ-9 elongase gene were linked by a 2A peptide. The Δ-5 desaturase gene was inserted between P2902 and TCYC1, thus obtaining the recombinant plasmid pZPK-G418-Elo16-Elo9-Des5.
[0018] (3) Construction of recombinant plasmid pZPK-Nourse-Des17-Elo5-Des4
[0019] Using plasmid pZPK-Nourse as the backbone, which contains promoter P2845 and terminator TCYC1, promoter P3626 and terminator TCYC1, and promoter P2520 and terminator TCYC1, the Δ-17 desaturase gene was inserted between P2845 and TCYC1, the Δ-5 elongase gene was inserted between P3626 and TCYC1, and the Δ-4 desaturase gene was inserted between P2520 and TCYC1, thus obtaining the recombinant plasmid pZPK-Nourse-Des17-Elo5-Des4;
[0020] (4) Construction of recombinant plasmid pZPK-G418-DelPEX10
[0021] Using plasmid pZPK-G418 as a backbone, the upper and lower homologous arms of the PEX10 gene were inserted. The G418 expression cassette (P2845-G418-TCTC1) was located between the upper and lower homologous arms of the PEX10 gene, thus obtaining the recombinant plasmid pZPK-G418-DelPEX10.
[0022] (5) Construction of the engineered strain SCD1 of Schizochytrium
[0023] The recombinant plasmid pZPK-G418-Elo16-Elo9-Des5 was transformed into Schizochytrium sp. HX308 to obtain the engineered strain SCD1 of Schizochytrium.
[0024] (6) Construction of the engineered strain SCD2 of Schizochytrium
[0025] Using engineered strain SCD1 as the chassis cell, the recombinant plasmid pZPK-G418-Elo16-Elo9-Des5 was transformed into engineered strain SCD1 to obtain the Schizochytrium engineered strain SCD2.
[0026] (7) Construction of the engineered strain SCD3 of Schizochytrium
[0027] Using engineered strain SCD2 as the chassis strain, the recombinant plasmid pZPK-G418-DelPEX10 was transformed into engineered strain SCD2, and the PEX10 gene was knocked out by homologous recombination to obtain the engineered strain SCD3 that produces high DHA content.
[0028] Furthermore, in steps (5)-(7), the import is achieved through an electroconversion method.
[0029] This invention also provides an application of the above-mentioned Schizochytrium engineered strain, wherein the Schizochytrium engineered strain produces DHA via shake-flask fermentation, comprising the following steps:
[0030] (1) Activation of engineered strains of Schizochytrium
[0031] The engineered strain of Schizochytrium preserved in glycerol tubes was streaked onto a solid plate and incubated upside down at 28 °C for 40-48 h until a single colony grew.
[0032] (2) Growth and culture of engineered strains of Schizochytrium
[0033] Select single colonies and inoculate them into seed culture medium. Incubate at 28 °C and 170-200 rpm for 24 h to obtain primary seed culture. Transfer the primary seed culture to a new seed culture medium at an inoculation rate of 3-5% and incubate at 28 °C and 170-200 rpm for 24 h to obtain secondary seed culture. Inoculate the secondary seed culture into a new seed culture medium at a ratio of 3-5% and incubate at 28 °C and 170-200 rpm for 24 h to obtain tertiary seed culture.
[0034] (3) Fermentation culture of engineered strains of Schizochytrium
[0035] The obtained tertiary seed culture solution was inoculated into 100 mL of fermentation culture at an inoculation rate of 1-2%, and cultured at 26 ℃ and 170-200 rpm for 90-100 h. During fermentation, the glucose concentration was controlled at 20-40 g / L.
[0036] (4) Extraction and analysis of products from engineered strains of Schizochytrium
[0037] Take 100 mL of fermentation broth, adjust the pH to about 10 by adding 5 M sodium hydroxide solution, add 3% (v / v) of cell wall disrupting enzyme, and shake in a shaker at 45-50 ℃ and 150-200 rpm for 8-10 h; then place it to cool at room temperature, and then add equal volumes of anhydrous ethanol and n-hexane in sequence, allow to stand for extraction, collect the upper organic phase, and repeat the extraction 3-5 times until the upper organic layer is transparent; then distill the collected organic layer to obtain oil containing DHA.
[0038] By adopting the above technical solution, the technical progress achieved by this invention compared with the prior art is as follows:
[0039] ①The Schizochytrium HX308 used in this invention contains a partially functional elongation desaturation pathway, providing a good foundation for establishing a complete elongation desaturation pathway; for the first time, a complete DHA elongation desaturation pathway containing Δ-4 desaturase and Δ-5 elongase was constructed in Schizochytrium, which synergistically produces DHA with the natural PKS pathway.
[0040] ②This invention integrates exogenous genes into the genome of Schizochytrium, thereby improving the stability of exogenous gene expression and thus improving the stability of engineered strains of Schizochytrium;
[0041] ③ The Schizochytrium engineered strain constructed in this invention can produce DHA through a combination of the PKS pathway and the elongation desaturation pathway, and inhibit fatty acid β-oxidation. The synergistic effect of the specific elongation enzyme / desaturation enzyme combination and PEX10 knockout not only avoids the metabolic bottleneck of single modification, but also achieves a breakthrough increase in DHA production, providing an efficient method for producing high-content DHA.
