Peptide mixture from peas with calcium binding and osteogenesis promoting effect and use thereof

Abstract

The application discloses a pea peptide mixture with calcium binding and osteogenesis promoting effects and application thereof, wherein the pea peptide mixture is derived from protein components in a by-product of pea starch extraction, is obtained through alkaline protease and papain enzymolysis and separation and purification, and is rich in aspartic acid and glutamic acid residues. The pea peptide mixture can effectively bind with calcium ions, the pea peptide mixture can promote calcium ion delivery in osteoblasts, improve alkaline phosphatase activity, and promote osteoblast differentiation, the osteogenesis promoting effect of the pea peptide mixture is related to epidermal growth factor receptor EGFR and downstream PI3K-Akt signal pathway regulation. The pea peptide mixture can improve glucocorticoid-induced zebrafish bone mass reduction, and up-regulate mRNA expression levels of ALP, EGFR, PI3K and Akt and other genes related to osteogenesis. The pea peptide mixture has both functions and nutrition, can be used for preparing products for promoting osteogenesis, improving bone mass, improving bone mass reduction and assisting in improving osteoporosis, and has a wide application prospect in the field of bone health.

Description

Technical Field

[0001] This invention belongs to the field of bioactive peptides and their product application technology, specifically relating to a mixture of pea peptides with calcium binding and osteogenic promotion effects and its applications. Background Technology

[0002] Osteoporosis is a metabolic bone disease characterized by decreased bone mass, impaired bone microstructure, and reduced bone strength, significantly increasing the risk of fractures. Maintaining bone homeostasis depends on a dynamic balance between bone resorption and bone formation, with osteoblast-mediated new bone formation playing a crucial role in maintaining bone mass and strength. Insufficient bone formation or increased bone resorption easily leads to bone loss and an imbalance in bone metabolism, subsequently causing bone health problems such as osteoporosis.

[0003] Currently, bone health interventions mainly rely on exogenous calcium supplementation, vitamin D supplementation, and anti-osteoporosis drug therapy. Calcium is an essential raw material for bone matrix mineralization and new bone formation, and an adequate calcium supply is crucial for maintaining bone homeostasis. However, traditional calcium supplements generally suffer from limited bioavailability, insufficient tissue or cellular utilization efficiency, and weak delivery capacity to osteoblasts, often requiring high doses or long-term supplementation, thus affecting their actual intervention effects. Furthermore, while some anti-osteoporosis drugs can improve bone density to some extent, long-term use may be accompanied by gastrointestinal discomfort or other adverse reactions, limiting their further application.

[0004] In recent years, bioactive peptides derived from food proteins have attracted widespread attention due to their wide availability, good biocompatibility, high safety, and tunable structure. Pea protein, in particular, is an important source of plant protein, boasting advantages such as abundant resources, high nutritional value, and suitability for enzymatic hydrolysis to prepare bioactive peptides. Pea peptide mixtures obtained from pea protein hydrolysis typically have small molecular weights and readily accumulate specific bioactive amino acid residues, thus showing promising applications in mineral binding and functional food development. However, current research on pea peptides focuses primarily on general nutritional function evaluation, while systematic studies on whether pea peptide mixtures rich in acidic amino acid residues possess strong calcium-binding capacity, can promote calcium utilization by osteoblasts, and exhibit clear osteogenic activity remain lacking.

[0005] Furthermore, existing research on bioactive peptides largely focuses on their calcium chelating or bone affinity properties, while understanding of their interactions with osteoblast membrane receptors and downstream signal transduction processes remains limited. Particularly for plant-derived peptide mixtures, their calcium ion delivery at the osteoblast level, their role in regulating osteogenic differentiation, and the related molecular mechanisms are still unclear, which to some extent limits their further development and application in bone health products. Therefore, developing a pea peptide mixture with strong calcium-binding capacity that can promote calcium ion utilization in osteoblasts, promote osteogenic differentiation, and improve bone health remains a pressing technical problem to be solved in this field. Summary of the Invention

[0006] This invention provides a mixture of pea peptides with calcium binding and osteogenic promotion effects and its applications. The mixture of pea peptides can effectively bind to calcium ions and can further promote calcium ion delivery in osteoblasts, increase alkaline phosphatase activity, and promote osteoblast differentiation, thereby promoting bone formation, increasing bone mass, improving osteopenia, and assisting in the improvement of osteoporosis.

