Application of the glucose dehydrogenase-encoding gdh gene in controlling the yield of secondary metabolites in Bacillus licheniformis

By knocking out the gdh gene in Bacillus licheniformis and using various modification methods to inhibit gdh expression, the yields of poly-γ-glutamic acid and bacitracin were significantly increased, solving the problem of insufficient yield in existing technologies and providing a new strategy for microbial fermentation production.

CN122303172APending Publication Date: 2026-06-30HUBEI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610623415.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-08
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

There is currently no research on the correlation between GDH and poly-γ-glutamic acid and bacitracin in Bacillus subtilis, resulting in insufficient production of its secondary metabolites.

Method used

By knocking out the gdh gene in Bacillus licheniformis, the expression of the gdh gene encoded by glucose dehydrogenase can be inhibited through modifications such as DNA methylation, histone deacetylation or H3K27me3, blocking RNA polymerase activity, CRISPRi, RNA interference, antisense oligonucleotides, translation inhibitors, upstream open reading frame editing, gene editing technology or ribozyme methods, thereby increasing the yield of secondary metabolites.

Benefits of technology

It significantly increased the yield of poly-γ-glutamic acid and bacitracin in Bacillus licheniformis, with bacitracin yield increasing by a minimum of 7.5% and a maximum of 10.6%, and poly-γ-glutamic acid yield increasing by at least 28.75% and a maximum of 38.80%.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

This invention belongs to the fields of genetic engineering and microbial technology, and discloses the application of the glucose dehydrogenase-encoding gdh gene in controlling the yield of secondary metabolites in Bacillus licheniformis. This invention involves knocking out the glucose dehydrogenase gene in Bacillus licheniformis. gdh ,get gdh Missing Bacillus licheniformis engineered strain DW2△ gdh and DW2-PR55-pgsB△ gdh Among them, DW2△ gdh The bacitracin production in different culture media was at least 7.5% higher than that of the control strain DW2, with a maximum increase of 10.6%. (DW2-PR55-pgsB△) gdh The production of polyγ-glutamic acid in different culture media was at least 28.75% higher than that of the control strain DW2-PR55-pgsB, and reached a maximum of 38.80%, indicating that this genetic engineering method can improve the production of secondary metabolites synthesized by microorganisms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and microbial technology, specifically relating to the application of the glucose dehydrogenase-encoded gdh gene in controlling the yield of secondary metabolites in Bacillus licheniformis. Background Technology

[0002] Bacillus licheniformis is an internationally recognized biosafety-assured (GRAS) industrial microbial strain. It possesses advantages such as a clear genetic background, strong robustness, and stable characteristics, and is therefore widely used in the fermentation production of secondary metabolites such as poly-γ-glutamic acid, lichenin, iturobrine, and bacitracin. Among these, poly-γ-glutamic acid (γ-PGA), also known as natto gum or poly-γ-glutamic acid, is a biopolymer produced through microbial fermentation. It is mainly composed of L-glutamic acid and / or D-glutamic acid monomers polymerized through γ-amide bonds. It possesses excellent water solubility, adsorption capacity, biodegradability, and non-toxicity to humans and the environment, making it widely applicable in numerous fields such as medicine, wastewater treatment, and agriculture.

[0003] Bacitracin is a polypeptide antibiotic synthesized by Bacillus subtilis and Bacillus licheniformis. It can strongly inhibit the growth of Gram-positive bacteria and some Gram-negative bacteria, and has a synergistic effect when used in combination with other antibiotics. Therefore, it is widely used in feed additives and the veterinary drug industry.

[0004] Currently, there are no studies on the correlation between GDH and poly-γ-glutamic acid and bacitracin in Bacillus. This application, using Bacillus licheniformis as an example, found that knocking out GDH in Bacillus licheniformis significantly increases the production of poly-γ-glutamic acid and bacitracin, which has important scientific research significance and application value in the high-yield production of poly-γ-glutamic acid and bacitracin in Bacillus. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the glucose dehydrogenase-encoded gdh gene in controlling the yield of secondary metabolites in Bacillus licheniformis. By knocking out the gdh gene in Bacillus licheniformis, the yield of secondary metabolites such as polyγ-glutamic acid and / or bacitracin in Bacillus licheniformis can be significantly increased.

