A method for creating a double-tail phenotype by using a cytosine single-base editing system to inactivate a goldfish szla gene and application

Abstract

The application discloses a method for creating a double-tail phenotype by using a cytosine single-base editing system to inactivate a goldfish szla gene and application thereof; a target sequence corresponding to sgRNA in the cytosine single-base editing system is shown as SEQ ID NO:1, a guide sequence is shown as SEQ ID NO:4, and a skeleton sequence is shown as SEQ ID NO:5. The method comprises the following steps: (1) obtaining sgRNA of the cytosine single-base editing system; (2) introducing the cytosine single-base editing system; and (3) performing phenotype analysis. The application has the advantages of precise target selection, clear editing result, predictable mutation type, convenient molecular detection and high phenotype induction efficiency, and can be used for precise creation of double-tail goldfish, development function research of a goldfish tail fin and molecular design breeding of ornamental fish.

Description

Technical Field

[0001] This invention relates to the field of gene editing, and in particular to a method for creating a double-tailed phenotype by site-specific inactivation of the goldfish szla gene using a cytosine single-base editing system. Background Technology

[0002] The double-tailed trait is one of the important phenotypic traits that distinguishes goldfish from ordinary crucian carp and determines their ornamental value. It has significant application value in the breeding of new goldfish varieties and the stable inheritance of traits. However, in the traditional goldfish breeding process, although the double-tailed trait can be obtained through artificial selection and population selection, its genetic stability is still somewhat insufficient. The single-tailed trait often reverts to its ancestral form in offspring populations, leading to segregation of the double-tailed phenotype, a decrease in the rate of high-quality products, and seriously affecting the purification, large-scale breeding, and commercial application of goldfish varieties.

[0003] In recent years, CRISPR / Cas9 gene editing technology has provided a new technical means for improving target traits in fish. However, traditional CRISPR / Cas9 mainly relies on DNA double-strand breaks and non-homologous end joining repair to generate insertion or deletion mutations. The mutation types are random, the editing results are not accurately predictable, and it is easy to produce indels of different lengths, chimeric mutations, or unexpected mutations, making it difficult to achieve precise and controllable modification of specific bases or specific codons. Therefore, there is an urgent need to establish a gene editing method that can achieve site-specific, controllable, and detectable base substitutions in the genes regulating key traits in goldfish, in order to improve the efficiency of trait creation and the accuracy of genetic improvement.

[0004] While cytosine single-base editors (CBEs) can achieve C→T base substitutions, their effective editing window is limited, and multiple editable Cs often exist in the target sequence, making bystander editing likely. Furthermore, not every single-base mutation leads to a definite phenotype, especially in polyploid species like goldfish that undergo whole-genome duplication, exhibit homologous gene redundancy, and have complex genetic backgrounds; a single base substitution often fails to directly produce observable morphological traits. Therefore, identifying precise targets within goldfish genes that are both within the effective editing window of CBEs and capable of inducing functional disruption and stable, observable phenotypes through a single C→T substitution remains a critical challenge that current technologies have not yet solved. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide a method and application for creating a double-tailed phenotype by site-specific inactivation of the goldfish szla gene using a cytosine single-base editing system, so as to achieve site-specific, controllable and detectable base substitution in the goldfish single and double tail regulatory gene szla, thereby improving the efficiency of double-tailed phenotype creation and the accuracy of genetic improvement.

[0006] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides an sgRNA, wherein the sgRNA is an sgRNA of a cytosine single-base editing system, and the cytosine single-base editing system is used to site-specifically inactivate the goldfish szla gene to create a goldfish double-tailed phenotype;

[0008] The target sequence corresponding to the sgRNA is located on the third exon of the goldfish szla gene, and the target sequence is shown in SEQ ID NO:1; the guide sequence of the sgRNA is shown in SEQ ID NO:4; and the backbone sequence of the sgRNA is shown in SEQ ID NO:5.

[0009] Secondly, the present invention provides a cytosine single-base editing system for site-specific inactivation of the goldfish szla gene to create a goldfish double-tailed phenotype, wherein the cytosine single-base editing system includes the aforementioned sgRNA.

[0010] Furthermore, it also includes a CBE fusion protein or mRNA encoding a CBE fusion protein; the CBE fusion protein is BS-EP1, and its editing window is located at positions 3-12 upstream of the PAM sequence, wherein the PAM sequence is NGG.