[0007] To achieve the above objectives, the present invention provides the following technical solution: a pea peptide mixture with calcium binding and osteogenic promotion effects, characterized in that: the pea peptide mixture is derived from the enzymatic hydrolysis product of protein components in pea starch extraction by-products; the pea peptide mixture contains one or both of aspartic acid residues and glutamic acid residues.

[0008] Preferably, the enzymatic hydrolysis product is obtained by a combined enzymatic hydrolysis process using alkaline protease and papain, and the pea peptide mixture is obtained after separation and purification following enzymatic hydrolysis.

[0009] Preferably, the separation and purification process includes flash evaporation to inactivate the enzyme after enzymatic hydrolysis, centrifugation, filtration, decolorization, nanofiltration, flash sterilization, spray drying, and screening.

[0010] Preferably, the flash sterilization temperature is 120℃-130℃.

[0011] This invention also provides the application of a mixture of pea peptides with calcium-binding and osteogenic properties in the preparation of products that improve bone health.

[0012] Preferably, the pea peptide mixture improves bone health by binding to calcium ions; the calcium ion binding site includes one or both of carboxyl oxygen atoms and amino nitrogen atoms.

[0013] Preferably, the pea peptide mixture, after binding with calcium ions, improves bone health through one or more of the following pathways: promoting calcium ion delivery within osteoblasts, increasing osteoblast alkaline phosphatase activity, and promoting osteoblast differentiation.

[0014] Preferably, the pea peptide mixture promotes improved bone health through regulation of the epidermal growth factor receptor EGFR and its downstream PI3K-Akt signaling pathway.

[0015] Preferably, the product that improves bone health includes one or more of the following products in combination: products that promote calcium ion delivery by osteoblasts, products that increase alkaline phosphatase activity, products that promote osteoblast differentiation, products that promote bone formation, products that increase bone mass, and products that improve osteopenia.

[0016] Preferably, the products that improve bone health include functional foods, health foods, nutritional supplements, foods for special medical purposes, or other pharmaceutically acceptable preparations.

[0017] Compared with the prior art, the beneficial effects of the present invention are: (1) By liquid chromatography-tandem mass spectrometry analysis and physicochemical characterization, it was confirmed that the pea peptide mixture is rich in aspartic acid and glutamic acid residues, has a strong calcium binding capacity, and its particle size, microstructure and related functional group characteristics change significantly after binding with calcium ions. (2) Through osteoblast calcium ion delivery experiment and alkaline phosphatase activity detection, it was confirmed at the cellular level that the pea peptide mixture can promote calcium ion delivery in MC3T3-E1 osteoblasts, increase alkaline phosphatase activity, and promote osteoblast differentiation. (3) Through transcriptome analysis, confocal localization and zebrafish experiments, it was revealed that the osteogenic effect of the pea peptide mixture is related to the regulation of EGFR and its downstream PI3K-Akt signaling pathway, and it was confirmed that it can improve the glucocorticoid-induced reduction in bone mass in zebrafish and restore the mRNA expression levels of osteogenic-related genes such as ALP, EGFR, PI3K and Akt. (4) Pea peptides are abundant and the acquisition steps are relatively simple. They can be obtained from the by-products of pea starch extraction through enzymatic hydrolysis and extraction steps. The production efficiency is high and it is conducive to large-scale production.

