A tcr sequence targeting a krass g12d antigen and applications thereof

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a TCR sequence targeting KRAS G12D antigen and application thereof. The CDR3 region of a wild type TCR is rationally designed and optimized through a simulation docking technology, and an optimized TCR with significantly improved affinity is obtained. Experimental results show that the TCR-T cell (human peripheral blood T cell TCR Homo sapiens) can effectively kill solid tumor cells, inhibit tumor growth in vivo and in vitro, improve the T cell immunotherapy effect, and can be used for preparing a cell drug for solid tumors, and has the advantages of high safety, strong targeting, significant effect and the like. The application provides a new drug selection and treatment scheme for the treatment of solid tumors.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a TCR sequence targeting the KRAS G12D antigen and its application. Background Technology

[0002] Solid tumors are a major disease posing a serious threat to human health. Traditional treatments such as surgery, chemotherapy, and radiotherapy have limited efficacy, high recurrence rates, and significant side effects. Clinically, there is an urgent need for safe, efficient, and highly targeted novel treatment methods. The KRAS gene is one of the most frequently mutated oncogenes in tumors, with approximately 20% of human malignant tumors associated with this mutation. Nearly 50% of patients with colorectal cancer and 25% of patients with lung cancer have KRAS mutations, while nearly 90% of patients with pancreatic cancer have KRAS mutations. The most common mutation is KRAS G12D, accounting for about 40% of KRAS mutations. However, the protein at the KRAS gene site is small and has a smooth surface, lacking the "deep pocket" structure that traditional small molecule drugs can bind to. It was once considered by the pharmaceutical community to be an "untreatable" target, and currently, there are no drugs targeting the KRAS G12D mutation on the market. Therefore, there is a need to develop effective treatments targeting the KRAS G12D mutation.

[0003] Tumor immunotherapy is rapidly developing and has become the fourth major pillar of treatment after surgery, radiotherapy, and chemotherapy. T-cell receptor-engineered T-cell (TCR-T) therapy is one of the most effective methods of immunotherapy for solid tumors. In recent years, research on TCR-T for the treatment of various solid tumors has increased significantly. In August 2024, Afami-cel, a TCR-T therapy for synovial sarcoma developed by Adaptimmune Therapeutics, received fast-track approval from the U.S. Food and Drug Administration (FDA), making it the world's first approved TCR-T cell therapy. The T-cell receptor (TCR) is a heterodimeric protein located on the surface of T cells. It is the molecule that specifically recognizes antigens and mediates immune responses on the T-cell surface. Due to the complex V(D)J rearrangement mechanism during cell development, the TCR gene sequence is extremely diverse. Therefore, the TCR has very high diversity and is one of the most polymorphic regions in the human genome, determining how the human immune system adapts to environmental changes.

[0004] The TCR consists of two polypeptide chains (α / β or γ / δ), with 95% of T cells expressing αβTCR. The mature TCR heavy chain gene is composed of four gene segments: a variable region (V), a polymorphic region (D), a linker region (J), and a constant region (C) (VDJC). The TCR light chain lacks the D region (VJC). Both the TCR heavy and light chains have three complementarity-determining regions (CDRs): CDR1, CDR2, and CDR3, which play a major role in antigen recognition. CDR3 is the TCR region that directly contacts the antigen. CDR3 is encoded by a portion of V, all of D and J, and the linker region between VD and DJ; therefore, CDR3 exhibits the highest degree of variability. Due to the inherent diversity of the V (65-100 types), D (2 types), and J (13 types) gene segments, and the frequent random insertion or deletion of non-template nucleotides in the linker regions of VD and DJ during rearrangement, the diversity of the CDR3 region is further increased, theoretically reaching 2 × 10-1. 19 αβ TCRs. The CDR3 region largely determines the diversity of TCRs.

[0005] The interaction between the TCR and the appropriate antigen peptide-MHC (pMHC) complex is a crucial component of an effective antitumor immune response. The binding between the TCR and MHC, or the TCR-T's ability to specifically recognize target antigens, is typically characterized by TCR affinity, which plays a central role in TCR sensitivity and specificity. T cells engineered with high-affinity TCRs exhibit better efficacy than those engineered with low-affinity TCRs. High-affinity TCRs do not require the presence of a CD8 co-receptor to facilitate antigen recognition, can detect low levels of antigens, and promote tumor regression. For example, the use of the DMF5 TCR, which has a higher affinity than the DMF4 TCR, in the MART-1 specific T cell receptor (TCR) clone resulted in better response rates in transduced T cells observed in experiments. This suggests that high-affinity TCRs capable of recognizing low-expressed pMHC on the surface of tumor cells are a better option for most clinical trials. However, since the affinity of native TCR sequences for antigens is likely low, once the TCR sequence is determined, optimization of the wild-type TCR sequence is necessary to improve TCR expression and affinity. Summary of the Invention

[0006] This invention provides an optimized high-affinity TCR targeting KRAS G12D and highly active TCR-T cells (human peripheral blood T cells TCR Homo sapiens) prepared therefrom, as well as their application in tumor treatment, providing a new treatment option for the treatment of KRAS G12D mutant solid tumors.

[0007] To overcome the shortcomings of the prior art, this invention provides a TCR sequence targeting the KRAS G12D antigen and its application.

