Recombinant reverse transcriptase with improved processivity

Abstract

The present disclosure provides a recombinant reverse transcriptase with improved sustained synthesis capability and uses thereof. In one embodiment, the recombinant reverse transcriptase is a fusion protein comprising a reverse transcriptase and a cold shock protein.

Description

[0001] sequence list

[0002] The sequence list is contained in a file named “088723-8001WO01”, which is 130,267 bytes in size (measured in Microsoft Windows), created on May 14, 2024, submitted electronically, and incorporated herein by reference.

[0003] Cross-references to related applications

[0004] This application claims priority to U.S. Provisional Application 63 / 615,793, filed December 29, 2023, the disclosure of which is incorporated herein by reference. Technical Field

[0005] This disclosure generally pertains to the field of molecular biology. Specifically, this disclosure relates to a recombinant reverse transcriptase with improved continuous synthetic capability. Background Technology

[0006] Reverse transcriptase (RT) is an enzyme that uses RNA as a template to generate complementary DNA (cDNA) through a process called reverse transcription. In nature, viruses use reverse transcriptase for genome replication, retrotransposons use it to multiply within the host genome, and eukaryotic cells use it to elongate telomeres at the ends of chromosomes. Reverse transcriptase is widely used in laboratories to convert RNA into DNA in molecular cloning, RNA sequencing, and reverse transcription polymerase chain reactions. Therefore, reverse transcriptase has become an indispensable tool in genetic research across various fields, including biology, medicine, and agriculture.

[0007] Cold shock proteins are found in various organisms, especially microorganisms, to cope with stress and adapt to changing environments, such as decreasing growth temperature, pH, and salt concentration. Cold shock proteins (Csp) are small proteins composed of 65-80 amino acid residues, and their traditionally proposed applications have been limited to their use as antifreeze proteins to prevent freezing or frost damage in agriculture.

[0008] Given the importance of reverse transcriptase, several approaches have been developed to improve its function. In recent years, mutants, fusion proteins, and protein mixtures have been created in pursuit of better performance, such as thermal stability, fidelity, and sustained synthesis capability. For example, sustained synthesis capability has been enhanced by mixing it with other nucleic acid-binding proteins, such as Ncp7, recA, SSB, T4gp32 (WO2000 / 055307A2), and cold shock protein (WO2009 / 108949A2). Despite these improvements in sustained synthesis capability of reverse transcription, synthesizing full-length cDNA from long RNA templates remains a challenge, and even today, the amount of cDNA synthesized may be insufficient in certain situations. Summary of the Invention

[0009] Improving the sustained synthetic capacity of reverse transcription remains a challenging topic requiring further development, and new methods need to be continuously explored to enhance the sustained synthetic capacity of reverse transcriptase. Given the limitations of the high sustained synthetic capacity of reverse transcriptase, there is a need in the art for improved RT compositions and methods to enhance existing technologies.

[0010] This disclosure provides fusion proteins containing Csp that improve sustained synthetic capabilities for improving DNA synthesis reactions, methods for synthesizing DNA using such fusion proteins, and kits for such methods. The fusion proteins, methods, and kits disclosed herein are intended to meet these and other needs.

[0011] On one hand, this disclosure provides a fusion protein with improved reverse transcription activity or sustained synthetic capability. In some embodiments, the fusion protein has improved reverse transcription activity or sustained synthetic capability compared to a protein without Csp fusion. In some embodiments, the fusion protein has improved sustained synthetic capability, capable of synthesizing long cDNA chains exceeding 15 kb. In some embodiments, the fusion protein is capable of synthesizing long cDNA chains at lower temperatures. In some embodiments, the fusion protein is capable of synthesizing long cDNA chains at temperatures not exceeding 50°C. In some embodiments, the fusion protein can synthesize long cDNA chains at temperatures not exceeding 42°C. In some embodiments, the fusion protein is capable of reverse transcription of secondary structure-rich RNA at lower temperatures. In some embodiments, the fusion protein is capable of reverse transcription of secondary structure-rich RNA at temperatures not exceeding 50°C. In some embodiments, the fusion protein is capable of reverse transcription of secondary structure-rich RNA at temperatures not exceeding 42°C.

[0012] In one aspect, the fusion protein comprises: a cold shock protein (Csp); and a reverse transcriptase (RT) operatively linked to Csp. In some embodiments, RT is linked to the N-terminus of Csp. In some embodiments, RT is linked to the C-terminus of Csp.

[0013] In some embodiments, Csp comprises a cold shock domain having at least one of two ribonucleoprotein (RNP) motifs (also known as nucleic acid binding motifs) RNP1 and RNP2. In some embodiments, RNP1 has the sequence X5-G-X6-G-X7-I (SEQ ID NO: 2), wherein X5 is K, R, S, D, E, N, Q, T, H, or Y; X6 is F, Y, W, L, V, A, I, M, H, R, or K; and X7 is F, Y, W, L, V, A, I, M, or H. In some embodiments, RNP2 has X8-X9-X 10 -X 11 -X 12 The sequence (SEQ ID NO: 3), wherein X8 is V, A, I, L, M, F or W; X9 is F, Y, W, H, Q, L, V, I, M or A; X 10 For A, I, L, M, F, V, or W; X 11 The numerators are H, Y, F, L, M, V, I, W, Q, or A; and X 12 It can be Y, W, L, F, M, V, I, Q, H, or A.

[0014] In some implementations, the cold shock domain contains at least one, two, three, four, or five motifs, which have a general formula selected from the group consisting of (1) G-X1-X2-K-X3-F-X4 (SEQ ID NO: 1), (2) X5-G-X6-G-X7-I (SEQ ID NO: 2), and (3) X8-X9-X 10 -X 11 -X 12 (SEQ ID NO: 3), (4)X 13 -X 14 -X 15 -X 16 -X 17 -X 18 -X 19 -X 20 -X 21 -X 22 -X 23 -X 24 -X 25 (SEQ ID NO: 4), or (5)X 26 -GX27 -X 28 -AX 29 -X 30 -X 31 (SEQ ID NO: 5), wherein: X1 is T, I, V, Q, N, L, K or R; X2 is V, I, L, A or G; X3 is F, T, Y, H, M or W; X4 is N, T, S or D; X5 is K, R, S, D, E, N, Q, T, H or Y; X6 is F, Y, W, L, V, A, I, M, H, R or K; X7 is F, Y, W, L, V, A, I, M or H; X8 is V, A, I, L, M, F or W; X9 is F, Y, W, H, Q, L, V, I, M or A; X 10 For A, I, L, M, F, V, or W; X 11 For H, Y, F, L, M, V, I, W, Q, or A; X 12 For Y, W, L, F, M, V, I, Q, H or A; X 13 For G, D, N, or E; X 14 For F, I, L, A, or Y; X 15 For K, P, Q, E, or R; X 16 For T, A, E, V, or S; X 17 For L, P, or I; X 18 For E, D, T, I, A, F, N, or K; X 19 For E, Q, T, P, A, or D; X 20 For G or N; X 21 For Q, M, T, L, E, or D; X 22 For K, R, N, E, S, Q, T, L, V, A, or I; X 23 For V or I; X 24 For E, S, T, or Q; X 25 For Y or F; X 26 For K or R; X 27 For P, L, N, Y, or A; X 28 For Q, K, S, T, A, or H; X 29 For A, V, T, S, G, R, or E; X 30 The denoted by X is N, E, K, V, C, R, H, G, D, or S; and X 31 It can be V, L, or I.

[0015] In some implementations, the cold shock domain has the following structure: G-X1-X2-K-X3-F-X4-X5-G-X6-G-X7-I-X8-X9-X 10 -X 11 -X 12 -X 13 -X 14 -X15 -X 16 -X 17 -X 18 -X 19 -X 20 -X 21 -X 22 -X 23 -X 24 -X 25 -X 26 -GX 27 -X 28 -AX 29 -X 30 -X 31 The sequence (SEQ ID NO: 6), wherein: X1 is T, I, V, Q, N, L, K, or R; X2 is V, L, A, G, or I; X3 is F, T, Y, H, M, or W; X4 is N, T, S, or D; X5 is K, R, S, D, E, N, Q, T, H, or Y; X6 is F, Y, W, L, V, A, I, M, H, R, or K; X7 is F, Y, W, L, V, A, I, M, or H; X8 is V, A, I, L, M, F, or W; X9 is F, Y, W, H, Q, L, V, I, M, or A; X 10 For A, I, L, M, F, V, or W; X 11 For H, Y, F, L, M, V, I, W, Q, or A; X 12 For Y, W, L, F, M, V, I, Q, H or A; X 13 For G, D, N, or E; X 14 For F, I, L, A, or Y; X 15 For K, P, Q, E, or R; X 16 For T, A, E, V, or S; X 17 For L, P, or I; X 18 For E, D, T, I, A, F, N, or K; X 19 For E, Q, T, P, A, or D; X 20 For G or N; X 21 For Q, M, T, L, E, or D; X 22 For K, R, N, E, S, Q, T, L, V, A, or I; X 23 For V or I; X 24 For E, S, T, or Q; X 25 For Y or F; X 26 For K or R; X 27 For P, L, N, Y, or A; X 28 For Q, K, S, T, A, or H; X 29 For A, V, T, S, G, R, or E; X 30 The denoted by X is N, E, K, V, C, R, H, G, D, or S; and X31 It can be V, L, or I.

[0016] In some implementations, Csp is selected from the group consisting of: CspA (ecCspA) derived from *Escherichia coli*, Csp2 (ttCsp2) derived from *Thermus thermophilus*, Csp1 (ttCsp1) derived from *Thermus thermophilus* (see Tanaka et al., FEBS J. 279(6):1014-29 (2012)), CspD (ecCspD) derived from *Escherichia coli*, CspH (ecCspH) derived from *Escherichia coli*, CspD (bbCspD) derived from *Bordetella bronchiseptica*, Csp (ahCsp) derived from *Actinomaduraharenae*, Csp (adCsp) derived from *Alicyclobacillus dauci*, and Csp (adCsp) derived from *Bacillus subtilis*. CspD (bsCspD) derived from *Mycobacterium tuberculosis* and CspA (mtCspA) derived from *Mycobacterium tuberculosis*. In some embodiments, Csp has an amino acid sequence selected from any of SEQ ID NOs: 7-39 or a sequence having at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with it.