[0018] Other features and advantages of this disclosure will become clear from the following detailed description of exemplary embodiments with reference to the accompanying drawings. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments or related technologies of this disclosure, the accompanying drawings used in the description of the embodiments or related technologies will be briefly introduced below. Obviously, the accompanying drawings described below are only embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0020] Figure 1 A schematic diagram illustrating the calcium binding and delivery process of a mixture of pea peptides; Figure 2 This is a diagram showing the amino acid distribution in a mixture of pea peptides. Figure 3 The average particle size analysis diagrams of the pea peptide mixture and the pea peptide calcium complex are shown. Figure 4 This is a scanning electron microscope image of the pea peptide-calcium complex. Figure 5 The fluorescence emission spectrum of pea peptides after binding with calcium ions; Figure 6 The UV-Vis absorption spectrum of pea peptides after binding with calcium ions; Figure 7 The Fourier transform infrared spectrum of pea peptides after binding with calcium ions; Figure 8 Schematic diagram illustrating the role of pea peptide-calcium complex in promoting calcium ion delivery in MC3T3-E1 cells; Figure 9 The effect of the pea peptide mixture on alkaline phosphatase activity in MC3T3-E1 cells is shown in the figure. Figure 10 Figure showing the effect of pea peptide mixture on transcriptome expression in MC3T3-E1 cells; Figure 11 This is a colocalization map of the expression and immunofluorescence of the osteoblast membrane receptor protein EGFR by a mixture of pea peptides. Figure 12 Fluorescence imaging of the effect of pea peptide-calcium complex on reversing glucocorticoid-induced bone loss in zebrafish; Figure 13 A bar graph showing the effect of pea peptide-calcium complex on reversing glucocorticoid-induced bone loss in zebrafish. Figure 14 Figure showing the effect of pea peptide-calcium complex on ALP gene expression in a glucocorticoid-induced zebrafish model. Figure 15 Figure showing the effect of pea peptide-calcium complex on EGFR gene expression in a glucocorticoid-induced zebrafish model. Figure 16 Figure showing the effect of pea peptide-calcium complex on PI3K gene expression in a glucocorticoid-induced zebrafish model. Figure 17 The figure shows the effect of pea peptide-calcium complex on Akt gene expression in a glucocorticoid-induced zebrafish model. Detailed Implementation

[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the present invention or its application or use. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0022] Unless otherwise specifically stated, the relative arrangement, numerical expressions, and values ​​of the components and steps set forth in these embodiments do not limit the scope of the invention. It should also be understood that, for ease of description, the dimensions of the various parts shown in the drawings are not drawn to actual scale. Techniques, methods, and devices known to those skilled in the art may not be discussed in detail, but where appropriate, such techniques, methods, and devices should be considered part of the specification. In all examples shown and discussed herein, any specific values ​​should be interpreted as merely exemplary and not as limitations. Therefore, other examples of exemplary embodiments may have different values. It should be noted that similar reference numerals and letters in the following figures denote similar items; therefore, once an item is defined in one figure, it need not be further discussed in subsequent figures.

[0023] Please see Figure 1-17 The present invention provides a technical solution: A mixture of pea peptides with calcium-binding and osteogenic promoting effects and its applications. The pea peptide mixture is derived from the protein components of pea starch extraction byproducts. It is obtained by enzymatic hydrolysis and purification using alkaline protease and papain. It is rich in aspartic acid and glutamic acid residues, which can effectively bind to calcium ions and further promote calcium ion delivery in osteoblasts, increase alkaline phosphatase activity, and promote osteoblast differentiation. Therefore, it can be used to promote bone formation, increase bone mass, improve osteopenia, and assist in the improvement of osteoporosis.

[0024] The pea peptides of this invention are the protein components remaining after pea starch extraction. These components are hydrolyzed using a complex enzyme, followed by flash evaporation to inactivate the enzyme, centrifugation, filtration, decolorization, nanofiltration, flash sterilization, spray drying, and screening to obtain a pea peptide mixture. Flash sterilization is a key controlled step, with a temperature of 120℃-130℃.

[0025] The application of the pea peptide mixture provided by this invention in promoting osteogenic formation is for non-therapeutic purposes; liquid chromatography-tandem mass spectrometry analysis shows that its main components are polypeptides containing aspartic acid and / or glutamic acid residues, and have calcium binding capacity.

[0026] See Figure 1The pea peptide mixture of the present invention has the ability to bind to calcium ions, and the binding sites include carboxyl oxygen atoms and / or amino nitrogen atoms. After binding to calcium ions, the particle size, microstructure, and related functional group characteristics of the pea peptide mixture undergo significant changes. The application of the pea peptide mixture of the present invention in promoting calcium ion delivery in osteoblasts is for non-therapeutic purposes. The pea peptide mixture can promote calcium ion delivery in MC3T3-E1 osteoblasts and improve the utilization efficiency of calcium ions by osteoblasts.