[0042] ④ This invention provides a method for constructing and applying a Schizochytrium strain that produces high-DHA content. The DHA oil produced reaches a yield of 67.9 g / L, and can produce high-DHA content, increasing the DHA content from 45.3% in the wild-type strain to 70.1%, with a DHA yield 1.7 times that of the wild-type strain.
[0043] ⑤ This invention provides a simple and efficient method for producing high-content DHA from Schizochytrium fungi, which is not limited by seasons, weather or other factors, and provides a new method for producing high-content DHA.
[0044] This invention is applicable to the construction of engineered strains of Schizochytrium with high DHA content, and the constructed engineered strains are further applied to the production of DHA through fed-batch fermentation in shake flasks. Attached Figure Description
[0045] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.
[0046] Figure 1 This is a skeleton diagram of the recombinant plasmid pZPK-G418-Elo16-Elo9-Des5 in Example 1 of the present invention;
[0047] Figure 2 This is a skeleton diagram of the recombinant plasmid pZPK-Nourse-Des17-Elo5-Des4 in Example 2 of the present invention;
[0048] Figure 3 This is a skeleton diagram of the recombinant plasmid pZPK-G418-DelPEX10 in Example 3 of the present invention;
[0049] Figure 4 The graph shows the oil and DHA production of Schizochytrium HX308 and engineered strains SCD2 and SCD3 in Example 6 of this invention.
[0050] Figure 5 The image shows the DHA content of Schizochytrium HX308 and engineered strains SCD2 and SCD3 in Example 6 of this invention. Detailed Implementation
[0051] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.
[0052] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.
[0053] The seed culture medium and fermentation culture medium in the implementation case are shown below:
[0054] Plate culture medium: pH 6.5, components include: agar 15 g / L, glucose 60 g / L, yeast extract 10 g / L, sodium sulfate 10 g / L, magnesium sulfate 4 g / L, ammonium sulfate 8 g / L, potassium chloride 2 g / L, calcium chloride 0.1 g / L, potassium sulfate 0.5 g / L, potassium dihydrogen phosphate 2 g / L, monosodium glutamate 8 g / L, zinc sulfate heptahydrate 4 mg / L, cobalt dichloride hexahydrate 0.01 mg / L, copper sulfate pentahydrate 2 mg / L, nickel sulfate hexahydrate 2 mg / L, ferrous sulfate heptahydrate 10 mg / L, calcium pantothenate 4 mg / L, manganese chloride tetrahydrate 5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 6 mg / L, vitamin B12 1.3 mg / L, solvent is water;
[0055] Seed culture medium: pH 6.6, components include: glucose 50 g / L, yeast extract 5 g / L, sodium sulfate 5 g / L, magnesium sulfate 2 g / L, ammonium sulfate 6 g / L, potassium chloride 1 g / L, calcium chloride 0.1 g / L, potassium sulfate 0.6 g / L, potassium dihydrogen phosphate 1 g / L, monosodium glutamate 10 g / L, 0.1% trace minerals, vitamin B6 5 mg / L and vitamin B12 0.5 mg / L, in water.
[0056] Fermentation medium: pH 7.0, consisting of: glucose 80 g / L, yeast extract 10 g / L, sodium sulfate 10 g / L, magnesium sulfate 2 g / L, ammonium sulfate 6 g / L, potassium chloride 1 g / L, calcium chloride 0.1 g / L, potassium sulfate 0.6 g / L, potassium dihydrogen phosphate 1 g / L, monosodium glutamate 20 g / L, zinc sulfate heptahydrate 3 mg / L, cobalt dichloride hexahydrate 0.05 mg / L, copper sulfate pentahydrate 4 mg / L, nickel sulfate hexahydrate 1.5 mg / L, ferrous sulfate heptahydrate 10 mg / L, calcium pantothenate 3 mg / L, manganese chloride tetrahydrate 4 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 5 mg / L and vitamin B12 0.5 mg / L, in water.
[0057] Example 1: Construction of recombinant plasmid pZPK-G418-Elo16-Elo9-Des5
[0058] S1. Optimized C16 / 18 elongase genes from Mortierella alpina, Δ-9 elongase genes from Isochrysis galbana, and Δ-5 desaturase genes from Mortierella alpina were synthesized to obtain codon-optimized C16 / 18 elongase genes, Δ-9 elongase genes, and Δ-5 desaturase genes, respectively.
[0059] S2. Amplification of the target gene
[0060] S21. Using the C16 / 18 elongase gene, Δ-9 elongase gene, and Δ-5 desaturase gene synthesized in step S1 as templates, PCR amplification was performed using Elo9-F / R (nucleotide sequences as shown in SEQ ID NO. 8 and NO. 9) and Des5-F / -R (nucleotide sequences as shown in SEQ ID NO. 10 and NO. 11) as primers, respectively, to obtain amplified fragments C16 / 18, Elo9, and Des5;
[0061] The PCR procedure is as follows: denaturation at 98 ℃ for 10 s, annealing at 58 ℃ for 10 s, extension at 72 ℃ for 1 min (extension time = target fragment length / 1kb, unit: min), repeated for 30 cycles.
[0062] Construction of S3 recombinant plasmid pZPK-G418-Elo9
[0063] S31. Using plasmid pZPK-G418 as the backbone, the plasmid carries promoter P1569 and terminator TCYC1, as well as promoter P2902 and terminator TCYC1. The sequence of promoter P1569 is shown in SEQ ID NO.12, the sequence of promoter P2902 is shown in SEQ ID NO.13, and the sequence of terminator TCYC1 is shown in SEQ ID NO.14.
