Clhak8 gene promoter mutation site related to salt tolerance of watermelon and application thereof

Abstract

The application discloses a ClHAK8 gene promoter variation site related to watermelon salt tolerance and application thereof, and relates to the technical field of biology.The ClHAK8 gene promoter variation site is located at the position of-1534 to-1529 bp in the ClHAK8 gene promoter region; and the nucleotide sequence of the ClHAK8 gene is shown as SEQ ID NO.1.It is first clarified in the application that the presence or absence of the W-box element (TTGACC) at the position of-1534 to-1529 bp in the upstream promoter region of the watermelon ClHAK8 gene is a core molecular switch for regulating watermelon salt tolerance.The application clarifies the molecular mechanism of the variation of the promoter cis-element for affecting the salt stress response of watermelon by regulating the expression of a potassium transport gene, perfects the salt tolerance regulation network of watermelon, and provides a stable and practical detection tool for the molecular marker assisted breeding of salt-tolerant watermelon.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the ClHAK8 gene promoter variant site related to salt tolerance in watermelon and its application. Background Technology

[0002] watermelon( Citrullus lanatus Watermelon is an important economic crop, but it is highly sensitive to soil salinity. With the development of facility agriculture and the excessive application of chemical fertilizers, secondary soil salinization has become increasingly serious, becoming a key factor restricting the sustainable development of the watermelon industry. Therefore, it is of great significance to explore key genes for salt tolerance in watermelons and establish an efficient molecular breeding system.

[0003] Plant response to salt stress is a complex regulatory process, with the interaction between transcription factors and promoter cis-acting elements being a core component. The W-box (with the core sequence TTGACC) is an important binding site for WRKY transcription factors and plays a crucial role in plant responses to abiotic stress. However, in watermelon, research on how variations in W-box elements on specific gene promoters affect salt tolerance has not been reported.

[0004] Currently, the identification of salt tolerance in watermelons mainly relies on phenotypic observations in the field or greenhouse, which is time-consuming, costly, and easily affected by the environment. Although some molecular markers have been developed, molecular markers directly related to salt tolerance, targeting variations in promoter functional elements, are still lacking. Potassium ions (K+) + The homeostasis of potassium transport genes is one of the core mechanisms of plant salt tolerance. By identifying variations in key elements that regulate the expression of potassium transport genes, salt-tolerant germplasm resources can be screened more precisely. Summary of the Invention

[0005] The purpose of this invention is to provide a promoter variant site of the ClHAK8 gene associated with watermelon salt tolerance and its application, thereby addressing the problems existing in the prior art. This invention has found a correlation between this variant site and watermelon salt tolerance, providing a stable and practical detection tool for marker-assisted breeding of salt-tolerant watermelons.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a ClHAK8 gene promoter mutation site related to salt tolerance in watermelon, wherein the ClHAK8 gene promoter mutation site is located at -1534 to -1529 bp in the ClHAK8 gene promoter region; The nucleotide sequence of the ClHAK8 gene is shown in SEQ ID NO.1.

[0007] The present invention also provides a primer pair for identifying the salt tolerance of watermelon, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4.

[0008] The present invention also provides the application of the above-mentioned primer pairs in the preparation of products for identifying the salt tolerance of watermelons.

[0009] Furthermore, the product is a reagent kit.

[0010] The present invention also provides a product for identifying the salt tolerance of watermelons, comprising the primer pair described above.

[0011] Furthermore, the product is a reagent kit.

[0012] This invention also provides the application of the above-mentioned ClHAK8 gene promoter mutation site in identifying watermelon salt tolerance.

[0013] The present invention also provides the application of the above-mentioned primer pairs or products in identifying the salt tolerance of watermelons.

[0014] This invention also provides a method for identifying the salt tolerance of watermelons, comprising the following steps: Genomic DNA was extracted from the watermelon plants to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pairs described above. The PCR amplification products were then sequenced to identify the salt tolerance of watermelons. If the PCR amplification product contains the TTGACC sequence, the watermelon plant to be tested is determined to be a salt-intolerant watermelon material; if the PCR amplification product does not contain the TTGACC sequence, the watermelon plant to be tested is determined to be a salt-tolerant watermelon material.

