Bacillus licheniformis with enhanced expression of yobn gene and application thereof in synthesis of poly-γ-glutamic acid
By enhancing the expression of the yobN gene in Bacillus licheniformis WX-02, a recombinant expression vector pHY-yobN was constructed and applied to γ-PGA synthesis. This solved the problem of insufficient research on the regulatory mechanisms related to γ-PGA synthesis and achieved a significant increase in γ-PGA yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUBEI UNIV
- Filing Date
- 2026-05-25
- Publication Date
- 2026-07-17
AI Technical Summary
Research on the regulatory mechanisms and potential engineering targets related to γ-PGA synthesis in existing technologies is relatively limited, and existing metabolic engineering strategies have limitations in terms of yield improvement.
By enhancing the expression of the yobN gene in Bacillus licheniformis WX-02, a recombinant expression vector pHY-yobN was constructed and transformed into Bacillus licheniformis. Constitutive expression of the yobN gene was achieved using the P43u12 promoter, thereby improving the synthesis capacity of γ-PGA.
The yield of γ-PGA was increased by 89.4% to 6.99 g/L, providing a new metabolic engineering strategy to enhance γ-PGA production.
Smart Images

Figure CN122405690A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to, but is not limited to, the field of bioengineering technology, and particularly relates to a Bacillus licheniformis strain with enhanced expression of the yobN gene and its application in the synthesis of polyγ-PGA. Background Technology
[0002] Poly-γ-glutamic acid (γ-PGA) is a natural high-molecular-weight polymer formed by the linkage of D-glutamic acid and / or L-glutamic acid through γ-amide bonds. It possesses excellent water solubility, biodegradability, biocompatibility, and non-toxicity. γ-PGA has wide applications in food, medicine, agriculture, cosmetics, water treatment, and biomaterials, demonstrating high industrial application value and promising market prospects.
[0003] Currently, the main methods for producing γ-PGA include chemical synthesis and microbial fermentation. Among them, microbial fermentation has become the primary method for γ-PGA production due to its advantages such as mild conditions, environmental friendliness, and high product safety. Bacillus microorganisms, especially Bacillus licheniformis, are widely used in γ-PGA biosynthesis research because of their rapid growth rate, relatively mature genetic manipulation, and strong glutamate metabolism capacity.
[0004] In recent years, with the development of metabolic engineering and synthetic biology, increasing γ-PGA production by regulating key metabolic genes has become a research hotspot. However, current research on the regulatory mechanisms related to γ-PGA synthesis and potential engineering targets is still relatively limited, and existing metabolic engineering strategies still have certain limitations in terms of yield enhancement. Therefore, developing new metabolic engineering targets is of great significance for improving γ-PGA production.
[0005] The yobN gene is an endogenous gene derived from Bacillus licheniformis WX-02 and is annotated as a protein-coding gene associated with amine oxidase or oxidoreductase. The inventors discovered that enhanced expression of the yobN gene can increase the synthesis capacity of γ-PGA in Bacillus licheniformis. Compared with the empty vector control strain, the recombinant Bacillus licheniformis WX-02 / pHY-yobN constructed using this invention showed an 89.4% increase in γ-PGA production, reaching 6.99 g / L. This method provides a novel metabolic engineering strategy for increasing γ-PGA production.
[0006] Based on the above analysis, the urgent technical problems that need to be solved in the existing technology are:
[0007] Current research on the regulatory mechanisms and potential engineering targets related to γ-PGA synthesis is still relatively limited, and existing metabolic engineering strategies still have certain limitations in terms of yield enhancement. Summary of the Invention
[0008] To address the problems existing in the prior art, this invention provides a Bacillus licheniformis strain with enhanced expression of the yobN gene and its application in the synthesis of polyγ-PGA.
[0009] This invention is achieved as follows: a Bacillus licheniformis strain with enhanced expression of the yobN gene and its application in the synthesis of poly-γ-PGA includes:
[0010] Step 1: Using Bacillus licheniformis WX-02 genomic DNA as a template, the yobN gene was amplified by PCR;
[0011] The genome sequence of Bacillus licheniformis WX-02 has been published in GenBank, accession number CP012110.1. This strain was deposited at the China Center for Type Culture Collection (CCTCC) on April 24, 2008, with accession number CCTCC NO: M208065.
