Multifunctional nanodiagnosis and treatment probe and preparation method and application thereof

Abstract

The application discloses a multifunctional nanodiagnosis and treatment probe and a preparation method and application thereof, and belongs to the technical field of nanobiomedicine and tumor molecular diagnosis and treatment. The multifunctional nanodiagnosis and treatment probe is prepared by the following steps: coating mesoporous silica on the surface of a core-shell structure upconversion nanoparticle, then adsorbing platinum particles and methylene blue into the mesoporous silica, then modifying polydopamine to the surface of the mesoporous silica coated core-shell structure upconversion nanoparticle on which the platinum particles and the methylene blue are adsorbed, and finally linking nucleic acid PH1 chains and EH2 dendrites to the surface of the upconversion nanoparticle and dispersing and preparing by using a PBS buffer. The multifunctional nanodiagnosis and treatment probe prepared by the application can not only realize specific recognition, quantitative detection and in-situ imaging of a target microRNA, but also can form a synergistic tumor treatment mode of "photodynamic therapy-optical thermal therapy-oxygen enhancement", and has a wide application prospect in early tumor screening, curative effect evaluation and individualized treatment.

Description

Technical Field

[0001] This invention belongs to the field of nanobiomedicine and tumor molecular diagnosis and treatment technology, specifically relating to a multifunctional nanodiagnostic probe for specific recognition imaging, quantitative detection and synergistic treatment of tumors, its preparation method and application. Background Technology

[0002] MicroRNAs, as a key class of non-coding RNAs, participate in multiple biological processes such as tumorigenesis, development, metastasis, and drug resistance by regulating target gene expression, and have become important biomarkers for early tumor diagnosis and targeted therapy. Among them, microRNA-21 exhibits abnormally high expression in various malignant tumors such as breast cancer, lung cancer, and cervical cancer. Its expression level is closely related to tumor invasiveness and clinical prognosis. Accurate detection of the spatiotemporal distribution and expression abundance of microRNA-21 is of great significance for early tumor screening, efficacy evaluation, and personalized treatment.

[0003] However, traditional microRNA detection methods have many limitations. For example, fluorescence in situ hybridization (FISH) is complex and lacks sufficient sensitivity; reverse transcription polymerase chain reaction (RTP) relies on cell lysis and cannot achieve live-cell in situ imaging; single-activation fluorescent probes are easily affected by interfering substances in the cytoplasm, resulting in non-specific reactions and signal leakage, making it difficult to distinguish tumor cells from normal cells; at the same time, most probes only have detection functions and lack synergistic therapeutic effects, failing to meet the clinical needs of integrated precision diagnosis and treatment. Furthermore, while photodynamic therapy, as a minimally invasive treatment, has advantages such as strong targeting and few side effects, the hypoxic nature of the tumor microenvironment severely limits the generation efficiency of reactive oxygen species, reducing treatment efficacy. Therefore, developing multifunctional nanoprobes that integrate highly specific detection and imaging with efficient synergistic therapy is key to solving these bottlenecks. Summary of the Invention

[0004] The purpose of this invention is to provide a multifunctional nanotherapeutic probe, its preparation method, and its applications. The multifunctional nanotherapeutic probe prepared by this invention can not only achieve specific recognition, quantitative detection, and in-situ imaging of target microRNA, but also form a synergistic tumor treatment mode of "photodynamic therapy-photothermal therapy-oxygen enhancement," showing broad application prospects in early tumor screening, efficacy evaluation, and personalized treatment.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides a multifunctional nano-therapeutic probe, comprising:

[0007] Core-shell upconversion nanoparticles;

[0008] A mesoporous silica layer covering the surface of the conversion nanoparticles on the core-shell structure;

[0009] Platinum particles and methylene blue adsorbed in the mesoporous silica layer;

[0010] A polydopamine layer modified on the surface of the mesoporous silica layer; and

[0011] Nucleic acid PH1 and nucleic acid EH2 chains grafted onto the surface of the polydopamine layer;

[0012] The nucleic acid PH1 chain contains a photolytic linker; the nucleic acid EH2 chain contains an endonuclease APE1 binding site.

[0013] Further, the sequence of the nucleic acid PH1 chain is: TAGCTT / iPCLink / TCAGACTGA / iCy3dT / GTTGAACAGGTCTCAACATCAGTCTGATAAGCTA; the sequence of the nucleic acid EH2 chain is: GACCTGTTCAACA / iCy5dT / CAGTCTGATAGCTTATCAGACTGATGTTGA / AP site / ACAGGTC.

[0014] Furthermore, the nucleic acid PH1 chain contains the following functional regions: (1) the TAGCTT segment is a locking sequence used to prevent the target microRNA-21 chain from binding to the nucleic acid PH1 chain; (2) the iPCLink segment is a photolytic linker used to break the locking sequence under ultraviolet light irradiation; (3) the TCAGACTGA segment and the GTTGAACAGGTCTCAACATCAGTCTGATAAGCTA segment are recognition sequences used to specifically bind to the target microRNA-21 chain and the nucleic acid EH2 chain; (4) the iCy3dT segment is a fluorescent dye used to absorb incident light with a wavelength of 535 nm and transfer the fluorescent dye to the nucleic acid EH2 chain through fluorescence resonance energy.

[0015] Furthermore, the nucleic acid EH2 chain contains the following functional regions: (1) the GACCTGTTCAACA and CAGTCTGATAGCTTATCAGACTGATGTTGA segments are recognition sequences used to specifically bind to the recognition sequence of the nucleic acid PH1 chain; (2) the iCy5dT segment is a fluorescent dye used to receive energy from the fluorescent dye of the nucleic acid PH1 chain and emit signal light with a wavelength of 658nm; (3) the AP site segment is a binding site for the endonuclease APE1, used to specifically respond to APE1 and break the locking sequence; (4) the ACAGGTC segment is a locking sequence used to prevent non-specific binding between the nucleic acid EH2 chain and the nucleic acid PH1 chain.

[0016] Furthermore, the core of the core-shell upconversion nanoparticle is ytterbium-erbium-thulium doped sodium yttrium fluoride nanoparticles NaYF4:Yb,Er,Tm, wherein the molar ratio of yttrium, ytterbium, erbium and thulium is (40~80):(10~30):(30~50):(0.5~2); the shell is ytterbium-neodymium doped sodium yttrium fluoride NaYF4:Yb,Nd, wherein the molar ratio of yttrium, ytterbium and neodymium is (4~6):(0.5~2):(3~7).

[0017] Furthermore, the average pore size of the mesoporous silica layer is 2.5~4.0 nm; the loading of the platinum particles is achieved by reduction with chloroplatinic acid; the polydopamine layer is formed by the self-polymerization of dopamine hydrochloride in tris(hydroxymethyl)aminomethane hydrochloride buffer at pH 8.0~9.0; the average particle size of the multifunctional nanoprobe grafted with nucleic acid PH1 and EH2 chains is 60~80 nm, and it exhibits good dispersibility and structural stability in PBS buffer at pH 7.4.