[0008] This invention is achieved through the following technical solution: In a first aspect, the present invention provides a TCR sequence targeting the KRAS G12D antigen, wherein the TCR sequence targeting the KRAS G12D antigen includes the α chain (TRA chain) sequence shown in SEQ ID NO:1 and the β chain (TRB chain) sequence shown in SEQ ID NO:2; the TRA chain includes a constant region as shown in SEQ ID NO:3 and a variable region linker region as shown in SEQ ID NO:4, and the TRB chain includes a constant region as shown in SEQ ID NO:5 and a variable region linker region as shown in SEQ ID NO:6; the variable region linker region of the TRA chain includes CDR3 as shown in SEQ ID NO:7, and the variable region linker region of the TRB chain includes CDR3 as shown in SEQ ID NO:8.

[0009] Furthermore, the variable region connection region of the TRA chain includes CDR1 as shown in SEQ ID NO: 9 and CDR2 as shown in SEQ ID NO: 10, and the variable region connection region of the TRB chain includes CDR1 as shown in SEQ ID NO: 11 and CDR2 as shown in SEQ ID NO: 12.

[0010] Furthermore, the CDR3 amino acid sequence of the TRA chain is shown in SEQ ID NO.13; the CDR3 amino acid sequence of the TRB chain is shown in SEQ ID NO.14.

[0011] In a second aspect, the present invention provides TCR sequence-associated biomaterials targeting the KRAS G12D antigen, wherein the biomaterials are any of the following: (1) Nucleic acid molecules encoding TCR; (2) An expression cassette containing the nucleic acid molecule described in (1); (3) A recombinant vector containing the nucleic acid molecule described in (1), or a recombinant vector containing the expression cassette described in (2); Thirdly, the present invention provides recombinant cells containing a TCR sequence targeting the KRAS G12D antigen or biological material related to a TCR sequence targeting the KRAS G12D antigen.

[0012] Furthermore, the recombinant cells included human peripheral blood T cells (TCR Homo sapiens), deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: C2026127 and deposit date of June 25, 2026.

[0013] Fourthly, the present invention provides a pharmaceutical composition comprising one or more of TCRs, biological materials, or recombinant cells.

[0014] Fifthly, the present invention provides the use of recombinant cells in any of the following: (1) Use in the preparation of drugs for the prevention or treatment of tumors; (2) Application in the preparation of drugs for the prevention or treatment of diseases related to KRAS G12D mutation.

[0015] In a sixth aspect, the present invention provides an MHC tetramer for screening TCR sequences targeting KRAS G12D antigen. The MHC tetramer is a complex composed of four pMHC monomer molecules and a fluorescent dye. It is based on streptavidin with a signal label, crosslinking four identical MHC monomer molecules to form an MHC tetramer.

[0016] Furthermore, the pMHC monomer molecule is a single antigen peptide-MHC molecule complex, and the antigen peptide is a Kras-G12D mutant peptide with the amino acid sequence shown in SEQ ID NO: 14.

[0017] Compared with the prior art, the advantages of the present invention are as follows: (1) This invention optimizes wild-type TCRs to improve affinity, which is a significant advantage over natural TCRs. Compared to existing technologies, naturally occurring TCRs typically have low affinity for antigen peptides (micromolar level), which limits the efficacy of TCR-T therapy. This invention predicts and obtains a more stable TCR CDR3 region sequence targeting the KRAS G12D mutant peptide using computer simulation docking technology. This means that: 1) the TCR structure is more stable, has better binding affinity to pMHC, and has stronger tumor cell recognition ability, enabling it to recognize low-density antigen peptide-MHC complexes on the surface of tumor cells; 2) human peripheral blood T cell TCR Homo sapiens prepared with the optimized TCR have better therapeutic effects. When encountering cells containing the KRAS G12D mutant, these human peripheral blood T cell TCR Homo sapiens can be more effectively activated, producing a stronger killing effect.

[0018] (2) This invention provides specific evidence for the application of anti-KRAS G12D mutant tumors. This invention clarifies the application of human peripheral blood T cell TCR Homo sapiens in killing malignant tumors carrying KRAS G12D mutations. TCR-T therapy belongs to cell therapy and has the characteristics of live cell drugs, which can expand in vivo and form immune memory. This invention provides optimized antigen-specific TCR-T, which can specifically target and kill KRAS G12D mutant tumor cells, providing a treatment option for refractory solid tumors such as pancreatic cancer that is different from small molecule drugs, does not produce drug resistance, and has the potential for durable remission.

[0019] (3) The human peripheral blood T cells TCR Homo sapiens described in this invention are human autologous T cells, prepared by transduction of the TCR gene mediated by a lentiviral vector. During the preparation process, serum-free culture medium is used for amplification to reduce the risk of immune rejection. Attached Figure Description

[0020] The invention will now be further described with reference to the accompanying drawings.

