Reversible immunoaffinity magnetic beads for rapid isolation of target cells and method for preparing the same

CN122644037APending Publication Date: 2026-08-28SHANGHAI TONGJI HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610657205.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-13
Publication Date
2026-08-28

AI Technical Summary

Technical Problem

传统的免疫亲和磁珠,即磁珠上包被能与靶细胞表明标志物结合的抗体,通常采用的偶联方式是生物素-链霉亲和素、小分子Linker等化学偶联,通常无法达到结合细胞后的温和解离(可逆且保持细胞活性);而采用流式细胞术分离细胞,耗时长、样本量需求高、需大型设备,昂贵且不便捷

Benefits of technology

[0047] (1) This invention aims to achieve reversible binding of immunoaffinity magnetic beads to target cells through a special linker design and a mild enzymatic digestion method. By introducing an enzyme cleavage site through the special linker design, the linker can be quickly and accurately cleaved under mild conditions (such as the addition of specific proteases), with an enzyme cleavage efficiency of >90%; the magnetic beads can be separated from the cells (separation efficiency >80%), avoiding mechanical or chemical damage and ensuring high cell activity (cell activity >95%) and integrity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122644037A_ABST
    Figure CN122644037A_ABST
Patent Text Reader

Abstract

The present application relates to a kind of reversible immunomagnetic beads for quickly separating target cells and its preparation method. Specifically, the present application provides a kind of reversible immunomagnetic beads, which includes magnetic carrier, affinity ligand and the connecting arm of the connection between the two, wherein the connecting arm contains a nucleotide sequence that can be specifically recognized by enzyme cutting, preferably containing deoxyinosine (dI) base.The present application also provides a kit comprising the magnetic beads and specific cleavage enzyme (such as endonuclease V).The magnetic beads of the present application can be cleaved by enzyme to achieve mild and rapid dissociation of the magnetic beads and target cells, with high separation efficiency and good cell viability, solving the problem of cell damage caused by irreversible binding of traditional immunomagnetic beads.The present application is simple to operate, does not require complex equipment, and the separated cells can be directly used for in vitro expansion, differentiation or cell therapy, and has wide research and clinical application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more specifically, to a reversible immunoaffinity magnetic bead for rapid separation of target cells and a method for its preparation. Background Technology

[0002] There are two main technologies for target cell isolation and purification: traditional immunoaffinity magnetic beads and flow cytometry. Traditional immunoaffinity magnetic beads, which are magnetic beads coated with antibodies that can bind to the markers on the target cells, usually use chemical conjugation methods such as biotin-streptavidin or small molecule linkers. These methods typically cannot achieve gentle dissociation after binding to cells (reversible and maintaining cell viability). On the other hand, flow cytometry for cell separation is time-consuming, requires large sample volumes, and necessitates large equipment, making it expensive and inconvenient.

[0003] Therefore, there is an urgent need in this field to find a novel cell separation method that can achieve efficient and gentle cell dissociation, while being easy to operate, requiring low equipment standards, and suitable for routine laboratory conditions. Summary of the Invention

[0004] The purpose of this invention is to provide a novel cell separation method that can achieve efficient and gentle cell dissociation, while being easy to operate, requiring low equipment standards, and suitable for routine laboratory conditions.

[0005] In a first aspect of the invention, a reversible immunoaffinity magnetic bead for separating target cells is provided, the magnetic bead comprising:

[0006] (a) Magnetic carrier;

[0007] (b) Affinity ligands capable of specifically binding to target cells; and

[0008] (c) A linker connecting the magnetic carrier and the affinity ligand;

[0009] The linker arm contains a nucleotide sequence that can be specifically cleaved and recognized by enzymes; the nucleotide sequence contains at least one deoxyinosine (dI) base.

[0010] In another preferred embodiment, the nucleotide sequence comprises 2-6 deoxyinosine (dI) bases, preferably 4.

[0011] In another preferred embodiment, the linker arm is an oligonucleotide with the sequence shown in SEQ ID NO: 1, or a variant thereof comprising substitutions, deletions, or additions of one or more nucleotides, wherein the variant retains the function of being specifically recognized by enzyme cleavage.

[0012] In another preferred embodiment, one end of the connecting arm is coupled to the magnetic carrier via a first covalent bond, and the other end is coupled to the affinity ligand via a second covalent bond.

[0013] In another preferred embodiment, the first covalent bond is an amide bond.

[0014] In another preferred embodiment, the second covalent bond is an amide bond.

[0015] In another preferred embodiment, the 3' end of the connecting arm forms an amide bond with a carboxyl group on the surface of the magnetic carrier through amino modification, and the 5' end of the connecting arm forms an amide bond with an amino group on the affinity ligand through carboxyl modification.

[0016] In another preferred embodiment, the affinity ligand is an antibody or a functional fragment thereof capable of recognizing markers on the surface of target cells.

[0017] In another preferred embodiment, the magnetic carrier is a carboxylated (-COOH) magnetic bead, an aminated (-NH2) magnetic bead, a thiolated (-SH) magnetic bead, or an epoxidized (-CH(O)CH2) magnetic bead.

[0018] In another preferred embodiment, the target cells include macrophages, T cells, granulocytes, and stem cells.

[0019] In a second aspect of the invention, a kit for isolating target cells is provided, comprising the reversible immunoaffinity magnetic beads described in the first aspect of the invention, and an enzyme capable of specifically cleaving the connecting arms; preferably, the enzyme is endonuclease V (Endo V).

[0020] In another preferred embodiment, the kit further comprises a cell separation buffer having an osmotic pressure of 280-330 mOsm / kg and containing Mg. 2+ .