[0018] Secondly, the present invention provides a method for preparing a multifunctional nano-therapeutic probe, comprising the following steps:

[0019] Step (1) First, add 10-20 mL of oleic acid-modified core-shell upconversion nanoparticle solution and 1-3 g of hexadecyltrimethylammonium bromide to 100-400 mL of ultrapure water and stir magnetically at 60-80 °C for 20-40 min. Then add 20-40 mL of anhydrous ethanol, 50-200 mL of ultrapure water and 3-5 mL of sodium hydroxide solution and stir magnetically at 60-80 °C for 30-60 min. Finally, add 1-2 mL of tetraethyl silicate solution and continue stirring magnetically at 60-80 °C for 2-4 h. After centrifugation, washing twice with ultrapure water and anhydrous ethanol, and vacuum drying at 60 °C for 24 h, mesoporous silica-coated core-shell upconversion nanoparticles are obtained.

[0020] Step (2) First, add 0.1~0.3 g of mesoporous silica-coated core-shell upconversion nanoparticles to 200~400 mL of ultrapure water and sonicate at room temperature for 1~2 h. Then add 10~20 mL of chloroplatinic acid solution and stir magnetically at room temperature for 1~2 h. Finally, add 0.01~0.03 g of sodium borohydride and continue to stir magnetically at room temperature for 4~8 h. After centrifugation, washing twice with anhydrous ethanol, and vacuum drying at 60 ℃ for 24 h, mesoporous silica-coated core-shell upconversion nanoparticles adsorbing platinum particles are obtained.

[0021] Step (3) Add 0.01~0.03 g of mesoporous silica-coated core-shell upconversion nanoparticles that adsorb platinum particles to 40~80 mL of methylene blue solution, stir magnetically at room temperature in the dark for 12 h, centrifuge, wash twice with ultrapure water, and vacuum dry at 60℃ for 24 h to obtain mesoporous silica-coated core-shell upconversion nanoparticles that adsorb platinum particles and methylene blue.

[0022] Step (4) 10-20 mg of mesoporous silica-coated core-shell upconversion nanoparticles adsorbed with platinum particles and methylene blue were added to 20-60 mL of tris(hydroxymethyl)aminomethane hydrochloride buffer solution and sonicated at room temperature for 1-2 h. Then 0.2-0.6 mL of dopamine hydrochloride solution was added and sonicated at room temperature for another 2-6 h. After centrifugation and washing with ultrapure water three times, polydopamine-modified mesoporous silica-coated core-shell upconversion nanoparticles adsorbed with platinum particles and methylene blue were obtained.

[0023] Step (5) First, add 0.05~0.15 g of polydopamine-modified adsorbed platinum particles and methylene blue mesoporous silica-coated core-shell structured upconversion nanoparticles to 50~100 mL of PBS buffer and sonicate at room temperature for 1~2 h. Then add 2~4 mL of 1-ethyl-(3-dimethylaminopropyl)carbodiimide solution and 2~8 mL of N-hydroxysuccinimide solution and incubate at 37 ℃ for 30~60 min. Finally, add 0.5~2 mL of nucleic acid PH1 chain solution and 1~3 mL of nucleic acid EH2 chain solution and continue incubating at 37 ℃ for 2~4 h. After centrifugation and washing with ultrapure water 3 times, disperse in 50~100 mL of PBS buffer to obtain the multifunctional nanotherapeutic probe.

[0024] Further, in step (1), the core of the oleic acid-modified core-shell upconversion nanoparticle is ytterbium-erbium-thulium doped sodium yttrium fluoride nanoparticle NaYF4:Yb,Er,Tm, wherein the molar ratio of yttrium, ytterbium, erbium and thulium is (40~80):(10~30):(30~50):(0.5~2), and the shell is ytterbium-neodymium doped sodium yttrium fluoride NaYF4:Yb,Nd, wherein the molar ratio of yttrium, ytterbium and neodymium is (4~6):(0.5~2):(3~7).

[0025] Furthermore, in step (1), the average particle size of the oleic acid-modified core-shell upconversion nanoparticles is 26 nm, and the oleic acid content is 99 wt%.

[0026] Furthermore, in step (1), the concentration of the oleic acid-modified core-shell upconversion nanoparticle solution is 20 mg / mL, and the solvent is cyclohexane.

[0027] Furthermore, in step (1), the concentration of the sodium hydroxide solution is 1 mol / L, and the solvent is ultrapure water.

[0028] Furthermore, in step (1), the concentration of the tetraethyl silicate solution is 1 mol / L, and the solvent is anhydrous ethanol.

[0029] Furthermore, in step (2), the concentration of the chloroplatinic acid solution is 0.05 mol / L, and the solvent is ultrapure water.

[0030] Furthermore, in step (3), the concentration of the methylene blue solution is 0.15 mmol / L, and the solvent is ultrapure water.

[0031] Further, in step (4), the concentration of tris(hydroxymethyl)aminomethane hydrochloride in the buffer solution is 0.01 mol / L and the pH value is 8.5.

[0032] Furthermore, in step (4), the concentration of the dopamine hydrochloride solution is 0.04 mol / L, and it is dissolved in ultrapure water.

[0033] Furthermore, in step (5), the pH value of the PBS buffer is 7.4.

[0034] Furthermore, in step (5), the concentrations of both the 1-ethyl-(3-dimethylaminopropyl)carbodiimide solution and the N-hydroxysuccinimide solution are 0.2 mol / L, and the solvent is ultrapure water.

[0035] Furthermore, in step (5), the concentrations of both the nucleic acid PH1 chain solution and the nucleic acid EH2 chain solution are 0.1 mol / L, and the solvent is PBS buffer.

[0036] Further, in step (5), the sequence of the nucleic acid PH1 chain is TAGCTT / iPCLink / TCAGACTGA / iCy3dT / GTTGAACAGGTCTCAACATCAGTCTGATAAGCTA, and the sequence of the nucleic acid EH2 chain is GACCTGTTCAACA / iCy5dT / CAGTCTGATAGCTTATCAGACTGATGTTGA / AP site / ACAGGTC.

[0037] Furthermore, the PH1 nucleic acid chain contains the following four functional regions: (1) The TAGCTT segment is a locking sequence used to prevent the target microRNA-21 chain from binding to the PH1 nucleic acid chain, thereby reducing false positive signals; (2) The iPCLink segment is a photolytic linker used to break the locking sequence, so that the recognition sequences of the target microRNA-21 chain and the nucleic acid EH2 chain specifically bind to the recognition sequence of the nucleic acid PH1 chain; (3) The TCAGACTGA segment and the GTTGAACAGGTCTCAACATCAGTCTGATAAGCTA segment are recognition sequences used to specifically bind the PH1 nucleic acid chain to the recognition sequences of the target microRNA-21 chain and the nucleic acid EH2 chain; (4) The iCy3dT segment is a fluorescent dye used to absorb incident light with a wavelength of 535 nm and transfer the fluorescence resonance energy to the fluorescent dye iCy5dT of the nucleic acid EH2 chain.