[0006] To achieve the above objectives, the present invention adopts the following technical measures:

[0007] Application of the gdh gene, which inhibits glucose dehydrogenase, in increasing the yield of secondary metabolites of Bacillus licheniformis, wherein the amino acid sequence encoded by the gene is shown in SEQ ID NO.2.

[0008] The above-described applications involve introducing substances that inhibit or prevent the expression of the glucose dehydrogenase-encoded gdh gene into Bacillus licheniformis.

[0009] The above-described applications refer to substances that inhibit the expression of the glucose dehydrogenase-encoded gdh gene, recombinant vectors, or recombinant microorganisms.

[0010] The above-described applications and the methods of inhibition include: DNA methylation, histone deacetylation or H3K27me3 modification, blocking RNA polymerase activity, CRISPRi, RNA interference (RNAi), antisense oligonucleotides (ASO), translation inhibitors, upstream open reading frame editing, gene editing technology, ribozyme methods or triple-stranded DNA technology.

[0011] In the above-described applications, the preferred gene editing technology is homologous recombination.

[0012] In the above-described applications, preferably, the secondary metabolite is bacitracin or polyγ-glutamic acid.

[0013] In the above-described applications, preferably, the Bacillus licheniformis is Bacillus licheniformis DW2.

[0014] In the above-described application, preferably, the application process includes fermenting Bacillus licheniformis with the gdh gene knocked out. The fermentation medium consists of 60-100 g / L soybean meal, 30-50 g / L corn starch, 4-8 g / L calcium carbonate, and 0.5-2 g / L ammonium sulfate, with the remainder being water and the pH being natural.

[0015] In the preferred embodiment of the above-described application, the application process includes fermenting Bacillus licheniformis with the gdh gene knocked out and the PpgsB promoter replaced by the PR55 promoter. The fermentation medium consists of: 60-100 g / L glucose, 8-16 g / L sodium citrate, 20-40 g / L sodium glutamate, 0.3-0.7 g / L dipotassium hydrogen phosphate, 0.3-0.7 g / L calcium chloride, 0.3-0.7 g / L magnesium sulfate, 0.003-0.005 g / L ferric chloride, 0.3-0.7 g / L manganese sulfate, with the remainder being water, and the pH being natural.

[0016] Compared with the prior art, the present invention has the following advantages:

[0017] This study significantly increased the yield of poly-γ-glutamic acid and / or bacitracin secondary metabolites in Bacillus licheniformis by deleting the gdh gene. The results indicate that deleting the gdh gene is a highly effective method for enhancing the ability of microorganisms to synthesize poly-γ-glutamic acid and / or bacitracin. The Bacillus licheniformis strain DW2△gdh obtained using the method provided in this invention significantly improved the strain's ability to synthesize bacitracin in different bacitracin fermentation media, with increases ranging from a minimum of 7.5% to a maximum of 10.6%. The Bacillus licheniformis strain DW2-PR55-pgsB△gdh obtained using the method provided in this invention significantly increased the yield of poly-γ-glutamic acid in different poly-γ-glutamic acid fermentation media, with increases ranging from at least 28.75% to a maximum of 38.80%. This study provides a novel strategy for the microbial fermentation production of bacitracin and poly-γ-glutamic acid. Detailed Implementation

[0018] The present invention will be further illustrated by the following examples, but these should not be construed as limiting the scope of the invention. The content disclosed in this invention can be improved simultaneously in terms of materials, methods, and reaction conditions; all such improvements should fall within the spirit and scope of this invention. Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all derived from commercial sources.

[0019] The culture media involved in the following implementation examples are as follows:

[0020] LB liquid medium: yeast extract 5 g·L -1 10 g / L of peptone -1 NaCl 10 g·L -1 pH 7.0.

[0021] LB solid medium: 5 g·L yeast extract -1 10 g / L of peptone -1 NaCl 10 g·L -1 15 g·L agar powder -1 .