[0021] In another preferred embodiment, the buffer solution comprises: 5-20 mM HEPES, 100-150 mM NaCl, 1-10 mM KCl, 1-10 mM glucose, 1-10 mM MgCl2, 0.1-1 mM reduced glutathione, pH 6-7.

[0022] In another preferred embodiment, the buffer solution comprises: 10 mM HEPES, 120 mM NaCl, 5 mM KCl, 5 mM glucose, 5 mM MgCl2, 0.5 mM reduced glutathione, and pH 7.4.

[0023] In a third aspect of the present invention, a method for preparing the reversible immunoaffinity magnetic beads described in the first aspect of the present invention is provided, comprising the following steps:

[0024] (1) A connecting arm with a first reactive group at one end is provided, and a magnetic carrier is provided;

[0025] (2) The first reactive group of the connecting arm is coupled to a magnetic carrier;

[0026] (3) Activate the second reactive group on the other end of the connecting arm of the product obtained in step (2);

[0027] (4) The activated second reactive group is coupled with the affinity ligand to obtain the reversible immunoaffinity magnetic beads.

[0028] In another preferred embodiment, the first reactive group of the connecting arm is an amino group.

[0029] In another preferred embodiment, the second reactive group of the connecting arm is a carboxyl group.

[0030] In another preferred embodiment, the surface of the magnetic carrier is covered with carboxyl groups.

[0031] In another preferred embodiment, the affinity ligand has an amino group.

[0032] In another preferred embodiment, in step (2), the first reactive group of the connecting arm is an amino group, and the surface of the magnetic carrier has a carboxyl group, which forms an amide bond through EDC / NHS catalysis.

[0033] In another preferred embodiment, in step (4), the second reactive group of the linker arm is a carboxyl group, and the affinity ligand has an amino group, which forms an amide bond through EDC / NHS catalysis.

[0034] In another preferred embodiment, after step (2) and / or step (4), a step of blocking the unreacted active groups with a blocking agent is further included.

[0035] In another preferred embodiment, the blocking agent is bovine serum albumin (BSA) or hydroxylamine hydrochloride.

[0036] In a fourth aspect of the invention, a method for in vitro isolation of target cells for non-therapeutic purposes is provided, comprising the following steps:

[0037] (a) A sample containing target cells is mixed and incubated with reversible immunoaffinity magnetic beads as described in the first aspect of the present invention or magnetic beads in the kit as described in the second aspect of the present invention to form a magnetic bead-cell complex.

[0038] (b) Separating the magnetic bead-cell complex from other components in the sample using magnetic separation technology;

[0039] (c) The magnetic bead-cell complex obtained in step (b) is subjected to an enzymatic cleavage reaction with an enzyme capable of cutting the connecting arm, thereby dissociating the magnetic beads from the target cells.

[0040] (d) Collect the dissociated target cells.

[0041] In another preferred embodiment, in step (c), the enzyme is endonuclease V.

[0042] In another preferred embodiment, in step (c), the enzymatic digestion reaction is carried out in a cell separation buffer, the components of which include: 5-20 mM HEPES, 100-150 mM NaCl, 1-10 mM KCl, 1-10 mM glucose, 1-10 mM MgCl2, 0.1-1 mM reduced glutathione, pH 6-7.

[0043] In another preferred embodiment, in step (c), the temperature of the enzymatic digestion reaction is 25-37°C and the time is 15-60 minutes.

[0044] In a fifth aspect of the invention, the reversible immunoaffinity magnetic beads described in the first aspect of the invention, or the kit described in the second aspect of the invention, are provided for use in the preparation of reagents or kits for isolating target cells.

[0045] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here.

[0046] Compared with the prior art, the present invention has the following technical effects:

[0047] (1) This invention aims to achieve reversible binding of immunoaffinity magnetic beads to target cells through a special linker design and a mild enzymatic digestion method. By introducing an enzyme cleavage site through the special linker design, the linker can be quickly and accurately cleaved under mild conditions (such as the addition of specific proteases), with an enzyme cleavage efficiency of >90%; the magnetic beads can be separated from the cells (separation efficiency >80%), avoiding mechanical or chemical damage and ensuring high cell activity (cell activity >95%) and integrity.

[0048] (2) This invention only requires conventional magnetic separation equipment (such as a magnetic rack), and the operation steps are simple and quick. It does not require complex instruments, which greatly reduces the threshold for use and time cost, making high-purity live cell sorting a conventional technology.

[0049] (3) The present invention combines immune affinity and reversible enzymatic digestion to achieve high specificity capture (high purity) and improve cell recovery rate and survival rate through gentle dissociation, which is particularly suitable for sorting precious and trace samples (such as clinical biopsy samples and rare cells).

[0050] (4) The method of the present invention enables the magnetic beads to be completely separated from the cells after enzyme digestion, and obtains “clean” target cells that can be directly used for in vitro expansion, induced differentiation, gene editing or cell reinfusion therapy, providing a safer and more efficient technical basis for the preparation of cell therapy products.

[0051] (5) Due to the irreversible binding of traditional immunomagnetic beads, problems such as magnetic bead retention and cell damage are caused. This invention solves the problem that the current separation method for maintaining cell viability after cell separation can only rely on large-scale equipment such as flow cytometry. It is suitable for cell sorting and subsequent culture and cell therapy. Attached Figure Description

[0052] Figure 1 The diagram shown is a schematic diagram of the construction of reversible immunoaffinity magnetic beads in an embodiment of the present invention.

[0053] Figure 2 The figure shown is a verification result of the optimization of the length of Oligo Linker and the number of dI sites in an embodiment of the present invention.