[0017] In some embodiments, RT is selected from MMLV RT, AMV RT, HIV RT, WDSV RT, RSV RT, ASLV RT, REV-T RT, MAV RT, and RAV RT. In some embodiments, RT has an amino acid sequence selected from any of SEQ ID NOs: 40-48, or a sequence having at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with it and having reverse transcriptase activity.

[0018] In some embodiments, RT is an RT mutant. In some embodiments, RT is a mutant lacking RNase H activity. In some embodiments, RT is an MMLV mutant (MMLVmut) containing at least one mutation selected from the D524N, E562Q, D583N, or D653N sequence of SEQ ID NO: 40. In some embodiments, RT is a mutant with enhanced heat resistance. In some embodiments, RT is an MMLV mutant (MMLVmut) containing at least one mutation selected from the V129R, T197A, H204R, N249D, M289L, Q291I, T306K, F309N, W313F, Y344F, T420V, L435G, N454K, or A644P sequence of SEQ ID NO: 40. In some embodiments, RT is an MMLV mutant containing at least one mutation selected from the T197A, H204R, F309N, W313F, L435G and N454K mutations in the sequence SEQ ID NO: 40.

[0019] In some embodiments, RT is selected from the group consisting of DNA polymerases with reverse transcriptase activity. In some embodiments, RT is selected from the group consisting of: Tth DNA polymerase, Tfl DNA polymerase, Tfi DNA polymerase, Tma DNA polymerase, Tne DNA polymerase, Z05 DNA polymerase, JDF-3 DNA polymerase, Bst DNA polymerase, and Bca DNA polymerase. In some embodiments, RT has an amino acid sequence selected from any of SEQ ID NOs: 40-48 or a sequence having at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with it, and has reverse transcriptase activity.

[0020] In some embodiments, RT is connected to Csp via a adapter. In some embodiments, the adapter has an amino acid sequence selected from G, PG, GSG, or SEQ ID NOs: 49-59.

[0021] In some embodiments, the fusion protein disclosed herein has an amino acid sequence selected from any one of SEQ ID NOs: 78-83, 86-92, 94, 96, 98-100 or a sequence having at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with it.

[0022] In some implementations, the fusion protein exhibits improved reverse transcription and sustained synthetic activity.

[0023] On the other hand, this disclosure provides polynucleotides encoding the fusion proteins disclosed herein.

[0024] On the other hand, this disclosure provides vectors containing the polynucleotides disclosed herein.

[0025] On the other hand, this disclosure provides a recombinant host cell suitable for producing proteins, which contains the polynucleotides disclosed herein.

[0026] On the other hand, this disclosure provides a kit for reverse transcription reactions comprising the fusion protein described herein and a reaction buffer. In some embodiments, the kit further comprises primers.

[0027] On the other hand, this disclosure provides a method for synthesizing DNA. In one embodiment, the method comprises incubating the disclosed fusion protein with an RNA template and primers under conditions suitable for reverse transcription of the fusion protein, thereby synthesizing a DNA strand complementary to the RNA template. In some embodiments, the primers are oligo(dT) primers, random sequence primers, or combinations thereof. Attached Figure Description

[0028] The following figures form part of this specification and are used to further illustrate certain aspects of this disclosure. A better understanding of this disclosure can be achieved by referring to one or more of these figures in conjunction with the detailed description of specific embodiments provided herein.

[0029] Figure 1 The activity comparison between Bos6C1 and competing products is presented. First-strand reverse transcriptase cDNA synthesis activity was performed at 42°C for 15 minutes using λRNA molecular weight standards (1, 2, 3, 5, 7, 9, and 15 kb) or HCV RNA molecular weight standards (1, 2, 3, 5, 7, and 9 kb) as templates.

[0030] Figure 2This study compares the first-strand reverse transcriptase cDNA synthesis activity using λRNA molecular weight standards (1, 2, 3, 5, 7, 9, and 15 kb) as RNA templates, after incubation at 42°C for 15 minutes (left) and 30 minutes (right). The 15 kb cDNA of Bos6C1 is clearly visible after 30 minutes of reaction.

[0031] Figure 3 The study demonstrates a comparison of first-strand reverse transcriptase cDNA synthesis activity at 42°C for 15 minutes (left) and 30 minutes (right) using HCV RNA molecular weight standards (1, 2, 3, 5, 7, and 9 kb) as RNA templates. Bos6C1 outperformed its competitors.

[0032] Figure 4 The results demonstrate that adapter length does not affect ttCsp1-MMLVmut activity. First-strand reverse transcriptase cDNA synthesis activity was performed at 42°C for 15 minutes using λRNA molecular weight standards (1, 2, 3, 5, 7, 9, and 15 kb) or HCV RNA molecular weight standards (1, 2, 3, 5, 7, and 9 kb) as templates.

[0033] Figure 5 This demonstrates that ttCsp1 can fuse to the N-terminus or C-terminus of MMLVmut. First-strand reverse transcriptase cDNA synthesis activity was performed at 42°C for 15 minutes (left) or 30 minutes (right) using λRNA molecular weight standards (1, 2, 3, 5, 7, and 15 kb) (top) or HCV RNA molecular weight standards (1, 2, 3, 5, 7, and 9 kb) (bottom) as templates.

[0034] Figure 6 This study demonstrates that ttCsp1 can fuse with HIV RT to enhance its sustained synthetic capacity. First-strand reverse transcriptase cDNA synthesis activity was achieved using λRNA molecular weight standards (1, 2, 3, 5, 7, 9, and 15 kb) (left) or HCV RNA molecular weight standards (1, 2, 3, 5, 7, and 9 kb) (right) as templates at 42°C for 30 minutes.

[0035] Figure 7Different Csp proteins were demonstrated to enhance the sustained synthesis capacity of reverse transcriptase. First-strand cDNA synthesis activity of reverse transcriptase was observed using λRNA molecular weight standards (1, 2, 3, 5, 7, 9, and 15 kb) as templates at 42°C for 15 minutes (left) and 30 minutes (right). The percentage of protein sequence identity between the various fusion Csp proteins and ttCsp1 is shown in parentheses. Even ecCspH with only 31.9% sequence identity to ttCsp1 played a similar role in enhancing the sustained synthesis capacity of MMLVmut.

[0036] Figure 8 Different Csp proteins were demonstrated to enhance sustained synthesis capabilities. First-strand reverse transcriptase cDNA synthesis activity was achieved using HCV RNA molecular weight standards (1, 2, 3, 5, 7, and 9 kb) as templates at 42°C for 15 minutes (left) and 30 minutes (right).

[0037] Figure 9 Multiple sequence alignments of various Csp proteins from thermophilic and thermophilic microorganisms are presented (Clustal Omega 1.2.2). Common sequences are shown at the top. The ttCsp1 sequence is moved to the bottom for display. Figure 10 The amino acid residue numbers used in the mutation study. The right side shows the percentage of paired sequence identity between each Csp protein and ttCsp1.

[0038] Figure 10 The effect of the predicted ttCsp1 mutation on its binding to RNA was demonstrated. First-strand reverse transcriptase cDNA synthesis activity was performed at 42°C for 15 minutes using λRNA molecular weight standards (1, 2, 3, 5, 7, 9, and 15 kb) as templates.

[0039] Figure 11 This study demonstrates that free Csp inhibits the reverse transcription of longer RNA fragments. First-strand reverse transcriptase cDNA synthesis activity was achieved using λRNA molecular weight standards (1, 2, 3, 5, 7, 9, and 15 kb) as templates at 42°C for 30 minutes.

[0040] Figure 12 This study demonstrates that free Csp inhibits the reverse transcription of longer RNA fragments. First-strand reverse transcriptase cDNA synthesis activity was achieved at 42°C for 30 minutes using HCV RNA molecular weight standards (1, 2, 3, 5, 7, and 9 kb) as templates.

[0041] Figure 13This demonstrates that eukaryotic Csp-like domains can also fuse with MMLV to enhance sustained synthesis capabilities. First-strand reverse transcriptase cDNA synthesis activity was achieved using λRNA molecular weight standards (1, 2, 3, 5, 7, 9, and 15 kb) (left) or HCV RNA molecular weight standards (1, 2, 3, 5, 7, and 9 kb) (right) as templates at 42°C for 15 minutes.

[0042] Figure 14 This study demonstrates that ttCsp1 can be fused with DNA polymerases (Bst, CA2, and CST) with reverse transcriptase activity to enhance the polymerases' sustained synthesis of RNA substrates (0.3 kb, 0.5 kb, and 1 kb). These DNA polymerases themselves are almost incapable of reverse transcribing 0.3 kb of RNA substrates after 60 minutes of reaction at 50°C. Through ttCsp1 fusion (cBst, cCA2, and cCST), they can be easily reverse transcribed to 1 kb under the same conditions.

[0043] Figure 15 This study demonstrates that introducing various known thermostability mutations into the MMLVmut region of the fusion protein can enhance the thermostability of Bos6Cs. Compared to Bos6C1, the resulting mutants Bos6C1ts1, Bos6C1ts2, Bos6C4ts3, Bos6C4ts4, Bos6C4ts5, Bos6C4ts6, and Bos6C1ts7 exhibit more active reverse transcription at a higher temperature of 50°C.

[0044] Figure 16 The sequence of the mutant MMLV RT and ttCsp1 fusion protein Bos6C1ts1 is shown (SEQ ID NO:99).

[0045] Figure 17 The sequence of the mutant MMLV RT and ttCsp1 fusion protein Bos6C1ts2 is shown (SEQ ID NO:100).

[0046] Figure 18 The sequence of the mutant MMLV RT and ttCsp1 fusion protein Bos6C1ts7 is shown (SEQ ID NO:101).

[0047] Figure 19 The sequence of the mutant MMLV RT and ttCsp1 fusion protein Bos6C4ts3 is shown (SEQ ID NO:102).

[0048] Figure 20 The sequence of the mutant MMLV RT and ttCsp1 fusion protein Bos6C4ts4 is shown (SEQ ID NO:103).

[0049] Figure 21 The sequence of the mutant MMLV RT and ttCsp1 fusion protein Bos6C4ts5 is shown (SEQ ID NO:104).