[0064] S32. pZPK-G418 was digested with XbaI enzyme, and the amplified C16 / 18 elongase gene-2A peptide-Elo9 gene was ligated into the digested pZPK-G418 plasmid backbone. The cloned plasmid was cloned in one step using ClonExpress MultiS One Step Cloning Kit.
[0065] S33. The circular recombinant plasmid was transformed into Escherichia coli DH5α competent cells, and the positive recombinant plasmid pZPK-G418-Elo9 was obtained by screening with KAN-resistant plates and verifying by colony PCR and sequencing.
[0066] S4. Construction of recombinant plasmid pZPK-G418-Elo16-Elo9-Des5
[0067] S41. pZPK-G418-Elo9 was digested with HindIII enzyme, and the amplified Des5 gene was ligated into the digested pZPK-G418-Elo9 plasmid backbone. The cloned gene was then cloned in one step using the ClonExpress MultiS One Step Cloning Kit.
[0068] S42. The circular recombinant plasmid was transformed into E. coli DH5a competent cells, and the positive recombinant plasmid pZPK-G418-Elo16-Elo9-Des5 was obtained by screening with KAN resistance plates and verifying by colony PCR and sequencing.
[0069] The skeleton diagram of the recombinant plasmid pZPK-G418-Elo16-Elo9-Des5 is shown below. Figure 1 As shown.
[0070] in,
[0071] ①The C16 / 18 gene sequence is shown in SEQ ID NO.1, specifically:
[0072]
[0073] ②The Elo9 gene sequence is as shown in SEQ ID NO.2, specifically:
[0074] ATGGCTCTCGCTAACGACGCTGGCGAACGCATCTGGGCTGCCGTTACGGATCCCGAGATTCTCATCGGCACCTTTTCGTACCTCCTCCTCAAGCCTCTCCTCCGCAACAGCGGCCTCGTTGACGAGAAGAAGGGCGCGTACCGCACCTCCATGATCTGGTACAACGTCCTCCTCGCTCTCTTCTCCGCCCTCAGCTTCTACGTCACCGCCACCGCCCTCGGCTGGGACTACGGTACGGGCGCGTGGCTCCGCCGCCAGACCGGCGATACCCCCCAGCCGCTCTTCCAGTGCCCGTCCCCGGTCTGGGACTCCAAGCTCTTTACCTGGACGGCTAAGGCCTTCTACTACTCCAAGTACGTCGAGTACCTTGACACCGCGTGGCTCGTTCTCAAGGGCAAGCGCGTTAGCTTCCTCCAGGCCTTCCACCACTTCGGCGCCCCCTGGGACGTCTACCTCGGCATCCGCCTCCACAACGAGGGCGTCTGGATCTTCATGTTCTTCAACAGCTTCATTCACACCATTATGTACACCTACTACGGCCTCACCGCTGCCGGCTACAAGTTCAAGGCCAAGCCCCTCATCACCGCCATGCAGATTTGCCAGTTCGTCGGCGGCTTCCTCCTCGTCTGGGATTACATCAACGTTCCGTGCTTCAACTCCGACAAGGGTAAGCTCTTTTCGTGGGCCTTCAACTACGCCTACGTCGGCAGCGTCTTCCTCCTCTTTTGCCACTTCTTTTACCAGGATAACCTCGCCACCAAGAAGAGCGCCAAGGCCGGCAAGCAGCTCTAG
[0075] ③The Des5 gene sequence is as shown in SEQ ID NO.3, specifically:
[0076]
[0077] ④The Elo9-F gene sequence is shown in SEQ ID NO.8, specifically:
[0078] GGACCAGAACCAGAGAAACCATGGCTCTCGCTAACGACGC
[0079] ⑤The Elo9-R gene sequence is shown in SEQ ID NO.9, specifically:
[0080] TGACATAACTAATTACATGACTAGAGCTGCTTGCCGGCCT
[0081] ⑥The Des5-F gene sequence is shown in SEQ ID NO.10, specifically as follows:
[0082] AGCCGAGCGCGGGAGGGAAGATGGGCACGGATCAGGCAA
[0083] ⑦The Des5-R gene sequence is shown in SEQ ID NO.11, specifically as follows:
[0084] TGACATAACTAATTACATGATCATTCCTCCTTCGGGCGGA
[0085] ⑧ The promoter P1569 sequence is shown in SEQ ID NO.12, specifically as follows:
[0086]
[0087] ⑨ The sequence of promoter P2902 is shown in SEQ ID NO.13, specifically:
[0088]
[0089] ⑩ The terminator TCYC1 sequence is shown in SEQ ID NO.14, specifically:
[0090] TCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCACACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCTCATTTATTTTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGC
[0091] Example 2: Construction of recombinant plasmid pZPK-Nourse-Des17-Elo5-Des4
[0092] S1. Optimized Δ-17 desaturase and Δ-5 elongase genes from Parietichytrium sp. and Δ-4 desaturase gene from Ostreococcus lucimarinus were synthesized to obtain codon-optimized Δ-17 desaturase, Δ-5 elongase, and Δ-4 desaturase genes, respectively.
[0093] S2. Amplification of the target gene
[0094] S21. Using the Δ-17 desaturase gene, Δ-5 elongase gene, and Δ-4 desaturase gene synthesized in step S1 as templates, PCR amplification was performed using primers Des17-F / R (nucleotide sequences as shown in SEQ ID NO.15 and NO.16), Elo5-F / -R (nucleotide sequences as shown in SEQ ID NO.17 and NO.18), and Des4-F / -R (nucleotide sequences as shown in SEQ ID NO.19 and NO.20) to obtain amplified fragments Des17, Elo5, and Des4.