[0054] Figure 3 The image shown is a comparison of the reversible immunoaffinity magnetic bead coupling results before and after in an embodiment of the present invention. Electron microscopy and particle size analysis results before and after coupling both show that the magnetic beads become larger and more uniformly distributed after coupling.

[0055] Figure 4 The diagram shows the optimization results of the reversible immunoaffinity magnetic bead enzymatic digestion buffer in this embodiment of the invention. 1xBuffer #1 represents DMEM basal medium, and 1xBuffer #2 represents a buffer containing 10 mM HEPES (pH 7.4 + 120 mM NaCl + 5 mM KCl + 5 mM glucose + 5 mM MgCl2 + 0.5 mM reduced glutathione). Screening tests were conducted for the buffers required for reversible immunoaffinity magnetic bead enzymatic digestion. The buffers needed to maintain high enzymatic digestion efficiency and cell viability. After comparing these two aspects, 1xBuffer #2 was selected as meeting the above requirements, achieving a viable cell rate of over 95% and an enzymatic digestion efficiency of over 90% after incubation.

[0056] Figure 5 The figures shown are related to the verification results of the reversible immunoaffinity magnetic beads separating target cells in the embodiments of the present invention. Based on the VSIG4 antibody-positive magnetic nanobeads constructed by the method of the present invention, their separation of THP-1 (VSIG4) was tested.+ The separation efficiency was above 80% when different numbers of positive cells were incorporated. In addition, the separation efficiency was also above 80% when the incubation time was greater than 15 minutes.

[0057] Figure 6 The figure shown is a graph illustrating the results of the verification of the release rate and cell viability of target cells separated by reversible immunoaffinity magnetic beads in an embodiment of the present invention.

[0058] Figure 7 The diagram shown illustrates the process of separating target cells using reversible immunoaffinity magnetic beads and its application in cell culture, as described in this embodiment of the invention.

[0059] Figure 8 The images show the results of isolating mouse bone marrow mononuclear macrophages using MNP@Oligo-VSIG4 in an embodiment of the present invention. The isolated VSIG4-positive mononuclear macrophages exhibited higher cell activity. In the images, A shows the results of microscopic photography and CCK8 detection, and B shows the results of immunofluorescence. Detailed Implementation

[0060] To make the objectives, technical solutions, beneficial effects, and significant advancements of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, all the described embodiments are only some embodiments of the present invention, and not all embodiments; based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0061] the term

[0062] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0063] As used herein, “including” or “containing” includes “comprising,” “mainly composed of,” “substantially composed of,” and “composed of”; “mainly composed of,” “substantially composed of,” and “composed of” are subordinate concepts of “containing,” “having,” or “including.”

[0064] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. Unless otherwise specified, all experimental materials and reagents involved in this invention are commercially available.

[0065] Experimental materials and reagents:

[0066] Carboxylated magnetic beads (Dongna Biotechnology, catalog number Mag9404), modified Oligo (Genewiz Synthetic, catalog number 80-1816039628), 0.1 M MES buffer (pH 4.8), 0.1 M PBS (pH 7.4), 1 mg / mL bovine serum albumin (BSA), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), N-hydroxysuccinimide (NHS), 0.5 mg antibody (VSIG4 antibody, brand AntibodySystem SAS, catalog number DHK26801), 1 M hydroxylamine hydrochloride, and ultrapure water.

[0067] Experimental methods

[0068] This invention designs an oligonucleotide containing four deoxyinosine (dI) bases (Oligo, 5'COOH-ATGCGATCTIGACTGAITCGAATICGGTACICATGTA-Aminolinker-3', where "I" represents deoxyinosine (dI), SEQ ID NO: 1) as a linker, and uses a control linker without dI (sequence ATGCGATCTAGACTGAATCGAATACGGTACACATGTA, SEQ ID NO: 2) to determine the enzyme digestion effect; carboxylated magnetic beads are directionally coupled to specific antibodies. Specifically, the amino-modified end of Oligo (3' Aminolinker C7 modification, referring to the chemical modification of the 3' end of the oligonucleotide (such as a primer or probe) by connecting an amino group (-NH2) to the carboxyl group on the surface of the magnetic beads via an amide bond; the carboxyl-modified end (COOH) of Oligo is activated by EDC / NHS and covalently bound to the amino group of the antibody, such as... Figure 1 As shown.

[0069] The experimental procedure is as follows:

[0070] Step 1: Activation of carboxylated magnetic beads

[0071] 1) Take carboxylated magnetic beads: Take 0.2 mL of carboxylated magnetic bead suspension (about 2 mg of magnetic beads), collect the magnetic beads with a magnetic rack, and discard the supernatant.

[0072] 2) Washing: Wash three times with 2 mL of 0.1 M MES buffer, and discard the supernatant after each wash using magnetic separation.

[0073] 3) Activate carboxyl groups: Resuspend the magnetic beads in 0.2 mL of 0.1 M M EES buffer. Add EDC to a final concentration of 10 mM and NHS to a final concentration of 5 mM. Shake at room temperature (300 rpm) for 15 minutes to activate the carboxyl groups on the magnetic beads.

[0074] Step 2: Coupling Oligo DNA with Magnetic Beads

[0075] 1) Prepare aminoated Oligo DNA: Take 20 μL of 100 μM aminoated Oligo DNA solution (dissolved in 0.1 M MES buffer).

[0076] 2) Coupling reaction: Mix the activated magnetic beads with Oligo DNA solution and shake at room temperature (200 rpm) for 2 hours.

[0077] 3) Termination of reaction: Add hydroxylamine hydrochloride to a final concentration of 50 mM (e.g., add 10 μL of 1 M hydroxylamine hydrochloride), and shake at room temperature for 15 minutes to terminate the reaction.