[0038] Furthermore, the EH2 nucleic acid chain contains the following four functional regions: (1) The GACCTGTTCAACA and CAGTCTGATAGCTTATCAGACTGATGTTGA segments are recognition sequences used to specifically bind to the recognition sequence of the PH1 nucleic acid chain; (2) The iCy5dT segment is a fluorescent dye used to absorb the energy transferred from the iCy3dT fluorescent dye of the PH1 nucleic acid chain and emit a signal light with a wavelength of 658 nm, thereby specifically detecting the target microRNA-21 chain and its content; (3) The AP site segment is the endonuclease APE1 binding site used to specifically respond to the endonuclease APE1, break the locking sequence, thereby specifically binding the recognition sequence of the EH2 nucleic acid chain to the recognition sequence of the PH1 nucleic acid chain; (4) The ACAGGTC segment is a locking sequence used to prevent the EH2 nucleic acid chain and the PH1 nucleic acid chain from binding and reduce false positive signals.

[0039] Thirdly, the present invention provides an application of the aforementioned multifunctional nanotherapeutic probe in specific identification imaging, quantitative detection, and synergistic treatment of tumors.

[0040] Furthermore, after the multifunctional nanotherapeutic probe enters tumor cells, under near-infrared light irradiation at a wavelength of 808 nm, the upconversion nanoparticles emit violet light at a wavelength of 380 nm, green light at 540 nm, and red light at 654 nm. The violet light at 380 nm can cleave the photolytic linker PC-linker on the PH1 nucleic acid chain, breaking the locking sequence TAGCTT, thereby exposing the recognition sequences TCAGACTGA and GTTGAACAGGTCTCAACATCAGTCTGATAAGCTA, which can be specifically recognized and bound by the highly expressed target microRNA-21 chain in tumor cells. Similarly, the highly expressed endonuclease APE1 in tumor cells can cleave the AP site on the EH2 nucleic acid chain, breaking the locking sequence ACAGGTC, thus exposing the PH1 nucleic acid chain. The recognition sequence of chain 1 specifically recognizes and binds to the GACCTGTTCAACA and CAGTCTGATAGCTTATCAGACTGATGTTGA segments; at this time, the recognition sequences of nucleic acid PH1 chain and nucleic acid EH2 chain on the upconversion nanoparticles specifically recognize and bind to the highly expressed target microRNA-21 chain in tumor cells through a hybridization chain reaction, forming a nanoladder structure; because the molecular chains form a nanoladder structure, the Cy3 fluorescent group of nucleic acid PH1 chain and the Cy5 fluorescent group of nucleic acid EH2 chain are close to each other, and a wavelength of 535 nm is used to detect this. The energy gained by the excitation of the Cy3 fluorophore of the PH1 nucleic acid chain by incident light at a wavelength of 658 nm is transferred to the Cy5 fluorophore of the EH2 nucleic acid chain through fluorescence resonance, resulting in the emission of a signal light with a wavelength of 658 nm. Therefore, the specific recognition, quantitative detection, and in-situ imaging of the highly expressed target microRNA-21 chain in tumors can be performed by observing the 658 nm signal light and its intensity changes. The 654 nm red light emitted by the upconversion nanoparticles can excite methylene blue in mesoporous silica to produce singlet oxygen. The platinum particles in the mesoporous silica can catalyze the decomposition of excess hydrogen peroxide in the tumor microenvironment to produce oxygen, thereby improving the generation efficiency of singlet oxygen and achieving efficient photodynamic therapy for tumors. The polydopamine on the upconversion nanoparticles can perform efficient photothermal therapy on tumors under irradiation with near-infrared light at a wavelength of 808 nm.

[0041] Furthermore, the sequence of the target microRNA-21 chain is UAGCUUAUCAGACUGAUGUUGA.

[0042] The significant advantages of this invention are:

[0043] (1) In the presence of both ultraviolet light and the highly expressed endonuclease APE1 in tumor cells, the photolytic linker PC-linker and AP site on the PH1 and EH2 chains of the present invention can be simultaneously disconnected. The recognition sequences of the PH1 and EH2 chains on the upconversion nanoparticles specifically recognize and bind to the highly expressed target microRNA-21 chain in tumor cells through hybridization chain reaction. At the same time, through fluorescence resonance energy transfer, the incident light with a wavelength of 535 nm is converted into an emitted signal light with a wavelength of 658 nm, and the 658 nm signal light and its intensity changes are used to specifically recognize, quantify, and perform in situ imaging of the highly expressed target microRNA-21 chain in tumors.

[0044] (2) Because violet light cannot penetrate skin tissue to directly reach the tumor site in the body, this invention uses near-infrared light with a wavelength of 808 nm, which can penetrate skin tissue, to irradiate the upconversion nanoparticles in the probe. After irradiation, the nanoparticles emit violet light with a wavelength of 380 nm. Under the action of this violet light, the photolytic linker PC-linker on the PH1 nucleic acid chain breaks, thereby triggering the specific recognition, quantitative detection, and in-situ imaging of the highly expressed target microRNA-21 chain in the tumor.

[0045] (3) The present invention uses near-infrared light with a wavelength of 808 nm to irradiate the upconversion nanoparticles in the probe, which can also emit red light with a wavelength of 654 nm. This red light can excite methylene blue in mesoporous silica to generate singlet oxygen, and the platinum particles in mesoporous silica can also catalyze the decomposition of excess hydrogen peroxide in the tumor microenvironment to generate oxygen, thereby improving the generation efficiency of singlet oxygen and realizing efficient photodynamic therapy for tumors.

[0046] (4) Polydopamine on upconversion nanoparticles can perform efficient photothermal therapy on tumors under near-infrared light with a wavelength of 808 nm. This avoids the problem that when polydopamine is irradiated with incident light with a wavelength of 980 nm to excite upconversion nanoparticles for photothermal therapy, the solvent background temperature rises due to the absorption of incident light with a wavelength of 980 nm, resulting in poor photothermal therapy effect of polydopamine. Attached Figure Description

[0047] Figure 1 Transmission electron microscopy (TEM) images of core-shell upconversion nanoparticles (UCNP) (a) and mesoporous silica-coated core-shell upconversion nanoparticles (UCNP@mSiO2) (b) prepared in Example 1 of this invention.

[0048] Figure 2X-ray diffraction pattern (a) and nitrogen adsorption-desorption curve (b) of the mesoporous silica-coated core-shell upconversion nanoparticles (UCNP@mSiO2) prepared in Example 1 of this invention.

[0049] Figure 3 The image shows the X-ray diffraction pattern of the mesoporous silica-coated core-shell upconversion nanoparticles (USP) that adsorbed platinum particles, prepared in Example 1 of this invention.