[0095] The PCR procedure is as follows: denaturation at 98 ℃ for 10 s, annealing at 58 ℃ for 10 s, extension at 72 ℃ for 2 min (extension time = target fragment length / 1kb, unit: min), repeated for 30 cycles.
[0096] Construction of S3 recombinant plasmid pZPK-Nourse-Des17
[0097] S31. Using plasmid pZPK-Nourse as the backbone, the plasmid contains promoter P2845 and terminator TCYC1, promoter P3626 and terminator TCYC1, and promoter P2520 and terminator TCYC1. The sequence of promoter P2845 is shown in SEQ ID NO.21, the sequence of promoter P3626 is shown in SEQ ID NO.22, the sequence of promoter P2520 is shown in SEQ ID NO.23, and the sequence of terminator TCYC1 is shown in SEQ ID NO.14.
[0098] S32. pZPK-Nourse was digested with XbaI enzyme, and the amplified Des17 gene was ligated into the digested pZPK-Nourse plasmid backbone. The cloned gene was then cloned in one step using the ClonExpress MultiS One Step Cloning Kit.
[0099] S33. The circular recombinant plasmid was transformed into Escherichia coli DH5a competent cells, and the positive recombinant plasmid pZPK-Nourse-Des17 was obtained by screening with KAN-resistant plates and verifying by colony PCR and sequencing.
[0100] S4. Construction of recombinant plasmid pZPK-Nourse-Des17-Elo5
[0101] S41. The pZPK-Nourse-Des17 was digested with HindIII enzyme, and the amplified Elo5 gene was ligated into the digested pZPK-Nourse-Des17 plasmid backbone. The cloned gene was then cloned in one step using the ClonExpress MultiS One Step Cloning Kit.
[0102] S42. The circular recombinant plasmid was transformed into Escherichia coli DH5a competent cells, and the positive recombinant plasmid pZPK-Nourse-Des17-Elo5 was obtained by screening with KAN-resistant plates and verifying by colony PCR and sequencing.
[0103] S5. Construction of recombinant plasmid pZPK-Nourse-Des17-Elo5-Des4
[0104] S41. The pZPK-Nourse-Des17-Elo5-Des4 plasmid was digested with PacI enzyme, and the amplified Des4 gene was ligated into the digested pZPK-Nourse-Des17-Elo5-Des4 plasmid backbone. The plasmid was cloned in one step using the ClonExpress MultiSOne Step Cloning Kit.
[0105] S42. The circular recombinant plasmid was transformed into E. coli DH5a competent cells, and the positive recombinant plasmid pZPK-Nourse-Des17-Elo5-Des4 was obtained by screening with KAN-resistant plates and verifying by colony PCR and sequencing.
[0106] The skeleton diagram of the recombinant plasmid pZPK-Nourse-Des17-Elo5-Des4 is shown below. Figure 2 As shown.
[0107] Among them, ① the Des17 gene sequence is shown in SEQ ID NO.4, specifically as follows:
[0108]
[0109] ②The Elo5 gene sequence is shown in SEQ ID NO.5, specifically:
[0110] ATGGCCGCCCGCGTCGAGAAGCAGCAGGCCCCCGCTAAGGCCGCTAAGAAGGTCGGCTCCCGCGTTGACCGCTCCGACGGCTTCTTCCGCACCTTTAACCTTTGCGCCCTTTACGGCTCCGCTTTTGCCTACGCCTACAACAACGGCCCGGTCGACAACGATGGCAAGGGCCTCTACTTCTCGAAGAGCCCCTTCTACGCCTTCCTCGTCAGCGACGCCATGACCTTTGGCGCTCCTCTCATGTACGTCATCGCCGTTATGGCGCTCAGCCGCTACATGGCTGACAAGCAGCCGCTCACCGGTTTCATCAAGTCCTACATCCAGCCGGTGTACAACATCGTCCAGATCGTCGTCTGCAGCTGGATGGCGTGGGGCCTCCTCCCTCAGGTCGACATCTTCAACCTTAACCCCTTCGGCCTCAACAAGCAGCGCGACGCCAACATCGAGTTCTTCGTCATGGTCCATCTCCTCACCAAGTTTCTCGACTGGACCGACACCTTCATCATGATCTTCAAGAAGAACTACGCCCAGGTCAGCTTCCTCCAGGTCTTCCACCACGCCACTATCGGTATGGTCTGGTCGTTCCTCCTCCAGCGCGGCTGGGGCTCCGGCACCGCTGCCTACGGCGCCTTTATTAACTCCGTCACCCACGTCATCATGTACACTCACTACTTCGTCACGTCGCTCAACATCAACAACCCCTTCAAGCGCTACATCACCGGCTTCCAGCTCTCCCAGTTTGCCAGCTGCATTGTGCACGCCCTCCTCGTGCTCGCTTTTGAGGAGGTCTACCCCCTCGAGTACGCCTACCTCCAGATTAGCTACCACATCATTATGCTCTACCTCTTTGGCCGTCGCATGAACTGGTCCCCTCTCTGGTGCACGGGTGAGGTCGACGGCCTCGACGTCAACGTCGAGACCAGCAAGAAGGCCCAGTAA
[0111] ③The Des4 gene sequence is shown in SEQ ID NO.6 and is specifically as follows:
[0112]
[0113] ④The Des17-F gene sequence is shown in SEQ ID NO.15, specifically as follows:
[0114] AGCGAGAGGCGAGAGAAAAGGCCACGAACTTCTCCCTCCT
[0115] ⑤The Des17-R gene sequence is shown in SEQ ID NO.16, specifically as follows:
[0116] TGACATAACTAATTACATGATTAGTCGGACTTAGCCTTAG
[0117] ⑥The Elo5-F gene sequence is shown in SEQ ID NO.17, specifically as follows:
[0118] TCAAATCAGCCGCAAGGAAAATGGCCGCCCGCGTCGAGAA
[0119] ⑦ The Elo5-R gene sequence is shown in SEQ ID NO.18, specifically:
[0120] TGACATAACTAATTACATGATTACTGGGCCTTCTTGCTGG
[0121] ⑧The Des4-F gene sequence is shown in SEQ ID NO.19, specifically as follows:
[0122] CAGCAGCAGCAGCAGGAACAATGACTGCCGGCTTTGAGGA
[0123] ⑨ The Des4-R gene sequence is shown in SEQ ID NO.20, specifically as follows:
[0124] TGACATAACTAATTACATGATTAGTTCTTGTCCCACGCGG
[0125] ⑩ The sequence of promoter P2845 is shown in SEQ ID NO.21, specifically:
[0126]
[0127] 11. The sequence of promoter P3626 is shown in SEQ ID NO.22, specifically as follows:
[0128]
[0129] 12. The promoter P2520 sequence is shown in SEQ ID NO.23, specifically as follows:
[0130]
[0131] Example 3 Construction of recombinant plasmid pZPK-G418-DelPEX10
[0132] S1. Amplification of the target gene
[0133] Using the genome of Schizochytrium HX 308 as a template, PCR amplification was performed using primers PEX10-UP-F / R (nucleotide sequences shown in SEQ ID NO. 24 and NO. 25) and PEX10-DW-F / R (nucleotide sequences shown in SEQ ID NO. 26 and NO. 27), yielding fragments PEX10-UP and PEX10-DW, respectively. The sequence of PEX10-UP is shown in SEQ ID NO. 28, and the sequence of PEX10-DW is shown in SEQ ID NO. 29.
[0134] The PCR procedure is as follows: denaturation at 98 ℃ for 10 s, annealing at 58 ℃ for 10 s, extension at 72 ℃ for 1 min (extension time = target fragment length / 1kb, unit: min), repeated for 30 cycles.
[0135] Construction of S2 recombinant plasmid pZPK-G418-DelPEX10 UP
[0136] S21. Using plasmid pZPK-G418 as the backbone, with a HindIII site set in front of the G418 promoter, pZPK-G418 was digested with HindIII enzyme, and the amplified PEX10-UP fragment was ligated into the digested pZPK-G418 plasmid backbone. One-step cloning was performed using ClonExpress MultiS One Step Cloning Kit.
[0137] S22. The circular recombinant plasmid was transformed into Escherichia coli DH5a competent cells, and the positive recombinant plasmid pZPK-G418-DelPEX10UP was obtained by screening with KAN-resistant plates and verifying by colony PCR and sequencing.
[0138] S3. Construction of recombinant plasmid pZPK-G418-DelPEX10
[0139] S31. Using plasmid pZPK-G418-DelPEX10UP as the backbone, with an XbaI site set after the G418 terminator, pZPK-G418-DelPEX10UP was digested with XbaI enzyme. The amplified PEX10-DW fragment was ligated into the digested pZPK-G418-DelPEX10UP plasmid backbone, and one-step cloning was performed using the ClonExpress MultiS One Step Cloning Kit.
[0140] S32. The circular recombinant plasmid was transformed into Escherichia coli DH5a competent cells, and the positive recombinant plasmid pZPK-G418-DelPEX10 was obtained by screening with KAN-resistant plates and verifying by colony PCR and sequencing.
[0141] The skeleton diagram of the recombinant plasmid pZPK-G418-DelPEX10 is shown below. Figure 3 As shown.
[0142] Among them, ① the PEX10 gene sequence is shown in SEQ ID NO.7, specifically as follows:
[0143]
[0144] ②The PEX10-UP-F sequence is shown in SEQ ID NO.24, specifically as follows:
[0145] CGTGTGTGTTTTAGCCACCAAAATTACGCGAAAGCTTGGT
[0146] ③The PEX10-UP-R sequence is shown in SEQ ID NO.25, specifically as follows:
[0147] TGCTGCATGGGACTCGCCATCTTCCCTTTCTGCTCAAGCCG
[0148] ④The PEX10-DW-F sequence is shown in SEQ ID NO.26, specifically as follows:
[0149] GCGTCTATTTCACCTTGTGATTCGAAAGTCATGACTTTTT
[0150] ⑤The PEX10-DW-R sequence is shown in SEQ ID NO.27, specifically as follows:
[0151] GCGCGGAACCGAGGCCACGTGCCAACGGCGGGCGCGGCG
[0152] ⑥The PEX10-UP sequence is shown in SEQ ID NO.28, specifically as follows:
[0153]
[0154] ⑦ The PEX10-DW sequence is shown in SEQ ID NO.29, specifically:
[0155]
[0156] Example 4 Construction of the engineered strain SCD2 of Schizochytrium
[0157] This embodiment describes a method for constructing a Schizochytrium engineered strain overexpressing the C16 / 18 elongase gene, the Δ-9 elongase gene, the Δ-5 desaturase gene, the Δ-17 desaturase gene, the Δ-5 elongase gene, and the Δ-4 desaturase gene, comprising the following steps performed sequentially:
[0158] S1. Activation of wild-type strains of Schizochytrium
[0159] The Schizochytrium strain preserved in glycerol tubes was streaked on a solid plate and incubated upside down at 28 °C for 40-48 h until a single colony grew.