[0078] Step 3: Block unreacted reactive groups

[0079] 1) Washing: Wash the magnetic beads three times with 2 mL PBS, and discard the supernatant after magnetic separation.

[0080] 2) Blocking: Resuspend the magnetic beads in 0.2 mL of 1 mg / mL BSA solution and shake at room temperature for 1 hour.

[0081] 3) Final washing: Wash 3 times with PBS, magnetically separate, and store in 0.2 mL PBS (4°C for later use).

[0082] Step 4: Conjugation of carboxylated Oligo DNA to antibodies

[0083] 1) Activate the carboxyl terminus: Take the above-conjugated magnetic beads and wash them three times with 2 mL of 0.1 M MES buffer. Resuspend them in 0.2 mL of MES buffer, add 10 mM EDC and 5 mM NHS to a final concentration, and shake at room temperature for 15 minutes.

[0084] 2) Prepare antibody solution: Dissolve 0.1 mg of antibody in 100 μL PBS (final concentration 1 mg / mL).

[0085] 3) Antibody conjugation: Mix the antibody solution with the activated magnetic beads and shake at room temperature (200 rpm) for 2 hours.

[0086] 4) Termination of reaction: Add hydroxylamine hydrochloride to a final concentration of 50 mM and shake at room temperature for 15 minutes.

[0087] Step 5: Blocking and Purification

[0088] 1) Blocking: Add 0.2 mL of 1 mg / mL BSA solution and shake at room temperature for 1 hour.

[0089] 2) Washing: Wash 3 times with 2 mL PBS, then magnetically separate and discard the supernatant.

[0090] 3) Storage: Resuspend in 0.2 mL PBS (containing 0.05% NaN3) and store at 4°C protected from light.

[0091] After cell immunoaffinity separation, the dI site in Oligo is cleaved by Endo V nuclease (the processing buffer consists of 10 mM HEPES, pH 7.4 + 120 mM NaCl + 5 mM KCl + 5 mM glucose + 5 mM MgCl2 + 0.5 mM reduced glutathione, which is a buffer that facilitates enzymatic cleavage and cell preservation; the optimal temperature is 37℃ and the processing time is 30 min), thus achieving gentle dissociation of the magnetic beads from the cells and ensuring cell viability.

[0092] This invention solves the problem of cell damage caused by the irreversible binding of traditional immunomagnetic beads, and is suitable for cell sorting followed by culture and cell therapy. The method is simple to operate, highly specific, and reproducible, and the dissociation efficiency can be controlled by adjusting the Oligo length and dI number.

[0093] Example 1: Construction of reversible immunoaffinity magnetic beads

[0094] like Figure 1 As shown, the carboxylated magnetic beads are first activated:

[0095] 1) Take 0.2 mL of carboxylated magnetic beads (commercial basic carboxylated magnetic beads) suspension (about 2 mg of magnetic beads), collect the magnetic beads using a magnetic rack, and discard the supernatant;

[0096] 2) Wash three times with 2 mL of 0.1 M MES buffer, and discard the supernatant after each wash using magnetic separation;

[0097] 3) Resuspend the magnetic beads in 0.2 mL of 0.1 M M MES buffer. Add EDC to a final concentration of 10 mM and NHS to a final concentration of 5 mM. Shake at room temperature (300 rpm) for 15 minutes to activate the carboxyl groups on the magnetic beads.

[0098] 4) Coupling the Oligo DNA from the above experimental method with the activated magnetic beads:

[0099] 4.1) Take 20 μL of 100 μM one-end aminoated Oligo DNA solution (dissolved in 0.1 M MES buffer).

[0100] 4.2) Mix the activated magnetic beads with the Oligo DNA solution and shake (200 rpm) at room temperature for 2 hours;

[0101] 4.3) Add hydroxylamine hydrochloride to a final concentration of 50 mM, shake at room temperature for 15 minutes to terminate the reaction; wash the magnetic beads three times with 2 mL PBS, and discard the supernatant after magnetic separation;

[0102] 4.4) Resuspend the magnetic beads in 0.2 mL of 1 mg / mL BSA solution and shake at room temperature for 1 hour;

[0103] 4.5) Wash three times with PBS, magnetically separate, and store in 0.2 mL PBS (4°C for later use).

[0104] 5) Conjugation of carboxylated Oligo DNA to antibodies (using anti-VSIG4 antibody as an example):

[0105] 5.1) Take the magnetic beads that have been coupled with Oligo, wash them three times with 2 mL of 0.1 M MES buffer, resuspend them in 0.2 mL of MES buffer, add 10 mM EDC and 5 mM NHS to a final concentration, and shake at room temperature for 15 minutes.

[0106] 5.2) Dissolve 0.1 mg of VSIG4 antibody in 100 μL of PBS;

[0107] 5.3) Mix the antibody solution with the activated Oligo-magnetic beads and shake at room temperature (200 rpm) for 2 hours;

[0108] 5.4) Add hydroxylamine hydrochloride to a final concentration of 50 mM and shake at room temperature for 15 minutes;

[0109] 5.5) Add 0.2 mL of 1 mg / mL BSA solution and shake at room temperature for 1 hour; wash 3 times with 2 mL PBS, and magnetically separate and discard the supernatant;

[0110] 5.6) Resuspend in 0.2 mL PBS (containing 0.05% NaN3) to obtain the fully coupled immunoaffinity magnetic beads, which can be stored at 4°C protected from light.