[0021] Figure 1 This is a schematic diagram of the T cell receptor (TCR) structure, showing the spatial configuration of the TCR α chain and β chain, as well as the positions of the three complementarity-determining regions CDR1, CDR2, and CDR3, of which the CDR3 region is the key region for optimization and modification in this invention. Figure 2 This is a diagram illustrating the construction of the pMHC tetramer of this invention; Figure 3 Image of specific CTL cells using MHC tetramer detection technology; among which, Figure 3 In the middle A, there is a T cell gating scatter plot. All T lymphocytes were screened by morphological forward scattering (FSC) / side scattering (SSC). Figure 3 Image B shows the tetramer staining clusters of CD8+ antigen-specific T cells. Flow cytometry was used to sort the cells and obtain specific CTL cells. Figure 4 This is a TCR sequencing map, used for analyzing major TCR clones; Figure 5 For the binding analysis of the TCR-pMHC complex based on molecular docking simulation, a comparison diagram of the root mean square deviation (RMSD) of the wild-type and mutant TCRα structures is presented. Figure 6 A comparison diagram of the root mean square fluctuation (RMSF) of the wild-type and mutant TCRα structures; Figure 7 A comparison diagram of the root mean square deviation (RMSD) of the structure of wild-type and mutant TCRβ; Figure 8A comparison diagram of the root mean square fluctuation (RMSF) of wild-type and mutant TCRβ structures; Figure 9 This is the structure of a wild-type TCR, where red bands represent TCRα; yellow bands represent TCRβ; sky-blue bands represent KRASG12D peptide; orange bands represent human leukocyte antigen (HLA) protein; and magenta bands represent β2-microglobulin (B2M). Figure 10 The structure represents a mutant TCR; among them, red band: TCRα; orange-red band: TCRβ; yellow band: KRASG12D peptide; orange band: HLA protein; and magenta band: B2M protein. Figure 11 Based on the simulated docking results, wild-type TCR and optimized TCR complex tetramers were synthesized. The binding concentration with KRAS G12D-HLA-A*11:01 was analyzed by ELISA. Compared with the wild-type TCR (wTCR), the optimized TCR showed a closer affinity to the positive control group with KRAS G12D HLA-A*11:01. The amino acid sequence of TRA-1 was AAVNPPDTGFQKL, and the amino acid sequence of TRB-4 was CASALSFRQGLRE. Figure 12 To synthesize wild-type TCR and optimized TCR complex tetramer based on the simulated docking results, the statistical analysis of the binding concentration of KRAS G12D-HLA-A*11:01 was detected by ELISA. Figure 13 For flow cytometry analysis, lentivirus transfected T cells were used, tetramer staining was employed, and transfection efficiency was determined by flow cytometry. An analysis of the empty vector control was also included. Figure 13 In the middle, A is a scatter plot of the total number of cells from FSC to SSC. Figure 13 The scatter plot of CD3-positive T cell populations is shown in section B. Figure 13 The middle C represents a scatter plot of PE-antigen tetramer-positive specific T cells; Figure 14 For flow cytometry analysis, lentivirus transfected T cells were used, tetramer staining was employed, and transfection efficiency was determined by flow cytometry. A TCR-wildtype analysis graph was also presented. Figure 14 In the middle, A is a scatter plot of the total number of cells from FSC to SSC. Figure 14 The scatter plot of CD3-positive T cell populations is shown in section B. Figure 14 The middle C represents a scatter plot of PE-antigen tetramer-positive specific T cells; Figure 15 For flow cytometry analysis, lentivirus transfected T cells were used, tetramer staining was employed, and transfection efficiency was determined by flow cytometry. A TCR-optimized analysis graph was also generated. Figure 15 In the middle, A is a scatter plot of the total number of cells from FSC to SSC. Figure 15The scatter plot of CD3-positive T cell populations is shown in section B. Figure 15 The middle C represents a scatter plot of PE-antigen tetramer-positive specific T cells; Figure 16 To optimize the co-culture of TCR-T cells with tumor cells for CCK8 detection, proliferation efficacy was assessed at effector-to-target ratios of 0.5:1 and 1:1. Figure 16 In the A group, the effector-to-target ratio was 0.5:1 (T cells: pancreatic cancer cells = 0.5:1). Figure 16 In the B group, the effector-to-target ratio was 1:1 (T cells: pancreatic cancer cells = 1:1); the aim was to construct the inhibitory effect of TCR-T cells on target cells. Figure 17 To optimize the co-culture of TCR-T cells with tumor cells for CCK8 assay, proliferation efficacy was assessed at effector-to-target ratios of 5:1 and 10:1. Figure 17 In the A group, the effector-to-target ratio was 5:1 (T cells: pancreatic cancer cells = 5:1). Figure 17 In the B group, the effector-to-target ratio was 10:1 (T cells: pancreatic cancer cells = 10:1). Figure 18 To optimize the co-culture of TCR-T cells with tumor cells for CCK8 detection, a proliferation efficacy map was obtained using an effector-to-target ratio of 20:1. Figure 19 To generate an LDH detection and analysis graph, we constructed the killing effect of TCR-T cells on target cells, optimized the co-culture of TCR-T cells with tumor cells, and detected the killing and lysis efficiency. Figure 20 Bar charts showing ELISA detection of Panc-1 tumor cells and granzyme B detection in co-cultured T cells and Panc-1 tumor cells; among which, Figure 20 A represents Panc-1 tumor cells. Figure 20 In Figure B, T cells were co-cultured with Panc-1 tumor cells to isomorphically construct TCR-T cells that inhibited the secretion of cytokines from target cells. Figure 21 Bar charts showing ELISA detection of Panc-1 tumor cells, T cells co-cultured with Panc-1 tumor cells, and interleukin-2 (IL-2) levels; among which, Figure 21 A represents Panc-1 tumor cells. Figure 21 In section B, T cells were co-cultured with Panc-1 tumor cells. Figure 22 For ELISA testing, bar chart of perforin detection for T cells co-cultured with Panc-1 tumor cells; Figure 23 To optimize the tumor-suppressing effect of TCR-T cells in an NCG animal model for in vivo experiments, the aim is to construct the tumor-suppressing effect of TCR-T cells in an NCG animal model. Detailed Implementation

[0022] The invention will now be further described with reference to the accompanying drawings.