[0027] This invention provides the use of a mixture of pea peptides in the preparation of formulations that promote calcium ion delivery to osteoblasts. The pea peptide mixture exerts its osteogenic-promoting effects by enhancing calcium ion utilization in osteoblasts through promoting intracellular calcium ion delivery.

[0028] This invention provides the application of a mixture of pea peptides in promoting osteoblast differentiation, for non-therapeutic purposes. The pea peptide mixture can increase the alkaline phosphatase activity of MC3T3-E1 osteoblasts, thereby promoting osteoblast differentiation. The pea peptide mixture can enhance osteogenic-related phenotypes. The invention also includes the application of the pea peptide mixture in the preparation of reagents promoting osteoblast differentiation. The pea peptide mixture can increase the alkaline phosphatase activity of MC3T3-E1 osteoblasts and promote osteoblast differentiation.

[0029] This invention provides the use of a pea peptide mixture in promoting bone formation and / or improving osteopenia for non-therapeutic purposes. The pea peptide mixture can improve glucocorticoid-induced osteopenia in zebrafish. The pea peptide mixture can restore the mRNA expression levels of osteogenic-related genes such as ALP, EGFR, PI3K, and Akt. The pea peptide mixture is also used in the preparation of products that promote bone formation and / or improve osteopenia. The products can be used to increase bone mass, improve bone health, and / or assist in the improvement of osteoporosis; the products can be functional foods, health foods, nutritional supplements, foods for special medical purposes, or pharmaceutically acceptable formulations.

[0030] The application of the pea peptide mixture in regulating the epidermal growth factor receptor (EGFR) and its downstream PI3K-Akt signaling pathway is for non-therapeutic purposes. The pea peptide mixture can interact with the osteoblast membrane protein EGFR and regulate the PI3K-Akt signaling pathway, thereby promoting osteogenic-related biological effects.

[0031] In this invention, MC3T3-E1 osteogenic progenitor cells were selected as the in vitro experimental system to evaluate the calcium-binding osteogenic activity of the pea peptide mixture; simultaneously, a glucocorticoid-induced zebrafish osteopenia model was selected as the in vivo experimental model to evaluate the effect of the pea peptide mixture in improving osteopenia. The following examples illustrate the study of the compositional characteristics, calcium-binding capacity, osteoblast calcium ion delivery capacity, osteogenic differentiation promotion effect, and related molecular mechanisms of the pea peptide mixture: Example 1: Preparation of pea peptide mixture.

[0032] Using protein components from pea starch extraction byproducts as raw materials, alkaline protease and papain were added at a ratio of 5% (w / w) for enzymatic hydrolysis at 37℃ for 2 hours. After hydrolysis, the enzymes were inactivated by flash evaporation at 120-130℃ for 15 seconds, followed by centrifugation at 10,000 rpm / min, leaf filtration, decolorization with activated carbon, nanofiltration through a 2 nm membrane, flash sterilization, spray drying, and screening through an 80-mesh sieve to obtain a pea peptide mixture. Flash sterilization is the key control step in this process, with a temperature of 120℃-130℃.

[0033] Example 2: Composition analysis of pea peptide mixture.

[0034] Accurately weigh the pea peptide sample obtained in Example 1 above, mix it with dithiothreitol solution to a final concentration of 10 mg / mL, and shake in a water bath at 50°C for 1 h. Then add iodoacetamide to a final concentration of 50 mg / mL, and react in the dark for 40 min. After desalting the sample using a C18 column, concentrate it by vacuum centrifugation at 45°C. Finally, perform sequence analysis of the pea peptide mixture using liquid chromatography-tandem mass spectrometry. The results are as follows: Figure 2 As shown, the pea peptide mixture is rich in aspartic acid and glutamic acid residues, suggesting that it has strong calcium-binding potential and a basis for further development as a bone health-related active ingredient.

[0035] Example 3: Preparation of pea peptide-calcium ion binding system and analysis of calcium binding capacity.