[0111] Example 2: Optimization and Verification of Oligo Linker

[0112] Oligo Linkers of different lengths (each containing 4 dI sites) were designed and synthesized to optimize and verify cleavage efficiency. They were named 27nt (Oligo, 5'COOH-ATGCTCTIGAGAITCATICGACITGTA-Aminolinker-3', where "I" represents deoxyinosine (dI), SEQ ID NO: 3), 37nt (Oligo, 5'COOH-ATGCGATCTIGACTGAITCGAATICGGTACICATGTA-Aminolinker-3', where "I" represents deoxyinosine (dI), SEQ ID NO: 1), and 47nt (Oligo, 5'COOH-ATGCTGGATCTIGACACTGAITCTCGAATICGTGGTACICACCTGTA-Aminolinker-3', where "I" represents deoxyinosine (dI), SEQ ID NO: 4) based on their lengths. Take 1 µL (1 pmol / µL) of the above Oligo Linker into centrifuge tubes and set up 4 groups: 27nt group (18 µL of 1×Endo V buffer + 1 µL of Endo V); 37nt group (18 µL of 1×Endo V buffer + 1 µL of Endo V); 47nt group (18 µL of 1×Endo V buffer + 1 µL of Endo V); and enzyme-free control (NEC) group (19 µL of 1×Endo V buffer + 1 µL of 37nt Oligo Linker). Add the corresponding reagents according to the above groups, incubate at 37℃ for 30 min, and then incubate at 65℃ for 10 min to inactivate the enzyme. Then, use this as a template for qPCR detection. The qPCR reaction system is as follows: 2 µL template + 0.8 µL primer + 10 µL TB Green Premix Ex Taq II reagent (TaKaRa, catalog number RR820A) + 7.2 µL deionized water. The qPCR program is as follows: 95℃ 30s + 40 cycles (95℃ 5s + 60℃ 3s). The residual amount of intact Oligo relative to the NEC group can be calculated based on the Ct value.

[0113] Oligo Linkers (all 37nt) containing different numbers of dI sites were designed and synthesized to optimize and verify cleavage efficiency. They were named according to the number of dI sites as follows: 2-dI (Oligo, 5'COOH-ATGCGATCTIGACTGAATCGAATICGGTACACATGTA-Aminolinker-3', where "I" represents deoxyinosine (dI), SEQ ID NO: 5), 4-dI (Oligo, 5'COOH-ATGCGATCTIGACTGAITCGAATICGGTACICATGTA-Aminolinker-3', where "I" represents deoxyinosine (dI), SEQ ID NO: 1), and 6-dI (Oligo, 5'COOH-ATGIGATCTIGACTGIATCGAIATCGGITACCAIGTA-Aminolinker-3', where "I" represents deoxyinosine (dI), SEQ ID NO: 6). Take 1 µL (1 pmol / µL) of the above Oligo Linker into a new centrifuge tube and set up 4 groups: 2-dI group (18 µL of 1×Endo V buffer + 1 µL of Endo V); 4-dI group (18 µL of 1×Endo V buffer + 1 µL of Endo V); 6-dI group (18 µL of 1×Endo V buffer + 1 µL of Endo V); and enzyme-free control (NEC) group (19 µL of 1×Endo V buffer + 1 µL of 4-dI OligoLinker). Add the corresponding reagents according to the above groups, incubate at 37℃ for 30 min, and then incubate at 65℃ for 10 min to inactivate the enzyme. Then, use this as a template for qPCR detection. The qPCR reaction system is as follows: 2 µL template + 0.8 µL primer + 10 µL TB GreenPremix Ex Taq II reagent (TaKaRa, catalog number RR820A) + 7.2 µL deionized water. The qPCR program is as follows: 95℃ for 30s + 40 cycles (95℃ 5s + 60℃ 3s). The residual amount of intact Oligo relative to the NEC group can be calculated based on the Ct value.

[0114] The results are as follows Figure 2As shown, the 37nt Oligo Linker has higher cleavage efficiency compared to Oligo Linkers of other lengths; and the Oligo Linker containing 4 dI sites has higher cleavage efficiency compared to Oligo Linkers containing other numbers of dI sites. Although the digestion efficiency of Oligo Linker with two dI sites or a length of 27nt can reach about 70%, theoretically, Endo V, under the matching buffer and appropriate digestion conditions, can digest dI sites with 100% efficiency (enzyme activity is defined as the amount of enzyme required to digest 1 pmol of a 34-mer oligonucleotide single strand containing a single dI site within 15 min at 37℃). Therefore, 70% is relatively low compared to 100%, while the digestion efficiency of Oligo Linker with four dI sites or a length of 37nt is about 95%, which is better. Secondly, considering that the cell capture rate and the digestion rate of Oligo Linker together determine the final target cell recovery rate, the recovery rate of target cells captured by commercial magnetic beads (irreversible, i.e., the cell capture rate) is usually >85%. Therefore, we choose Oligo Linker with a digestion efficiency of more than 85%, which is more conducive to improving the subsequent cell recovery rate (reversible). In summary, the 37nt Oligo Linker containing 4 dI sites is optimal, and the reversible immunoaffinity magnetic beads used in subsequent embodiments are all magnetic beads linked by this Oligo Linker.

[0115] Example 3: Identification of reversible immunoaffinity magnetic beads

[0116] The VSIG4 reversible immunoaffinity magnetic beads (MNP@Oligo-VSIG4) constructed in Example 1 were air-dried, and the samples were then adhered to conductive adhesive and vacuum-sealed for scanning electron microscopy imaging. Next, using MNP as a control, the constructed MNP@Oligo-VSIG4 was used as a template for qPCR detection. The qPCR reaction system was as follows: 2µL template + 0.8µL primers (sequences: upstream 5'-CAGCCAATGCGATCTAGACTGAATC-3', SEQ ID NO: 7; downstream 5'-GGATCCTACATGTGTACCGTATTCG-3', SEQ ID NO: 8) + 10µL TB Green Premix Ex Taq II reagent (TaKaRa, catalog number RR820A) + 7.2µL deionized water. The qPCR program was as follows: 95℃ for 30s + 40 cycles (95℃ for 5s + 60℃ for 3s). The amount of Oligo coupled to MNP@Oligo-VSIG4 relative to the MNP group can be calculated based on the Ct value.