[0050] Figure 4 The Zeta potential diagrams are for the core-shell upconversion nanoparticles (UCNP), mesoporous silica-coated core-shell upconversion nanoparticles (UCNP@mSiO2), mesoporous silica-coated core-shell upconversion nanoparticles adsorbed with platinum particles (USP), and mesoporous silica-coated core-shell upconversion nanoparticles adsorbed with platinum particles and methylene blue (USPB) prepared in Example 1 of this invention.

[0051] Figure 5 The infrared absorption spectrum of the mesoporous silica-coated core-shell upconversion nanoparticles (USPBPs) prepared in Example 1 of this invention, which are polydopamine-modified adsorbed platinum particles and methylene blue, is shown.

[0052] Figure 6 The UV-Vis absorption spectra of polydopamine-modified platinum particles and methylene blue-coated core-shell upconversion nanoparticles (USPBP) and polydopamine-modified platinum particles and methylene blue-coated core-shell upconversion nanoparticles (USPBPR) grafted with nucleic acid PH1 and EH2 chains prepared in Example 1 of this invention are shown.

[0053] Figure 7 The fluorescence spectrum of the solution prepared in Example 2 of this invention is shown.

[0054] Figure 8 The fluorescence spectrum of the solution prepared in Comparative Example 1 of this invention is shown.

[0055] Figure 9 The fluorescence spectrum of the solution prepared in Comparative Example 2 of this invention is shown.

[0056] Figure 10 The fluorescence spectrum of the solution prepared in Comparative Example 3 of this invention is shown.

[0057] Figure 11 The fluorescence spectrum of the solution prepared in Comparative Example 4 of this invention is shown.

[0058] Figure 12 The fluorescence spectrum (a) of the solution prepared in Example 3 of this invention and the linear correlation between fluorescence intensity and microRNA-21 concentration (b) are shown.

[0059] Figure 13This is a schematic diagram illustrating the principle of specific recognition and quantitative detection of the multifunctional nano-therapeutic probes prepared in this invention.

[0060] Figure 14 This is a confocal image of HeLa cells from Example 4 of the present invention.

[0061] Figure 15 This is a confocal image of mouse embryonic fibroblasts, which is Comparative Example 5 of this invention.

[0062] Figure 16 This is the UV-Vis absorption spectrum of the solution prepared in Example 5 of the present invention as the irradiation time increases.

[0063] Figure 17 The fluorescence spectrum of the solution prepared in Example 6 of this invention as time increases.

[0064] Figure 18 This is a graph showing the relationship between solution temperature and irradiation time in Example 7 of the present invention. Detailed Implementation

[0065] To enable those skilled in the art to better understand the present invention, exemplary embodiments or examples of the present invention will be described below in conjunction with the accompanying drawings. Obviously, the described embodiments or examples are merely some, not all, of the embodiments or examples of the present invention. All other embodiments or examples obtained by those skilled in the art based on the embodiments or examples of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0066] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

[0067] The beneficial effects of the present invention will be described below with reference to specific embodiments.

[0068] Example 1

[0069] This embodiment provides a method for preparing a multifunctional nanodiagnostic probe that specifically identifies and images, quantitatively detects, and synergistically treats tumors, including the following steps:

[0070] (1) First, 15 mL of oleic acid-modified core-shell structured upconversion nanoparticle solution and 2 g of hexadecyltrimethylammonium bromide were added to 250 mL of ultrapure water and magnetically stirred at 70 °C for 30 min. Then, 30 mL of anhydrous ethanol, 100 mL of ultrapure water and 4 mL of sodium hydroxide solution were added and magnetically stirred at 70 °C for 45 min. Finally, 1.5 mL of tetraethyl silicate solution was added and magnetically stirred at 70 °C for 3 h. After centrifugation, washing twice with ultrapure water and anhydrous ethanol, and vacuum drying at 60 °C for 24 h, mesoporous silica-coated core-shell structured upconversion nanoparticles were obtained.

[0071] The oleic acid-modified core-shell upconversion nanoparticles have a core of ytterbium-erbium-thulium doped sodium yttrium fluoride nanoparticles NaYF4:Yb,Er,Tm, wherein the molar ratio of yttrium, ytterbium, erbium, and thulium is 60:20:40:1, and a shell of ytterbium-neodymium doped sodium yttrium fluoride NaYF4:Yb,Nd, wherein the molar ratio of yttrium, ytterbium, and neodymium is 5:1:5.

[0072] The oleic acid-modified core-shell upconversion nanoparticles have an average particle size of 26 nm and an oleic acid content of 99 wt%.

[0073] The concentration of the oleic acid-modified core-shell upconversion nanoparticle solution was 20 mg / mL, and the solvent was cyclohexane.

[0074] The sodium hydroxide solution has a concentration of 1 mol / L and is in the form of ultrapure water.

[0075] The concentration of the tetraethyl silicate solution is 1 mol / L, and the solvent is anhydrous ethanol.

[0076] (2) First, 0.2 g of mesoporous silica-coated core-shell upconversion nanoparticles were added to 300 mL of ultrapure water and sonicated at room temperature for 1.5 h. Then, 15 mL of chloroplatinic acid solution was added and magnetically stirred at room temperature for 1.5 h. Finally, 0.02 g of sodium borohydride was added and magnetically stirred at room temperature for 6 h. After centrifugation, washing twice with anhydrous ethanol, and vacuum drying at 60 °C for 24 h, mesoporous silica-coated core-shell upconversion nanoparticles adsorbing platinum particles were obtained.

[0077] The concentration of the chloroplatinic acid solution is 0.05 mol / L, and the solvent is ultrapure water.

[0078] (3) 0.02 g of mesoporous silica core-shell structure upconversion nanoparticles adsorbing platinum particles were added to 60 mL of methylene blue solution and stirred magnetically at room temperature in the dark for 12 h. After centrifugation, washing twice with ultrapure water, and vacuum drying at 60 °C for 24 h, mesoporous silica core-shell structure upconversion nanoparticles adsorbing platinum particles and methylene blue were obtained.

[0079] The concentration of the methylene blue solution was 0.15 mmol / L, and the solvent was ultrapure water.

[0080] (4) 15 mg of mesoporous silica-coated core-shell upconversion nanoparticles that adsorb platinum particles and methylene blue were added to 40 mL of tris(hydroxymethyl)aminomethane hydrochloride buffer solution and sonicated at room temperature for 1.5 h. Then 0.4 mL of dopamine hydrochloride solution was added and sonicated at room temperature for another 4 h. After centrifugation and washing with ultrapure water three times, polydopamine-modified mesoporous silica-coated core-shell upconversion nanoparticles that adsorb platinum particles and methylene blue were obtained.

[0081] The concentration of tris(hydroxymethyl)aminomethane hydrochloride in the buffer solution is 0.01 mol / L, and the pH value is 8.5.