[0050] Figure 22 The sequence of the mutant MMLV RT and ttCsp1 fusion protein Bos6C4ts6 is shown (SEQ ID NO:105). Detailed Implementation

[0051] Before describing this disclosure in more detail, it should be understood that this disclosure is not limited to the specific embodiments described, and therefore variations are possible. It should also be understood that the terminology used herein is for describing specific embodiments only and is not intended to be limiting, as the scope of this disclosure is limited only by the appended claims.

[0052] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Although any methods and materials similar to or equivalent to those described herein may be used in the practice or testing of this disclosure, only preferred methods and materials are described herein.

[0053] All publications and patents referenced in this specification are incorporated herein by reference as if each publication or patent were expressly and individually designated to be incorporated herein by reference, and are incorporated herein by reference to disclose and describe the methods and / or materials relating to the cited publication. The reference to any publication is intended to demonstrate that it was published prior to the filing date and should not be construed as an admission that this disclosure is exempt from any rights prior to that publication. Furthermore, the publication dates provided may differ from the actual publication dates and may require separate verification.

[0054] Those skilled in the art will appreciate upon reading this disclosure that each embodiment described and illustrated herein has independent components and features that can be readily separated from or combined with features of several other embodiments without departing from the scope or spirit of this disclosure. Any of the described methods may be performed in the order of the events described or in any other logically feasible order.

[0055] I. Definition

[0056] It should be understood that the foregoing overview and the detailed description below are exemplary and illustrative only, and do not limit the claimed invention. In this application, unless expressly stated otherwise, the use of the singular form also includes the plural meaning. In this disclosure, unless expressly indicated to refer only to alternatives or mutually exclusive alternatives, the term “or” is used to mean “and / or”. “Another” as used herein may refer to at least a second or more. Furthermore, the use of the term “including” and other forms such as “includes” and “included” is not limited. Additionally, unless expressly stated otherwise, terms such as “element” or “component” cover elements and components containing one unit as well as elements and components containing more than one subunit. Furthermore, the use of the term “part” can include a portion or the entire part.

[0057] As used herein, unless the context clearly indicates otherwise, the singular forms “a” and “the” include plural references.

[0058] As used herein, the term "amino acid" refers to an organic compound containing amino (-NH2) and carboxyl (-COOH) functional groups, as well as the distinctive side chain of each amino acid. In this disclosure, amino acid names are also represented by standard single-letter or three-letter codes.

[0059] As used herein, a "mutant" protein is a protein that has one or more amino acid substitutions, deletions (including truncation), or additions (including deletions) relative to a wild-type protein. A mutant protein may have less than 100% sequence identity with the amino acid sequence of a naturally occurring protein, but may have any amino acid that is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of a naturally occurring protein.

[0060] As used herein, the term "fusion protein" refers to a protein composed of multiple natively unlinked polypeptide components. A fusion protein can be a combination of two, three, or even four or more different proteins. The term polypeptide includes fusion proteins, including but not limited to the fusion of two or more heterologous amino acid sequences, the fusion of a polypeptide with a heterologous targeting sequence, linker, immunotag, or detectable fusion chaperone (such as fluorescent protein). One or more heterologous domains may be added to the N-terminus, C-terminus, and / or middle portion of a fusion protein. If the two parts of a fusion protein are "heterologous," they are not the same protein in their native state.

[0061] As used herein, the term "Csp" refers to a cold shock protein. Csp is a small protein composed of 65-80 amino acid residues that binds to single-stranded nucleic acids via a highly conserved cold shock domain (CSD). The CSD contains two ribonucleoprotein (RNP) motifs, RNP1 and RNP2, also known as nucleic acid binding motifs. It should be understood that the Csp contained in the fusion proteins disclosed herein may be naturally occurring Csp, a mutant version of naturally occurring Csp, or a fragment of naturally occurring Csp, wherein in each case, Csp (or its mutant version or fragment) binds to single-stranded nucleic acids, thereby improving the sustained synthesis capability of the fusion protein.

[0062] As used herein, the term "RT" refers to reverse transcriptase. It should be understood that the RT contained in the fusion proteins disclosed herein may be a naturally occurring RT, a mutant version of a naturally occurring RT, or a fragment of a naturally occurring RT, wherein in each case, the RT (or a mutant version or fragment thereof) is a polypeptide or subunit with reverse transcription activity.

[0063] The term "host cell" refers to a cell that has been transformed with a nucleic acid sequence or is capable of being transformed and thereby expressing the target gene. This term includes the offspring of the parent cell, regardless of whether the offspring are morphologically or genetically identical to the original parent cell, as long as the target gene is present.

[0064] As used herein, “isolated” biological components (such as nucleic acids, peptides, or cells) refer to those that have been substantially isolated, prepared, or purified from other biological components or cells of the organism in which they naturally exist, i.e., separated from other chromosomal and extrachromosomal DNA and RNA, cells, and proteins. Therefore, “isolated” nucleic acids, peptides, and proteins include nucleic acids and proteins purified using standard purification methods. The term also encompasses nucleic acids, peptides, and proteins prepared through recombinant expression in host cells, as well as chemically synthesized nucleic acids.

[0065] As used herein, the term “link” refers to a combination of molecules through intramolecular interactions (e.g., covalent, metallic, and / or ionic bonds) or intermolecular interactions (e.g., hydrogen bonds or non-covalent bonds).

[0066] As used herein, the terms “nucleic acid” or “polynucleotide” refer to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) in single-stranded or double-stranded form and their polymers. Unless otherwise stated, specific polynucleotide sequences also implicitly encompass their conserved modified variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as explicitly stated sequences. Specifically, degenerate codon substitutions can be achieved by generating a sequence in which the third position of one or more selected (or all) codons is replaced by a mixture of bases and / or deoxyinosine residues (see Batzer et al., Nucleic Acid Res. 19(18):5081 (1991); Ohtsuka et al., J. Biol. Chem. 260(5):2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8(2):91-98 (1994)).

[0067] The term "operable link" refers to an arrangement of elements in which the described components are configured to perform their usual function. Thus, a specific signal peptide operably linked to a polypeptide directs the polypeptide from the cell for secretion. In the case of promoters, a promoter operably linked to a coding sequence will direct the expression of that coding sequence. Promoters or other control elements do not need to be adjacent to the coding sequence, as long as they can direct its expression. For example, an untranslated but transcribed insert sequence can exist between the promoter and coding sequences, and the promoter sequence can still be considered "operably linked" to the coding sequence.

[0068] The "sequence identity percentage (%)" of an amino acid sequence (or nucleic acid sequence) is defined as the percentage of amino acid (or nucleic acid) residues in a candidate sequence that are identical to those in a reference sequence after sequence alignment and, if necessary, the introduction of vacancies to achieve the maximum number of identical amino acids (or nucleic acids). Conservative substitutions of amino acid residues may or may not be considered identical residues. For example, alignments can be performed using publicly available tools such as BLASTN, BLASTp (available on the website of the National Center for Biotechnology Information (NCBI), see also Altschul SF et al., J. Mol. Biol., 215(3):403–410 (1990); Stephen F. et al., Nucleic Acids Res., 25(17):3389–3402 (1997)), ClustalW2 (available on the website of the European Institute of Bioinformatics, see also Higgins DGet al., Methods in Enzymology, 266:383-402 (1996); Larkin MA et al., Bioinformatics (Oxford, England), 23(21): 2947-8 (2007)), and ALIGN or Megalign (DNASTAR) software to determine the percentage of amino acid (or nucleic acid) sequence identity. Those skilled in the art can use the default parameters provided by the tool, or customize the parameters appropriately according to the comparison requirements, for example by selecting a suitable algorithm.

[0069] The terms "peptide" or "protein" refer to a chain of amino acids consisting of at least two amino acids linked together by peptide bonds. In addition to amino acids, peptides and proteins may include other parts (e.g., may be glycosylated) and / or may have undergone other processing or modification. Those skilled in the art will understand that a "peptide" or "protein" can be a complete polypeptide chain produced by a cell (with or without a signal sequence) or its functional portion. Those skilled in the art will further understand that peptides or proteins may sometimes comprise multiple polypeptide chains, for example, linked by one or more disulfide bonds or otherwise associated. The term also includes amino acid polymers, where one or more amino acids are chemical analogs of the corresponding naturally occurring amino acids, and polymers.

[0070] When the term "recombinant" is used to refer to polypeptides (e.g., antibodies, antigens) or polynucleotides, it refers to polypeptides or polynucleotides produced through recombinant methods. "Recombinant polypeptide" includes any polypeptide expressed by a recombinant polynucleotide. "Recombinant polynucleotide" includes any polynucleotide modified by introducing at least one exogenous (i.e., foreign, and usually heterologous) nucleotide or altering at least one native nucleotide component of the polynucleotide, and does not necessarily include all coding sequences or regulatory elements naturally associated with the coding sequence. "Recombinant vector" refers to a non-naturally occurring vector, including, for example, a vector containing a recombinant polynucleotide sequence.

[0071] As used herein, a "vector" refers to a nucleic acid molecule introduced into a host cell that transforms the host cell. A vector may include a nucleic acid sequence that allows it to replicate within the host cell, such as an origin of replication. A vector may also include one or more therapeutic genes and / or selection marker genes, as well as other genetic elements known in the art. A vector can transduce, transform, or infect cells, thereby causing the cells to express nucleic acids and / or proteins other than those native to the cell. Optionally, a vector may include substances that facilitate nucleic acid entry into the cell, such as viral particles, liposomes, protein coatings, etc.

[0072] II. Fusion Proteins and Their Preparation

[0073] A. Fusion protein

[0074] This disclosure provides, in one aspect, a fusion protein with improved reverse transcription and sustained synthetic capacity (i.e., improved cDNA synthetic activity). In one embodiment, the fusion protein disclosed herein comprises a reverse transcriptase (RT) and a cold shock protein (Csp) operatively linked to the RT. It should be understood that the fusion protein of this disclosure can have various forms and structures. The Csp can be linked to the N-terminus or C-terminus of the RT. The Csp can be linked to the RT directly or indirectly (e.g., through a linker).