[0117] Finally, using MNP as a control, the constructed MNP@Oligo-VSIG4 was used as a sample for Western blotting. 1 µL of sample was added to 9 µL of loading buffer, and the mixture was denatured at 95 °C for 10 min, followed by SDS-PAGE electrophoresis. After transfer to a membrane for 40 min and blocking for 30 min, the membrane was incubated overnight at 4 °C with horseradish peroxidase-labeled secondary antibody. The next day, the membrane was exposed to ECL detection solution.

[0118] The results are as follows Figure 3 As shown, compared with carboxylated magnetic beads (MNP), the surface of the coupled magnetic beads MNP@Oligo-VSIG4 appears rougher due to the coupling with Oligo-VSIG4, and particle size analysis also shows that the particle size of MNP@Oligo-VSIG4 is significantly increased.

[0119] Example 4: Optimization of reversible immunoaffinity magnetic bead enzymatic digestion buffer

[0120] Furthermore, to ensure good enzymatic digestion efficiency and cell viability of magnetic beads, the present invention optimizes the reaction buffer. The culture medium (DMEN basal medium) used for cell culture can maintain good cell viability for a certain period of time, while the buffer for nuclease can maintain high enzyme digestion efficiency, but has high osmotic pressure and cannot guarantee cell viability.

[0121] Therefore, this invention optimizes the buffer solution based on the existing buffer, and prepares a self-prepared buffer Buffer#2 (10 mM HEPES, pH 7.4 + 120 mM NaCl + 5 mM KCl + 5 mM glucose + 5 mM MgCl2 + 0.5 mM reduced glutathione, osmotic pressure approximately 310 mOsm / kg). The concentrations of each component in Buffer#2 are determined by comprehensively considering the acid-base balance, the essential components required for cell survival, the osmotic pressure, and the metal ions required for nuclease activity. For example, if the glucose concentration is too high, the concentrations of other ions need to be reduced to balance the osmotic pressure, which may affect the enzyme's digestion efficiency; if it is too low, cell activity may be affected. Comparative verification of reversible cell separation was performed using DMEN basal medium (L-glutamine 2 mM, glucose 4500 mg / L, sodium pyruvate 110 mg / L, phenol red 15 mg / L, sodium bicarbonate 3700 mg / L, and various amino acids, vitamins, inorganic salts, etc., with an osmotic pressure of approximately 320-350 mOsm / kg) as Buffer #1, supplemented with PBS (NaCl 137 mM, KCl 2.7 mM, Na2HPO4 10 mM and KH2PO4 2 mM).

[0122] First, take an equal volume of 20 µL of THP-1 cell suspension (1×10⁻⁶). 6(cells / mL) were placed in three new centrifuge tubes. After centrifugation, the supernatant was discarded. The cells were resuspended in 20 µL of Buffer #1, Buffer #2, and PBS, respectively. After standing at 37°C for 15 min, the cells were mixed with 20 µL of 0.4% trypan blue solution in equal volumes (1:1) in the centrifuge tubes. The mixture was gently pipetted and incubated at room temperature for 2-3 min. Then, 10–15 µL of the mixture was added to a hemocytometer or cell counting chamber. The cells were counted under a microscope within 3-5 min. Live cells were transparent and bright, while dead cells were stained blue. The dead cell rate was calculated using the formula (dead cell rate = number of dead cells / total number of cells × 100%).

[0123] Take 1 µL of the coupled magnetic beads MNP@Oligo-VSIG4 into four new centrifuge tubes and set up four groups: Buffer#1 group (Buffer#1 18 µL + Endo V 1 µL); Buffer#2 group (Buffer#2 18 µL + Endo V 1 µL); PBS group (PBS 18 µL + Endo V 1 µL); and enzyme-free control (NEC) group (19 µL of 1×Endo V's accompanying buffer). Add the corresponding reagents according to the above groups, incubate at 37°C for 15 min, and then incubate at 65°C for 10 min to inactivate the enzyme. Then, using this as a template, qPCR detection was performed. The qPCR reaction system was as follows: 2 µL template + 0.8 µL primers (sequences: upstream 5'-CAGCCAATGCGATCTAGACTGAATC-3', SEQ ID NO: 7; downstream 5'-GGATCCTACATGTGTACCGTATTCG-3', SEQ ID NO: 8) + 10 µL TB GreenPremix Ex Taq II reagent (TaKaRa, catalog number RR820A) + 7.2 µL deionized water. The qPCR program was as follows: 95℃ for 30 s + 40 cycles (95℃ 5 s + 60℃ 3 s). The residual amount of intact magnetic beads relative to the NEC group in the system could be calculated based on the Ct value.

[0124] The results are as follows Figure 4 As shown, compared with the control group (1xBuffer#1) or NEC, 1xBuffer#2 was able to maintain good cell viability and enzyme digestion efficiency.

[0125] Example 5: Validation of the effect of reversible immunoaffinity magnetic beads in separating target cells

[0126] This invention uses THP1 cells that highly express VSIG4 as positive cells and C166 cells that do not express VSIG4 as negative cells to verify the cell isolation of MNP@Oligo-VSIG4.