[0012] Step 2: Prepare the expression vector pHY300-P43u12, and insert the yobN gene fragment obtained in Step 1 into the expression vector according to the homologous recombination site on the expression vector to obtain the recombinant expression vector.
[0013] Step 3: The recombinant expression vector obtained in Step 2 is transferred into Bacillus licheniformis WX-02 competent cells, and tetracycline is used as a selection marker for resistance to obtain positive transformants, which are Bacillus licheniformis with enhanced expression of the yobN gene.
[0014] Furthermore, the expression vector is a constitutive expression vector carrying the P43u12 promoter.
[0015] Furthermore, the expression vector is a pHY300-P43u12 expression vector constructed based on the pHY300PLK backbone, and the pHY300-P43u12 expression vector is obtained by inserting the pHY300PLK vector into the P43u12 promoter.
[0016] Furthermore, in step 1, the primer sequences for amplifying the yobN gene are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.
[0017] Furthermore, in step 2, a recombinant expression vector is constructed using seamless cloning, restriction endonuclease ligation, or homologous recombination.
[0018] The present invention also provides a Bacillus licheniformis strain with enhanced expression of the yobN gene, which is obtained according to the method for constructing Bacillus licheniformis strain with enhanced expression of the yobN gene.
[0019] Another object of the present invention is to provide a method for increasing the yield of polyγ-glutamic acid:
[0020] Step 1), activate and culture the Bacillus licheniformis strain enhanced with the yobN gene, and then perform seed culture;
[0021] Step 2) After the seed culture is completed, the bacterial solution is inoculated into the fermentation medium for fermentation culture to obtain polyγ-glutamic acid.
[0022] Further, in step 1), the activation culture includes: inoculating the *Bacillus licheniformis* strain with enhanced yobN gene expression into LB medium at a volume percentage of 1-5%, and culturing at 200-250 r / min and 37±1℃ for 10-15 h; and / or,
[0023] Seed culture includes: inoculating the activated bacterial solution into the seed culture medium at a volume percentage of 1-5% and then culturing at 200-250 r / min and 37±1℃ for 10-15 h;
[0024] Preferably, the seed culture medium is composed of the following components by weight-volume ratio: 8-12 g / L tryptone, 3-7 g / L yeast extract, 8-12 g / L NaCl, and the remainder is sterile water.
[0025] Furthermore, in step 2), the control conditions for polyγ-glutamic acid fermentation culture include: inoculating the bacterial culture after the seed culture is completed into the fermentation medium at an inoculation rate of 2-4%, and fermenting at 200-250 r / min and a temperature of 37±1℃ for 24-48 h;
[0026] The fermentation medium is composed of the following components by weight-volume ratio: glucose 60-80 g / L, sodium citrate 10-20 g / L, NaNO3 5-15 g / L, NH4Cl 5-10 g / L, K2HPO4·3H2O 0.5-2.0 g / L, anhydrous CaCl2 0.5-2.0 g / L, ZnSO4·7H2O 0.5-2.0 g / L, MgSO4·7H2O 0.5-2.0 g / L, MnSO4·H2O 0.05-0.30 g / L, with the balance being sterile water.
[0027] Furthermore, the initial pH of the fermentation medium is 6.5~7.5.
[0028] Based on the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solution to be protected by this invention are as follows:
[0029] This invention successfully obtained *Bacillus licheniformis* strains with enhanced yobN gene expression by transforming a plasmid vector carrying the yobN gene into *Bacillus licheniformis* WX-02. Compared with strains obtained by directly transforming a blank plasmid vector without the yobN gene into *Bacillus licheniformis* WX-02, the *Bacillus licheniformis* strain with enhanced yobN expression constructed by this invention showed an 89.4% increase in γ-PGA production, reaching 6.99 g / L. The results of this invention demonstrate that enhanced yobN gene expression can promote γ-PGA synthesis in *Bacillus licheniformis*, providing a novel metabolic engineering strategy for increasing γ-PGA production. Attached Figure Description
[0030] Figure 1 This is a flowchart of a method for constructing Bacillus licheniformis with enhanced expression of the yobN gene, provided in an embodiment of the present invention.