[0160] S2. Preparation of competent cells of wild-type strains of Schizochytrium
[0161] Single colonies were selected and inoculated into seed culture medium, and cultured at 28 ℃ and 170-200 rpm for 24 h to obtain primary seed culture. The primary seed culture was then transferred to a new seed culture medium at an inoculation rate of 3-5%, and cultured at 28 ℃ and 170-200 rpm for 24 h to obtain secondary seed culture. The secondary seed culture was then inoculated into a new seed culture medium at a rate of 3-5%, and cultured at 28 ℃ and 170-200 rpm for 24 h to obtain tertiary seed culture. 25 mL of the tertiary seed culture was centrifuged at 4000 rpm for 5 min at room temperature, the supernatant was discarded, and the culture was gently resuspended with an equal volume of pretreatment solution (20 mM DTT, 0.1 M CaCl2, pH 6.5 Tris-HCl) and gently shaken to loosen the cell walls. The system was then centrifuged at 4000 rpm for 5 min and washed twice with an equal volume of pre-cooled PBS (4 ℃, 4000 rpm, 5 min). The cells were then washed twice with pre-cooled sorbitol solution containing 0.1 M CaCl2 and centrifuged under the same conditions. Finally, the bacterial resuspended in 200 mL of pre-cooled 1 M sorbitol solution containing 0.1 M CaCl2, and then aliquoted into 100 μL tubes and stored on ice for later use.
[0162] S3. Transformation of wild-type strains of Schizochytrium
[0163] Mix 10 μL of linearized plasmid pZPK-G418-Elo16-Elo9-Des5 with competent cells, transfer to a pre-cooled and dried electroporation cuvette, incubate on ice for 30 min, and then perform a 2 kV single-pulse electroporation.
[0164] Immediately after the electric shock, add 500-1000 μL of pre-cooled seed culture (containing 1M sterile pre-cooled sorbitol solution), mix well, and transfer to seed culture medium containing 1M sorbitol. Incubate at 28 ℃ and 170 rpm for 2-4 h.
[0165] After incubation, take 300-500 μL of bacterial suspension and spread it evenly on a plate containing 500 mg / L G418 resistance, and incubate at 28 ℃ for 2-4 days.
[0166] S4. Screening and identification of the engineered strain SCD1 of Schizochytrium.
[0167] Single colonies were selected from the spread plates and inoculated into seed culture medium, with G418 resistance added. The culture was incubated at 28 °C and 170-200 rpm for 24 h, and then subcultured three times to stabilize the vector. One mL of the bacterial culture was then added to an equal volume of 40% glycerol and stored at -80 °C.
[0168] S5. Construction of the engineered strain SCD2 of Schizochytrium
[0169] The linearized plasmid pZPK-Nourse-Des17-Elo5-Des4 was transformed into the Schizochytrium engineered strain SCD1 using the same procedure to obtain the Schizochytrium engineered strain SCD2. Transformants were screened on selection plates containing 75 mg / L Norilskine.
[0170] Example 5 Construction of the engineered strain SCD3 of Schizochytrium
[0171] This embodiment describes a method for constructing a fungus strain using the Schizochytrium engineered strain SCD2 as the chassis strain and knocking out the PEX10 gene, including the following steps performed sequentially:
[0172] S1. Activation of the engineered strain SCD2 of Schizochytrium
[0173] The engineered strain SCD2 of Schizochytrium preserved in glycerol tubes was streaked onto a solid plate and incubated upside down at 28 °C for 40-48 h until a single colony grew.
[0174] S2. Preparation of competent cells of the engineered strain SCD2 of Schizochytrium
[0175] Single colonies were selected and inoculated into seed culture medium, and cultured at 28 ℃ and 170-200 rpm for 24 h to obtain primary seed culture. The primary seed culture was then transferred to a new seed culture medium at an inoculation rate of 3-5%, and cultured at 28 ℃ and 170-200 rpm for 24 h to obtain secondary seed culture. The secondary seed culture was then inoculated into a new seed culture medium at a rate of 3-5%, and cultured at 28 ℃ and 170-200 rpm for 24 h to obtain tertiary seed culture. 25 mL of the tertiary seed culture was centrifuged at 4000 rpm for 5 min at room temperature, the supernatant was discarded, and the culture was gently resuspended in an equal volume of pretreatment solution (20 mM DTT, 0.1 M CaCl2, pH 6.5 Tris-HCl) and gently shaken to loosen the cell walls. The system was then centrifuged at 4000 rpm for 5 min and washed twice with an equal volume of pre-cooled PBS (4 ℃, 4000 rpm, 5 min). The cells were then washed twice with pre-cooled sorbitol solution containing 0.1 M CaCl2 and centrifuged under the same conditions. Finally, the bacterial resuspended in 200 mL of pre-cooled 1 M sorbitol solution containing 0.1 M CaCl2, and then aliquoted into 100 μL tubes and stored on ice for later use.
[0176] S3. Transformation of the engineered strain SCD2 of Schizochytrium.
