Genes, primers and application for identifying imperator star and east star and tiger star

CN122503521APending Publication Date: 2026-08-04SANYA INST OF OCEANOGRAPHY OCEAN UNIV OF CHINA +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611010884.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-08
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

目前市场供应几乎全部依赖野外捕捞,但由于野生资源本身数量有限,且长期捕捞导致资源日益稀缺,亟需建立稳定的人工繁育技术体系,以实现种质资源保护和产业化开发利用

Benefits of technology

[0012] The advantages of this invention compared to existing technologies are as follows: This invention abandons the conventional, time-consuming mitochondrial gene (COI/ND2) sequencing and alignment method. Through an innovative bioinformatics analysis strategy combining whole-genome sequence sliding window cutting and double rigorous alignment (minimap2 and BLASTn), it accurately identifies a highly reliable and specific sequence fragment (SEQ ID NO. 1) unique to the Emperor Star Spotted Fish and completely absent in easily confused closely related species (such as the Eastern Star Spotted Fish). Based on this target, a PCR amplification technology has been developed that not only completely solves the systemic defect of traditional mitochondrial gene sequencing, which can only identify the maternal parent and cannot identify hybrids, but also allows for intuitive result determination through ordinary PCR amplification combined with agarose gel electrophoresis. This method significantly reduces the identification time from the traditional 2-3 days to several hours, greatly meeting the industrial production needs for large-scale, high-efficiency screening of hundreds or thousands of candidate Emperor Star Spotted Fish broodstock, and laying an absolutely pure genetic foundation for the breeding system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122503521A_ABST
    Figure CN122503521A_ABST
Patent Text Reader

Abstract

The present application relates to a kind of gene, primer and application for identifying emperor star and east star and tiger spot, belong to aquaculture field, the gene is high credibility specific fragment, the nucleotide sequence of the specific fragment is as shown in SEQ ID NO.1, the primer for identifying emperor star and east star and tiger spot is as shown in SEQ ID NO.2-3. Using the primer of the primer for the suspected individual to be detected, using the primer for PCR amplification, it is emperor star for 174 bp band, east star and tiger spot cannot amplify band.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of aquaculture, specifically relating to a gene, primer, and application for identifying the Emperor Star Spotted Grouper, Eastern Star Spotted Grouper, and Tiger Spotted Grouper. Background Technology

[0002] Emperor Star-shaped Perch (Black Saddle-gill Spiny Perch) Plectropomus laevis This is a large and extremely rare high-quality grouper, prized not only for its delicious flesh and high economic value, but also for its vibrant colors and ornamental appeal. Currently, market supply relies almost entirely on wild catches. However, due to the limited number of wild resources and the increasing scarcity caused by long-term fishing, there is an urgent need to establish a stable artificial breeding technology system to achieve the protection of germplasm resources and their industrial development and utilization.

[0003] However, the industry faces multiple technical bottlenecks when introducing these extremely precious wild-caught emperor grouper into indoor artificial breeding systems. Wild emperor grouper exhibit variations in body color and markings across different sea areas and growth stages, making them easily confused with closely related species such as the leopard-gill sea bass. Relying solely on traditional morphological methods is insufficient to guarantee the absolute purity of the original germplasm, easily leading to mixed breeding populations and affecting germplasm preservation and subsequent propagation. Therefore, there is an urgent need to establish a method that integrates precise molecular identification to ensure the germplasm purity of breeding populations, laying a technical foundation for the protection of emperor grouper germplasm resources and fully artificial breeding. Summary of the Invention

[0004] The purpose of this invention is to provide a primer for identifying the emperor star-shaped stellate, the eastern star-shaped stellate, and the tiger star-shaped stellate, and its application.

[0005] This invention is achieved through the following technical solution: A gene for identifying Emperor Star Spotted ...

[0006] A primer set for identifying emperor star-shaped stellate ...

[0007] The present invention also provides a method for identifying Emperor Star Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted Spotted with PCR amplification using the primer set. Spotted ...