[0023] Example 1

[0024] (1) In this embodiment, an in vitro antigen presentation method is used. In the culture system, an artificially synthesized antigen presentation vector loaded with the KRAS G12D mutant polypeptide: VVVGADGVGK (the amino acid sequence is designed according to the specific HLA (HLA-A*101) restriction element) is added. At the same time, a suitable combination of cytokines is added to the culture system to promote the activation, proliferation and differentiation of T cells, thereby inducing the generation of effector T cells that can specifically recognize the KRAS G12D mutation in vitro.

[0025] (2) Enrichment and sorting of antigen-specific T cells: To obtain high-purity antigen-specific T cells, this invention uses pMHC tetramer technology to sort specific T cells (see...). Figure 2 pMHC (antigen peptide-MHC molecule complex) is a complex structure formed by the binding of major histocompatibility complex (MHC) molecules to antigen peptides, playing a crucial role in the immune response. It is present on the surface of antigen-presenting cells or target cells, ensuring the immune system can accurately recognize and respond to foreign substances. pMHC formation depends on the specific binding of antigen peptides to MHC molecules. pMHC tetramer sorting techniques, such as... Figure 2 As shown: a complex composed of four pMHC monomer molecules (i.e., a single antigen peptide-MHC molecule complex) and a fluorescent dye (such as PE dye). Based on streptavidin with a signal label, it crosslinks four identical MHC monomer molecules to form an MHC tetramer. (The antigen peptide is designed according to the target antigen: in this experiment, the antigen peptide is the Kras-G12D mutant peptide SEQ ID NO.15: VVVGADGVGK). It can bind to multiple TCRs on the surface of T cells, thereby greatly improving the affinity and stability of the MHC-peptide complex with TCRs. After the MHC-peptide tetramer binds to the TCRs of specific T cells, it can be detected by flow cytometry (FACS). The advantages of this tetramer technology are its speed, directness, sensitivity, and high specificity. The tetramer used in this invention is the KRAS G12D antigen peptide presented by a specific subtype of human MHC (HLA-A*101). The resulting pMHC can rapidly recognize antigen-specific cytotoxic T cells.

[0026] like Figure 3-4The diagram shows the use of tetramer technology, with flow cytometry for detection and sorting. Flow cytometry was used to delineate a cell population that was CD8 positive and tetramer double positive; this cell population represents antigen-specific cytotoxic T cells capable of specifically recognizing the KRAS G12D mutation. The sorted T cells were of high purity and good viability, and were used for subsequent in vitro expansion and functional validation.

[0027] Cell amplification and detection after sorting: TCR sequencing was performed on the sorted T cells, and the number of clones for each TCR VDJ combination and CDR3 region sequence was compared to obtain the dominant TCR clone of KRAS G12D (see...). Figure 3-4 The following sequences constitute the major TCR clone (wild type) of KRAS G12D.

[0028] Figure 4 The results are as follows: TCR sequencing was performed to analyze dominant TCR clones. Below is the KRAS G12D-HLA-A*1101 antigen-specific, wild-type TCR dominant clone DNA sequence (the yellow highlighted part is the CDR3 sequence): KRAS G12D-HLA-A*1101 antigen-specific TCR DNA sequence: TRAC (Constant Region) (SEQ ID NO: 3) ATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGC ATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGAAAGTTCCTGTGATGTCAAGCTGGTCGAGAAAAGCTTTGAAACAGATACGAACCTAAACTTTCAAAACCTGTCAGTGATTGGGTTCCGAATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGCTAG.

[0029] > TRA(vj) (Variable Connectivity Region) SEQ ID NO: 18: ATGGGCCGTAAAGAAGTGGAACAGGACCCAGGCCCTTTTAACGTACCGGAAGGCGCTACCGTTGCTTTCAACTGCACCTATTCCAACAGCGCATCCCAGTCTTTCTTCTGGTATCGTCAGGACTGCCGCAAAGAACCGAAACTGCTGATGAGCGTCTATAGCTCCGGTAACGAAGATGGTCGCTTCACCGCCCAGCTGAACCGTGCGTCTCAGTACATCTCTCTGCTGATTCGTGATAGCAAGCTGAGCGATTCCGCGACTTACCTGTGCTGTGCTGTTAACCCACCGGACACCGGCTTTCAAAAACTGGTATTCCGTAACAACGACATGCGCTTTGGTGCAGGTACGCGTCTGACTGTTAAACCGAACATCCAGAACCCGGATCCAGCGGTATATCAGCTGCGTGATAGCAAAAGCAGCGACAAATCCGTTTGCCTGTTCACCGACTTCGACTCCCAAACCAATGTTAGCCAGTCCAAAGACTCCGACGTTTACATTACCGACAAGTGTGTCCTGGATATGCGTTCTATGGACTTCAAATCCAATTCCGCTGTTGCGTGGTCCAACAAATCCGACTTCGCATGCGCTAACGCGTTCAACAACTCCATCATCCCGGAAGATACCTTCTTCCCATCCCCGGAATCTTCTGGCTCT。