[0031] Figure 2 This is a flowchart of a method for increasing the yield of polyγ-glutamic acid provided in an embodiment of the present invention;
[0032] Figure 3 This is an agarose gel electrophoresis image of the yobN gene fragment amplified in Example 1 of the present invention; wherein lane M is a DNA marker and lane 1 is the yobN gene fragment;
[0033] Figure 4 This is an agarose gel electrophoresis image of the pHY300-P43u12 vector backbone fragment amplified in Example 1 of this invention; wherein lane M is the DNA marker and lane 1 is the vector backbone fragment.
[0034] Figure 5 This is a colony PCR verification diagram of the recombinant expression vector pHY-yobN in Example 1 provided by the present invention; wherein, lane M is a DNA marker and lane 1 is a positive clone;
[0035] Figure 6 This is a colony PCR verification diagram of recombinant Bacillus licheniformis WX-02 / pHY-yobN in Example 1 provided by the present invention; wherein, lane M is the DNA marker and lane 1 is the positive transformant; wherein, the molecular weights corresponding to the bands in the above DNA marker lanes from top to bottom are as follows: 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp. Detailed Implementation
[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0037] like Figure 1 As shown in the figure, the method for constructing Bacillus licheniformis with enhanced expression of the yobN gene provided in this embodiment of the invention includes the following steps:
[0038] S101, using Bacillus licheniformis WX-02 genomic DNA as a template, the yobN gene was amplified by PCR;
[0039] S102, Prepare the expression vector pHY300-P43u12, and insert the yobN gene fragment obtained in S101 into the expression vector according to the homologous recombination site on the expression vector to obtain the recombinant expression vector.
[0040] S103: The recombinant expression vector obtained in S102 was transferred into Bacillus licheniformis WX-02 competent cells, and tetracycline was used as a selection marker for resistance to obtain positive transformants, which are Bacillus licheniformis strains with enhanced expression of the yobN gene.
[0041] The expression vector provided in this embodiment of the invention is a constitutive expression vector carrying the P43u12 promoter.
[0042] The expression vector provided in this embodiment of the invention is the pHY300-P43u12 expression vector constructed based on the pHY300PLK backbone.
[0043] In S101 provided in this embodiment of the invention, the primer sequences for amplifying the yobN gene are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.
[0044] In S102 provided in this embodiment of the invention, a recombinant expression vector is constructed using seamless cloning, restriction endonuclease ligation, or homologous recombination.
[0045] The Bacillus licheniformis strain with enhanced expression of the yobN gene provided in the embodiments of the invention is obtained according to the construction method of Bacillus licheniformis strain with enhanced expression of the yobN gene.
[0046] like Figure 2 As shown, an embodiment of the present invention provides a method for increasing the yield of poly-γ-glutamic acid, comprising the following steps:
[0047] S201, the Bacillus licheniformis strain with enhanced expression of the yobN gene is activated and cultured, and then seed culture is performed;
[0048] S202 involves inoculating the bacterial culture solution after seed culture into a fermentation medium for fermentation culture to obtain polyγ-glutamic acid.
[0049] In S201 provided in this embodiment of the invention, the activation culture includes: inoculating the *Bacillus licheniformis* strain with enhanced yobN gene expression into LB medium at a volume percentage of 1-5%, and culturing at 200-250 r / min and 37±1℃ for 10-15 h; and / or,
[0050] Seed culture includes: inoculating the activated bacterial solution into the seed culture medium at a volume percentage of 1-5% and then culturing at 200-250 r / min and 37±1℃ for 10-15 h;
[0051] Preferably, the seed culture medium is composed of the following components by weight-volume ratio: 8-12 g / L tryptone, 3-7 g / L yeast extract, 8-12 g / L NaCl, and the remainder is sterile water.
[0052] In the S202 provided in this embodiment of the invention, the control conditions for polyγ-glutamic acid fermentation culture include: inoculating the bacterial culture after the seed culture is completed into the fermentation medium at an inoculation rate of 2-4%, and fermenting at 200-250 r / min and a temperature of 37±1℃ for 24-48 h;
[0053] The fermentation medium is composed of the following components by weight-volume ratio: glucose 60-80 g / L, sodium citrate 10-20 g / L, NaNO3 5-15 g / L, NH4Cl 5-10 g / L, K2HPO4·3H2O 0.5-2.0 g / L, anhydrous CaCl2 0.5-2.0 g / L, ZnSO4·7H2O 0.5-2.0 g / L, MgSO4·7H2O 0.5-2.0 g / L, MnSO4·H2O 0.05-0.30 g / L, with the balance being sterile water.