[0008] Furthermore, the PCR amplification reaction system includes: 2 μL of genomic DNA with a final concentration of 100 ng / μL; 1 μL of forward primer with a final concentration of 10 μM; 1 μL of reverse primer with a final concentration of 10 μM; 10 μL of 2×Rapid Taq Plus Master Mix; and sterile double-distilled water to a final volume of 20 μL.

[0009] Furthermore, the PCR amplification reaction conditions are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 20 s, for a total of 35 cycles from denaturation to extension; 72℃ full extension for 5 min; and storage at 4℃.

[0010] The present invention also provides the application of the gene-specific fragments or primers in the identification of Emperor Star Spot, Eastern Star Spot and Tiger Spot.

[0011] Furthermore, the application can be used for the artificial breeding of Emperor Star Spot. In order to ensure the purity of the Emperor Star Spot variety, the morphological characteristics are first identified. Individuals with indistinct morphological characteristics are identified using the specific fragments or primers.

[0012] The advantages of this invention compared to existing technologies are as follows: This invention abandons the conventional, time-consuming mitochondrial gene (COI / ND2) sequencing and alignment method. Through an innovative bioinformatics analysis strategy combining whole-genome sequence sliding window cutting and double rigorous alignment (minimap2 and BLASTn), it accurately identifies a highly reliable and specific sequence fragment (SEQ ID NO. 1) unique to the Emperor Star Spotted Fish and completely absent in easily confused closely related species (such as the Eastern Star Spotted Fish). Based on this target, a PCR amplification technology has been developed that not only completely solves the systemic defect of traditional mitochondrial gene sequencing, which can only identify the maternal parent and cannot identify hybrids, but also allows for intuitive result determination through ordinary PCR amplification combined with agarose gel electrophoresis. This method significantly reduces the identification time from the traditional 2-3 days to several hours, greatly meeting the industrial production needs for large-scale, high-efficiency screening of hundreds or thousands of candidate Emperor Star Spotted Fish broodstock, and laying an absolutely pure genetic foundation for the breeding system. Attached Figure Description

[0013] Figure 1 The image shown is of Emperor Star Spot in a specific embodiment of the present invention; Figure 2 The image shown is of a star-shaped polka dot in a specific embodiment of the present invention; Figure 3 This is an image of a tiger stripe in a specific embodiment of the present invention; Figure 4This is a diagram showing the results of the first agarose gel electrophoresis in Example 1 of the present invention; where M is the marker, 1-2 are the genomic DNA of the caudal fin tissue of the individual to be tested, 3-4 are the genomic DNA of the caudal fin tissue of the individual to be tested, and 5-6 are the genomic DNA of the caudal fin tissue of the individual to be tested. Figure 5 The image shows the results of the second agarose gel electrophoresis in Example 1 of this invention; where M is the marker; 1 is the genomic DNA of the Eastern Star Spot, with no band; 2 is the genomic DNA of the tail fin tissue of the Emperor Star Spot, with a single and clear specific amplification band at 174bp; and 3 is the genomic DNA of the Tiger Spot, with no band. Detailed Implementation

[0014] The technical solution of the present invention will be further explained below through embodiments, but the scope of protection of the present invention is not limited in any way by the embodiments.

[0015] (1) Source of sample materials The Emperor Star Spotted Fish was caught in the Xisha Islands waters of the South China Sea in March 2025. Figure 1 As shown.

[0016] The grouper was purchased from Hainan Lingshui Chengxin Delin Aquatic Breeding Co., Ltd. Figure 2 As shown.

[0017] The tiger grouper was purchased from Hainan Lingshui Chengxin Delin Aquatic Breeding Co., Ltd. Figure 3 As shown.

[0018] (2) Sources of reagents and consumables Table 1. Sources and Product Codes of Reagents and Consumables Required for the Experiment ; ; (3) The sources of the instruments and equipment are shown in Table 2; Table 2. Sources and Models of Instruments and Equipment Required for the Experiment .