[0022] Poly-γ-glutamic acid fermentation medium: 80 g / L glucose, 12 g / L sodium citrate, 20 g / L sodium glutamate, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L calcium chloride, 0.5 g / L magnesium sulfate, 0.004 g / L ferric chloride, 0.5 g / L manganese sulfate, pH natural.

[0023] Bacitracin fermentation medium: 50 g / L corn starch -1 80 g·L soybean meal -1 Calcium carbonate 6 g·L -1Mannitol 3g·L -1 2 g·L ammonium sulfate -1 pH is natural.

[0024] Example 1:

[0025] Construction of Bacillus licheniformis GDH knockout vector:

[0026] Step 1: Based on the upstream and downstream sequences of the gdh gene (the gene sequence is shown in SEQ ID NO.1, and the protein encoded by the gdh gene is shown in SEQ ID NO.2) in the genomic DNA sequence of Bacillus licheniformis DW2 (CN117402802A), primers for the upstream homologous arm of the gdh gene (AF and AR) and primers for the downstream homologous arm (BF and BR) were designed. Using the genomic DNA of Bacillus licheniformis DW2 as a template, PCR amplification was performed using the primers for the upstream and downstream homologous arms of the gdh gene to obtain the upstream homologous arm of the gdh gene (upper homologous arm sequence is shown in SEQ ID NO.3) and the downstream homologous arm of the gdh gene (lower homologous arm sequence is shown in SEQ ID NO.4).

[0027] The sequences of AF, AR, BF, and BR are as follows:

[0028] AF:GTTTATGCATCCCTTAACAGCCGCATCAGAAGAATAC

[0029] AR:GGGTTGATTCCTCCTTATTGAAAC;

[0030] BF:ATAAGGAGGAATCAACCCAAAGAAGGCGGGGGTGCCT

[0031] BR:TCCTTTGATCTTTTCTACTCTCGACACCTGGTGTATTCACCTT.

[0032] Step 2: The upstream homologous arm of the gdh gene and the downstream homologous arm of the gdh gene are joined together by overlap extension PCR (primers AF and BR are used) to form the target gene fragment.

[0033] Step 3: The above fusion fragment and the T2(2)-Ori plasmid backbone were ligated using Gibison and transformed into E. coli DH5α. The transformation product was plated on LB solid medium containing kanamycin resistance and cultured at 37℃ for 18 h. Transformants were picked from the LB solid medium and colony PCR was performed on the plasmids of the transformants (the primers used were T2-F and T2-R). If the PCR verification result of the transformant showed an electrophoretic band at 1256 bp, it indicated that the integration expression vector was successfully constructed. The above transformant was a positive transformant and named the integration expression vector T2(2)-gdh.

[0034] T2-F: ATGTGATAACTCGGCGTA

[0035] T2-R: GCAGAGCAGCAGATTACGC.

[0036] Example 2:

[0037] Construction of gdh gene knockout strains:

[0038] Step 1: Transform the recombinant vector T2(2)-gdh into Bacillus licheniformis DW2 competent cells. Screening was performed at 37°C on a kanamycin-resistant medium to obtain transformants. Plasmids from the transformants were then selected for colony PCR verification (primers used were T2-F and T2-R). If the PCR verification result of the transformant showed an electrophoretic band at 1556 bp, it proved that the knockout expression vector T2(2)-gdh had been successfully transformed into Bacillus licheniformis DW2.

[0039] Step 2: The positive transformants obtained in Step 1 were cultured three times at 45°C on a medium containing kanamycin resistance, each time for 12 h. The colony PCR was performed using T2-F and gdh-YR as primers to detect single-exchange strains.

[0040] The sequences of primers gdh-YF and gdh-YR are as follows:

[0041] gdh-YF: AGCTGAAAAGCTTGCGGT

[0042] gdh-YR: CCTACACTATCATTGCTATGTAAAC.