[0011] Thirdly, the present invention also provides an application of the above-mentioned sgRNA as an sgRNA of a cytosine single-base editing system, used to site-directedly inactivate the goldfish szla gene to create a goldfish double-tailed phenotype.

[0012] The target sequence corresponding to the sgRNA is located on the third exon of the goldfish szla gene, and the target sequence is shown in SEQ ID NO:1.

[0013] Fourthly, the present invention also provides an application of the above-mentioned cytosine single-base editing system for site-specific inactivation of the goldfish szla gene to create a goldfish double-tailed phenotype;

[0014] The target sequence corresponding to the sgRNA is located on the third exon of the goldfish szla gene, and the target sequence is shown in SEQ ID NO:1.

[0015] Fifthly, the present invention also provides a method for creating a double-tailed phenotype by site-specific inactivation of the goldfish szla gene using a cytosine single-base editing system, comprising:

[0016] (1) Obtaining the sgRNA of the cytosine single-base editing system: The target sequence corresponding to the sgRNA is located on the third exon of the goldfish szla gene, and the target sequence is shown in SEQ ID NO:1; the guide sequence of the sgRNA is shown in SEQ ID NO:4; the backbone sequence of the sgRNA is shown in SEQ ID NO:5;

[0017] (2) Introduction of cytosine single base editing system: The complex of the CBE fusion protein of the cytosine single base editing system and sgRNA, namely the RNP complex, was introduced into the fertilized egg of goldfish in the one-cell stage by microinjection;

[0018] (3) Phenotypic analysis: Analyze the tail fin phenotype of juvenile fish to obtain goldfish with double tail phenotype.

[0019] Furthermore, the CBE fusion protein is BS-EP1, and its editing window is located at positions 3-12 upstream of the PAM sequence, which is NGG.

[0020] Furthermore, in (2):

[0021] The concentration of the RNP complex was 300 ng / ul, and the injection volume was 5 nl / embryo.

[0022] Furthermore, in (2), the injection time is between 20 and 40 minutes after fertilization.

[0023] Furthermore, prior to phenotypic analysis (3), edit result detection is also included, which includes:

[0024] The injected embryos were placed in water for incubation.

[0025] DNA was extracted from the injected embryos.

[0026] Amplification was performed using amplification primers containing the target, the forward primer sequence of which is shown in SEQ ID NO:6 and the reverse primer sequence is shown in SEQ ID NO:7;

[0027] Then, sequencing analysis was performed to detect the effect of sequence editing.

[0028] By adopting the above technical solution, the present invention has at least the following advantages:

[0029] 1. High precision: This invention does not rely on random indels generated after Cas9 double-strand breaks, but instead directly induces a C→T single-base substitution at the target site through CBE, precisely changing the target codon of the szla gene from CAG to TAG. This mutation type is clearly defined, the molecular mechanism is clear, and it facilitates subsequent genotype detection and phenotypic association analysis.

[0030] 2. No donor template required: This invention does not rely on HDR donor templates and does not require homologous recombination repair, making it suitable for scenarios where HDR efficiency is low in early fish embryos.

[0031] 3. Can directly cause premature termination mutation: By changing CAG to TAG, this invention can directly form a stop codon in the szla coding region, causing the szla protein to terminate translation prematurely, thereby achieving the disruption of the target gene function.

[0032] 4. High phenotypic efficiency: After treating single-tailed goldfish embryos with this method, about 50% of the individuals can show the double-tailed phenotype, indicating that this method has high phenotypic induction efficiency and application value.

[0033] 5. Applicable to molecular design breeding of goldfish: This method can be used to rapidly create goldfish with double-tailed traits, shortening the traditional breeding cycle and reducing the problem of genetic background contamination in hybridization. In addition to breeding applications, this method can also serve as a functional verification tool for studying the role of the szla gene in goldfish tail fin development, body axis development, and the formation of single and double tail traits. Attached Figure Description

[0034] The above is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0035] Figure 1 This is a schematic diagram of the method for creating a double-tailed phenotype in goldfish using CBE-targeted editing of the szla gene in this invention.