[0030] CDR1: (SEQ ID NO: 9) ACCTATTCCAACAGCGCATCCCAGTCTTTCTTC。

[0031] CDR2: (SEQ ID NO: 10) ATGAGCGTCTATAGCTCCGGTAACGAAGAT。

[0032] CDR3 (SEQ ID NO: 19) TGTGCTGTTAACCCACCGGACACCGGCTTTCAAAAACTG。

[0033] >TRBC (constant region) (SEQ ID NO: 5) GAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCCATCAGAAGCAGAGATCTCCCACACCCAAAAGGCCACACTGGTATGCCTGGCCACAGGCTTCTACCCCGACCACGTGGAGCTGAGCTGGTGGGTGAATGGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCCGCAGCCCCTCAAGGAGCAGCCCGCCCTCAATGACTCCAGATACTGCCTGAGCAGCCGCCTGAGGGTCTCGGCCACCTTCTGGCAGAACCCCCGCAACCACTTCCGCTGTCAAGTCCAGTTCTACGGGCTCTCGGAGAATGACGAGTGGACCCAGGATAGGGCCAAACCCGTCACCCAGATCGTCAGCGCCGAGGCCTGGGGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCAGCAAGGGGTCCTGTCTGCCACCATCCTCTATGAGATCTTGCTAGGGAAGGCCACCTTGTATGCCGTGCTGGTCAGTGCCCTCGTGCTGATGGCCATGGTCAAGAGAAAGGATTCCAGAGGCTAG.

[0034] > TRB(v-j) (variable region joining region) (SEQ ID NO: 20) ATGGACGTTAAAGTAACTCAATCCAGCCGCTACCTGGTCAAACGCACGGGCGAGAAGGTGTTCCTGGAATGCGTTCAGGACATGGACCACGAAAACATGTTCTGGTACCGCCAGGACCCTGGTCTGGGTCTGCGCCTGATTTATTTCAGCTACGACGTTAAAATGAAAGAAAAGGGCGATATTCCGGAAGGTTACTCCGTCAGCCGTGAAAAAAAAGAACGCTTCAGCCTGATCCTGGAGAGCGCGTCTACCAACCAGACTTCCATGTATCTGTGCTGCGCATCTTCTCTGTCTTTTCGTCAGGGTCTGCGTGAACAGTACTTCCAACGTCAGGAAGGTGATACTCAGTACTTCGGTCCTGGTACCCGTCTGACTGTGCTGGAGGACCTGAAAAACGTTTTCCCGCCGGAAGTTGCCGTGTTTGAACCGTCCGAAGCGGAAATCAGCCACACCCAGAAAGCTACTCTGGTCTGCCTGGCCACCGGTTTCTATCCTGATCACGTTGAACTGAGCTGGTGGGTGAACGGCAAAGAAGTTCACAGCGGTGTTTGTACGGATCCGCAGCCACTGAAAGAACAGCCAGCACTGAACGACTCCCGTTACGCGCTGTCCTCCCGTCTGCGCGTTTCTGCTACTTTTTGGCAGAATCCGCGTAACCACTTCCGTTGTCAGGTCCAGTTTTACGGCCTGAGCGAGAATGACGAATGGACTCAGGACCGTGCGAAACCGGTAACTCAGATTGTTAGCGCTGAAGCCTGGGGTCGTGCCGAT。

[0035] CDR1:(SEQ ID NO: 11) GTTCAGGACATGGACCACGAAAACATG。

[0036] CDR2:(SEQ ID NO: 12): TTCAGCTACGACGTTAAAATGAAA。

[0037] CDR3 (SEQ ID NO: 21): TGCGCATCTTCTCTGTCTTTTCGTCAGGGTCTGCGTGAA.

[0038] The protein sequence corresponding to the CDR3 sequence mentioned above: TRA CDR3 (SEQ ID NO. 16): CAVNPPDTGFQKL.

[0039] TRB CDR3 (SEQ ID NO. 17): CASSLSFRQGLRE.

[0040] (4) Rational design and screening of high-affinity TCRs. To improve the affinity of natural TCRs, this invention uses computer simulation docking technology to perform structural modeling and interaction analysis on the TCR-KRAS G12D-HLA complex.

[0041] First, based on the TCR structure diagram ( Figure 1 Based on the CDR3 region sequence of the natural TCR, the spatial positions of the α chain, β chain, and CDR3 region shown in the diagram were used to construct a three-dimensional structural model of TCR-pMHC. Virtual mutations were performed on the amino acid residues in the CDR3 region of the TCR α and β chains, and the changes in the stability of the complex after mutation were evaluated through molecular dynamics simulations.