[0043] Step 3: The strains showing a 1318 bp band in the PCR test obtained in Step 2 are considered single-crossover strains. A single colony of one of these single-crossover strains is inoculated into liquid LB medium and cultured at 37°C in a kanamycin-free medium for several subculturings. Transformants are then selected for colony PCR verification (primers are gdh-YF and gdh-YR). If the PCR verification result of the transformant is: an electrophoretic band at 1932 bp, it indicates a gene reversion mutation, and the transformant is *Bacillus licheniformis* DW2; an electrophoretic band at 1231 bp indicates successful gdh gene knockout. Subsequent DNA sequencing of the positive transformants further verifies the result, yielding a double-crossover successful gdh knockout strain, namely *Bacillus licheniformis* DW2△gdh.

[0044] Example 3:

[0045] Construction of Bacillus licheniformis strain DW2-PR55-pgsB△gdh:

[0046] Step 1: Construction of the T2-PR55-pgsB promoter replacement vector

[0047] Based on the upstream and downstream sequences (SEQ ID NO. 6 and SEQ ID NO. 7) of the promoter PpgsB (the gene sequence is shown in SEQ ID NO. 5) of the pgsBCAE operator in the genomic DNA sequence of Bacillus licheniformis DW2 (CN117402802A), primers for the upstream homologous arm of the PpgsB promoter (PpgsB-AF, PpgsB-AR) and the downstream homologous arm (PpgsB-BF, PpgsB-BR) were designed. Using the genomic DNA of Bacillus licheniformis DW2 as a template, PCR amplification was performed using the primers for the upstream and downstream homologous arms of the PpgsB gene to obtain the upstream homologous arm (500 bp) (upper homologous arm sequence is SEQ ID NO. 6) and the downstream homologous arm (500 bp) (lower homologous arm sequence is SEQ ID NO. 7) of the PpgsB promoter. NO.7); Using pHY-PR55-GFP as a template, the PR 55 promoter sequence (SEQ ID NO.8) was amplified using primers PR55-F and PR55-R.

[0048] The sequences of PpgsB-AF, PpgsB-AR, PpgsB-BF, and PpgsB-BR are as follows:

[0049] PpgsB-AF:ATTCACAAAAAATAGGCAATGGACGTATCCCGTCTC

[0050] PpgsB-AR: AAAACATACCACCTATCATCCCTCTTCAAAACAAATGCG;

[0051] PpgsB-BF: ACAAAGGGGGAGATTTGTATGTGGGTAATGCTATTAGCCT

[0052] PpgsB-BR:TTGATCTTTCTACGAGCAAATGTCCATTATAAGGAATGGTTG;

[0053] PR55-F: TGATAGGTGGTATGTTTTCGC

[0054] PR55-R: ACAAATCTCCCCCTTTGTTG;

[0055] PR55-YF: GGAAAGAACGGGGTTTGTGATAT

[0056] PR55-YR: AAACTGTCTGAGGTATTCATCTG.

[0057] The upstream homologous arm of the PpgsB promoter, the downstream homologous arm of the PR55 promoter, and the downstream homologous arm of the PpgsB promoter were ligated together by overlap extension PCR (using primers PpgsB-AF and PpgsB-BR) to form the target gene fragment. The fusion fragment was then ligated to the T2(2)-Ori plasmid backbone via Gibison ligation and transformed into E. coli DH5α. The transformation product was plated on LB solid medium containing kanamycin resistance and cultured at 37°C for 18 h. Transformants were picked from the LB solid medium, and colony PCR was performed on the plasmids selected from the transformants (using primers T2-F and T2-R). Positive transformants were obtained and named T2(2)-PR55-pgsB.

[0058] Subsequently, following the method in Example 2, T2(2)-PR55-pgsB was electroporated into Bacillus licheniformis DW2△gdh or DW2 competent cells. Positive transformants were screened, and single-double exchanges were performed on the positive transformants to finally obtain recombinant strains DW2-PR55-pgsB and DW2-PR55-pgsB△gdh that produce polyγ-glutamic acid.