[0036] Figure 2 This is a sequence analysis diagram of the control and edited individuals after CBE editing of the szla gene in this invention.

[0037] Figure 3 This is a phenotypic analysis diagram of the control and edited individuals after CBE editing of the szla gene in this invention;

[0038] Figure 4 This is a schematic diagram of the editing window and PAM site of the CBE fusion protein in one embodiment of the present invention. Detailed Implementation

[0039] Exemplary embodiments of the invention will now be described in more detail with reference to the accompanying drawings. While exemplary embodiments of the invention are shown in the drawings, it should be understood that the invention may be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that a more thorough understanding of the invention will be achieved and that the full scope of the invention will be conveyed to those skilled in the art.

[0040] This invention precisely screened and validated a single-base editing target with a clear functional effect in the goldfish single and double tail regulatory gene szla. The target is located in the third exon of the szla gene, with the target sequence: 5'-GTGTCAGAGCTGTCCGTCTG-3' (SEQ ID NO:1). The target cytosine is located within the effective editing window of CBE. A single C→T single-base substitution can change the target codon from CAG to the TAG stop codon, thereby causing premature termination of translation of the szla protein and disrupting its gene function. This design achieves a direct correspondence from "a single base change" to "the generation of a clear morphological phenotype," overcoming the problems of uncontrollable random indel mutations, complex mutation types, and difficulties in phenotypic prediction in traditional CRISPR / Cas9 methods.

[0041] It is important to note that goldfish differ from other species. As polyploids that undergo whole-genome duplication, exhibit homologous gene redundancy, and possess complex genetic backgrounds, changes to a single gene, single site, or single base are unlikely to produce significant and visible phenotypes. Therefore, current gene editing research in goldfish primarily focuses on the more mature CRISPR / Cas9 and CRISPR / Cas12a technologies. However, the aforementioned technical obstacles and difficulties have led those skilled in the art to adopt a wait-and-see attitude towards the application of cytosine single-base editors in goldfish phenotypic improvement. Even when applied to goldfish, in practice, due to the aforementioned reasons, it is often impossible to obtain the desired phenotype after numerous experiments. Furthermore, the target gene sequence in goldfish often contains multiple editable Cs, making bystander editing likely and preventing targeted, controlled editing.

[0042] This invention, through extensive experimental research, selected the szla gene and, through specific target design, induced a double-tailed phenotype in single-tailed goldfish by a key C→T substitution within the szla gene, achieving a double-tailed phenotype acquisition rate of approximately 50%, indicating that this target has strong functional sensitivity and phenotypic transformation efficiency. Unlike conventional gene editing that randomly destroys target genes, this invention offers advantages such as precise target selection, clear editing results, predictable mutation types, convenient molecular detection, and high phenotypic induction efficiency. It can be used for the precise creation of double-tailed goldfish, research on the developmental function of goldfish tail fins, and molecular design breeding of ornamental fish.

[0043] This embodiment provides a method and application for creating a double-tailed phenotype in goldfish by point-inactivating the szla gene using a cytosine single-base editing system, such as... Figure 1 As shown, it includes;

[0044] 1. Target design and synthesis:

[0045] Based on the szla gene coding sequence, CBE target sites capable of converting the target codon CAG to the stop codon TAG were screened, taking into account codon translation characteristics and the specificity of the editing window. Based on these targets, sgRNAs for cytosine single-base editing systems were designed. The sgRNA sequence is complementary to the target sequence, thereby achieving guided localization. It should be noted that to increase sequence stability, terminal modifications can be added during synthesis at the company.

[0046] Through extensive screening, this invention ultimately selected three target sequences: szla-1:GTGTCAGAGCTGTCCGTCTG (SEQ ID NO:1); szla-2: GCCGCAGATGAGCGTCTGCC (SEQ ID NO:2); and szla-3: GGGCCAGGCGTGTCCATGAC (SEQ ID NO:3). All of these targets meet the following criteria: they are located in the coding region of the szla gene, specifically in an exon; they contain a codon that can be transformed into a stop codon through C→T editing; the target cytosine C is located within the effective editing window of CBE; and the target C→T substitution can lead to the transformation of an amino acid-coding codon into a stop codon. It is important to note that the target design should minimize interference with non-target functional sites to facilitate subsequent genotype-phenotype correspondence analysis, although this aspect cannot be directly predicted.