[0019] Example 1 This embodiment provides a method for germplasm identification of wild emperor star-shaped variegated plants, the method comprising the following steps: S1. Extract genomic DNA from the tail fin tissue. The specific steps are as follows: Live fish that initially matched the morphological characteristics of the Emperor Star Grouper were selected from wild-caught individuals and used as reserve broodstock. These reserve broodstock were individually held and numbered, and a small amount of caudal fin tissue was harvested from each. Similarly, small amounts of caudal fin tissue were also harvested from wild-caught Eastern Star Grouper and Tiger Grouper. Genomic DNA was extracted from the caudal fin tissue using a marine animal genome extraction kit (Tiangen Biochemical; all reagents and consumables described below are from this kit). The DNA extraction steps are as follows: (1) Sample pretreatment: The tail fin tissue was powdered using liquid nitrogen fumes. 30 mg of tail fin tissue powder was weighed and 200 μL of GA buffer was added to a centrifuge tube. The mixture was gently mixed and shaken for 15 seconds to ensure that the tail fin tissue was completely infiltrated.

[0020] (2) Proteinase K digestion: Add 20 μL of Proteinase K solution (20 mg / mL) to a centrifuge tube, mix thoroughly, and incubate in a metal bath at 55°C until the tail fin tissue is completely dissolved.

[0021] (3) Pyrolysis and precipitation: Add 200 μL of GB pyrolysis solution, mix thoroughly, place in a 70℃ metal bath for 10 min, and then add 200 μL of anhydrous ethanol and mix well.

[0022] (4) Adsorption column purification: Transfer the mixture to a CB3 adsorption column, place it in a collection tube, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid. Then add 500 μL of GD buffer and 600 μL of PW wash buffer, centrifuge for 30 seconds each time, and wash the adsorption column to remove impurities.

[0023] (5) Drying the adsorption column: Place the cleaned adsorption column back into the centrifuge tube, centrifuge at 12,000 rpm for 2 min, and then let it stand at room temperature for 2-5 min to ensure that the ethanol in the adsorption column is completely evaporated.

[0024] (6) DNA elution: Place the adsorption column into a new centrifuge tube, add 50~200μL of sterile water to the middle of the adsorption column, let it stand at room temperature for 2min, then centrifuge at 12000rpm for 2min and collect the eluted DNA solution.

[0025] (7) Quality Inspection and Preservation: Use a spectrophotometer to detect the concentration and purity of DNA to ensure OD 260 / OD 280 Between 1.8 and 2.0, OD 260 / OD 230 Greater than 2.0.

[0026] The final concentrations of genomic DNA from the caudal fin tissues of Emperor Starfish, Eastern Starfish, and Tiger Starfish were all 80-220 ng / μL. The genomic DNA from the caudal fin tissues of the three fish species were detected by 1.2% agarose gel electrophoresis. The remaining genomic DNA from the caudal fin tissues was stored at -20℃ for later use.

[0027] The results of the first agarose gel electrophoresis are as follows: Figure 4 As shown, M is the marker, lanes 1-2 contain genomic DNA from the caudal fin tissue of the individual to be tested (Emperor Star Spot), lanes 3-4 contain genomic DNA from the caudal fin tissue of the individual to be tested (Eastern Star Spot), and lanes 5-6 contain genomic DNA from the caudal fin tissue of the individual to be tested (Tiger Spot). The DNA is intact and can be used for subsequent experiments.

[0028] S2. Screening for highly reliable and specific fragments of Emperor Star Spot, the specific steps are as follows: (1) The genomic DNA of the Emperor Star Spotted Caudal Fin Tissue prepared in step S1 above was sent to Novogene Biotechnology Co., Ltd. for sequencing to obtain the sequencing data of the Emperor Star Spotted Caudal Fin Tissue genome.

[0029] (2) Extract the exon and intron sequences of all genes in the sequencing data of the Emperor Star Spot genome obtained in step (1) above, and organize them into FASTA format files.