[0075] Cold shock protein

[0076] As used in this article, cold shock proteins (Csp) are a class of proteins expressed in organisms, particularly microorganisms, to cope with stress and adapt to changing environments, such as decreased growth temperature, pH, and salt concentration. Csp are highly conserved and diverse proteins in both structure and function (see Chaudhary et al., Int J Biol Macromol. 220:743-753 (2022)). Csp are multifunctional proteins that interact with different types of biomolecules, including DNA, RNA, and proteins. They play key roles in transcriptional regulation and post-translational modifications associated with a variety of metabolic pathways. CspA and CspC also show similar functions in certain responses (Derman et al., Food Microbiol. 46:463-470 (2014)). In prokaryotes, Csp are involved in various cellular and metabolic processes, such as growth and development, osmotic oxidation, starvation, stress tolerance, and host cell invasion. Eukaryotic Csp is an evolved form of prokaryotic Csp, with its cold shock domain flanked by N-terminal and C-terminal domains. In eukaryotes, Csp acts as a nucleic acid chaperone by preventing the formation of mRNA secondary structures at low temperatures. Furthermore, Csp is a small protein composed of 65-80 amino acid residues that can bind to single-stranded nucleic acids through a highly conserved cold shock domain (CSD). The CSD contains two ribonucleoprotein (RNP) motifs, RNP1 and RNP2, also known as nucleic acid binding motifs (see Tanaka et al., FEBS J. 279(6):1014-29(2012)).

[0077] It should be understood that the Csp contained in the fusion protein disclosed herein may be a naturally occurring Csp, a mutant version of a naturally occurring Csp, or a fragment of a naturally occurring Csp, wherein in each case, the Csp (or a mutant version or fragment thereof) binds to a single-stranded nucleic acid, thereby improving the ability of the fusion protein to be synthesized continuously.

[0078] Naturally occurring Csps exist in a variety of organisms. For example, nine Csps (ecCsp) exist in Escherichia coli, namely ecCspA to ecCspI, among which ecCspD and ecCspF have the lowest sequence identity, at 26.9%. ecCspA has been shown to be an RNA chaperone, while the functions of the other ecCsps are still unclear. Csp also exists in other organisms, including Bacillus subtilis (bsCspB), Bacillus caldolyticus (bcCspB), Thermotoga maritima (tmCspB, tmCspL), Neisseria meningitidis (nmCsp), Salmonella typhimurium (stCsp), Thermus thermophilus (ttCsp1, ttCsp2), Actinomadura harenae (ahCsp), and Lactobacillus plantarum (lpCspL). Exemplary naturally occurring Csp amino acid sequences are listed in Table 1.

[0079] Table 1. Examples of exemplary cold shock proteins / domains

[0080]

[0081] It should be understood that other naturally occurring Csp can be identified using methods known in the art (e.g., by sequence alignment).

[0082] In some embodiments, the Csp contained in the fusion protein disclosed herein contains one or more mutations, such as deletions, insertions, or substitutions, compared to naturally occurring Csp. The inventors further discovered that replacing the K at position 13 of ttCsp1 with R or S (natural amino acids from tgemCsp, ecCspF, and ecCspH) also increases the sustained synthetic capacity of the fusion protein. Therefore, in some embodiments, the Csp contained in the fusion protein disclosed herein is derived from a thermophilic species and contains a substitution at position 13 of SEQ ID NO: 35. For example, when the Csp is derived from a thermophilic species, the amino acid corresponding to position 13 of SEQ ID NO: 35 can be selected from S, A, G, V, L, I, M, F, W, P, T, C, Y, N, Q, D, R, K, E, or H. In some embodiments, the amino acid corresponding to position 13 of SEQ ID NO: 35 is selected from K, S, or R. In some embodiments, the amino acid corresponding to position 13 of SEQ ID NO: 35 is K.

[0083] Furthermore, the inventors discovered that other amino acids near the 13th amino acid of SEQ ID NO: 35 can also be substituted to produce fusion proteins with increased sustained synthetic capacity. For example, substitution of amino acids at positions 5, 6, 8, 10, 15, 17, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 58, 60, 61, 63, 64 and / or 65 of SEQ ID NO: 35 also produced fusion proteins with increased sustained synthetic capacity, as well as a control fusion protein.

[0084] In some embodiments, Csp is a mutated Csp having at least one mutation selected from the group consisting of K13A, Y15A, F17A, F27A, H29A, Y30A, F38A, and K58A of SEQ ID NO: 35.

[0085] In some embodiments, the Csp contained in the fusion protein disclosed herein is a fragment of a naturally occurring Csp protein. In some embodiments, the Csp contained in the fusion protein disclosed herein contains a cold shock domain (CSD). In some embodiments, the Csp contained in the fusion protein disclosed herein contains at least one of two ribonucleoprotein (RNP) motifs (also known as nucleic acid binding motifs) RNP1 and RNP2.

[0086] In some embodiments, RNP1 has at least one sequence X5-G-X6-G-X7-I (SEQ ID NO: 2), wherein X5 is K, R, S, D, E, N, Q, T, H or Y; X6 is F, Y, W, L, V, A, I, M, H, R or K; and X7 is F, Y, W, L, V, A, I, M or H.

[0087] In some implementations, RNP2 has at least one sequence X8-X9-X 10 -X 11 -X 12 (SEQ ID NO: 3), where X8 is V, A, I, L, M, F, or W; X9 is F, Y, W, H, Q, L, V, I, M, or A; X 10 For A, I, L, M, F, V, or W; X 11 The numerators are H, Y, F, L, M, V, I, W, Q, or A; and X 12 It can be Y, W, L, F, M, V, I, Q, H, or A.

[0088] In some embodiments, the cold shock domain has at least one sequence G-X1-X2-K-X3-F-X4 (SEQ ID NO: 1), wherein X1 is T, I, V, Q, N, L, K or R; X2 is V, L, A, G or I; X3 is F, T, Y, H, M or W; and X4 is N, T, S or D.

[0089] In some implementations, the cold shock domain has at least one sequence X. 13 -X 14 -X 15 -X 16 -X 17 -X 18 -X 19 -X 20 -X 21 -X 22 -X 23 -X 24 -X 25 (SEQ ID NO: 4), where X 13 For G, D, N, or E; X 14 For F, I, L, A, or Y; X 15 For K, P, Q, E, or R; X 16 For T, A, E, V, or S; X 17 For L, P, or I; X 18 For E, D, T, I, A, F, N, or K; X 19 For E, Q, T, P, A, or D; X 20 For G or N; X 21 For Q, M, T, L, E, or D; X 22 For K, R, N, E, S, Q, T, L, V, A, or I; X 23 For V or I; X 24 For E, S, T, or Q; X 25 It can be Y or F.

[0090] In some implementations, the cold shock domain has at least one sequence X. 26 -GX 27 -X 28 -AX 29 -X 30 -X 31 (SEQ ID NO: 5), where X 26 For K or R; X 27 For P, L, N, Y, or A; X 28 For Q, K, S, T, A, or H; X 29 For A, V, T, S, G, R, or E; X 30 The denoted by X is N, E, K, V, C, R, H, G, D, or S; and X31 It can be V, L, or I.

[0091] In some implementations, the cold shock domain has the following structure: G-X1-X2-K-X3-F-X4-X5-G-X6-G-X7-I-X8-X9-X 10 -X 11 -X 12 -X 13 -X 14 -X 15 -X 16 -X 17 -X 18 -X 19 -X 20 -X 21 -X 22 -X 23 -X 24 -X 25 -X 26 -GX 27 -X 28 -AX 29 -X 30 -X 31 The sequence is defined as follows: X1 is T, I, V, Q, N, L, K, or R; X2 is V, L, A, G, or I; X3 is F, T, Y, H, M, or W; X4 is N, T, S, or D; X5 is K, R, S, D, E, N, Q, T, H, or Y; X6 is F, Y, W, L, V, A, I, M, H, R, or K; X7 is F, Y, W, L, V, A, I, M, or H; X8 is V, A, I, L, M, F, or W; X9 is F, Y, W, H, Q, L, V, I, M, or A; X 10 For A, I, L, M, F, V, or W; X 11 For H, Y, F, L, M, V, I, W, Q, or A; X 12 For Y, W, L, F, M, V, I, Q, H or A; X 13 For G, D, N, or E; X 14 For F, I, L, A, or Y; X 15 For K, P, Q, E, or R; X 16 For T, A, E, V, or S; X 17 For L, P, or I; X 18 For E, D, T, I, A, F, N, or K; X 19 For E, Q, T, P, A, or D; X 20 For G or N; X 21 For Q, M, T, L, E, or D; X 22 For K, R, N, E, S, Q, T, L, V, A, or I; X 23 For V or I; X 24For E, S, T, or Q; X 25 For Y or F; X 26 For K or R; X 27 For P, L, N, Y, or A; X 28 For Q, K, S, T, A, or H; X 29 For A, V, T, S, G, R, or E; X 30 The denoted by X is N, E, K, V, C, R, H, G, D, or S; and X 31 It can be V, L, or I.