[0036] After reacting the pea peptide mixture with calcium ions, the calcium content and particle size were determined. Figure 3 ), Scanning electron microscope ( Figure 4 ), fluorescence spectrum ( Figure 5 ), UV-Vis absorption spectrum ( Figure 6 ) and Fourier transform infrared spectroscopy ( Figure 7 The mixture of pea peptides was characterized using the following method. It was observed that the mixture could effectively bind to calcium ions, and that significant changes occurred in particle size, microstructure, and related functional group characteristics after binding, indicating that it possesses a clear calcium-binding capacity.

[0037] Example 4: Effect of pea peptide mixture on promoting calcium ion delivery in osteoblasts.

[0038] After MC3T3-E1 cells were seeded and cultured, a calcium ion control group and treatment groups with different concentrations (2, 4, 8 mg / mL) of pea peptide-calcium complex were set up. The fluorescence intensity of intracellular calcium ions was detected using the Fluo-8AM fluorescent probe to evaluate the ability of the pea peptide-calcium complex to promote calcium ion delivery in osteoblasts. Results are as follows: Figure 8 As shown, the pea peptide-calcium complex can enhance the intracellular calcium ion fluorescence signal in MC3T3-E1 cells, and the enhancement trend is increasing with the increase of treatment concentration, indicating that the pea peptide-calcium complex can promote intracellular calcium ion delivery in osteoblasts and improve the utilization efficiency of calcium ions by osteoblasts.

[0039] Example 5: Effect of pea peptide mixture on osteoblast differentiation.

[0040] Osteoblast differentiation was induced using differentiation medium. Under serum-free conditions, osteoblasts were co-incubated with 1, 10, and 100 μg / mL pea peptides for 72 h. Alkaline phosphatase activity was then measured using an ALP kit to evaluate the effect of the pea peptide mixture on osteoblast differentiation. Results are as follows: Figure 9 As shown, the pea peptide mixture can significantly increase the activity of ALP in osteoblasts, and the effect increases with increasing dosage, indicating that the pea peptide mixture has the effect of promoting osteoblast differentiation.

[0041] Example 6: Effects of pea peptide mixtures on osteogenic signaling pathways.

[0042] Pea peptides were co-cultured with MC3T3-E1 cells for 72 h, and total RNA was extracted for transcriptome sequencing analysis. Results are shown below. Figure 10 After treatment with the pea peptide mixture, differentially expressed genes were significantly enriched in pathways closely related to osteogenic formation, such as the PI3K-Akt signaling pathway and EGFR tyrosine kinase inhibitor resistance. These results indicate that the osteogenic effect of the pea peptide mixture is related to the regulation of EGFR and its downstream PI3K-Akt signaling pathway.

[0043] Example 7: Effect of pea peptide on osteoblast membrane receptor protein EGFR.

[0044] Pea peptides were co-cultured with osteoblasts, and the interaction between the pea peptide mixture and the osteoblast membrane protein EGFR was examined by immunofluorescence confocal microscopy. An EGFR inhibitor intervention group was included for comparison. Results are shown below. Figure 11The figure shows that treatment with pea peptide mixture (1, 10, 100 μg / mL) for 72 h increased the significant co-localization of pea peptide mixture with EGFR, and the promoting effect was dose-dependent, that is, as the dose increased, the fluorescence intensity of EGFR increased significantly, and EGFR inhibitors could weaken this related effect.

[0045] Example 8: The effect of pea peptide calcium complex on improving reduced bone mass in zebrafish.

[0046] A glucocorticoid-induced zebrafish bone loss model was established using prednisolone induction. Control, model, and positive control groups, as well as treatment groups with different concentrations (20, 40, 80 μg / mL) of pea peptide-calcium complex, were included for 7 days. After treatment, calcein staining and fluorescence imaging were used to evaluate zebrafish bone formation. The fluorescence imaging and bar chart results are shown below. Figure 12 and Figure 13 As shown, the pea peptide-calcium complex can significantly improve glucocorticoid-induced osteopenia in zebrafish, increase bone fluorescence intensity, and exhibit a certain concentration-dependent relationship, indicating that it has the effect of improving osteopenia and promoting bone formation.