[0042] Because the TCR-pMHC binding interface is extremely flexible, the CDR1 / CDR2 / CDR3 loop regions exhibit large swing amplitudes; existing scoring models have biases in calculating hydrogen bonds, hydrophobic interactions, salt bridges, and van der Waals forces, making it difficult to accurately quantify the subtle changes in affinity caused by single-point mutations in the CDR region; conventional static docking does not consider water molecules, ions, and the cell membrane microenvironment; while TCR-pMHC interactions are highly dependent on the hydrogen bond network mediated by interface-bound water, static models will miss key interactions; modifying CDR region amino acids solely to improve affinity can easily disrupt the Cα / Cβ constant region pairing interface, exacerbating exogenous-endogenous TCR mismatch; simulations only assess binding free energy and cannot predict changes in the immunogenicity of the TCR sequence after mutation; modified TCR amino acid mutation sites may form new T cell epitopes, which may be cleared by the patient's immune system after reinfusion, and simulation methods cannot predict this in advance; docking only simulates the extracellular TCR-pMHC ternary complex, ignoring the effects of hydrophobic mutations in the α chain transmembrane region and intracellular signaling domains on TCR membrane expression and conformational folding; KRAS The G12D mutant peptide is short and has a weak binding affinity to the HLA binding pocket. The peptide exhibits multiple swing conformations within the HLA groove. The simulation simulates the binding between free protein molecules. Under physiological conditions, both TCR and HLA are anchored to the cell membrane, resulting in membrane steric hindrance and receptor aggregation effects. Simulating high-affinity sequences may not necessarily lead to a synchronous increase in TCR-T cytotoxic activity at the cellular level. Higher affinity is not always better: ultra-high affinity TCRs can easily induce persistent T cell exhaustion. The simulation only calculates binding energy and cannot predict downstream biological phenotypes such as T cell proliferation, exhaustion, and cytotoxic function.

[0043] In this embodiment, the KRAS G12D-pMHC complex was simulated using molecular dynamics (MD) beforehand. Multiple mainstream dynamic conformations were extracted as multi-template docking initiation structures to avoid bias from a single static conformation. After docking, the MD simulation was extended, and all-atom molecular dynamics simulations were performed at the hundreds of ns–μs level. Explicit water molecule models (such as TIP3P) and physiological ion concentrations were used to retain key bound water at the interface and analyze the water-mediated hydrogen bond network to avoid design bias caused by neglecting water bridge interactions. When necessary, a phospholipid bilayer membrane model was added to simulate the effects of steric hindrance and microenvironment on the cell membrane, more closely resembling the TCR recognition state on the in vivo membrane surface. The molecular dynamics simulation conditions were optimized to closely approximate the actual physiological state of the cell. Based on the simulation prediction results, an in vitro experimental system was further constructed, and the simulation analysis results were further confirmed through wet experiments.

[0044] Simulated docking results show that replacing the first amino acid (cysteine, Cys) in the CDR3 region of the TCR α chain with alanine (Ala) and the fourth amino acid (serine, Serine) in the CDR3 region of the TCR β chain with alanine (Ala) significantly improves structural stability. Figure 4As shown, 1) Structural stability comparison: The overall structural stability of the mutant-optimized protein is significantly better than that of the wild type. The average RMSD of the mutant over the entire lifecycle is 6.979 Å, which is 1.605 Å lower than that of the wild type (8.584 Å). The standard deviation and coefficient of variation of the mutant RMSD are much lower than those of the wild type, indicating more stable conformational fluctuations and better structural consistency. 2) Convergence judgment: The convergence of the mutant protein is excellent. The absolute difference in the mean RMSD between the first and last 250 ns of the simulation is only 0.263 Å, and sufficient structural equilibrium is reached after 100 ns. The convergence of the wild type protein is poor, with a mean difference of 1.531 Å between the first and last half. 3) Difference in structural flexibility: The structural flexibility of the wild type protein is significantly greater, with a total RMSD fluctuation range of 12.765 Å and a coefficient of variation of 0.180. The structural rigidity of the mutant protein is stronger, with a RMSD fluctuation range of only 8.786 Å and a coefficient of variation of 0.090, which is only half that of the wild type, showing that the TCR structure after mutation optimization has a significant advantage in structural stability.

[0045] Based on the simulated docking results, the following optimized combination was determined in this invention: the TRA chain CDR3 region uses the TRA-1 sequence (amino acid sequence AAVNPPDTGFQKL), and the TRB chain CDR3 region uses the TRB-4 sequence (amino acid sequence CASALSFRQGLRE). Compared to the wild-type TCR (wTCR), this optimized TCR exhibits higher binding stability in simulated docking (see...). Figure 4-12 ).

[0046] Optimized CDR3 region protein sequence: TRA-1 CDR3 (SEQ ID NO. 13): AAVNPPDTGFQKL.

[0047] TRB-4 CDR3 (SEQ ID NO. 14): CASALSFRQGLRE.

[0048] SEQ ID NO.1:

[0049] SEQ ID NO.2

[0050] Variable region joining region of TRA chain as set forth in SEQ ID NO: 4 TRA(v-j) (variable region joining region) ATGGGCCGTAAAGAAGTGGAACAGGACCCAGGCCCTTTTAACGTACCGGAAGGCGCTACCGTTGCTTTCAACTGCACCTATTCCAACAGCGCATCCCAGTCTTTCTTCTGGTATCGTCAGGACTGCCGCAAAGAACCGAAACTGCTGATGAGCGTCTATAGCTCCGGTAACGAAGATGGTCGCTTCACCGCCCAGCTGAACCGTGCGTCTCAGTACATCTCTCTGCTGATTCGTGATAGCAAGCTGAGCGATTCCGCGACTTACCTGTGCGCCGCTGTTAACCCACCGGACACCGGCTTTCAAAAACTGGTATTCCGTAACAACGACATGCGCTTTGGTGCAGGTACGCGTCTGACTGTTAAACCGAACATCCAGAACCCGGATCCAGCGGTATATCAGCTGCGTGATAGCAAAAGCAGCGACAAATCCGTTTGCCTGTTCACCGACTTCGACTCCCAAACCAATGTTAGCCAGTCCAAAGACTCCGACGTTTACATTACCGACAAGTGTGTCCTGGATATGCGTTCTATGGACTTCAAATCCAATTCCGCTGTTGCGTGGTCCAACAAATCCGACTTCGCATGCGCTAACGCGTTCAACAACTCCATCATCCCGGAAGATACCTTCTTCCCATCCCCGGAATCTTCTGGCTCT。