[0054] The fermentation medium provided in this embodiment of the invention has an initial pH of 6.5 to 7.5.
[0055] Specific implementation of the present invention:
[0056] The technical solution adopted in this application is as follows:
[0057] Using Bacillus licheniformis WX-02 genomic DNA as a template, the yobN gene fragment was amplified by PCR, and a recombinant expression vector was constructed using pHY300-P43u12 as an expression vector through a seamless cloning method to obtain the recombinant plasmid pHY-yobN.
[0058] Preferably, the upstream and downstream primer sequences for amplifying the yobN gene are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.
[0059] yobN-F: (SEQ ID NO.2)
[0060] AGAAAGGAGGAATATATATTGAATTTTCAATTAACT
[0061] yobN-R: (SEQ ID NO.3)
[0062] AACTTGGTCTGACAGTTATACGCGGGAGGCCTG
[0063] Preferably, the primer sequences for amplifying the expression vector backbone are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.
[0064] 300-amp-P43u12-bone-F: (SEQ ID NO.4)
[0065] TATATATTCCTCCTTTCTAATAT;
[0066] 300-amp-P43u12-bone-R: (SEQ ID NO.5)
[0067] CTGTCAGACCAAGTTTACTCATA
[0068] Preferably, the expression vector is pHY300-P43u12. The pHY300-P43u12 expression vector is a constitutive expression vector constructed based on the pHY300PLK backbone, which carries the P43u12 promoter element.
[0069] Preferably, the recombinant expression vector is constructed using a seamless cloning method.
[0070] The recombinant expression vector was transformed into Bacillus licheniformis WX-02 competent cells, and after screening with a tetracycline-resistant medium, recombinant Bacillus licheniformis with enhanced expression of the yobN gene was obtained.
[0071] Example 1:
[0072] The method for constructing Bacillus licheniformis WX-02 / pHY-yobN with enhanced yobN expression includes:
[0073] 1. The specific steps for step 1 are as follows:
[0074] Using Bacillus licheniformis WX-02 genomic DNA as a template, upstream primers (yobN-F) and downstream primers (yobN-R) for the yobN gene were designed, and the yobN gene fragment was amplified by PCR (e.g., Figure 3 (As shown).
[0075] Simultaneously, using the expression vector pHY300-P43u12 as a template, amplification primers for the vector backbone were designed (300-amp-P43u12-bone-F and 300-amp-P43u12-bone-R), and linearized vector backbone fragments were amplified using PCR (e.g., ...). Figure 4 (As shown).
[0076] The nucleotide sequence of the yobN gene is shown in SEQ ID NO.1;
[0077] SEQ ID NO.1:
[0078]
[0079] The sequences of yobN-F, yobN-R, 300-amp-P43u12-bone-F, and 300-amp-P43u12-bone-R are as follows:
[0080] yobN-F:
[0081] AGAAAGGAGGAATATATATTGAATTTTCAATTAACT (SEQ ID NO. 2);
[0082] yobN-R:
[0083] AACTTGGTCTGACAGTTATACGCGGGAGGCCTG (SEQ ID NO.3);
[0084] 300-amp-P43u12-bone-F:
[0085] TATATATTCCTCCTTTTCTAATAT (SEQ ID NO. 4);
[0086] 300-amp-P43u12-bone-R:
[0087] CTGTCAGACCAAGTTTACTCATA (SEQ ID NO. 5).
[0088] 2. The specific steps for step 2 are as follows:
[0089] The yobN gene fragment obtained in step 1 was ligated to the linearized vector backbone fragment using a seamless cloning method to obtain a recombinant expression vector.
[0090] Subsequently, the ligation product was transformed into E. coli DH5α competent cells and screened on LB medium containing tetracycline resistance to obtain positive transformants.