[0030] The specific steps are as follows: FastP v0.23.2 was used to perform quality control and filtering on the sequencing data of the Emperor Star genome obtained in step (1) above; based on PacBio HiFi high-precision long read data and combined with Hi-C clean reads, haplotype-resolved initial assembly was performed using hifiasm v0.20.0-r639 to obtain contig-level genome sequences. On this basis, purge_dups v1.2.5 was used to remove redundant haplotype sequences and overlapping regions to improve the accuracy of assembly and single-copy integrity; Hi-C clean reads were further aligned to the assembly results through the Juicer pipeline (restriction endonuclease was MboI) to construct a chromosome interaction matrix, and chromosome-level scaffolds were constructed for the contigs using 3D-DNA v180114. Subsequently, Juicebox v1.11.08 was used to perform manual visualization correction on the assembly results to correct potential mis-splicing regions; to further improve genome continuity, TGS GapCloser was used. v1.2.1 (parameter: --min_idy0.05) uses HiFi data to fill the gaps in the assembly; finally, Merqury v1.3 is used to evaluate the quality of the assembly results, and the accuracy of the genome bases is quantitatively evaluated by calculating the QV value, thereby obtaining a chromosome-level genome assembly result with high continuity and high accuracy, that is, the FASTA format file of the Emperor Star Spot reference genome.

[0031] In some specific implementations, the data in the FASTA format file can also be directly processed by the sequencing company (Novogene Biotechnology Co., Ltd.), which can also produce a completely consistent FASTA format file of the Emperor Star reference genome.

[0032] Currently, the reference genome of Emperor Star Spot has not been published on NCBI, but those skilled in the art can obtain the reference genome of Emperor Star Spot by following the sequencing and processing steps described above.

[0033] (3) Using the sliding window method (seqkit sliding tool), the sequence in the FASTA format file of the reference genome of the Emperor Star Grouper obtained in step (2) above is divided into overlapping fragments with a length of 300 bp and a step size of 100 bp; and the 300 bp fragment obtained after segmentation is used as the query sequence. The whole genome is compared with the reference genome of the closely related species, the Leopard Gill Sea Bass (YSFRI_Pleo_2.0 GCF_008729295.1 on NCBI) and the reference genome of the common grouper, the Tiger Grouper (Brown Spotted Grouper) (E.fuscoguttatus.final_Chr_v1 GCF_011397635.1 on NCBI), in the short sequence mode (-xsr) using minimap2 (v2.30) software.

[0034] (4) Based on the whole genome alignment results in step (3) above, extract the sequences that did not produce any valid alignment (i.e., alignment flag=4) as candidate fragments; and perform BLASTn secondary alignment to strictly verify the above candidate fragments, and completely eliminate sequences that can be detected as homologous matches in the genomes of East Star and Tiger Spot.

[0035] Finally, the 300 bp sequence that was not significantly matched by both minimap2 and BLASTn alignment strategies was identified as a "highly reliable specific fragment" unique to Emperor Star and missing in closely related species (Eastern Star and Tiger Star). The sequence of the highly reliable specific fragment is shown in SEQ ID NO.1.

[0036] SEQ ID NO.1 is located at position 9366244-9366543 on chromosome 24 in the Emperor Star Spot genome obtained in step (2) above, which has not yet been published on NCBI, and is marked as Chr24_9366244-9366543.

[0037] Therefore, those skilled in the art are fully capable of performing whole-genome alignment by using the reference genome of the introduced closely related species (Eastern Star and Tiger Spot) published on NCBI with the steps disclosed in the above steps (1)-(3), and are fully capable of obtaining highly reliable specific fragments that are unique to the Emperor Star and missing in closely related species (Eastern Star and Tiger Spot). Specific fragment (SEQ ID NO.1): TTATCCACCTCTTTTTATTCAAGTTAAAAGTGACTTAATATTGTAAATAAAGCCTTAGAAAGGCAAATCACGTTTAAAACCACCAAATGTCCCAAAATGTCAGATCAAAATTCTACTCGTTGA AAAGGGGGTCGGTCTCGTATACAGTAATAATATTTTTCATGTACAAGAGGTTTATTGTCACGCCTTCATATTTAGTGCCACTGTCATTGATAATTCTTTACAGTTTTGCTTGTCCCTCTAAATCTCCAGTTCTTCTGAATGCAATCATTT TCAGGACAAGTCAAACAAATGTGT GAGA; S3. Primer design and PCR amplification reaction, the specific steps are as follows: 1. Using Primer 3, specific primers were designed for the high-confidence specific fragment (SEQ ID NO.1) obtained in step S2 above, and then the specificity was checked across the entire genome using Tbtools software: Forward primer F: SEQ ID NO.2: 5'-AAAGGGGGTCGGTCTCGTAT-3'; Reverse primer R: SEQ ID NO.3: 5'-ACACATTTGTTTGACTTGTCCTGA-3'.