[0051] CDR3 of TRA chain as set forth in SEQ ID NO: 7 GCCGCTGTTAACCCACCGGACACCGGCTTTCAAAAACTG。

[0052] Variable region joining region of TRB chain as set forth in SEQ ID NO: 6 ATGGACGTTAAAGTAACTCAATCCAGCCGCTACCTGGTCAAACGCACGGGCGAGAAGGTGTTCCTGGAATGCGTTCAGGACATGGACCACGAAAACATGTTCTGGTACCGCCAGGACCCTGGTCTGGGTCTGCGCCTGATTTATTTCAGCTACGACGTTAAAATGAAAGAAAAGGGCGATATTCCGGAAGGTTACTCCGTCAGCCGTGAAAAAAAAGAACGCTTCAGCCTGATCCTGGAGAGCGCGTCTACCAACCAGACTTCCATGTATCTGTGCTGCGCATCTGCCCTGTCTTTTCGTCAGGGTCTGCGTGAACAGTACTTCCAACGTCAGGAAGGTGATACTCAGTACTTCGGTCCTGGTACCCGTCTGACTGTGCTGGAGGACCTGAAAAACGTTTTCCCGCCGGAAGTTGCCGTGTTTGAACCGTCCGAAGCGGAAATCAGCCACACCCAGAAAGCTACTCTGGTCTGCCTGGCCACCGGTTTCTATCCTGATCACGTTGAACTGAGCTGGTGGGTGAACGGCAAAGAAGTTCACAGCGGTGTTTGTACGGATCCGCAGCCACTGAAAGAACAGCCAGCACTGAACGACTCCCGTTACGCGCTGTCCTCCCGTCTGCGCGTTTCTGCTACTTTTTGGCAGAATCCGCGTAACCACTTCCGTTGTCAGGTCCAGTTTTACGGCCTGAGCGAGAATGACGAATGGACTCAGGACCGTGCGAAACCGGTAACTCAGATTGTTAGCGCTGAAGCCTGGGGTCGTGCCGAT。

[0053] The CDR3 of the TRB chain as shown in SEQ ID NO: 8 TGCGCATCTGCCCTGTCTTTTCGTCAGGGTCTGCGTGAA。

[0054] Example 2

[0055] In this embodiment, T cells were transfected using the TCR containing the optimized CDR3 region prepared in Example 1: (1) Construction of the TCR lentiviral vector. Based on the obtained TRA and TRB sequences, the complete TCR α and β chain coding sequences were amplified and constructed into the lentiviral transfection plasmid. (2) Lentiviral packaging and concentration. The constructed TCR lentiviral plasmid and helper plasmid were introduced into packaging cells (293T cells) to produce infectious viral particles: One day before transfection, 293T cells in logarithmic growth phase and in good condition were seeded in 10cm culture dishes, so that their confluence reached 70%-90% on the day of transfection. Using PEI transfection reagent, the TCR lentiviral plasmid and packaging plasmids psPAX2 and pMD2.G were co-transfected into 293T cells at an optimized ratio (4:3:1). 6-8 hours after transfection, the medium was replaced with DMEM medium containing high concentration of serum (e.g., 30% FBS). 48 and 72 hours after transfection, cell culture supernatant rich in lentiviral particles was collected. To improve viral titer and infection efficiency, the supernatant was concentrated using PEG precipitation. The concentrated viral solution was used to infect 293T cells, and the viral titer (TU / mL) was calculated by fluorescence counting. Determining the viral titer is a prerequisite for accurate transfection (determining MOI). (3) Lentiviral transduction of T cells and flow cytometry: Primary T cells were isolated from peripheral blood and activated by anti-CD3 / CD28 antibody-conjugated magnetic beads for 48 hours to bring them into an activated state suitable for lentiviral infection. Activated T cells were collected and the density was adjusted to 0.5-1×10⁻⁶. 6 Add cells / mL and an appropriate amount of lentivirus to a culture plate, and incubate the plate overnight at 37°C in a 5% CO2 incubator. Approximately 24 hours after infection, carefully aspirate the virus-containing culture medium and replace it with fresh T cell culture medium (containing IL-2) for continued culture and amplification.

[0056] PE-tetramer flow cytometry staining (to confirm TCR expression): T cells (approximately 1×10⁻⁶ cells) were collected 3-5 days after transfection. 6 Cells were washed with staining buffer (PBS containing BSA). PE-labeled antigen peptide-MHC tetramer was added and incubated at 4°C in the dark for 30 minutes. Subsequently, surface marker co-staining was performed with fluorescent antibodies against human CD3 and CD8, and incubated at 4°C in the dark for 20-30 minutes. Cells were washed 2-3 times, and the proportion of PE-positive cells was detected by flow cytometry; these were considered T cells successfully expressing the specific TCR. We used tetramer technology for flow cytometry staining analysis (PE fluorescence). Simultaneously, this invention compared wild-type and optimized TCRs. Figures 13-15Compared to the control group, both wild-type and optimized TCRs were expressed in T cells, but the optimized TCR showed significantly improved expression efficiency (flow cytometry positivity rate increased from 46.91% to 71.29%), demonstrating better stability and expression of the TCR sequence. This embodiment successfully constructed optimized TCR-T cells. Figure 15 The cells enclosed in the R3 phylum are the antigen-specific optimized TCR-T cells required by this invention.