[0091] After initial screening by colony PCR, positive plasmids were sequenced for verification, confirming the correct insertion sequence and orientation, thus obtaining the recombinant expression vector pHY-yobN (e.g., Figure 5 (as shown)
[0092] 3. The specific steps for step 3 are as follows:
[0093] The recombinant expression vector pHY-yobN obtained in step 2 was transformed into Bacillus licheniformis WX-02 competent cells by high voltage electroporation. Positive transformants were obtained by screening on LB medium containing tetracycline resistance.
[0094] The transformants were verified by colony PCR. After successful verification, recombinant Bacillus licheniformis WX-02 / pHY-yobN (e.g.) was obtained. Figure 6 (As shown).
[0095] Example 2:
[0096] The application of the recombinant Bacillus licheniformis WX-02 / pHY-yobN obtained in Example 1 in γ-PGA production includes the following steps:
[0097] 1) The specific steps for obtaining the seed culture are as follows: First, activate Bacillus licheniformis WX-02 / pHY-yobN by inoculating it into 5 mL of LB medium at a volume percentage of 1% from a glycerol tube, and incubate it at 230 r / min and 37℃ for 12 hours. Then, inoculate the activated bacterial culture into the seed culture medium at a volume percentage of 3% and incubate it at 230 r / min and 37℃ for 12 hours to obtain the seed culture bacterial culture.
[0098] The seed culture medium is formulated with 1% tryptone, 0.5% yeast extract, 1% NaCl, and the remainder is sterile water with a natural pH.
[0099] 2) The specific steps of shake flask fermentation are as follows: 50 mL of fermentation medium is added to a 250 mL Erlenmeyer flask, and then the seed culture bacterial solution is inoculated into the fermentation medium at an inoculation amount of 3% (volume percentage). Fermentation is carried out at a speed of 230 r / min and a temperature of 37℃ for 36 hours to obtain the product.
[0100] The fermentation medium consisted of: 70 g / L glucose, 15 g / L sodium citrate, 10 g / L NaNO3, 8 g / L NH4Cl, 1.0 g / L K2HPO4·3H2O, 1.0 g / L anhydrous CaCl2, 1.0 g / L ZnSO4·7H2O, 1.0 g / L MgSO4·7H2O, and 0.15 g / L MnSO4·H2O, with the initial pH adjusted to 7.2.
[0101] Bacillus licheniformis WX-02 / pHY300-P43u12 transformed with the empty vector pHY300-P43u12 was used as a control strain and fermented under the same conditions.
[0102] The yield of γ-PGA was determined by hexadecyltrimethylammonium bromide (CTAB) turbidimetric method. The principle is that CTAB can form an insoluble complex with negatively charged γ-PGA, thereby causing a change in the turbidity of the system. The γ-PGA content is determined by detecting the OD400 value.
[0103] The CTAB detection solution consists of 0.15 M CTAB in 2% NaOH solution.
[0104] γ-PGA standards were prepared using a gradient dilution method, with standard concentrations of 0.02 g / L, 0.04 g / L, 0.06 g / L, 0.08 g / L, and 0.10 g / L, respectively. Standard curves were plotted for quantitative analysis of samples.
[0105] The pretreatment steps for fermentation broth samples are as follows:
[0106] Take 2.00 g of fermentation broth, add 4 mL of HCl solution with pH 1, mix well, and centrifuge at 12000 r / min for 5 min; take the supernatant, adjust to neutral, and add three times the volume of ethanol to precipitate; the resulting precipitate is redissolved and used for subsequent detection.
[0107] During the test, after removing the bacterial cells, the sample was appropriately diluted, and 100 μL of the sample was added to a 96-well plate. Then, 100 μL of CTAB detection solution was added. After reacting at room temperature for 3-5 min, the absorbance was measured at a wavelength of 400 nm, and the γ-PGA concentration was calculated based on the standard curve.
[0108] All experiments were performed in triplicate.
[0109] Table 1
[0110] strain γ-PGA (g / L) OD600 WX-02 / pHY300-P43u12 3.69 3.34 WX-02 / pHY-yobN 6.99 2.73
[0111] As shown in Table 1, under the same fermentation conditions, the γ-PGA production of recombinant Bacillus licheniformis WX-02 / pHY-yobN was significantly higher than that of the control strain, with an increase of approximately 89.4%.