[0059] Example 4:

[0060] Application of gdh gene knockout in increasing the yield of bacitracin, a secondary metabolite of Bacillus licheniformis:

[0061] Seed fermentation: First, Bacillus licheniformis DW2△gdh and DW2 were activated separately by inoculating 1% (v / v) of the bacterial culture into 5 mL of LB medium from a glycerol tube and culturing at 230 r / min and 37℃ for 12 hours. Then, the activated bacterial culture was inoculated into seed culture medium at 1% (v / v) and cultured at 230 r / min and 37℃ for 12 hours to obtain the seed culture solution (the seed culture medium formula is: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2).

[0062] The specific steps of the fermentation culture are as follows: 20 mL of different fermentation culture media with different formulations are added to a 250 mL Erlenmeyer flask. The specific formulations of the culture media are shown in Table 1. In addition, each culture medium contains 6 g / L CaCO3. The pH of the fermentation culture media used is natural. Then, the seed culture bacterial solution is inoculated at an inoculation amount of 3% (volume percentage). The fermentation is carried out at a speed of 230 r / min and a temperature of 37℃ for 48 hours to obtain the fermentation broth.

[0063] Table 1. Culture medium formulations for bacitracin fermentation

[0064] .

[0065] The method for bacitracin assay is as follows:

[0066] Sample pretreatment: The fermentation broth was centrifuged at 12000 rpm for 5 min to remove bacterial cells and residual soybean meal. The supernatant was diluted appropriately with anhydrous ethanol of a certain concentration. 1 mL of the supernatant was filtered through a 0.22 μm aqueous filter membrane and then analyzed by high-performance liquid chromatography (HPLC). Detection conditions: The yield of bacitracin in the fermentation broth produced in the above examples was determined by HPLC. Specific determination conditions were as follows: An Agilent 1200 HPLC system was used; the column was a Hypersil BDS C18 (5 μm, 4.6 mm × 250 mm); the mobile phase was A:B = 35:65 (Phase A: 100 mL pH 6.0 phosphate buffer mixed with 300 mL water; Phase B: 520 mL methanol mixed with 40 mL acetonitrile); flow rate: 1.0 mL / min; column temperature: 30°C; UV detector wavelength: 254 nm; injection volume: 20 μL. The yield of bacitracin in the fermentation broth was calculated based on the standard curve prepared using bacitracin standards.

[0067] Table 2 Comparison of bacitracin production by Bacillus licheniformis DW2 and DW2△gdh

[0068] .

[0069] The applicant also measured the bacitracin yield of culture media numbered 1-9 in Table 1. Table 2 shows that, under the same seed fermentation and production fermentation conditions, the use of the *Bacillus licheniformis* DW2△gdh strain of this invention significantly improved the strain's ability to synthesize bacitracin, with an increase ranging from a minimum of 7.5% to a maximum of 10.6%. The technical solution of this invention has significant scientific research value and application value in the high-yield production of bacitracin by *Bacillus*.

[0070] Example 5:

[0071] Application of gdh gene knockout in increasing the production of poly-γ-glutamate, a secondary metabolite of Bacillus licheniformis:

[0072] 1) Seed fermentation: Activated Bacillus licheniformis DW2-PR55-pgsB and DW2-PR55-pgsB△gdh were picked from plates and inoculated into 250 mL Erlenmeyer flasks containing 50 mL of liquid LB. The flasks were incubated at 37°C and 230 rpm for 12 h. Subsequently, 2% (v / v) of the inoculum was added to poly-γ-glutamic acid fermentation medium (50 mL in 250 mL Erlenmeyer flasks).

[0073] The applicant selected nine culture medium formulations for the fermentation medium, numbered 1-9 as polyγ-glutamic acid fermentation medium (Table 3). In addition, each culture medium contains 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L calcium chloride, 0.5 g / L magnesium sulfate, 0.004 g / L ferric chloride, 0.5 g / L manganese sulfate, and natural pH.

[0074] Table 3. Culture medium formulations for γ-polyglutamic acid fermentation

[0075] .

[0076] The culture conditions were 37℃, 230 rpm for 48 h, and the yield of polyγ-glutamic acid was measured after fermentation.