[0127] C166 cells were digested with trypsin and the concentration was adjusted to 1×10⁻⁶. 5 Take 50 µL (5000 cells / tube) and place it into 4 new centrifuge tubes. Add 5 µL (50 cells), 10 µL (100 cells), 20 µL (200 cells), and 50 µL (500 cells) of THP-1 cells (1×10⁻⁶ cells / mL) to each tube respectively. 4 (cells / mL), each group was brought to 100µL with Buffer #2. Then, 1µL of magnetic beads MNP@Oligo-VSIG4 were added to each group, mixed thoroughly, and incubated at 37°C for 15 min. The cells were then washed three times using a magnetic rack to remove unbound negative cells. The cell pellet was then resuspended in 20µL, and the cell count was performed under a microscope to calculate the separation efficiency for each group.

[0128] C166 cells were digested with trypsin and the concentration was adjusted to 1×10⁻⁶. 5 Take 50 µL (5000 cells / tube) of THP-1 cells per mL and place it in 5 new centrifuge tubes. Add 5 µL (50 cells) of THP-1 cells (1×10⁻⁶ cells / mL) to each tube. 4 (cells / mL), each group was brought to 100µL with Buffer #2. Then, 1µL of magnetic beads MNP@Oligo-VSIG4 were added to each group, and after thorough mixing, the cells were incubated at 37°C for 5 min, 15 min, 30 min, 45 min, and 60 min, respectively. The cells were then washed three times using a magnetic rack to remove unbound negative cells. The cell pellet was then resuspended in 20µL, and the cell count was performed under a microscope to calculate the separation efficiency for each group.

[0129] The results are as follows Figure 5 As shown, with a magnetic bead dosage of 1 μL, the separation efficiency of 50-200 THP1 cells can be achieved by incorporating 5000 C166 cells into them. The separation efficiency can also reach over 80% when the incubation time is 15 min. The separation efficiency will increase to some extent with the extension of the incubation time.

[0130] Example 6: Validation of target cell release rate and cell viability separated by reversible immunoaffinity magnetic beads

[0131] Furthermore, based on the optimized buffer and incubation time described above, this invention uses 50 µL of THP-1 cells (1 × 10⁻⁶ cells per cell line). 5 The cells were incubated with 1µL MNP@Oligo-VSIG4 for 15 min, and then stained with CCR2 antibody (1:50) and goat anti-rabbit AF-488 fluorescent secondary antibody. The binding of cells to magnetic beads was observed under a microscope.

[0132] Secondly, the release of target cells was detected at different enzymatic digestion times. C166 cells were digested with trypsin at a concentration adjusted to 1×10⁻⁶. 5 Take 50 µL (5000 cells / tube) of THP-1 cells per mL and place it in 5 new centrifuge tubes. Add 5 µL (50 cells) of THP-1 cells (1×10⁻⁶ cells / mL) to each tube. 4 (cells / mL), each group was brought to 100µL with Buffer #2. Then, 1µL of magnetic beads MNP@Oligo-VSIG4 was added to each group, thoroughly mixed, and incubated at 37°C for 15 min. The cells were then washed three times with a magnetic rack to remove unbound negative cells, and the cell pellet was resuspended in 20µL. The magnetic bead-cell mixture was then counted under a microscope. Equal volumes of the mixture were divided into five groups, and the mixture was incubated with Endo V for 5 min, 10 min, 15 min, 25 min, and 40 min, respectively. After elution with a magnetic rack, the supernatant was collected, and the cell count was determined under a microscope. The release efficiency of each group could be calculated based on the amount of magnetic beads-cell mixture added.

[0133] Finally, the cell viability of the isolated cells and THP-1 cells was compared using the CCK8 assay. An equal volume of the isolated VSIG4-positive cell suspension (1×10⁻⁶) was taken. 5 (cells / mL) and THP-1 cell suspension (1×10) 5 100 µL of each of the two cell types (cells / mL) was seeded in five 96-well plates, with six replicates for each cell type. On days 1, 2, 3, 4, and 5 after seeding, 10 µL of CCK8 solution was added to each well, and the plates were incubated at 37°C for 1 hour. The absorbance of each well was then measured at a wavelength of 450 nm, and the viability of the two cell types could be calculated based on the absorbance.

[0134] The results are as follows Figure 6 As shown, when the enzymatic digestion time is 15 minutes or more, the release efficiency of target cells can reach over 95%, and the overall separation efficiency is over 80%. The viability of the separated cells is basically the same as that of normally cultured THP-1 cells. Based on this, experimental verification based on cell lines shows that MNP@Oligo-VSIG4 can achieve a target cell separation efficiency of over 80%, with short processing time and good cell viability.

[0135] Example 7: Reversible immunoaffinity magnetic beads for separating target cells

[0136] Figure 7 The diagram illustrates the reversible immunoaffinity magnetic beads of the present invention for cell separation and subsequent applications.

[0137] Based on samples such as blood (requiring pretreatment such as density gradient centrifugation or erythrocyte lysis to separate leukocytes), tissue single-cell suspensions (tissues require routine mechanical shearing, digestion, filtration, etc., to prepare tissue single-cell suspensions), or bone marrow-derived cells (requiring pipetting, filtration, and dispersion into single cells), 1 μL of magnetic beads corresponds to 10 cells sorted. 6 The cells are mixed with magnetic beads and incubated for ≥15 minutes. Then, they are washed with a magnetic rack to remove unbound negative cell components. After digestion with Endo V nuclease at 37°C for 15 minutes, the cell suspension is placed on a magnetic rack and aspirated. These are the isolated target cells, which can be used for subsequent direct analysis, culture expansion, culture activation, and further cell therapy.