[0092] In some embodiments, X1 is I, T, or R. In some embodiments, X1 is I. In some embodiments, X1 is T. In some embodiments, X1 is R. In some embodiments, X2 is V, L, A, or G. In some embodiments, X2 is V. In some embodiments, X2 is L. In some embodiments, X2 is A. In some embodiments, X2 is G. In some embodiments, X3 is T, Y, H, M, or W. In some embodiments, X3 is T. In some embodiments, X3 is Y. In some embodiments, X3 is H. In some embodiments, X3 is M. In some embodiments, X3 is W. In some embodiments, X4 is D, T, S, or N. In some embodiments, X4 is D. In some embodiments, X4 is T. In some embodiments, X4 is S. In some embodiments, X4 is N. In some embodiments, X5 is S or K. In some embodiments, X5 is S. In some embodiments, X5 is K. In some embodiments, X6 is K, F, or Y. In some embodiments, X6 is K. In some embodiments, X6 is F. In some embodiments, X6 is Y. In some embodiments, X7 is I. In some embodiments, X8 is V or I. In some embodiments, X8 is V. In some embodiments, X8 is I. In some embodiments, X9 is Q or F. In some embodiments, X9 is Q. In some embodiments, X9 is F. In some embodiments, X 10 For V or A. In some implementations, X 10 For V. In some implementations, X 10 For A. In some implementations, X 11 For H. In some implementations, X 12 It can be I, F, or Y. In some implementations, X 12 For I. In some implementations, X 12 For F. In some implementations, X 12 For Y. In some implementations, X 13 For D or G. In some implementations, X 13 For D. In some implementations, X13 For G. In some implementations, X 14 It can be A, Y, or F. In some implementations, X 14 For A. In some implementations, X 14 For Y. In some implementations, X 14 For F. In some implementations, X 15 It is E, K, or R. In some implementations, X 15 For E. In some implementations, X 15 For K. In some implementations, X 15 For R. In some implementations, X 16 V, S, or T. In some implementations, X 16 For V. In some implementations, X 16 For S. In some implementations, X 16 For T. In some implementations, X 17 For L. In some implementations, X 18 It can be T, D, K, E, or N. In some implementations, X 18 For T. In some implementations, X 18 For D. In some implementations, X 18 For K. In some implementations, X 18 For E. In some implementations, X 18 For N. In some implementations, X 19 It can be P, E, A, Q, or E. In some implementations, X 19 For P. In some implementations, X 19 For E. In some implementations, X 19 For A. In some implementations, X 19 For Q. In some implementations, X 19 For E. In some implementations, X 20 For G. In some implementations, X 21 For L, Q, or D. In some implementations, X 21 For L. In some implementations, X 21 For Q. In some implementations, X 21 For D. In some implementations, X 22 For R, S, or I. In some implementations, X 22 For R. In some implementations, X 22 For S. In some implementations, X 22 For I. In some implementations, X 23 For V. In some implementations, X 24It can be E, S, Q, or T. In some implementations, X 24 For E. In some implementations, X 24 For S. In some implementations, X 24 For Q. In some implementations, X 24 For T. In some implementations, X 25 For F. In some implementations, X 26 For K or R. In some implementations, X 26 For K. In some implementations, X 26 For R. In some implementations, X 27 For P or N. In some implementations, X 27 For P. In some implementations, X 27 For N. In some implementations, X 28 For T, A, H, or Q. In some implementations, X 28 For T. In some implementations, X 28 For A. In some implementations, X 28 For H. In some implementations, X 28 For Q. In some implementations, X 29 It can be A, G, S, E, or V. In some implementations, X 29 For A. In some implementations, X 29 For G. In some implementations, X 29 For S. In some implementations, X 29 For E. In some implementations, X 29 For V. In some implementations, X 30 For N, V, or S. In some implementations, X 30 For N. In some implementations, X 30 For V. In some implementations, X 30 For S. In some implementations, X 31 For V or I. In some implementations, X 31 For V. In some implementations, X 31 For I.

[0093] reverse transcriptase

[0094] Reverse transcriptase (RT), also known as RNA-dependent DNA polymerase, is a DNA polymerase that synthesizes complementary DNA using RNA as a template. Any reverse transcriptase with reverse transcription activity can be used in this invention. Examples of reverse transcriptases include viral reverse transcriptases, such as reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV), reverse transcriptases derived from Avian Myeloblastosis Virus (AMV), reverse transcriptases derived from Human Immunodeficiency Virus (HIV), reverse transcriptases derived from Rous Sarcoma Virus (RSV), reverse transcriptases derived from Walleye Dermal Sarcoma Virus (WDSV), reverse transcriptases derived from Avian Sarcoma-Leukosis Virus (ASLV), and reverse transcriptases derived from Avian Reticuloendotheliosis Virus (REV-T). Reverse transcriptases derived from various bacteria include those derived from myeloblastosis-associated viruses (MAV, Myeloblastosis Associated Virus), Rous-associated viruses (RAV, Rous Associated Virus), and bacteria (such as DNA polymerases from the genus *Thermus thermophiles* (Tth DNA polymerase, etc.), *Thermus filiformis* (Tfi DNA polymerase, etc.), *Thermus flavus* (Tfl DNA polymerase, etc.), *Thermotoga maritima* (Tma DNA polymerase, etc.), *Thermotoga neapolitana* (Tne DNA polymerase, etc.), and *Thermus species Z05*). Z05 DNA polymerase (Z05 DNA polymerase, etc.), derived from the Thermococcus species JDF-3 bacteria (Thermococcus species)The reverse transcriptases used include JDF-3 DNA polymerase (JDF-3 DNA polymerase, etc.), DNA polymerases derived from thermophilic bacteria of the genus *Bacillus stearothermophilus* (BstDNA polymerase, etc.), and DNA polymerases derived from thermophilic bacteria of the genus *Bacillus caldotenax* (Bca DNA polymerase, etc.). Virus-derived reverse transcriptases are preferred, and the present invention more preferably uses reverse transcriptases derived from MMLV, AMV, or HIV. Furthermore, reverse transcriptases modified with naturally derived amino acid sequences may also be used in the present invention, provided they possess reverse transcription activity. The amino acid sequences of exemplary reverse transcriptases are listed in Table 2.

[0095] Table 2. Examples of exemplary reverse transcriptases

[0096]

[0097] It should be understood that the RT contained in the fusion protein disclosed herein may be a naturally occurring RT, a mutant version of a naturally occurring RT, or a fragment of a naturally occurring RT, wherein in each case, the RT (or its mutant version or fragment) is a polypeptide or subunit with reverse transcription activity.

[0098] In some embodiments, RT is a mutant lacking RNase H activity. In some embodiments, RT is a mutant MMLV (MMLVmut) having at least one mutation of D524N, E562Q, D583N, or D653N in the sequence of SEQ ID NO: 40. In some embodiments, RT is a mutant with enhanced heat resistance. In some embodiments, RT is an MMLV mutant (MMLVmut) having at least one mutation of V129R, T197A, H204R, N249D, M289L, Q291I, T306K, F309N, W313F, Y344F, T420V, L435G, N454K, or A644P in the sequence of SEQ ID NO: 40. In some implementations, RT is an MMLV mutant having a mutation selected from T197A, H204R, F309N, W313F, L435G and N454K in the sequence of SEQ ID NO: 40.

[0099] In the exemplary embodiments detailed herein, the cold shock proteins and reverse transcriptases of the present invention are wild-type or mutant forms of wild-type ttCsp1, ecCspA, ecCspD, ecCspH, ahCsp, MMLV reverse transcriptase, or HIV reverse transcriptase, having altered characteristics that confer advantageous properties to the fusion reverse transcriptase. However, it should be understood that the invention is not limited to the exemplary embodiments detailed herein. For example, the invention includes mutants of cold shock proteins other than ttCsp1, such as mutants of any cold shock protein family; or the invention includes mutants of reverse transcriptases other than MMLV reverse transcriptase, such as mutants of any viral-derived reverse transcriptase. These wild-type or mutant forms can be wild-type or mutant forms of Csp or reverse transcriptases, including but not limited to Csp or reverse transcriptases from thermophilic species or thermophilic stearothermophilus species. Those skilled in the art fully understand and appreciate that Csp or reverse transcriptases exhibit moderate levels of sequence identity and conservation. Therefore, those skilled in the art can easily identify similar domains in a particular Csp or reverse transcriptase that correspond to a domain of another Csp or reverse transcriptase. Thus, the specific domains mentioned herein are wild-type. Csp or reverse transcriptases can be readily associated with corresponding domains in other Csp or reverse transcriptases.

[0100] connector

[0101] In some embodiments, the fusion protein includes a linker connecting Csp and RT. In some embodiments, the linker typically consists of amino acid residues that promote helical and turn interactions, such as alanine, serine, and glycine. However, other residues may also function. In some embodiments, the linker comprises the amino acid sequence (GGGGS)n or (GSGGS)n (n=2-5). Exemplary linker amino acid sequences are listed in Table 3.

[0102] Table 3. Examples of exemplary connectors

[0103]

[0104] While the exemplary embodiments discussed in detail herein relate to ttCsp1, other cold shock proteins, reverse transcriptases, and other reverse transcriptases derived from other viruses, it should be understood that mutant Csp or reverse transcriptases can be derived from any Csp or reverse transcriptase that is identical to a Csp or reverse transcriptase derived from a virus, eubacteria, or archaea. When a mutant Csp or reverse transcriptase is not derived from ttCsp1 or MMLV reverse transcriptase, the mutant Csp or reverse transcriptase may have one or more mutations in a domain corresponding to a domain identified in the specific reference ttCsp1 or MMLV reverse transcriptase herein. Those skilled in the art will recognize that a Csp or reverse transcriptase can be any cold shock protein or reverse transcriptase derived from a virus, eubacteria, or archaea, including but not limited to viral reverse transcriptases, eubacterial or archaea cold shock proteins, and their mutants or derivatives. Thus, in various embodiments, Csp is derived from eubacterial Csp and reverse transcriptase is derived from viral reverse transcriptase. Suitable Csp or reverse transcriptase can be derived from a variety of thermophilic bacteria or viruses, including but not limited to avian myeloblastosis virus, Rous sarcoma virus, thermophilic species and marine thermophila, such as Thermus thermophilus (Tth) and Thermotoga maritima (Tma UITma).

[0105] B. Preparation method

[0106] The fusion proteins disclosed herein can be prepared by recombination, for example by expression from nucleic acid constructs encoding fusion proteins, as described in, for example, Molecular Cloning: A Laboratory Manual, 4th Edition (Sambrook et al., 2001), the entire contents of which are incorporated herein by reference.

[0107] In one embodiment, DNA encoding Csp and RT is isolated and sequenced using conventional methods (e.g., using oligonucleotide probes capable of specifically binding to genes encoding Csp or RT). The encoding DNA can also be obtained through synthetic methods. The isolated polynucleotides encoding Csp and RT can be inserted into a vector to generate polynucleotides encoding fusion proteins using recombination techniques known in the art. Many vectors are available. Vector components typically include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter (e.g., SV40, CMV, EF-1α), and a transcription termination sequence.

[0108] Vectors containing multinucleotide sequences encoding fusion proteins can be introduced into host cells for cloning or gene expression. Suitable host cells for cloning or expressing the DNA in the vectors described herein include prokaryotes (e.g., E. coli), yeasts (e.g., Saccharomyces cerevisiae), or higher eukaryotic cells (e.g., mammalian host cell lines).

[0109] The host cells were transfected with the above expression or cloning vectors to produce fusion proteins and cultured in a conventional nutrient medium that was appropriately modified to induce promoters, select transformants, or amplify genes encoding the desired sequences.

[0110] In some embodiments, the fusion protein of this disclosure may be purified. As used herein, the term "purified" means a composition that can be separated from other components, wherein the protein is purified to any degree relative to its naturally available state. Thus, a purified protein also refers to a protein that has been isolated from the environment in which it may naturally exist. When the term "basically purified" is used, this name refers to a composition in which a protein or peptide is the major component of the composition, such as a protein content (e.g., by weight) of about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more in the composition.