[0047] The sgRNA includes a guide sequence (a 20 nt spacer, determined by the target sequence) and a backbone sequence (scaffold structure, Cas9 binding backbone).

[0048] For example, sgRNAs designed for szla-1:

[0049] The initiating sequence is: CAGACGGACAGCTCTGACAC (SEQ ID NO:4);

[0050] The skeleton sequence is:

[0051] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT (SEQ ID NO: 5).

[0052] The backbone sequences of the sgRNAs designed for szla-2 and szla-3 are the same as those for szla-1.

[0053] 2. Introduction of the cytosine single-base editing system: The cytosine single-base editing system includes a CBE fusion protein or mRNA encoding the CBE fusion protein and sgRNA. The core component of the CBE editing system, the CBE fusion protein / sgRNA complex, i.e., the RNP complex (300 ng / ul), is introduced into goldfish embryos (one-cell stage fertilized eggs of goldfish) via microinjection. The injection volume is 5 nmol / embryo, and the injection time is between 20-40 minutes after fertilization.

[0054] The CBE fusion protein is BS-EP1 (a commercially available protein), and its edit window is located at positions 3-12 upstream of the PAM sequence. The PAM sequence is NGG. Figure 4 As shown.

[0055] 3. Editing Result Detection: Incubated embryos were placed in water at 23°C and fed live brine shrimp once a day, with water quality controlled simultaneously. DNA was extracted from the injected embryos using the PK enzyme lysis method. The specific steps were as follows: 20 μL of DNA extraction solution was placed per embryo and incubated at 100°C for 5 min in a PCR instrument; then cooled on ice for 2 min, 1 μL of PK enzyme was added, centrifuged, and incubated at 55°C for 2 h; then at 100°C for 5 min, followed by incubation at 4°C until ∞. 15 μL of the supernatant was used as the DNA working solution. Amplification primers containing the target were designed (forward primer F: TCCAGTCAAACTCAATGTATTCAGC; reverse primer R: GAAGTCACTAAACCCCATTTGGAAA, SEQ ID NO: 6, 7). PCR amplification was performed using 3G Taq Master Mix enzyme. Amplification was performed using forPAGE, and the sequences were sent to the company for Sanger sequencing analysis to test the sequence editing efficiency. The results showed that only the szla-1 target site could induce precise substitution of the target base; the other two target sites, although meeting the CBE editing conditions, could not induce the editing of the target base. The effective target sequence is: GGTCAGAGCTGTCCGTCTG (SEQ ID NO:1), with the target base "CAG" replaced by "TAG" (e.g., ...). Figure 2 (As shown).

[0056] This invention fully considers the editing window characteristics of CBE during the target design stage, designing the target cytosine C within the efficient editing window of CBE, enabling the C site to be site-specifically deaminated and ultimately converted to T. This target C is located at the first base of the CAG codon in the third exon of the szla gene. After editing, the CAG codon originally encoding glutamine can be directly converted to the stop codon TAG, thereby causing premature termination of translation of the szla protein and disrupting its function.

[0057] 4. Phenotypic Analysis: After the fry have developed for 2 weeks, the tail fin phenotype of the juvenile fish is photographed and analyzed using a stereomicroscope. The phenotypic rate of the double-tailed phenotype is also counted. The szla-1 target can cause single-tailed goldfish to transform into double-tailed goldfish, and the phenotypic rate is approximately 50% (e.g., Figure 3 (As shown).

[0058] In summary, this invention does not simply apply a mature CBE editing system to goldfish. Instead, based on the characteristics of the CBE editing window and the coding sequence of the szla gene, it precisely designs a target site capable of generating a stop codon through a single target cytosine C→T substitution. This target site is located in the third exon of the goldfish szla gene, with the target C within the effective CBE editing window. After editing, the CAG codon is transformed into the TAG stop codon, causing premature termination of translation of the szla protein and disrupting its function. Because goldfish exhibit polyploidy and homologous gene redundancy, a single base substitution typically fails to produce a significant morphological phenotype. However, the target site described in this invention, after CBE editing, can induce a double-tailed phenotype in approximately 50% of individuals, indicating that this target site has significant functional sensitivity and application value. This invention overcomes the problems of reversion to ancestral traits in double-tailed goldfish, uncontrollable random indels in CRISPR / Cas9, and uncertain phenotypic effects of single-base mutations in polyploid species in traditional breeding, and provides a new technical solution for the precise creation of double-tailed goldfish, the study of goldfish tail fin development function, and molecular design breeding of ornamental fish.