[0077] The method for determining poly-γ-glutamic acid is as follows:

[0078] Fermentation broth pretreatment: The fermentation broth was diluted 30 times with deionized water, centrifuged to remove bacteria, and then filtered through a 0.22 μm aqueous filter before gel permeation chromatography (GPC) detection. GPC detection conditions were as follows: a TSK Gel G6000 PWXL column was used; the detection wavelength was 220 nm; the injection volume was 10 μL; the mobile phase was a mixture of 25 mM anhydrous sodium sulfate and acetonitrile (8:1 volume ratio); and the flow rate was 0.5 mL / min. The poly-γ-glutamic acid (PGA) content in the fermentation broth was calculated based on a standard curve prepared using PGA standards.

[0079] The applicant also determined the yield of poly-γ-glutamic acid in culture media numbered 1-9 in Table 3. As shown in Table 4, under the same seed fermentation and production fermentation conditions, the use of *Bacillus licheniformis* DW2-PR55-pgsB△gdh of the present invention significantly improved the poly-γ-glutamic acid synthesis capacity of the strain, with an increase of at least 28.75% and a maximum of 38.80%. The technical solution of the present invention has significant scientific research significance and application value in the high-yield production of poly-γ-glutamic acid by *Bacillus*.

[0080] Table 4 Comparison of γ-polyglutamic acid production between Bacillus licheniformis DW2-PR55-pgsBΔgdh and control strain DW2-PR55-pgsB

[0081] .

[0082] Fermentation of DW2-PR55-pgsB△gdh in different culture media can significantly increase the yield of polyγ-glutamic acid, by at least 28.75% and up to 38.80% compared with the control strain DW2-PR55-pgsB.

[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. Application of the gdh gene encoding glucose dehydrogenase inhibition in increasing the yield of secondary metabolites of Bacillus licheniformis, wherein the amino acid sequence encoded by the gene is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, Its application process involves introducing substances that inhibit or prevent the expression of the glucose dehydrogenase-encoding gdh gene into Bacillus licheniformis.

3. The application according to claim 2, characterized in that, The substance described is an expression cassette, recombinant vector, or recombinant microorganism that inhibits the expression of the gdh gene encoded by glucose dehydrogenase.

4. The application according to claim 1, characterized in that, The methods of inhibition include: DNA methylation, histone deacetylation or H3K27me3 modification, blocking RNA polymerase activity, CRISPRi, RNA interference, antisense oligonucleotides, translation inhibitors, upstream open reading frame editing, gene editing technology, ribozyme methods or triple-stranded DNA technology.

5. The application according to claim 4, characterized in that, The gene editing technology mentioned is homologous recombination.

6. The application according to claim 1, characterized in that, The secondary metabolites are bacitracin or polyγ-glutamic acid.

7. The application according to claim 1, characterized in that, The Bacillus mentioned is Bacillus licheniformis DW2.

8. The application according to claim 1, characterized in that, The application process involves fermenting Bacillus licheniformis with the gdh gene knocked out. The fermentation medium consists of 60-100 g / L soybean meal, 30-50 g / L corn starch, 4-8 g / L calcium carbonate, and 0.5-2 g / L ammonium sulfate, with the remainder being water and the pH being natural.

9. The application according to claim 1, characterized in that, The application process involves fermenting Bacillus licheniformis with the gdh gene knocked out and the PpgsB promoter replaced by the PR55 promoter. The fermentation medium consists of: 60-100 g / L glucose, 8-16 g / L sodium citrate, 20-40 g / L sodium glutamate, 0.3-0.7 g / L dipotassium hydrogen phosphate, 0.3-0.7 g / L calcium chloride, 0.3-0.7 g / L magnesium sulfate, 0.003-0.005 g / L ferric chloride, 0.3-0.7 g / L manganese sulfate, and the remainder being water, with a natural pH.

Citation Information

Patent Citations

  • Method for producing ectoine with high yield by bacillus licheniformis for weakening phosphoenolpyruvate carboxykinase gene and application

    CN117402802A