[0082] The concentration of the dopamine hydrochloride solution is 0.04 mol / L, and the solvent is ultrapure water.

[0083] (5) First, 0.1 g of polydopamine-modified adsorbed platinum particles and methylene blue mesoporous silica-coated core-shell structured upconversion nanoparticles were added to 80 mL of PBS buffer and sonicated at room temperature for 1.5 h. Then, 3 mL of 1-ethyl-(3-dimethylaminopropyl)carbodiimide solution and 6 mL of N-hydroxysuccinimide solution were added and incubated at 37 °C for 45 min. Finally, 1 mL of nucleic acid PH1 chain solution and 2 mL of nucleic acid EH2 chain solution were added and incubated at 37 °C for another 3 h. After centrifugation and washing with ultrapure water three times, the nanoprobes were dispersed in 80 mL of PBS buffer to obtain the multifunctional nanotherapeutic probe.

[0084] The pH value of the PBS buffer is 7.4.

[0085] The concentrations of both the 1-ethyl-(3-dimethylaminopropyl)carbodiimide solution and the N-hydroxysuccinimide solution were 0.2 mol / L, and the solvent was ultrapure water.

[0086] The concentrations of both the nucleic acid PH1 chain solution and the nucleic acid EH2 chain solution were 0.1 mmol / L, and the solvent was PBS buffer.

[0087] The sequence of the nucleic acid PH1 chain is TAGCTT / iPCLink / TCAGACTGA / iCy3dT / GTTGAACAGGTCTCAACATCAGTCTGATAAGCTA.

[0088] The sequence of the nucleic acid EH2 chain is GACCTGTTCAACA / iCy5dT / CAGTCTGATAGCTTATCAGACTGATGTTGA / AP site / ACAGGTC.

[0089] The polydopamine-modified adsorbed platinum particles grafted with nucleic acid PH1 and EH2 chains and the methylene blue-coated mesoporous silica core-shell upconversion nanoparticles have an average particle size of 72 nm and exhibit good dispersibility and structural stability in PBS buffer at pH 7.4.

[0090] Figure 1 (a) is a transmission electron microscope image of the core-shell structured upconversion nanoparticles of this embodiment. As shown in the figure, the particles exhibit a uniform hexagonal structure with an average size of approximately 26 nm. Figure 1 (b) is a transmission electron microscope image of the mesoporous silica-coated core-shell upconversion nanoparticles prepared in this embodiment. As shown in the figure, after the mesoporous silica-coated core-shell upconversion nanoparticles are coated, the average size increases to 72 nm and the size is relatively uniform.

[0091] Figure 2 (a) shows the X-ray diffraction patterns of core-shell upconversion nanoparticles and mesoporous silica-coated core-shell upconversion nanoparticles. As shown in the figure, the diffraction peaks of the core-shell upconversion nanoparticles at 17.18°, 29.94°, 30.83°, 43.52°, and 53.71° are attributed to the (100), (110), (101), (201), and (211) crystal planes of the sodium yttrium cubic crystal structure, respectively. Compared with the core-shell upconversion nanoparticles, the mesoporous silica-coated core-shell upconversion nanoparticles prepared in this embodiment show a new broad diffraction peak of amorphous silica at 22.62°, indicating that silica was successfully coated on the surface of the upconversion nanoparticles. Figure 2 (b) shows the nitrogen adsorption-desorption curve of the mesoporous silica-coated core-shell upconversion nanoparticles prepared in this embodiment. The results show that the adsorption-desorption curve is a typical type IV isotherm, and the adsorption and desorption branches form a typical H1 type hysteresis loop in the medium and high pressure region. This proves that the mesoporous silica successfully coated the core-shell upconversion nanoparticles. The mesoporous pore size is calculated to be about 3.25 nm.

[0092] Figure 3 The figure shows the X-ray diffraction pattern of the mesoporous silica-coated core-shell upconversion nanoparticles with adsorbed platinum particles prepared in this embodiment. As shown in the figure, the characteristic diffraction peaks of metallic platinum at 39.7° and 46.2° in the standard card JCPDS No. 4-0802 are clearly visible in the X-ray diffraction pattern of the nanoparticles, which proves that the platinum particles were successfully adsorbed into the mesopores of silica.

[0093] Figure 4 The figure shows the Zeta potential diagrams for the core-shell upconversion nanoparticles, mesoporous silica-coated core-shell upconversion nanoparticles, mesoporous silica-coated core-shell upconversion nanoparticles adsorbing platinum particles, and mesoporous silica-coated core-shell upconversion nanoparticles adsorbing platinum particles and methylene blue, prepared in this embodiment. The Zeta potential of the core-shell upconversion nanoparticles is 5.76 mV. After coating their surface with mesoporous silica, the Zeta potential decreases to -11.5 mV. This is mainly because the silica surface is rich in silanol groups, which can partially ionize into -SiO₂ in aqueous solution. - This leads to an increase in surface negative charge and a decrease in zeta potential. When mesoporous silica adsorbs platinum particles, the trace positive charge on the surface of the platinum particles causes a significant increase in the zeta potential of the mesoporous silica-coated core-shell upconversion nanoparticles. When methylene blue is further adsorbed, the zeta potential of the mesoporous silica-coated core-shell upconversion nanoparticles adsorbed with platinum particles and methylene blue decreases significantly. This phenomenon can be attributed to the synergistic effect of the electronic structure regulation of platinum particles and the redox reaction on the surface of methylene blue.

[0094] Figure 5 The figure shows the infrared absorption spectrum of the polydopamine-modified platinum and methylene blue-coated mesoporous silica core-shell upconversion nanoparticles prepared in this embodiment, with a wavenumber of 1594 cm⁻¹. -1 Absorption peaks for aromatic ring stretching vibration and NH bending vibration appeared nearby, at a wavenumber of 1349 cm⁻¹. -1 The presence of absorption peaks from the NC stretching vibrations on the benzene ring nearby confirms that polydopamine has been successfully modified onto the nanoparticles.

[0095] Figure 6 The UV-Vis absorption spectra of the mesoporous silica-coated core-shell upconversion nanoparticles with polydopamine-modified adsorption platinum particles and methylene blue before and after the PH1 and EH2 nucleic acid grafting were prepared in this embodiment. The results show that after grafting the nucleic acid PH1 and EH2 chains, the upconversion nanoparticles exhibit new characteristic absorption peaks of DNA purine and pyrimidine bases at a wavelength of around 260 nm, which proves that the PH1 and EH2 nucleic acid grafting was successful.

[0096] Example 2

[0097] This embodiment provides a specific recognition experiment using a multifunctional nanodiagnostic probe.

[0098] First, 200 μL of the multifunctional nanoprobe was irradiated with near-infrared light at a wavelength of 808 nm for 0.5 h. Then, 1 μL of 1.0 U / mL endonuclease APE1 and 1 μL of 10 nmol / L target microRNA-21 strand were added and incubated at 37 °C for 2 h. Finally, the fluorescence spectrum of the solution was detected when the excitation wavelength was 535 nm.