[0047] Example 9: Effects of pea peptide-calcium complex on the expression of osteogenic genes in zebrafish.

[0048] A glucocorticoid-related osteopenia model was established in zebrafish using prednisolone induction. Three-day-fed zebrafish juveniles were selected, and control, model, positive control, and treatment groups with different concentrations (20, 40, 80 μg / mL) of pea peptide-calcium complex were set up and incubated for 7 days. The mRNA expression levels of ALP, EGFR, PI3K, and Akt were detected using real-time quantitative PCR after calibration with the internal reference gene β-actin. The primer sequences used were: β-actin: Forward ACATCAGCATGGCTTCTGCT, Reverse GAAGTCCTCTCGGGGAAAGC; EGFR: Forward CTCTTGGAGTGGCCGTTCTC, Reverse TCAGAGGCTCCACAAGCTCT; PI3K: Forward TGTGAAGCACTCAAGCAGTCA, Reverse ATCACCGAGGCAGAAAGACG; AKT: Forward CACAAAGTCCCGCACCAAAG, Reverse GTGCAACTTCGTCCTTAGCG; ALP: Forward CTCGACTAGAGAGCAGCACG, Reverse TCAGCCTGCGTTTACGGATT.

[0049] The results are as follows Figure 14-17 As shown, in a glucocorticoid-induced osteopenia model, ALP ( Figure 14 EGFR Figure 15 ), PI3K ( Figure 16 ) and Akt ( Figure 17 The expression of these genes was suppressed, but treatment with the pea peptide-calcium complex restored the mRNA expression levels of these genes, indicating that the pea peptide mixture, after binding with calcium ions, can not only improve the osteopenia phenotype, but also regulate the molecular signaling pathways related to osteogenesis.

[0050] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A mixture of pea peptides with calcium-binding and osteogenic effects, characterized in that: The pea peptide mixture is derived from the enzymatic hydrolysis product of protein components in pea starch extraction byproducts; the pea peptide mixture contains one or both of aspartic acid residues and glutamic acid residues.

2. The pea peptide mixture with calcium binding and osteogenic promotion effects according to claim 1, characterized in that: The enzymatic hydrolysis product was obtained by a combined enzymatic hydrolysis process using alkaline protease and papain. After enzymatic hydrolysis, the product was separated and purified to obtain a mixture of pea peptides.

3. The pea peptide mixture with calcium binding and osteogenic promotion effects according to claim 2, characterized in that: The separation and purification process includes flash evaporation to inactivate enzymes after enzymatic hydrolysis, centrifugation, filtration, decolorization, nanofiltration, flash sterilization, spray drying, and screening.

4. The pea peptide mixture with calcium binding and osteogenic promoting effects according to claim 3, characterized in that: The flash sterilization temperature is 120℃-130℃.

5. The use of a mixture of pea peptides as described in any one of claims 1-4, which has calcium-binding and osteogenic effects, in the preparation of products that improve bone health.

6. The application according to claim 5, characterized in that: The pea peptide mixture improves bone health by binding to calcium ions; the calcium ion binding sites include one or both of carboxyl oxygen atoms and amino nitrogen atoms.

7. The application according to claim 6, characterized in that: The pea peptide mixture, after binding with calcium ions, improves bone health through one or more of the following pathways: promoting calcium ion delivery within osteoblasts, increasing alkaline phosphatase activity in osteoblasts, and promoting osteoblast differentiation.

8. The application according to claim 7, characterized in that: The pea peptide mixture promotes improved bone health through regulation of the epidermal growth factor receptor EGFR and its downstream PI3K-Akt signaling pathway.

9. The application according to claim 5, characterized in that: The products that improve bone health include one or more of the following products in combination: products that promote calcium ion delivery by osteoblasts, products that increase alkaline phosphatase activity, products that promote osteoblast differentiation, products that promote bone formation, products that increase bone mass, and products that improve osteopenia.

10. The application according to claim 5, characterized in that: The products that improve bone health include functional foods, health foods, nutritional supplements, foods for special medical purposes, or other pharmaceutically acceptable preparations.

Images