[0111] Protein purification techniques are well known to those skilled in the art. These techniques involve, to some extent, the crude separation of the cellular environment into peptide and non-peptide fractions. After separating the peptide from other proteins, the target peptide can be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogenization). Analytical methods particularly suitable for preparing pure peptides include ion-exchange chromatography, size exclusion chromatography; polyacrylamide gel electrophoresis; and isoelectric focusing. Other protein purification methods include precipitation with ammonium sulfate or PEG, or by heat denaturation followed by centrifugation; gel filtration, reversed-phase chromatography, hydroxyapatite chromatography, and affinity chromatography; and combinations of these techniques with other techniques.

[0112] III. Compositions and Kits

[0113] This disclosure also provides compositions and kits comprising the fusion protein described herein. In addition to the fusion protein described herein, such compositions and kits also contain components that can be used for cDNA synthesis, such as primers, deoxyribonucleotides, and reaction buffers.

[0114] In one embodiment, in addition to the fusion protein described herein, the composition or kit according to this disclosure may also include at least one primer, at least one deoxyribonucleotide, and / or a reaction buffer.

[0115] Primers can be oligonucleotides with nucleotide sequences complementary to the template RNA, and there are no particular restrictions as long as they can anneal to the template RNA under the reaction conditions used. Primers can be oligonucleotides (such as oligo(dT)) or oligonucleotides with random sequences (random primers).

[0116] Because a specific annealing process is required, the primer length is preferably at least 6 nucleotides, and more preferably at least 10 nucleotides. For the synthesis of oligonucleotides, the primer length is preferably at most 100 nucleotides, and more preferably at most 30 nucleotides. Oligonucleotides can be synthesized, for example, using the phosphoramide process according to a DNA synthesizer 394 (manufactured by Applied Biosystems, Inc.). Oligonucleotides can also be synthesized by other methods, such as the phosphotriester method, the H-phosphite method, or the thiophosphate method. Oligonucleotides can be derived from biological samples and, for example, can be prepared by isolating from restriction endonuclease digests of DNA prepared from natural samples.

[0117] As used herein, a deoxyribonucleotide is a phosphate group bonded to deoxyribose via a phosphate ester bond, which in turn is bonded to an organic base via a phosphate ester bond. Natural DNA comprises four distinct nucleotides. Nucleotides composed of adenine, guanine, cytosine, and thymine bases can be found in natural DNA. Adenine, guanine, cytosine, and thymine bases are abbreviated as A, G, C, and T, respectively. Deoxyribonucleotides include free monophosphates, diphosphates, and triphosphates (more specifically, each phosphate group comprises one, two, or three phosphate moieties). Therefore, deoxyribonucleotides include deoxyribonucleoside triphosphates (e.g., dATP, dCTP, dITP, dGTP, and dTTP) and their derivatives. Deoxyribonucleotide derivatives include [αS]dATP, 7-denitro-dGTP, 7-denitro-dATP, and deoxyribonucleotide derivatives resistant to nucleic acid degradation. Nucleotide derivatives include, for example, deoxyribonucleotides labeled in a manner detectable by radioisotopes, such as... 32 P or 35 S, fluorescent part, chemiluminescent part, bioluminescent part, or enzyme.

[0118] As used herein, deoxyribonucleotide triphosphates refer to nucleotides whose sugar moiety consists of deoxyribose and which have triphosphate groups. Natural DNA comprises four different nucleotides, each with adenine, guanine, cytosine, and thymine as its base moiety. The deoxyribonucleotide triphosphates contained in the exemplary compositions or kits of this disclosure are mixtures of the four deoxyribonucleotide triphosphates: dATP, dCTP, dGTP, and dTTP.

[0119] As used herein, the reaction buffer refers to a solution suitable for reverse transcription of the fusion proteins disclosed herein. In one embodiment, the reaction buffer comprises a buffer or a mixture of buffers and may further comprise divalent and monovalent cations. In one embodiment, the reaction buffer included in the composition or kit is a 5-fold (5X) or 10-fold (10X) buffer, meaning that the buffer needs to be diluted 5-fold or 10-fold in the reverse transcription reaction. In one embodiment, the 1-fold reaction buffer contains 50 mM Tris 8.5, 50 mM KCl, and 4 mM MgCl2.

[0120] IV. Instructions for Use

[0121] On the other hand, this disclosure provides methods for cDNA synthesis using fusion proteins as disclosed herein.

[0122] In one embodiment, a method for synthesizing cDNA using the compositions disclosed herein includes the following steps:

[0123] A) Prepare a solution comprising the fusion protein disclosed herein, at least one primer, at least one deoxyribonucleotide, and RNA as a template; and

[0124] B) Incubate the solution prepared in step A) under conditions suitable for the fusion protein to carry out reverse transcription, that is, synthesize cDNA using RNA as a template.

[0125] RNA that can serve as a template for the methods described herein is capable of initiating a reverse transcription reaction from the primer when the primer hybridizes with the RNA. In one of the methods disclosed herein, the reverse transcription reaction may include a single template or multiple different templates with different nucleotide sequences. When using primers specific to a particular template, primer extension products from multiple different templates in a mixture of nucleic acids can be generated. Multiple templates may be present in different nucleic acids or in the same nucleic acid. There are no particular limitations on the RNA that can serve as a template for the methods disclosed herein. Examples of such RNA include: a set of RNA molecules in all RNA in a sample, a set of RNA molecules such as mRNA, tRNA, and rRNA, or a specific set of RNA molecules (e.g., a set of RNA molecules with a common nucleotide sequence motif, transcripts transcribed by RNA polymerase, a set of RNA molecules enriched by subtractive enrichment methods), and any RNA capable of generating primers used in the reverse transcription reaction.

[0126] In some implementations, the RNA serving as a template may be included in a sample derived from an organism (such as cells, tissues, or blood), or may be included in samples such as food, soil, or wastewater from the organism. Furthermore, the RNA may also be included in a nucleic acid-containing preparation obtained by processing the sample using conventional methods. Examples of preparations include homogenized cells, samples obtained by fractionating homogenized cells, all RNA in a sample, or a specific set of RNA molecules, such as a sample rich in mRNA.

[0127] There are no particular limitations on the amount of fusion protein used in the methods disclosed herein. When using 20 μL of reaction solution for reverse transcription, the amount of fusion protein can be 0.02–20 μg, 1–10 μg, or 2–5 μg.

[0128] There are no particular limitations on the primer concentrations used in the methods disclosed herein. To maximize the synthesis of cDNA from template RNA, the concentration in the reverse transcription reaction is preferably at least 0.1 μM; when Oligo dT primers are used in the reverse transcription reaction, the concentration is preferably at least 2.5 μM; and when random primers are used in the reverse transcription reaction, the concentration is preferably at least 5 μM.

[0129] The conditions suitable for the reverse transcription reaction of the fusion protein, i.e., the synthesis of primer extension strands complementary to the template RNA, are not particularly limited. Examples of temperature ranges include 30°C - 65°C, preferably 37°C - 50°C, and more preferably 42°C - 45°C. Examples of preferred reaction times include 5 min - 120 min, and more preferably 15 min - 60 min.

[0130] In some embodiments, the cDNA synthesis method for the fusion protein disclosed herein exhibits improved sustained synthesis capability compared to the parent reverse transcriptase that derives the fusion protein, when using RNA templates with transcription lengths of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 kb. Therefore, the cDNA synthesis method disclosed herein has a particular advantage in synthesizing cDNA, for example, from long RNA templates, where high sustained synthesis capability is required for the reverse transcription reaction. The improvement in the sustained synthesis capability of the reverse transcription reaction can be assessed, for example, by examining the amount and / or strand length of the synthesized cDNA. The amount of synthesized cDNA obtained by the reverse transcription reaction can be examined by performing real-time PCR on a given amount of reaction solution after the reverse transcription reaction to quantify the synthesized target nucleic acid sequence. The length of the synthesized cDNA obtained by the reverse transcription reaction can be confirmed by determining the amount of amplified product obtained by PCR, starting near the downstream of the promoter region of the primers used in the reverse transcription reaction, using one primer pair from different amplification strand lengths, and a given amount of reaction solution after the reverse transcription reaction.

[0131] When performing a nucleic acid amplification reaction, the cDNA obtained by the method of this invention is used as a template, and the cDNA can be amplified. There are no particular limitations on the nucleic acid amplification reaction. A preferred example is polymerase chain reaction (PCR).

[0132] The following examples are intended to better illustrate the claimed invention, but should not be construed as limiting the scope of the invention in any way. All specific compositions, materials, and methods described below, whether in whole or in part, fall within the scope of this invention. These specific compositions, materials, and methods are not intended to limit the invention, but are merely illustrative of specific embodiments falling within the scope of this invention. Those skilled in the art can develop equivalent compositions, materials, and methods without inventive effort and without departing from the scope of this invention. It should be understood that many variations can be made to the procedures described herein without departing from the scope of this invention. The inventors intend that these variations are also included within the scope of this invention.

[0133] Example 1

[0134] Materials and Methods

[0135] Clone various fusion constructs using MMLVmut:

[0136] Unless otherwise stated, all proteins are N-terminal His8-tagged. Codons for *E. coli* expression were optimized using IDT (Integrated DNA Technologies) software. Gene fragments were synthesized by Twist Bioscience and cloned into the NcoI and XhoI sites of the pET28a (Novagen) expression vector. pET28a was first digested with NcoI (NEB, Cat#R3193) and XhoI (NEB, Cat#R0146), and the linearized plasmid was then purified using a GFX PCR DNA and gel purification kit (Cytiva, Cat#28903470). Expression plasmids were assembled using HiFi DNA assembly premix (New England Biolabs E2621), and sequences were confirmed using Sanger sequencing (Azenta).

[0137] HIV2 cloning:

[0138] ttCsp1 was fused to the N-terminus of the HIV p66 protein via a 10-amino acid linker. The C-terminus of the p51 protein contains an 8×histidine tag (His8 tag). The gene fragment consisting of ttCsp1-p66-stop codon-T7 promoter-rbs-p51-His8 was synthesized by Twist and cloned into the pET28a vector at NcoI and XhoI restriction sites using the Gibson assembly method.