[0099] Figure 7 The fluorescence spectrum of the solution prepared in this embodiment shows that the solution emits fluorescence at a wavelength of 658 nm under incident light at a wavelength of 535 nm. This is the result of fluorescence resonance energy transfer after the formation of the nanoladder structure.

[0100] Comparative Example 1

[0101] The difference between this comparative example and Example 2 is that the 200 μL multifunctional nano-therapeutic probe was not irradiated with near-infrared light at a wavelength of 808 nm for 0.5 h.

[0102] Figure 8 The fluorescence spectrum of the solution prepared for this comparative example shows that when the multifunctional nano-therapeutic probe was not irradiated with near-infrared light at a wavelength of 808 nm, the solution had no fluorescence emission peak in the wavelength range of 600~800 nm, which is a result of the absence of a nanoladder structure.

[0103] Comparative Example 2

[0104] The difference between this comparative example and Example 2 is that 1 μL of 1.0 U / mL endonuclease APE1 was not added.

[0105] Figure 9 The fluorescence spectrum of the solution prepared in this comparative example was obtained. The results showed that when no endonuclease APE1 was added, the solution had no fluorescence emission peak in the wavelength range of 600~800 nm, which is a result of the absence of nanoladder structure formation.

[0106] Comparative Example 3

[0107] The difference between this comparative example and Example 2 is that the 200 μL multifunctional nano-therapeutic probe was not irradiated with near-infrared light at a wavelength of 808 nm for 0.5 h, and 1 μL of 1.0 U / mL endonuclease APE1 was not added.

[0108] Figure 10The fluorescence spectrum of the solution prepared for this comparative example was obtained. The results showed that when the multifunctional nano-therapeutic probe was not irradiated with near-infrared light at a wavelength of 808 nm and no endonuclease APE1 was added, the solution had no fluorescence emission peak in the wavelength range of 600~800 nm, which is a result of the failure to form a nanoladder structure.

[0109] Comparative Example 4

[0110] The difference between this comparative example and Example 2 is that the target microRNA-21 chain is replaced with microRNA-222 chain, microRNA-141 chain, microRNA-155 chain, or a mixture of microRNA-21 chain and the above microRNA chains.

[0111] The sequence of the microRNA-222 chain is AGCUACAUCUGGCUACUGGGU, the sequence of the microRNA-141 chain is UAACACUGUCUGGUAAAGAUGG, and the sequence of the microRNA-155 chain is UUAAUGCUAAUCGUGAUAGGGGU.

[0112] Figure 11 The fluorescence spectra of the solutions prepared in this comparative example are shown. The results show that when the target microRNA-21 chain is replaced with microRNA-222 chain (a), microRNA-141 chain (b), and microRNA-155 chain (c), respectively, the solution has no fluorescence emission peak in the wavelength range of 600~800 nm. When the target microRNA-21 chain is replaced with a mixture of microRNA-222 chain, microRNA-141 chain, microRNA-155 chain and microRNA-21 chain (d), a fluorescence emission peak at a wavelength of 658 nm can be observed. These results demonstrate that the multifunctional nanotherapeutic probe prepared in this invention can specifically recognize the target microRNA-21 chain and is not affected by other microRNA chains.

[0113] Example 3

[0114] This embodiment provides a quantitative detection experiment using a multifunctional nanodiagnostic probe.

[0115] The difference between this embodiment and Example 2 is that the concentrations of the target microRNA-21 chain are 0.01, 0.075, 0.15, 0.3, 0.5, 0.75, 1.5 and 2 nmol / L, respectively.

[0116] Figure 12The fluorescence spectrum of the solution prepared in this embodiment is shown in (a), and the linear correlation between fluorescence intensity and microRNA-21 concentration is shown in (b). The results show that as the concentration of microRNA-21 increases, the intensity of the fluorescence emission peak near 658 nm gradually increases. Within the range of 0.01-2 nmol / L, the fluorescence emission peak intensity shows a good linear relationship with the concentration of microRNA-21, with a detection limit as low as 3.9 pmol / L and a linear correlation coefficient R0. 2 It is 0.9959.

[0117] Figure 13 The schematic diagram of the specific recognition imaging and quantitative detection principle of the multifunctional nanotherapeutic probe of this invention is shown in the figure. When the multifunctional nanotherapeutic probe enters tumor cells, under near-infrared light irradiation at a wavelength of 808 nm, the upconversion nanoparticles emit violet light at a wavelength of 380 nm, which can cleave the photolytic linker PC-linker on the PH1 nucleic acid chain, breaking the locking sequence TAGCTT segment, thereby exposing the recognition sequences TCAGACTGA and GTTGAACAGGTCTCAACATCAGTCTGATAAGCTA that can be specifically recognized and bound by the target microRNA-21 chain highly expressed in tumor cells. The endonuclease APE1, which is highly expressed in tumor cells, can cleave the AP site on the EH2 nucleic acid chain, breaking the locking sequence ACAGGTC segment, thereby exposing the nucleic acid PH1 chain that can be specifically recognized and bound by the target microRNA-21 chain. The recognition sequence of chain 1 specifically recognizes and binds to the GACCTGTTCAACA and CAGTCTGATAGCTTATCAGACTGATGTTGA segments. At this time, the recognition sequences of nucleic acid PH1 chain and nucleic acid EH2 chain on the upconversion nanoparticle specifically recognize and bind to the highly expressed target microRNA-21 chain in tumor cells through hybridization chain reaction, forming a nanoladder structure. Because the molecular chains form a nanoladder structure, the Cy3 fluorescent group of nucleic acid PH1 chain and the Cy5 fluorescent group of nucleic acid EH2 chain are close to each other. The energy obtained by exciting the Cy3 fluorescent group of nucleic acid PH1 chain with incident light at a wavelength of 535 nm is transferred to the Cy5 fluorescent group of nucleic acid EH2 chain through fluorescence resonance, emitting a signal light with a wavelength of 658 nm. Therefore, the specific recognition and quantitative detection of the highly expressed target microRNA-21 chain in tumors can be performed by observing the 658 nm signal light and its intensity changes.

[0118] Example 4

[0119] This embodiment provides a specific imaging experiment using a multifunctional nanodiagnostic probe.

[0120] First, 20 μL of the multifunctional nanoprobe was added to 1 mL of DMEM cell culture medium containing HeLa cells and incubated at 37 ℃ for 4 h. Then, it was irradiated with near-infrared light at a wavelength of 808 nm for 30 min, and incubated at 37 ℃ for another 4 h. Finally, confocal images were obtained at the following two channels: Green fluorescence (Cy3 fluorophore channel: excitation wavelength 535 nm, emission wavelength range 500-600 nm); Red fluorescence (Cy5 fluorophore channel: emission wavelength range 650-750 nm).