[0059] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, equivalent changes, or alterations made by those skilled in the art using the disclosed technical content shall fall within the protection scope of the present invention.

Claims

1. An sgRNA, characterized in that, The sgRNA is the sgRNA of the cytosine single-base editing system, which is used to site-specifically inactivate the goldfish szla gene to create the goldfish double-tail phenotype; The target sequence corresponding to the sgRNA is located on the third exon of the goldfish szla gene, and the target sequence is shown in SEQ ID NO:1; The guide sequence of the sgRNA is shown in SEQ ID NO:4; the backbone sequence of the sgRNA is shown in SEQ ID NO:

5.

2. A cytosine single-base editing system, characterized in that, The cytosine single-base editing system used for site-directed inactivation of the goldfish szla gene to create a goldfish double-tailed phenotype includes the sgRNA as described in claim 1.

3. The cytosine single-base editing system according to claim 2, characterized in that, It also includes CBE fusion proteins or mRNA encoding CBE fusion proteins; The CBE fusion protein is BS-EP1, and its editing window is located at positions 3-12 upstream of the PAM sequence, which is NGG.

4. An application of the sgRNA according to claim 1, characterized in that, sgRNA, as a cytosine single-base editing system, is used to site-directedly inactivate the goldfish szla gene to create the goldfish double-tailed phenotype. The target sequence corresponding to the sgRNA is located on the third exon of the goldfish szla gene, and the target sequence is shown in SEQ ID NO:

1.

5. The application of the cytosine single-base editing system according to any one of claims 2-4, characterized in that, Used to inactivate the szla gene in goldfish at a specific location to create the double-tailed phenotype in goldfish; The target sequence corresponding to the sgRNA is located on the third exon of the goldfish szla gene, and the target sequence is shown in SEQ ID NO:

1.

6. A method for creating a double-tailed phenotype in goldfish by site-specific inactivation of the szla gene using a cytosine single-base editing system, characterized in that, include: (1) Obtaining the sgRNA of the cytosine single base editing system: The target sequence corresponding to the sgRNA is located on the third exon of the goldfish szla gene, and the target sequence is shown in SEQ ID NO:1; the guide sequence of the sgRNA is shown in SEQ ID NO:4; the backbone sequence of the sgRNA is shown in SEQ ID NO:5; (2) Introduction of cytosine single base editing system: The complex of the CBE fusion protein of the cytosine single base editing system and sgRNA, namely the RNP complex, was introduced into the fertilized egg of goldfish in the one-cell stage by microinjection; (3) Phenotypic analysis: Analyze the tail fin phenotype of juvenile fish to obtain goldfish with double tail phenotype.

7. The method for creating a double-tailed phenotype in goldfish by site-specific inactivation of the szla gene using a cytosine single-base editing system according to claim 6, characterized in that, The CBE fusion protein is BS-EP1, and its editing window is located at positions 3-12 upstream of the PAM sequence, which is NGG.

8. The method for creating a double-tailed phenotype in goldfish by site-specific inactivation of the szla gene using a cytosine single-base editing system according to claim 6, characterized in that, In (2): The concentration of the RNP complex was 300 ng / ul, and the injection volume was 5 nl / embryo.

9. The method for creating a double-tailed phenotype in goldfish by site-specific inactivation of the szla gene using a cytosine single-base editing system according to claim 6, characterized in that, In (2), the injection time is between 20 and 40 minutes after fertilization.

10. The method for creating a double-tailed phenotype in goldfish by site-specific inactivation of the szla gene in goldfish using a cytosine single-base editing system according to claim 6, characterized in that, (3) Phenotypic analysis is preceded by edit result detection, which includes: The injected embryos were placed in water for incubation. DNA was extracted from the injected embryos. Amplification was performed using amplification primers containing the target, the forward primer sequence of which is shown in SEQ ID NO:6 and the reverse primer sequence is shown in SEQ ID NO:7; Then, sequencing analysis was performed to detect the effect of sequence editing.

Images