[0038] The designed forward primer F and reverse primer R were sent to Beijing Qingke Biotechnology Co., Ltd. for primer synthesis, which will be used for subsequent PCR amplification reactions.

[0039] 2. Using the genomic DNA from the Emperor Star-shaped Caudal Fin Tissue, the Eastern Star-shaped Caudal Fin Tissue, and the Tiger-shaped Caudal Fin Tissue obtained in step S1 above as templates, PCR amplification reactions were performed respectively using the synthesized specific primers (SEQ ID NO.2 and SEQ ID NO.3). Specific steps are as follows: (1) The PCR amplification reaction system (20 μL system) is designed as follows: Genomic DNA from caudal fin tissue (100 ng / μL), 2 μL; Forward primer F (10 μM), 1 μL; Reverse primer R (10 μM), 1 μL; 2× Rapid Taq Plus Master Mix, 10 μL; Add sterile double-distilled water to a final volume of 20 μL.

[0040] (2) The PCR amplification reaction procedure is as follows: Pre-denaturation at 94℃ for 5 minutes; Denaturation at 94℃ for 30 seconds; Anneal at 58℃ for 30 seconds; The denaturation and extension program was performed at 72°C for 20 seconds, with a total of 35 cycles. Extend the heat at 72℃ for 5 minutes. Store at 4℃.

[0041] After the PCR amplification reaction was completed, the PCR amplification products were obtained, and the PCR amplification products were detected by 1.2% agarose gel electrophoresis.

[0042] The results of the second agarose gel electrophoresis are as follows: Figure 5 As shown, M is the marker; 1 is the genomic DNA of the Eastern Star Spot, which has no band; 2 is the genomic DNA of the tail fin tissue of the Emperor Star Spot, which has a single and clear specific amplification band at 174 bp; and 3 is the genomic DNA of the Tiger Spot, which has no band.

[0043] The results showed that the pure Emperor Star Spotted Plant could be specifically identified using the specific amplification primers SEQ ID NO.2 and SEQ ID NO.3. However, the closely related species, Eastern Star Spotted Plant and Tiger Spotted Plant, could not be identified.

Claims

1. A gene for identifying emperor star-shaped spots from eastern star-shaped spots and tiger spots, characterized in that, The gene is a high-confidence-specific fragment, and the nucleotide sequence of the high-confidence-specific fragment is shown in SEQ ID NO.

1. Individuals possessing the high-confidence-specific fragment are Emperor Star Spots.

2. A primer for identifying the emperor star-shaped stellate horn, the eastern star-shaped stellate horn, and the tiger stellate horn, characterized in that, The sequences of the primers are shown in SEQ ID NO.2-3.

3. A method for identifying Emperor Star Spotted ... The method involves extracting DNA from suspected Emperor Star Spot, and then using the primers to perform PCR amplification on the DNA of the sample to be tested. The sample that produces a 174bp band is Emperor Star Spot, while the Eastern Star Spot and Tiger Star Spot cannot produce bands.

4. The method according to claim 3, characterized in that, The PCR amplification reaction system includes: 2 μL of genomic DNA with a final concentration of 100 ng / μL; 1 μL of forward primer with a final concentration of 10 μM; 1 μL of reverse primer with a final concentration of 10 μM; 10 μL of 2×Rapid Taq Plus Master Mix; and sterile double-distilled water to a final volume of 20 μL.

5. The method according to claim 3, characterized in that, The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 20 s, for a total of 35 cycles from denaturation to extension; 72℃ extension for 5 min; and storage at 4℃.

6. The use of the gene of claim 1 or the primer of claim 2 in the identification of Emperor Star Spot, Eastern Star Spot, and Tiger Spot.