[0121] Figure 14 The image shows a confocal image of HeLa cells in this embodiment. As shown in the figure, obvious red fluorescence can be observed in HeLa cells, which proves that the multifunctional nanotherapeutic probe can specifically image tumor cells.

[0122] Comparative Example 5

[0123] The difference between this comparative example and Example 4 is that the DMEM cell culture medium contains mouse embryonic fibroblasts.

[0124] Figure 15 The image shows a confocal image of mouse embryonic fibroblasts in this comparative example. Because the target microRNA-21 chain and the endonuclease APE1 are not present in normal mouse embryonic fibroblasts, only the green fluorescence emitted by the Cy3 fluorescent group can be observed.

[0125] Example 5

[0126] This embodiment evaluates the photodynamic therapy effect of a multifunctional nano-therapeutic probe by detecting the content of singlet oxygen.

[0127] Under light-protected conditions, 10 μL of 1,3-diphenylisobenzofuran at a concentration of 5 mmol / L was added to 1 mL of a multifunctional nano-therapeutic probe, and then irradiated with near-infrared light at a wavelength of 808 nm. The absorbance of 1,3-diphenylisobenzofuran in the solution at a wavelength of 416 nm was measured every 5 min of irradiation.

[0128] Figure 16This is the UV-Vis absorption spectrum of the solution prepared in this embodiment as the irradiation time increases. Since 1,3-diphenylisobenzofuran reacts with singlet oxygen to form 1,2-dibenzoylbenzene, the content of singlet oxygen in the solution can be characterized by the decrease in absorbance at 417 nm in the UV-Vis absorption spectrum of the 1,3-diphenylisobenzofuran solution. The results show that the absorbance of the 1,3-diphenylisobenzofuran solution at 417 nm gradually decreases with increasing irradiation time. This demonstrates that under incident light at 808 nm, the multifunctional therapeutic nanoprobe can emit red light at 654 nm and excite methylene blue in mesoporous silica to generate singlet oxygen, thereby achieving a photodynamic therapy effect.

[0129] Example 6

[0130] This embodiment assesses the ability of platinum particles in mesoporous silica to catalyze the decomposition of excess hydrogen peroxide in the tumor microenvironment to produce oxygen by detecting the concentration of dissolved oxygen in the solution.

[0131] First, 10 μL of 1 mmol / L tris(4,7-biphenyl-1,10-o-phenanthroline) ruthenium dichloride aqueous solution was added to 2 mL of multifunctional nano-therapeutic probe, followed by 10 μL of 1 mol / L hydrogen peroxide aqueous solution. The fluorescence spectrum of the solution was detected every 2 min.

[0132] Figure 17 The image shows the fluorescence spectrum of the solution prepared in this embodiment as a function of time. Because the tris(4,7-biphenyl-1,10-o-phenanthroline)ruthenium dichloride solution emits red fluorescence at a wavelength of 630 nm under anaerobic conditions, but undergoes fluorescence quenching in the presence of oxygen, the fluorescence intensity of the tris(4,7-biphenyl-1,10-o-phenanthroline)ruthenium dichloride solution is negatively correlated with the oxygen content. The results show that, in the presence of hydrogen peroxide, the fluorescence intensity of tris(4,7-biphenyl-1,10-o-phenanthroline)ruthenium dichloride continuously decreases with time, demonstrating that the platinum particles adsorbed by the multifunctional nanoprobe can catalyze the generation of oxygen from hydrogen peroxide, and the oxygen concentration tends to stabilize after 5 minutes.

[0133] Example 7

[0134] One mL of multifunctional nano-therapeutic probe was irradiated with 808 nm near-infrared light, and the temperature change of the probe solution was recorded every 30 seconds using a thermal imager to evaluate the photothermal therapeutic effect of the multifunctional nano-therapeutic probe.

[0135] Figure 18The figure shows the relationship between solution temperature and irradiation time in this embodiment. As the irradiation time increases, the solution temperature rises rapidly. When the irradiation time is 10 min, the solution temperature reaches its maximum value and remains constant. This proves that the multifunctional nano-therapeutic probe has good photothermal performance.

[0136] While the present invention has been disclosed above, its scope of protection is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention, and all such changes and modifications will fall within the scope of protection of the present invention.

Claims

1. A multifunctional nano-therapeutic probe, characterized in that, include: Core-shell upconversion nanoparticles; A mesoporous silica layer covering the surface of the conversion nanoparticles on the core-shell structure; Platinum particles and methylene blue adsorbed in the mesoporous silica layer; A polydopamine layer modified on the surface of the mesoporous silica layer; as well as Nucleic acid PH1 and nucleic acid EH2 chains grafted onto the surface of the polydopamine layer; The nucleic acid PH1 chain contains a photolytic linker; the nucleic acid EH2 chain contains an endonuclease APE1 binding site.

2. The multifunctional nanotherapeutic probe according to claim 1, characterized in that, The sequence of the nucleic acid PH1 chain is: TAGCTT / iPCLink / TCAGACTGA / iCy3dT / GTTGAACAGGTCTCAACATCAGTCTGATAAGCTA; the sequence of the nucleic acid EH2 chain is: GACCTGTTCAACA / iCy5dT / CAGTCTGATAGCTTATCAGACTGATGTTGA / AP site / ACAGGTC.

3. The multifunctional nanotherapeutic probe according to claim 1, characterized in that, The PH1 nucleic acid chain contains the following functional regions: (1) The TAGCTT segment is a locking sequence used to prevent the target microRNA-21 chain from binding to the nucleic acid PH1 chain; (2) The iPCLink segment is a photodisintegrable linker used to disconnect the locking sequence under ultraviolet light irradiation; (3) The TCAGACTGA and GTTGAACAGGTCTCAACATCAGTCTGATAAGCTA segments are recognition sequences used to specifically bind to the target microRNA-21 chain and the nucleic acid EH2 chain; (4) The iCy3dT segment is a fluorescent dye used to absorb incident light with a wavelength of 535 nm and transfer the energy to the nucleic acid EH2 chain through fluorescence resonance.

4. The multifunctional nanotherapeutic probe according to claim 1, characterized in that, The EH2 nucleic acid chain contains the following functional regions: (1) The GACCTGTTCAACA and CAGTCTGATAGCTTATCAGACTGATGTTGA segments are recognition sequences used to specifically bind to the recognition sequence of the PH1 nucleic acid chain; (2) The iCy5dT segment is a fluorescent dye used to receive energy from the fluorescent dye of the nucleic acid PH1 chain and emit signal light with a wavelength of 658nm; (3) The AP site is the binding site of the endonuclease APE1, which is used to specifically respond to APE1 to break the locking sequence; (4) The ACAGGTC segment is a locking sequence used to prevent non-specific binding of the nucleic acid EH2 chain and the nucleic acid PH1 chain.