[0177] Mix 10 μL of linearized plasmid pZPK-G418-DelPEX10 with competent cells, transfer to a pre-cooled and dried electroporation cuvette, incubate on ice for 30 min, and then perform a 2 kV single-pulse electroporation.
[0178] Immediately after the electric shock, add 500-1000 μL of pre-cooled seed culture (containing 1M sterile pre-cooled sorbitol solution), mix well, and transfer to seed culture medium containing 1M sorbitol. Incubate at 28 ℃ and 170 rpm for 2-4 h.
[0179] After incubation, take 300-500 μL of bacterial suspension and spread it evenly on a plate containing 100 mg / L bleomycin (Zeocin) resistance, and incubate at 28 ℃ for 2-4 days.
[0180] S4. Screening and identification of the engineered strain SCD3 of Schizochytrium.
[0181] Single colonies were selected from the spread plates and inoculated into seed culture medium. Bleomycin (Zeocin) was added, and the culture was carried out at 28°C and 170-200 rpm for 24 h. The culture was then passaged three times to stabilize the vector. Colony PCR was performed using primers PEX10-test-F / R (nucleotide sequences SEQ ID NO. 30 and SEQ ID NO. 31) to verify whether the PEX10 gene had been successfully knocked out. The obtained positive transformants were inoculated into seed culture medium and cultured for 24 h. One mL of the bacterial culture was then added to an equal volume of 40% glycerol and stored at -80°C.
[0182] The PEX10-test-F sequence is shown in SEQ ID NO.30, specifically as follows:
[0183] GCGCGGCAATTTAAGAGGAC
[0184] The PEX10-test-R sequence is shown in SEQ ID NO.31, specifically as follows:
[0185] TGAGGAACACGGGGAAGGTT
[0186] Example 6: Application of Schizochytrium engineered strain SCD3 in the production of high-content DHA
[0187] This embodiment uses the Schizochytrium engineered strain SCD3 constructed in Example 5 to produce DHA, and includes the following steps performed sequentially:
[0188] S1. Growth and culture of engineered strains of Schizochytrium HX308, SCD2, and SCD3
[0189] The engineered strains of Schizochytrium HX308, SCD2, and SCD3 preserved in glycerol tubes were streaked on solid plates and incubated upside down at 28 °C for 40-48 h until single colonies grew.
[0190] Single colonies of HX308, SCD2, and SCD3 were selected and inoculated into seed culture medium, and cultured at 28 ℃ and 170-200 rpm for 24 h to obtain primary seed culture. The primary seed culture was then transferred to a new seed culture medium at an inoculation rate of 3-5% and cultured at 28 ℃ and 170-200 rpm for 24 h to obtain secondary seed culture. The secondary seed culture was then inoculated into a new seed culture medium at a ratio of 3-5% and cultured at 28 ℃ and 170-200 rpm for 24 h to obtain tertiary seed culture.
[0191] S2. Fermentation culture of engineered strains of Schizochytrium HX308, SCD2, and SCD3
[0192] The obtained tertiary seed culture solution was inoculated into 100 mL fermentation culture at an inoculation rate of 1-2%, and cultured at 26℃ and 170-200 rpm for 90-100 h. During fermentation, the glucose concentration was controlled at 20-40 g / L.
[0193] S3. Extraction and analysis of products from engineered strains of Schizochytrium.
[0194] After fermentation, take 100 mL of fermentation broth and adjust the pH to about 10 by adding 5M sodium hydroxide solution. Add 3% (v / v) of cell wall disrupting enzyme and shake in a shaker at 45-50 ℃ and 150-200 rpm for 8-10 h. Then cool it to room temperature, and then add equal volumes of anhydrous ethanol and n-hexane in sequence. Allow it to stand for extraction, collect the upper organic phase, and repeat the extraction 3-5 times until the upper organic layer is transparent. Then distill the collected organic layer to obtain oil containing DHA.
[0195] The DHA oil obtained can be weighed to calculate the oil yield of engineered strains HX308, SCD2, and SCD3.
[0196] Pipette 20 μL into a clean centrifuge tube, then add 500 μL of 1M sodium hydroxide-methanol solution, and shake at 1200 rpm for 4–6 h to ensure complete methylation. Next, add 40 μL of concentrated sulfuric acid to terminate the methylation reaction. Finally, add 1 mL of hexane containing the internal standard, and shake at 1200 rpm for 1–2 h. Collect the upper organic layer in a gas chromatography vial for fatty acid composition analysis. The results are as follows: Figure 4 and Figure 5 As shown.
[0197] Depend on Figure 4 and Figure 5 It is evident that genetically engineered strains of *Schizochytrium* significantly increased DHA content. The engineered strain SCD2 achieved an oil yield of 62.8 g / L and a DHA content of 62.2%; the engineered strain SCD3 achieved an oil yield of 67.9 g / L and a DHA content as a percentage of total fatty acids as high as 70.1%, representing the highest level to date. Compared to the original strain HX308, the extended desaturation pathway and the combined production of the PKS pathway, along with the synergistic effect of PEX10 knockout, significantly improved DHA production efficiency and reduced production costs.
Claims
1. An engineered strain of Schizochytrium capable of producing high-DHA content, characterized in that, This engineered strain was derived from *Schizochytrium* sp. HX308. It was obtained by overexpressing the C16 / 18 elongase, Δ-9 elongase, Δ-5 desaturase, Δ-17 desaturase, and Δ-4 desaturase genes, establishing a complete elongation-desaturation pathway through the combined expression of these six genes. The peroxisome synthesis factor PEX10 gene was also knocked out. Both strategies work synergistically and are indispensable for constructing a high-DHA *Schizochytrium* engineered strain.