[0112] The results showed that enhanced expression of the yobN gene effectively promoted the synthesis of γ-PGA in Bacillus licheniformis, providing a feasible strategy for increasing γ-PGA production. The above-described embodiments are merely preferred embodiments of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.
[0113] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A method for constructing Bacillus licheniformis strains with enhanced expression of the yobN gene, characterized in that, The construction method described below: Step 1: Using Bacillus licheniformis WX-02 genomic DNA as a template, the yobN gene was amplified by PCR; Step 2: Prepare the expression vector pHY300-P43u12, and insert the yobN gene fragment obtained in Step 1 into the expression vector according to the homologous recombination site on the expression vector to obtain the recombinant expression vector. Step 3: The recombinant expression vector obtained in Step 2 is transferred into Bacillus licheniformis WX-02 competent cells, and tetracycline is used as a selection marker for resistance to obtain positive transformants, which are Bacillus licheniformis with enhanced expression of the yobN gene.
2. The method for constructing Bacillus licheniformis with enhanced expression of the yobN gene as described in claim 1, characterized in that, The expression vector is a constitutive expression vector carrying the P43u12 promoter.
3. The method for constructing Bacillus licheniformis strains with enhanced yobN gene expression as described in claim 1, characterized in that, The expression vector is the pHY300-P43u12 expression vector, which is constructed by inserting the pHY300PLK vector into the P43u12 promoter.
4. The method for constructing Bacillus licheniformis with enhanced expression of the yobN gene as described in claim 1, characterized in that, In step 1, the primer sequences for amplifying the yobN gene are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.
5. The method for constructing Bacillus licheniformis strains with enhanced expression of the yobN gene as described in claim 1, characterized in that, In step 2, a recombinant expression vector is constructed using seamless cloning, restriction endonuclease ligation, or homologous recombination.
6. A Bacillus licheniformis strain with enhanced expression of the yobN gene, characterized in that, It is obtained by the method for constructing Bacillus licheniformis with enhanced expression of the yobN gene according to any one of claims 1 to 5.
7. A method for increasing the yield of polyγ-glutamic acid, characterized in that, Fermentation culture of Bacillus licheniformis with enhanced expression of the yobN gene as described in claim 6, the method comprising the following steps: Step 1), activate and culture the Bacillus licheniformis strain enhanced with the yobN gene, and then perform seed culture; Step 2) After the seed culture is completed, the bacterial solution is inoculated into the fermentation medium for fermentation culture to obtain polyγ-glutamic acid.
8. The method for increasing polyγ-glutamic acid production as described in claim 7, characterized in that, In step 1), the activation culture includes: inoculating the *Bacillus licheniformis* strain with enhanced yobN gene expression into LB medium at a volume percentage of 1-5%, and culturing at 200-250 r / min and 37±1℃ for 10-15 h; and / or, Seed culture includes: inoculating the activated bacterial solution into the seed culture medium at a volume percentage of 1-5% and then culturing at 200-250 r / min and 37±1℃ for 10-15 h; Preferably, the seed culture medium is composed of the following components by weight-volume ratio: 8-12 g / L tryptone, 3-7 g / L yeast extract, 8-12 g / L NaCl, and the remainder is sterile water.
9. The method for increasing polyγ-glutamic acid yield as described in claim 7 or 8, characterized in that, In step 2), the control conditions for polyγ-glutamic acid fermentation culture include: inoculating the bacterial culture after the seed culture is completed into the fermentation medium at an inoculation rate of 2-4%, and fermenting at 200-250 r / min and a temperature of 37±1℃ for 24-48 h. The fermentation medium is composed of the following components by weight-volume ratio: glucose 60-80 g / L, sodium citrate 10-20 g / L, NaNO3 5-15 g / L, NH4Cl 5-10 g / L, K2HPO4·3H2O 0.5-2.0 g / L, anhydrous CaCl2 0.5-2.0 g / L, ZnSO4·7H2O 0.5-2.0 g / L, MgSO4·7H2O 0.5-2.0 g / L, MnSO4·H2O 0.05-0.30 g / L, with the remainder being sterile water.
10. The method for increasing polyγ-glutamic acid yield as described in claim 9, characterized in that, The initial pH of the fermentation medium is 6.5-7.5.