5. The multifunctional nanotherapeutic probe according to claim 1, characterized in that, The core of the core-shell upconversion nanoparticles is ytterbium-erbium-thulium doped sodium yttrium fluoride nanoparticles NaYF4:Yb,Er,Tm, wherein the molar ratio of yttrium, ytterbium, erbium and thulium is (40~80):(10~30):(30~50):(0.5~2); the shell is ytterbium-neodymium doped sodium yttrium fluoride NaYF4:Yb,Nd, wherein the molar ratio of yttrium, ytterbium and neodymium is (4~6):(0.5~2):(3~7).

6. The multifunctional nanotherapeutic probe according to claim 1, characterized in that, The mesoporous silica layer has an average pore size of 2.5–4.0 nm; the platinum particles are loaded by reduction with chloroplatinic acid; the polydopamine layer is formed by the self-polymerization of dopamine hydrochloride in a tris(hydroxymethyl)aminomethane hydrochloride buffer at pH 8.0–9.0; the multifunctional nanoprobe grafted with nucleic acid PH1 and EH2 chains has an average particle size of 60–80 nm.

7. A method for preparing a multifunctional nano-therapeutic probe according to any one of claims 1 to 6, characterized in that, Includes the following steps: Step (1) Oleic acid-modified core-shell upconversion nanoparticles are mixed with hexadecyltrimethylammonium bromide and ultrapure water, and anhydrous ethanol, sodium hydroxide solution and tetraethyl silicate are added in sequence. After the reaction, mesoporous silica-coated core-shell upconversion nanoparticles are obtained. Step (2) Disperse the product of step (1) in ultrapure water, add chloroplatinic acid solution and sodium borohydride, and reduce to obtain mesoporous silica-coated core-shell structured upconversion nanoparticles that adsorb platinum particles. Step (3) Disperse the product of step (2) in a methylene blue solution, stir and adsorb in the dark to obtain mesoporous silica-coated core-shell upconversion nanoparticles that adsorb platinum particles and methylene blue. Step (4) Disperse the product of step (3) in tris(hydroxymethyl)aminomethane hydrochloride buffer, add dopamine hydrochloride solution, and react to obtain polydopamine modified nanoparticles. Step (5) Disperse the product from step (4) in PBS buffer, add 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide for activation, then add nucleic acid PH1 chain solution and nucleic acid EH2 chain solution, and incubate to obtain the multifunctional nanotherapeutic probe.

8. The preparation method according to claim 7, characterized in that, In step (1), the core of the oleic acid-modified core-shell upconversion nanoparticles is ytterbium-erbium-thulium doped sodium yttrium fluoride nanoparticles NaYF4:Yb,Er,Tm, wherein the molar ratio of yttrium, ytterbium, erbium, and thulium is (40~80):(10~30):(30~50):(0.5~2), and the shell is ytterbium-neodymium doped sodium yttrium fluoride NaYF4:Yb,Nd, wherein the molar ratio of yttrium, ytterbium, and neodymium is (4~6):(0.5~2):(3~7); the average particle size of the oleic acid-modified core-shell upconversion nanoparticles is 26 nm, and the oleic acid content is 99 wt%; the concentration of the oleic acid-modified core-shell upconversion nanoparticle solution is 20 mg / mL, the solvent is cyclohexane; and the concentration of the sodium hydroxide solution is 1 mg / mL. The concentration of the tetraethyl orthosilicate solution was 1 mol / L, and the solvent was ultrapure water; the concentration of the tetraethyl orthosilicate solution was 1 mol / L, and the solvent was anhydrous ethanol.

9. The preparation method according to claim 7, characterized in that, In step (2), the concentration of chloroplatinic acid solution is 0.05 mol / L; the amount of sodium borohydride is 0.01~0.03 g.

10. The preparation method according to claim 7, characterized in that, In step (3), the concentration of the methylene blue solution is 0.15 mmol / L.

11. The preparation method according to claim 7, characterized in that, In step (4), the concentration of tris(hydroxymethyl)aminomethane hydrochloride buffer is 0.01 mol / L and the pH is 8.5; the concentration of dopamine hydrochloride solution is 0.04 mol / L and the solvent is ultrapure water.

12. The preparation method according to claim 7, characterized in that, In step (5), the pH of the PBS buffer is 7.4; the concentrations of 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide are both 0.2 mol / L, and the solvent is ultrapure water; the sequence of the nucleic acid PH1 chain is TAGCTT / iPCLink / TCAGACTGA / iCy3dT / GTTGAACAGGTCTCAACATCAGTCTGATAAGCTA, and the sequence of the nucleic acid EH2 chain is GACCTGTTCAACA / iCy5dT / CAGTCTGATAGCTTATCAGACTGATGTTGA / AP site / ACAGGTC.

13. The preparation method according to claim 7, characterized in that, The PH1 nucleic acid chain contains the following four functional regions: (1) The TAGCTT segment is a locking sequence used to prevent the target microRNA-21 chain from binding to the nucleic acid PH1 chain, thereby reducing false positive signals; (2) The iPCLink segment is a photolytic linker used to break the locking sequence, thereby allowing the recognition sequences of the target microRNA-21 chain and the nucleic acid EH2 chain to specifically bind to the recognition sequence of the nucleic acid PH1 chain; (3) The TCAGACTGA and GTTGAACAGGTCTCAACATCAGTCTGATAAGCTA segments are recognition sequences used to specifically bind the nucleic acid PH1 chain to the target microRNA-21 chain and the nucleic acid EH2 chain. (4) The iCy3dT segment is a fluorescent dye used to absorb incident light with a wavelength of 535 nm and transfer the fluorescent dye iCy5dT to the nucleic acid EH2 chain through fluorescence resonance.

14. The preparation method according to claim 7, characterized in that, The EH2 nucleic acid chain contains the following four functional regions: (1) The GACCTGTTCAACA and CAGTCTGATAGCTTATCAGACTGATGTTGA segments are recognition sequences used to specifically bind to the recognition sequence of the PH1 nucleic acid chain; (2) The iCy5dT segment is a fluorescent dye used to absorb the energy transferred from the iCy3dT fluorescent dye of the nucleic acid PH1 chain and emit a signal light with a wavelength of 658 nm, thereby specifically detecting the target microRNA-21 chain and its content. (3) The AP site is the binding site of the endonuclease APE1, which is used to specifically respond to the endonuclease APE1, break the locking sequence, so that the recognition sequence of the nucleic acid EH2 chain specifically binds to the recognition sequence of the nucleic acid PH1 chain; (4) The ACAGGTC segment is a locking sequence used to prevent the binding of nucleic acid EH2 chain and nucleic acid PH1 chain, thereby reducing false positive signals.

15. The use of a multifunctional nanotherapeutic probe according to any one of claims 1-6 in the preparation of a medicament for specific identification imaging, quantitative detection and synergistic treatment of tumors.

16. The application according to claim 15, characterized in that, The tumor is a tumor that highly expresses the microRNA-21 chain, and the sequence of the microRNA-21 chain is UAGCUUAUCAGACUGAUGUUGA.

Images