[0015] Furthermore, the PCR amplification reaction system consists of: 2 μL ddH2O, 1 μL 10 mM upstream primer, 1 μL 10 mM downstream primer, 5 μL 2×PCR MIX, and 1 μL DNA template.

[0016] The present invention discloses the following technical effects: This invention is the first to clearly demonstrate that the presence or absence of the W-box element (TTGACC) in the upstream promoter region of the watermelon ClHAK8 gene at -1534 to -1529 bp is the core molecular switch regulating the salt tolerance of watermelon. The molecular marker is directly associated with the salt tolerance phenotype, and the identification results are accurate and reliable.

[0017] Traditional watermelon salt tolerance identification relies on field observation of salt stress phenotypes, which has drawbacks such as long cycle, susceptibility to environmental interference from temperature, light, water and fertilizer, and high cost of large-scale screening. In contrast, this invention only requires the extraction of plant genomic DNA, which can be detected by conventional PCR amplification combined with Sanger sequencing. It does not require high-precision experimental equipment, has a simple operation process, low detection cost, and is suitable for large-scale germplasm resource screening by breeding units.

[0018] The molecular markers developed in this invention can be used for early salt tolerance screening in watermelon seeds and seedlings, without waiting for salt stress treatment in mature plants, which greatly shortens the breeding cycle and can effectively improve the efficiency of salt-tolerant germplasm screening.

[0019] This invention elucidates the molecular mechanism by which promoter cis-element variations affect watermelon salt stress response by regulating potassium transport gene expression, improves the watermelon salt tolerance regulatory network, and provides a stable and practical detection tool for molecular marker-assisted breeding of salt-tolerant watermelons. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 Statistical graphs of the transcriptome data of ClHAK8 in salt-tolerant and salt-intolerant varieties; Figure 2 A diagram illustrating the structural variation analysis of genome assembly bases in salt-tolerant and salt-intolerant varieties; Figure 3 Comparison of different watermelon varieties after treatment with 0 or 150 mM NaCl; Figure 4 A statistical graph showing the expression levels of the ClHAK8 gene in different watermelon varieties after treatment with 0 or 150 mM NaCl. Figure 5 A statistical chart showing the potassium ion content of different watermelon varieties after treatment with 0 or 150 mM NaCl. Figure 6 A diagram illustrating the diversity analysis of the promoter region of the watermelon ClHAK8 gene. Detailed Implementation

[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0023] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0024] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0025] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0026] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0027] Example 1: Discovery of the ClHAK8 gene promoter mutation site 1. Transcriptome sequencing analysis of salt-tolerant watermelon strains “Zhongshihong” and salt-intolerant strain “PI186489” before and after salt stress revealed a significant difference in the expression level of the potassium ion transporter gene ClHAK8 under salt stress: ClHAK8 expression was significantly upregulated in the salt-tolerant strain, while its expression was significantly downregulated in the salt-intolerant strain. Figure 1 This suggests that transcriptional regulation of this gene plays a crucial role in watermelon's response to salt stress.

[0028] 2. To investigate the molecular regulatory mechanism of differential ClHAK8 gene expression, this invention used the reference genome data of watermelon 97103 (http: / / cucurbitgenomics.org / , V2) to locate and obtain the ClHAK8 gene (2319 bp coding region, nucleotide sequence as shown in SEQ ID NO.1) and its upstream promoter sequence information located on chromosome 10. The nucleotide sequence of the upstream 2000 bp promoter region is shown in SEQ ID NO.2.

[0029] 3. Primers were designed based on the reference genome sequence, and the ClHAK8 gene promoter was cloned using genomic DNA from the salt-tolerant material "Zhongshihong" and the salt-intolerant material "PI186489" as templates, respectively. Double alignment analysis of the promoter sequences from the two extreme materials revealed a key structural difference in the promoter region: the promoter sequence of the salt-intolerant material "PI186489" contained a complete W-box core cis-acting element (sequence TTGACC, located at -1534 to -1529 bp in the promoter region); while in the salt-tolerant material "Zhongshihong", this W-box element was missing (e.g., ...). Figure 2 (As shown).