[0139] Protein expression and purification:

[0140] The plasmid was transformed into NiCo21(DE3) cells (NEB, Cat#C2529H). 400 ml of LB was seeded with overnight culture. Cells were grown at 37°C until OD600 reached 0.5–0.8, then induced overnight at 16°C with 0.2 mM IPTG. The next day, the cell pellet was incubated on ice for 20 min in lysis buffer (30 mM Tris 8.0, 10 mM imidazole, 200 mM NaCl, 2 mM MgCl2, 10% glycerol, 0.5% n-octyl β-d-thiopyranoside, 10 mg lysozyme). After adding DNase I, the cell lysate was centrifuged at 20,000 g for 1 h to clarify. 0.5 ml of Ni-NTA resin (Qiagen, Cat#30210) was added to the clarified lysate, and batch binding was performed at 4°C for 1 h. Ni-NTA resin was packed into an empty PD10 column (Cytiva, Cat#17043501) and washed with 100 ml of wash buffer (30 mM Tris 8.0, 30 mM imidazole, 300 mM NaCl, 5 mM MgSO4, 10% glycerol, 0.5 mM DTT). Proteins were eluted with 2.5 ml of elution buffer (30 mM Tris 8.0, 300 mM imidazole, 100 mM NaCl, 5 mM MgSO4, 10% glycerol, and 1 mM DTT), and loaded into a pre-equilibrated PD10 column (Cytiva, Cat#17085101) (equilibration buffer: 50 mM Tris 8.0, 75 mM KCl, 3 mM MgCl2, 10% glycerol, and 1 mM DTT), and eluted with 3.5 ml of the same equilibration buffer. The protein was then concentrated using an Amicon Ultra-430K (Millipore, Cat#UFC803096), and glycerol was added to achieve a final concentration of 50%. The protein was then aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C until further use. Before assays, protein concentrations were determined using the Bradford method (BioRad), and the concentrations of all groups were adjusted to be consistent.

[0141] Construction of λ and HCV RNA molecular weight standards (RNA ladder):

[0142] The pUC19 vector (NEB, Cat#N3041) was modified to include a T7 promoter, SpeI and PacI restriction enzyme sites, a 30 bp sequence immediately adjacent to the λ DNA, followed by an A sequence, a T7 terminator, and a NotI restriction endonuclease site. The DNA fragment was synthesized by Twist and pUC19 was inserted at the HindIII / XbaI site. The DNA sequence between HindIII and XbaI is AAGCTTGAAATTAATACGACTCACTATAGGGGACTAGTTTAATTAAGTGATCCGACAGGTTACGGGGTCCTGTCCGAAAAAAAAAGAAAAAAAAAAAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGGCGGCCGCTCTAGA (SEQ ID NO: 60). The final vector is pUC19T7A.

[0143] λDNA of different lengths (NEB, Cat#N3011) was obtained by PCR amplification and assembled into pUC19T7A from the SpeI site to obtain standard plasmids with molecular weights of 1, 2, 3, 5, 7, and 9 kb. The primers used for PCR are as follows:

[0144]

[0145] By digesting the 9 kb plasmid with PacI and inserting an approximately 6 kb λDNA fragment generated by PCR using the following primers, 15 kb molecular weight standard plasmids were generated: 5'- GGTCCTTTCCGGCAATCAGGCAGTTTAAT AGGGCTGACGTTTAACCAGAC (SEQ ID NO: 68) and 5'- CTGCGTGAGTATCCGTGAGAATAAGTGATCCGACAGGTTACGG (SEQ ID NO: 69).

[0146] To obtain the standard molecular weight sequence of hepatitis C virus (HCV) RNA, we first need to obtain the HCV genome. DNA fragment synthesis (Twist) was performed using the HCV genome sequence NC_004102.1, serotype 1a, and isolate H77 as templates. The fragments were then assembled into the pUC19 vector using HiFi DNA assembly premix (NEB E2621). Once the HCV genome was constructed, molecular weight standard plasmids could be generated using a method similar to that used for λ molecular weight standard plasmids. The primers used for PCR are as follows:

[0147]

[0148] The λ molecular weight standard plasmid was linearized using NotI (NEB R3189), and the HCV molecular weight standard plasmid was linearized using XbaI (NEB R0145). Plasmids were purified using the GFX PCR DNA and Gel Strip Purification Kit (Cytiva28903470), and RNA was transcribed using the HiScribe T7 High-Yield RNA Synthesis Kit (NEB E2040S). RNA was purified using the Monarch RNA Purification Kit (NEB T2050S). RNA concentration was measured using nanodrop, and RNA fragments of different sizes were mixed in equal volumes of 2 μg / μL to obtain the final molecular weight standards.

[0149] Reverse transcriptase assay:

[0150] The 10 μl assay solution was prepared as follows: 50 mM Tris 8.5, 50 mM KCl, 4 mM MgCl2, 0.5 mM dNTP, 80 μM poly T primer (5'-TTTTTTTTTTTTCTTTTTTTTTCGG) (SEQ ID NO: 77), 1 μg RNA molecular weight standard, 5 mM DTT, and 1 μl purification enzyme. The samples were incubated in a PCR instrument at different temperatures for different durations. At the end of the reaction, 2 μl of 0.5 M EDTA and 2 μl of 1 M NaOH were added, and the mixture was incubated at 95°C for 10 minutes to hydrolyze the RNA. The mixture was neutralized with 4 μl of 0.5 M HCl. 2 μl of RNA loading solution (enzyme-free assay system) and 2 μl of cDNA were mixed with 2x RNA loading dye (NEB B0363S) and analyzed on a 0.8% agarose TAE gel.

[0151] Example 2

[0152] This embodiment illustrates that fusing the cold shock protein (Csp) of *Thermus thermophilus* to the N-terminus of MMLV RT improves the sustained synthesis of reverse transcriptase. Specifically, Csp1 (ttCsp1) from the thermophilic microorganism *Thermus thermophilus* and RNase H inactivation mutants of MMLV RT (D524N, E562Q, D583N, D653N) (MMLVmut) were used. Initially, the linker used was Gly-Ser-Gly-Gly-Ser (SEQ ID NO: 49, located in the fusion protein Bos6C1).

[0153] To test the sustained synthesis capability of RT, we constructed molecular weight standards for λRNA (1, 2, 3, 5, 7, 9, and 15 kb) and molecular weight standards for hepatitis C virus (HCV) RNA (1, 2, 3, 5, 7, and 9 kb). All molecular weight standards could be reverse transcribed using universal polyT primers.

[0154] HCV RNA is known to have a complex folded structure (see Pirakitikulr et al., Mol Cell. 62(1):111-20 (2016); Quade et al., Nat Commun. 6:7646 (2015)), and is a more difficult substrate for reverse transcription (RT). Specifically, HCV RNA is a type of RNA rich in secondary structure, which is difficult to reverse transcribe at lower temperatures (such as 37°C, 42°C, etc.). To reverse transcribe HCV RNA, it is usually necessary to raise the temperature to unwind the secondary structure. However, as the temperature increases, the RT for transcribing HCV RNA must have higher thermostability. In this example, we demonstrate that our fusion protein can reverse transcribe HCV RNA at lower temperatures.

[0155] The reverse transcription activity of Bos6C1 was compared with that of commercially available RTs (SuperScript IV, Maxima H (both from ThermoFisher), and ProtoScript II (NEB)) using two molecular weight standards. The results showed that Bos6C1 had a significantly improved sustained synthetic capacity. Figure 1 Bos6C1 can reverse transcribe 9 kb RNA within 15 min at 42°C. After 30 min at 42°C, Bos6C1 can reach 15 kb, which is better than other RT methods. Figure 2 Furthermore, Bos6C1 can overcome the highly folded RNA structure in HCV RNA without increasing the reaction temperature. Within 15 minutes of reaction at 42°C, Bos6C can complete the synthesis of the entire HCV genome's first-strand cDNA, superior to other reverse transcriptases. Figure 3 ).

[0156] Example 3

[0157] This example illustrates the effect of adapter length on the RT function of the ttCsp1-MMLVmut fusion protein. To examine how adapter length affects fusion protein function, we constructed the following construct:

[0158]

[0159] like Figure 4As shown, the linker length does not affect the function of the fusion protein. Furthermore, ttCsp1 can fuse to the C-terminus of MMLVmut (Bos6C7) to improve the sustained synthesis ability of MMLVmut. Figure 5 ).

[0160] Table 4. Sequences of ttCsp1-MMLV fusion proteins with different linkers

[0161]

[0162] Example 4

[0163] This example illustrates that ttCsp1 can also improve the sustained synthesis of HIV1 RT. To test whether ttCsp1 contributes to the sustained synthesis of other RTs, we chose HIV1 RT because it is the most extensively studied viral RT. HIV1 RT has two subunits: p66 and p51. p51 is a proteolytic cleavage product of p66. Together, they form a tight complex, and both parts are essential for the stability and function of HIV1 RT. Structurally, the N-terminus of p66 in HIV1 RT (PDB 4B3O) is closer to the active site. Therefore, we fused ttCsp1 to the N-terminus of the HIV1 p66 subunit (cHIV1). Figure 6 As shown, cHIV1 can reverse transcribe RNA fragments that are much longer than the HIV1 RT itself, which demonstrates that ttCsp1 fusion can serve as a general strategy to improve the continuous synthetic capacity of RT.

[0164] Table 5. Sequences of HIV1 RT subunits

[0165]

[0166] Example 5

[0167] This example illustrates that other Csp besides ttCsp1 can also improve the sustained synthesis capability of RT.