2. The engineered strain produces DHA by synergistically working with the natural PKS pathway of Schizochytrium, and neither pathway can be omitted.
3. The Schizochytrium strain capable of producing high DHA content according to claim 1, characterized in that, The enzyme comprises: the C16 / 18 elongase derived from *Mortierella alpina*, with the nucleotide sequence shown in SEQ ID No. 1; the Δ-9 elongase derived from *Isochrysis galbana*, with the nucleotide sequence shown in SEQ ID No. 2; the Δ-5 desaturase derived from *Mortierella alpina*, with the nucleotide sequence shown in SEQ ID No. 3; the Δ-17 desaturase derived from *Parietichytrium sp.*, with the nucleotide sequence shown in SEQ ID No. 4; the Δ-5 elongase derived from *Parietichytrium sp.*, with the nucleotide sequence shown in SEQ ID No. 5; and the Δ-4 desaturase derived from *Ostreococcus lucimarinus*, with the nucleotide sequence shown in SEQ ID No.
6.
4. The nucleotide sequence of the gene for knocking out the peroxisome synthesis factor PEX10 is shown in SEQ ID No. 7; A high-DHA-content Schizochytrium strain was constructed by synergistic effects of a specific elongase / desaturase combination and PEX10 knockout.
5. A method for constructing a Schizochytrium engineered strain for producing high DHA content as described in claim 1 or 2, comprising the following steps: (1) The C16 / 18 elongase gene, Δ-9 elongase gene, Δ-5 desaturase gene, Δ-17 desaturase gene, Δ-5 elongase gene and Δ-4 desaturase gene were synthesized after codon optimization. The synthesized genes were used as templates for PCR amplification to obtain the target genes respectively. (2) Construction of recombinant plasmid pZPK-G418-Elo16-Elo9-Des5 Using plasmid pZPK-G418 as the backbone, which contains promoter P1569 and terminator TCYC1, as well as promoter P2902 and terminator TCYC1, the C16 / 18 elongase gene and the Δ-9 elongase gene were inserted between P1569 and TCYC1, and the C16 / 18 elongase gene and the Δ-9 elongase gene were linked by a 2A peptide. The Δ-5 desaturase gene was inserted between P2902 and TCYC1, thus obtaining the recombinant plasmid pZPK-G418-Elo16-Elo9-Des5. (3) Construction of recombinant plasmid pZPK-Nourse-Des17-Elo5-Des4 Using plasmid pZPK-Nourse as the backbone, which contains promoter P2845 and terminator TCYC1, promoter P3626 and terminator TCYC1, and promoter P2520 and terminator TCYC1, the Δ-17 desaturase gene was inserted between P2845 and TCYC1, the Δ-5 elongase gene was inserted between P3626 and TCYC1, and the Δ-4 desaturase gene was inserted between P2520 and TCYC1, thus obtaining the recombinant plasmid pZPK-Nourse-Des17-Elo5-Des4; (4) Construction of recombinant plasmid pZPK-G418-DelPEX10 Using plasmid pZPK-G418 as a backbone, the upper and lower homologous arms of the PEX10 gene were inserted. The G418 expression cassette (P2845-G418-TCTC1) was located between the upper and lower homologous arms of the PEX10 gene, thus obtaining the recombinant plasmid pZPK-G418-DelPEX10. (5) Construction of the engineered strain SCD1 of Schizochytrium The recombinant plasmid pZPK-G418-Elo16-Elo9-Des5 was transformed into Schizochytrium sp. HX308 to obtain the engineered strain SCD1 of Schizochytrium. (6) Construction of the engineered strain SCD2 of Schizochytrium Using engineered strain SCD1 as the chassis cell, the recombinant plasmid pZPK-G418-Elo16-Elo9-Des5 was transformed into engineered strain SCD1 to obtain the Schizochytrium engineered strain SCD2. (7) Construction of the engineered strain SCD3 of Schizochytrium Using engineered strain SCD2 as the chassis strain, the recombinant plasmid pZPK-G418-DelPEX10 was transformed into engineered strain SCD2, and the PEX10 gene was knocked out by homologous recombination to obtain the engineered strain SCD3 that produces high DHA content.
6. The application of the Schizochytrium engineered strain for producing high DHA content according to claim 1 or 2, wherein the fermentation culture includes the following steps: (1) Activate the engineered strain of Schizochytrium preserved in glycerol tubes, select single colonies to inoculate into primary seed liquid, and culture for 20-24 h; (2) Inoculate the primary seed culture into the secondary seed culture at a ratio of 1 / 100 and culture for 20-24 h; (3) Inoculate the secondary seed liquid into the fermentation medium at a ratio of 1 / 10 for fed fermentation and culture for 90-100 h.
7. The application of the Schizochytrium engineered strain for producing high DHA content according to claim 4, characterized in that, The fermentation conditions were 26 ℃, 170-200 rpm, and glucose concentration controlled at 20-40 g / L.
8. The application of the engineered strains of Schizochytrium according to claims 1-5 in the production of algal oil.
Citation Information
Patent Citations
DHA (docosahexaenoic acid)-producing Schizochytrium limacinum gene engineering strain, and construction method and application thereof
CN104974944A