[0030] SEQ ID NO.1:

[0031] SEQ ID NO.2:

[0032] Example 2: Development and Application of Molecular Markers Specific primers were designed to amplify DNA molecules containing the differentially expressed regions identified in Example 1, as follows: 1. DNA extraction DNA was extracted from young watermelon tissues using a DNA extraction kit, and the qualified DNA was stored at -20℃ for later use.

[0033] 2. Primer design Based on the molecular marker pClHAK, the following primer sequences were designed: pClHAK-F: 5'-TTGACAGATGGACAGTAGATATTGTT-3' (SEQ ID NO. 3) pClHAK-R: 5'-CCACATATAAAATTTGAATAGACCAC-3' (SEQ ID NO.4) Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the working solution concentration was 10 μM. The nucleotide sequence of the PCR amplification product of the salt-intolerant material “PI186489” is shown in SEQ ID NO.5.

[0034] SEQ ID NO.5: TTGACAGATGGACAGTAGATATTGTTAAGAATTAATTACGAAGGTAGCAAGCAAATAAATAATAGTTTTTTATAATAATAAAAAAATCATAATTTAATATATTTATCTATTACTATTGTTCAACTTAATCAATAATTTATAATAACTATACAATTTATATATTTGTAATTACTCTATAGAAATGCAAATTTACAATAATTTTATTTTAGATAACATAATTGAATATAGCTAAACTGATCAAGACATATATATAG TTGACC AAAGATCAAAAATTTGATTTCATCATGTATTATTGAGTTAACAAAATGAAAATAAATAAATAAATAAATAAATAAATAAATAAAGTGGTCTATTCAAATTTTATATGTGG.

[0035] 3. PCR amplification PCR amplification was performed using the following reaction system and procedure: The PCR reaction system consisted of 2 μL ddH2O, 1 μL 10 mM upstream primer, 1 μL 10 mM downstream primer, 5 μL 2×PCR MIX, and 1 μL DNA template.

[0036] The PCR reaction program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 30 s, 56℃ annealing for 20 s, 72℃ extension for 25 s, for a total of 32 cycles; stored at 4℃.

[0037] The PCR amplification products were detected by 1.0% agarose gel electrophoresis. During electrophoresis, the electrophoresis buffer was 1×TAE, and the electrophoresis was performed at a constant voltage of 150V for 15-20 min. After electrophoresis, gel imaging was performed for observation (e.g.,...). Figure 3 (As shown).

[0038] 4. Sanger sequencing of PCR amplification products By directly performing Sanger sequencing on the PCR amplification products of the test material, the watermelon plant can be determined to be a salt-tolerant variety based on sequence comparison: if the PCR amplification product contains the TTGACC sequence, the watermelon plant is a salt-intolerant watermelon material; if the PCR amplification product does not contain the TTGACC sequence, the watermelon plant is a salt-tolerant watermelon material.

[0039] Example 3: Verification of salt tolerance of the ClHAK8 gene To verify the function of the ClHAK8 gene in the salt stress response of watermelon, salt-tolerant materials (Zhongshihong) and salt-intolerant materials (PI186489) were treated with 150 mM NaCl. The treatment method was based on the following literature: "Gao Bowen. Preliminary establishment and transcriptome analysis of salt tolerance identification system for watermelon seedlings [D]. Chinese Academy of Agricultural Sciences, 2022". After salt stress treatment, the ClHAK8 gene was analyzed by real-time quantitative PCR, and K+ was detected. + The content of.

[0040] The real-time quantitative PCR reaction system is as follows: 1 μL 10mM upstream primer, 1 μL 10mM downstream primer, 10 μL 2×AMP SYBR Green fluorescent dye, 2 μL 5×cDNA, 6 μL H2O.

[0041] The reaction conditions for real-time quantitative PCR were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 58℃ annealing for 10 s, and 72℃ extension for 20 s, for a total of 45 cycles.