[0168] Cold shock proteins are abundant (see Yu et al., Int J Mol Sci. 20(16):4059 (2019)). *E. coli* has nine genes (CspA to CspI) encoding proteins with similar folding and function. ecCspA has been shown to be an RNA chaperone (see Jiang et al., J Biol Chem. 272(1):196-202 (1997)), while the functions of other ecCsp proteins remain unclear. The DNA dT6 crystal structure of *Bacillus subtilis* CspB (see Max et al., J Mol Biol. 360(3):702-14 (2006)) shows that the important interaction between Csp and nucleic acids is base stacking onto hydrophobic residues, while there is no significant interaction with the nucleic acid backbone. Therefore, we hypothesize that all Csp proteins with similar folding and correctly positioned hydrophobic residues can be fused with MMLVmut to improve their sustained synthetic capacity, regardless of the biological function of Csp in vivo and the nature of the nucleic acid they bind to. To demonstrate this, a series of different Csp fusions with MMLVmut were constructed, all located at the N-terminus of MMLVmut with a 5-amino acid linker (GSGGS, SEQ ID NO:41). (ec = *Escherichia coli*, ah = *Actinomadura harenae*)

[0169] Table 6. MMLVs fused with Csp of Escherichia coli or Actinobacter madurae

[0170]

[0171] Table 7. Sequences of MMLVs fused with Csp of Escherichia coli or Actinobacter madurae

[0172]

[0173] All fusion proteins showed improved sustained synthetic capacity, similar to Bos6C1. Figure 7 and Figure 8 Furthermore, various residues crucial for nucleic acid interactions were identified in the bsCspB structure (see Max et al., J MolBiol. 360(3):702-14). Based on sequence alignment ( Figure 9 Mutation studies were conducted on Bos6C1 to demonstrate the importance of these residues in improving the sustained synthesis capability of fusion RT in the ttCsp1 context. Figure 10The results showed that single or multiple mutations of important and conserved nucleic acid binding residues reduced the sustained synthesis capacity of fusion RTs, but did not completely eliminate the improvement relative to MMLVmut alone, indicating that multiple residues are involved in nucleic acid binding. Improving the K-response of bsCspB to dT6... D The mutations in (Max et al., J Mol Biol. 360(3):702-14, Table 4) showed a general correlation with mutations that reduced the ability of fusion RT to transcribe longer RNA fragments, suggesting that the RNA interaction mechanism utilized by ttCsp1 in fusion RT proteins is similar. However, compared to MMLVmut, the Csp mutant still showed improved sustained synthesis capacity, indicating that the smaller Csp protein folds utilize multiple residues for nucleic acid binding.

[0174] Example 6

[0175] Given previous reports that binding Csp to RT in reverse transcription enhances RT activity (see WO2009 / 108949A2), we compared the sustained synthetic capacity of the fusion proteins disclosed in this paper with that of combinations of free Csp (ecCspA and ttCsp1, respectively) and RT. Figure 11 and Figure 12 As shown, although the fusion protein improves the ability to continuously synthesize long RNA templates for reverse transcription, free Csp actually hinders the reverse transcription of longer RNA fragments.

[0176] In summary, the Csp protein folding structure uniquely recognizes nucleic acid fragments in a sequence- and backbone-independent manner through the stacking interactions between hydrophobic protein residues and nucleic acid bases. This property can be used to help reverse transcriptase locate RNA, improve its binding to RNA, and unfold the RNA structure, thereby improving the overall sustained synthesis capacity of RT.

[0177] Example 7

[0178] This example illustrates that Csp-like domains in eukaryotic proteins can enhance shock response (RT). We fused three types of cold shock domains derived from human proteins YBX1, YBX2, and CSDE1a to MMLV RT, respectively. Figure 13 As shown, Csp-like domains in eukaryotic proteins can also improve RT activity.

[0179] It is worth noting that YBX1 or YBX2 has a structural motif (SEQ ID NO: 1), an RNP1 motif (SEQ ID NO: 2), and an RNP2 motif (SEQ ID NO: 3); CSDE1a has an RNP1 motif (SEQ ID NO: 2). Figure 10 and 13The results demonstrate that RNP1 and RNP2 play a crucial role in enhancing sustained synthesis capacity. Regardless of domain / protein origin, Csp-type folds and their nucleic acid-interacting residues are key to improving sustained synthesis capacity.

[0180] Table 7. MMLVmut fused with eukaryotic Csp-like domains

[0181]

[0182] Example 8

[0183] This example illustrates that DNA polymerases Bst, CA2, and CST exhibit enhanced RNA synthesis capabilities upon fusion with Csp.

[0184] like Figure 14 As shown, ttCsp1 can fuse with Bst, CA2, and CST DNA polymerases, which also possess reverse transcriptase activity, thereby enhancing the polymerases' sustained synthesis of RNA substrates (0.3 kb, 0.5 kb, and 1 kb). These DNA polymerases themselves are almost incapable of reverse transcribing 0.3 kb RNA substrates within 60 min at 50°C. Through ttCsp1 fusion, cBst, cCA2, and cCST can be easily reverse transcribed to 1 kb under the same conditions.

[0185] Table 8. Fusion sequences of Bst, CA2, CST and their ttCsp1 sequences

[0186]

[0187] Example 9

[0188] The Bos6C series can be reverse transcribed at 42°C. This temperature is more favorable for RNA stability compared to higher temperatures. However, if a higher reaction temperature is required, the MMLVmut portion of Bos6C can be mutated to improve its thermal stability at higher temperatures. Figure 15 Examples of Bos6C1 (Bos6C1ts1, Bos6C1ts2, and Bos6C1ts7) and Bos6C4 (Bos6C4ts3, Bos6C4ts4, Bos6C4ts5, and Bos6C4ts6) are given. These variants exhibit better reverse transcription performance than Bos6C1 at 50°C.

Claims

1. A fusion protein, said fusion protein comprising: (a) Reverse transcriptase RT; and (b) The cold shock protein Csp operatively linked to the RT.

2. The fusion protein according to claim 1, wherein the Csp is linked to the N-terminus of the RT.

3. The fusion protein according to claim 1, wherein the Csp is connected to the C-terminus of the RT.

4. The fusion protein according to claim 1, wherein the RT is selected from the group consisting of: MMLV RT, AMV RT, HIV RT, WDSV RT, RSV RT, ASLV RT, REV-T RT, MAV RT, and RAV RT.

5. The fusion protein according to claim 1, wherein the RT is selected from the group consisting of: Tth DNA polymerase, Tfl DNA polymerase, Tfi DNA polymerase, Tma DNA polymerase, Tne DNA polymerase, Z05 DNA polymerase, JDF-3 DNA polymerase, Bst DNA polymerase, Bca DNA polymerase, CA2 DNA polymerase, and CST DNA polymerase.

6. The fusion protein according to claim 1, wherein the RT has an amino acid sequence selected from any one of SEQ ID NOs: 40-48, or a sequence that is at least 80% identical to it and has reverse transcriptase activity.

7. The fusion protein of claim 1, wherein the Csp comprises a cold shock domain CSD, the CSD comprising at least one motif having a general formula selected from the group consisting of: (1) G-X1-X2-K-X3-F-X4 (SEQ ID NO: 1), (2) X5-G-X6-G-X7-I (SEQ ID NO: 2), (3) X8-X9-X 10 -X 11 -X 12 (SEQ ID NO: 3), (4) X 13 -X 14 -X 15 -X 16 -X 17 -X 18 -X 19 -X 20 -X 21 -X 22 -X 23 -X 24 -X 25 (SEQ ID NO: 4), or (5) X 26 -GX 27 -X 28 -AX 29 -X 30 -X 31 (SEQ ID NO: 5), where: X1 can be T, I, V, Q, N, L, K, or R; X2 can be V, L, A, G, or I; X3 can be F, T, Y, H, M, or W; X4 can be N, T, S, or D; X5 can be K, R, S, D, E, N, Q, T, H, or Y; X6 is F, Y, W, L, V, A, I, M, H, R or K; X7 is F, Y, W, L, V, A, I, M or H; X8 can be V, A, I, L, M, F, or W; X9 is F, Y, W, H, Q, L, V, I, M or A; X 10 It can be A, I, L, M, F, V, or W; X 11 For H, Y, F, L, M, V, I, W, Q, or A; X 12 It can be Y, W, L, F, M, V, I, Q, H, or A; X 13 It can be G, D, N, or E; X 14 For F, I, L, A, or Y; X 15 It can be K, P, Q, E, or R; X 16 For T, A, E, V, or S; X 17 For L, P, or I; X 18 It can be E, D, T, I, A, F, N, or K; X 19 The options are E, Q, T, P, A, or D; X 20 For G or N; X 21 It can be Q, M, T, L, E, or D; X 22 For K, R, N, E, S, Q, T, L, V, A, or I; X 23 For V or I; X 24 For E, S, T or Q; X 25 For Y or F; X 26 For K or R; X 27 It can be P, L, N, Y, or A; X 28 It can be Q, K, S, T, A, or H; X 29 It can be A, V, T, S, G, R, or E; X 30 For N, E, K, V, C, R, H, G, D, or S; X 31 It can be V, L, or I.

8. The fusion protein according to claim 1, wherein the Csp is selected from the group consisting of: ahCsp, abCsp, adCsp, atCsp, bbCspD, bsCspC, bsCspD, bsCpsB, bpCspA, ecCspA, ecCspB, ecCspC, ecCspD, ecCspE, ecCspF, ecCspG, ecCspH, ecCspI, mtCspA, msCsp, svCspA, tgCsp, tgemCsp, txCsp, tCsp, tglyCsp, tsCsp, tbCsp, vcCspD, YBX1, YBX2, and CSDE1a.

9. The fusion protein according to claim 1, wherein the Csp has an amino acid sequence selected from any one of SEQ ID NOs: 7-39 or a sequence having at least 30% identity with it.

10. The fusion protein of claim 1, wherein the Csp is connected to the RT via a connector.

11. The fusion protein of claim 10, wherein the linker has an amino acid sequence selected from G, PG, GSG or SEQ ID NOs:49-59.

12. The fusion protein according to claim 1, wherein the fusion protein has an amino acid sequence selected from any one of SEQ ID NOs: 78-83, 86-92, 94, 96, 98-100, 101, 102, 103, 104, 105 or a sequence having at least 80% identity with it; Optionally, the fusion protein has improved reverse transcription and sustained synthetic activity.

13. The fusion protein according to claim 1, wherein the fusion protein has improved reverse transcription activity or sustained synthetic activity.

14. A polynucleotide encoding a fusion protein according to any one of claims 1 to 13.

15. A vector comprising the polynucleotide according to claim 14.

16. A recombinant host cell suitable for producing proteins, said recombinant host cell comprising the polynucleotide according to claim 14.

17. A kit for reverse transcription reaction, the kit comprising a fusion protein according to any one of claims 1 to 13 and a reaction buffer.

18. The kit according to claim 17, wherein the kit further comprises primers.

19. A method for synthesizing DNA, the method comprising: Under conditions suitable for reverse transcription of the fusion protein according to claim 1, the fusion protein is incubated with an RNA template and primers to synthesize a DNA strand complementary to the RNA template.

20. The method of claim 19, wherein the primer is an oligo(dT) primer, a random sequence primer, or a combination thereof.

Images