[0138] Example 8: Sorting and activity detection of VSIG4-positive macrophages for cell therapy

[0139] The VSIG4-positive cell sorting magnetic beads (MNP@Oligo-VSIG4) constructed in the above embodiments were used for the reversible sorting of VSIG4-positive macrophages. The cell sorting process is as follows:

[0140] Isolation of VSIG4-positive macrophages from bone marrow

[0141] (1) Acquisition and induction of differentiation of bone marrow mononuclear cells:

[0142] Under aseptic conditions, mouse femurs and tibias were harvested, and bone marrow cells were flushed out with PBS containing 2% FBS. After erythrocyte lysis, the cells were resuspended in complete medium (RPMI-1640, 10% FBS) containing 20 ng / mL M-CSF and seeded at an appropriate density in culture dishes. The cells were cultured at 37°C in a 5% CO2 incubator for 5-7 days, with half the medium replaced every 2-3 days, to induce differentiation into bone marrow-derived macrophages.

[0143] (2) Positive sorting of MNP@Oligo-VSIG4 reversible immunoaffinity magnetic beads:

[0144] Collect induced cells, resuspend them in pre-chilled cell sorting buffer (10 mM HEPES, pH 7.4 + 120 mM NaCl + 5 mM KCl + 5 mM glucose + 5 mM MgCl2 + 0.5 mM reduced glutathione) and count them. Divide the cells into groups of 10-1. 7 Add 10 μL of MNP@Oligo-VSIG4 to each cell and incubate at room temperature for 15 minutes. Wash twice with buffer, place on a magnetic rack, and remove unbound cells. The sorted cells can be used immediately for subsequent experiments. A portion of the cells can be taken for purity retesting by immunofluorescence and cell viability detection using CCK8.

[0145] Before and after sorting, bone marrow-derived mononuclear macrophages were placed in culture dishes and incubated at 37°C in a CO2 incubator, and photographed under an optical microscope.

[0146] The results are as follows Figure 8 As shown, compared with the VSIG4-positive cells before sorting with magnetic beads, the bone marrow-derived VSIG4-positive macrophages after sorting were in good cell condition, with virtually no magnetic beads remaining on the cell surface. Figure 8 (AB). Furthermore, CCK8 assay was performed, and the cells after sorting showed good proliferation capacity, even better than the bone marrow-derived cell mixture (BMDM) before sorting.

[0147] The preferred embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and the devices and structures not described in detail should be understood as being implemented in a conventional manner in the art. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the scope of the present invention. This does not affect the essential content of the present invention. Therefore, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the present invention's technical solutions still fall within the protection scope of the present invention.

Claims

1. A reversible immunoaffinity magnetic bead for separating target cells, characterized in that, The magnetic beads include: (a) Magnetic carrier; (b) Affinity ligands capable of specifically binding to target cells; and (c) A linker that connects the magnetic carrier to the affinity ligand; The linker arm contains a nucleotide sequence that can be specifically cleaved and recognized by enzymes; the nucleotide sequence contains at least one deoxyinosine (dI) base.

2. The reversible immunoaffinity magnetic beads according to claim 1, characterized in that, The nucleotide sequence contains 2-6 deoxyinosine (dI) bases, preferably 4.

3. The reversible immunoaffinity magnetic beads according to claim 1, characterized in that, The linker arm is an oligonucleotide with the sequence shown in SEQ ID NO: 1, or a variant thereof containing substitutions, deletions, or additions of one or more nucleotides, and the variant retains the function of being specifically recognized by enzyme cleavage.

4. The reversible immunoaffinity magnetic beads according to claim 1, characterized in that, The 3' end of the connecting arm forms an amide bond with the carboxyl group on the surface of the magnetic carrier through amino modification, and the 5' end of the connecting arm forms an amide bond with the amino group on the affinity ligand through carboxyl modification.

5. A kit for isolating target cells, characterized in that, The device comprises the reversible immunoaffinity magnetic beads of claim 1, and an enzyme capable of specifically cleaving the linker arm; preferably, the enzyme is endonuclease V (Endo V).

6. The reagent kit according to claim 5, characterized in that, The kit also includes a cell separation buffer with an osmotic pressure of 280-330 mOsm / kg and contains Mg. 2+ .

7. The reagent kit according to claim 6, characterized in that, The buffer solution comprises: 5-20 mM MEPES, 100-150 mM NaCl, 1-10 mM KCl, 1-10 mM glucose, 1-10 mM MgCl2, 0.1-1 mM reduced glutathione, pH 6-7.

8. A method for preparing the reversible immunoaffinity magnetic beads according to claim 1, characterized in that, Includes the following steps: (1) A connecting arm with a first reactive group at one end is provided, and a magnetic carrier is provided; (2) The first reactive group of the connecting arm is coupled to a magnetic carrier; (3) Activate the second reactive group on the other end of the connecting arm of the product obtained in step (2); and (4) The activated second reactive group is coupled with the affinity ligand to obtain the reversible immunoaffinity magnetic beads.

9. A method for in vitro isolation of target cells for non-therapeutic purposes, characterized in that, Includes the following steps: (a) A sample containing target cells is mixed with the reversible immunoaffinity magnetic beads of claim 1 or the magnetic beads in the kit of claim 2 and incubated to form a magnetic bead-cell complex. (b) Separating the magnetic bead-cell complex from other components in the sample using magnetic separation technology; (c) The magnetic bead-cell complex obtained in step (b) is subjected to an enzymatic cleavage reaction using an enzyme capable of cleaving the connecting arms, thereby dissociating the magnetic beads from the target cells; and (d) Collect the dissociated target cells.

10. The use of the reversible immunoaffinity magnetic beads of claim 1 or the kit of claim 5 in the preparation of reagents or kits for isolating target cells.