[0042] Phenotypic figures of various watermelon varieties after salt stress treatment are shown below. Figure 3It is evident that, after salt stress treatment, the growth of salt-tolerant materials is significantly better than that of non-salt-tolerant materials.

[0043] Real-time quantitative PCR analysis of the ClHAK8 gene yielded the following results: Figure 4 As shown, under salt stress, the expression level of the ClHAK8 gene was significantly upregulated (updated by more than 2-fold) in the salt-tolerant material "Zhongshihong" while it was significantly downregulated in the salt-intolerant material "PI186489".

[0044] Meanwhile, this invention detected K in various watermelon varieties. + The content of [the substance] was found to have changed significantly before and after salt stress. Figure 5 This trend is consistent with the gene expression level.

[0045] The above results indicate that salt-induced expression of the ClHAK8 gene is closely related to whether its promoter contains a W-box repressive element: salt-tolerant materials, lacking this element, can effectively activate ClHAK8 expression to enhance K+ expression. + This enhances salt tolerance by increasing absorption capacity; conversely, in salt-intolerant materials, the presence of this element may lead to inhibition by WRKY-type transcription factors, resulting in ClHAK8's inability to respond normally to salt stress. This real-time quantitative PCR validation result strongly supports, at the functional level, the causal relationship between the promoter variant site identified in this invention and the salt-tolerant phenotype of watermelon.

[0046] Example 4 The accuracy of the molecular markers in Example 2 in predicting salt tolerance of watermelons was verified using 99 watermelon samples (see Table 1).

[0047] The salt tolerance of various watermelon materials was tested using the method described in the literature "Gao Bowen. Preliminary establishment and transcriptome analysis of salt tolerance identification system for watermelon seedlings [D]. Chinese Academy of Agricultural Sciences, 2022". The results are shown in Table 1.

[0048] After extracting genomic DNA from watermelon, PCR amplification was performed using primers pClHAK-F / R, following the same method as in Example 2. The PCR amplification products were then subjected to Sanger sequencing; the results are shown below. Figure 6 It is evident that watermelon materials containing the TTGACC sequence in their PCR amplification products are all salt-intolerant watermelon materials, while watermelon materials without the TTGACC sequence in their PCR amplification products are all salt-tolerant watermelon materials. The results show that the molecular markers of this invention can effectively predict the salt tolerance of watermelon varieties.

[0049] Table 1. Salt tolerance test results of 99 watermelon samples The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A promoter variant site of the ClHAK8 gene associated with salt tolerance in watermelon, characterized in that, The ClHAK8 gene promoter mutation site is located at -1534 to -1529 bp in the ClHAK8 gene promoter region; The nucleotide sequence of the ClHAK8 gene is shown in SEQ ID NO.

1.

2. A primer pair for identifying the salt tolerance of watermelons, characterized in that, This includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

4.

3. The application of the primer pair as described in claim 2 in the preparation of a product for identifying the salt tolerance of watermelon.

4. The application according to claim 3, characterized in that, The product in question is a reagent kit.

5. A product for identifying the salt tolerance of watermelons, characterized in that, Includes the primer pair as described in claim 2.

6. The product according to claim 5, characterized in that, The product in question is a reagent kit.

7. The application of the ClHAK8 gene promoter variant site as described in claim 1 in identifying salt tolerance in watermelon.

8. The application of a primer pair as described in claim 2 or the product as described in claim 5 or 6 in identifying the salt tolerance of watermelons.

9. A method for identifying the salt tolerance of watermelons, characterized in that, Includes the following steps: Genomic DNA was extracted from the watermelon plants to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 2. The PCR amplification products were then sequenced to identify the salt tolerance of watermelons. If the PCR amplification product contains the TTGACC sequence, the watermelon plant to be tested is determined to be a salt-intolerant watermelon material; if the PCR amplification product does not contain the TTGACC sequence, the watermelon plant to be tested is determined to be a salt-tolerant watermelon material.

10. The method according to claim 9, characterized in that, The PCR amplification reaction system consisted of: 2 μL ddH2O, 1 μL 10 mM upstream primer, 1 μL 10 mM downstream primer, 5 μL 2×PCR MIX, and 1 μL DNA template.

Images