[0057] This embodiment optimizes the co-culture of TCR-T cells with target cells (Panc-1, human pancreatic cancer cells) to detect the inhibitory effect of the constructed TCR-T cells on tumor cell proliferation (results are shown in 16-18). Compared with the untreated group and the control group, the tumor cell proliferation rate in the experimental group was significantly inhibited and showed a negative growth trend, indicating that the constructed TCR-T cells have a significant inhibitory effect on tumor cell growth. Panc-1 naturally expresses HLA-A*11:01 and KRAS G12D mutations, and the Panc-1 cells used in this experiment have been validated (through authoritative HLA typing identification by the TRON cell line portal and the Hildebrand laboratory at the University of Oklahoma Health Sciences Center. This provides the most authoritative evidence that PANC-1 simultaneously expresses HLA-A*11:01 and KRAS G12D). (1) Robert B, Kargbo, Unveiling New KRAS(G12D) Inhibitors: A PromisingApproach for Pancreatic Cancer Therapy.[J] .ACS Med Chem Lett, 2023, 14: 889-890. (2)Dan, Lu, Yuan, Chen,Min, Jiang et al. KRAS G12V neoantigen specific Tcell receptor for adoptive T cell therapy against tumors.[J].Nat Commun,2023, 14: 6389. and other documents can be verified).

[0058] In this embodiment, TCR-T cells were co-cultured with target cells Panc-1 (human pancreatic cancer cells) to detect the killing effect of the constructed TCR-T cells on tumor cells (results are shown in...). Figure 19 Compared with the control group, the experimental group showed a significant killing effect even under low target-to-effect conditions.

[0059] In this embodiment, TCR-T cells were co-cultured with target cells Panc-1 (human pancreatic cancer cells), and the secretion of cytotoxic factors was detected (see results). Figures 20-22Compared with the control group, the expression of granzyme B (Gra B), perforin, interleukin-2 (IL-2), interferon-γ (IFN-γ), and tumor necrosis factor-α (TNF-α) in the experimental group was significantly upregulated, indicating that the killing ability of TCR-T cells was significantly enhanced.

[0060] In this embodiment, TCR-T cells were administered to NCG mice modeled using Panc-1 (human pancreatic cancer cells) cells (administered via intravenous infusion at a dose of 2 × 10⁻⁶ cells). 8 ~5×10 8 The tumor was administered at a rate of 1 cell / kg mouse body weight, with a single infusion as the administration frequency, and continuous monitoring of tumor growth was performed (results are shown in...). Figure 23 Compared with the control group, the TCR-T cells showed a significant tumor growth suppression ability.

Claims

1. A TCR sequence targeting the KRAS G12D antigen, characterized in that, The TCR sequence targeting the KRAS G12D antigen includes the α chain (TRA chain) sequence shown in SEQ ID NO:1 and the β chain (TRB chain) sequence shown in SEQ ID NO:2; the TRA chain includes a constant region as shown in SEQ ID NO:3 and a variable region linking region as shown in SEQ ID NO:4, and the TRB chain includes a constant region as shown in SEQ ID NO:5 and a variable region linking region as shown in SEQ ID NO:6; The variable region linker of the TRA chain includes CDR3 as shown in SEQ ID NO: 7, and the variable region linker of the TRB chain includes CDR3 as shown in SEQ ID NO:

6.

2. The TCR sequence targeting KRAS G12D antigen according to claim 1, characterized in that, The variable region linker of the TRA chain includes CDR1 as shown in SEQ ID NO: 9 and CDR2 as shown in SEQ ID NO:

10. The variable region linker of the TRB chain includes CDR1 as shown in SEQ ID NO: 11 and CDR2 as shown in SEQ ID NO:

12.

3. The TCR sequence targeting KRAS G12D antigen according to claim 1, characterized in that, The CDR3 amino acid sequence of the TRA chain is shown in SEQ ID NO.13; the CDR3 amino acid sequence of the TRB chain is shown in SEQ ID NO.

14.

4. A biomaterial associated with the TCR sequence targeting the KRAS G12D antigen as described in any one of claims 1-3, characterized in that, The biomaterial is any one of the following: (1) A nucleic acid molecule encoding the TCR of any one of claims 1-3; (2) An expression cassette containing the nucleic acid molecule described in (1); (3) A recombinant vector containing the nucleic acid molecule described in (1) or a recombinant vector containing the expression cassette described in (2).

5. Recombinant cells, characterized in that, The recombinant cells contain the TCR sequence targeting the KRASG12D antigen as described in any one of claims 1-3 or the biological material as described in claim 4.

6. The recombinant cell according to claim 5, characterized in that, The recombinant cells included human peripheral blood T cells TCRomo sapiens, deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: C2026127 and deposit date of June 25, 2026.

7. A pharmaceutical composition, characterized in that, The pharmaceutical composition contains the TCR according to any one of claims 1-3, the biomaterial according to claim 4, or the recombinant cell according to claim 5 or 6.

8. The use of the TCR sequence targeting the KRAS G12D antigen as described in any one of claims 1-3, the biomaterial as described in claim 4, or the recombinant cell as described in claim 5 or 6 in any of the following; (1) Use in the preparation of drugs for the prevention or treatment of tumors; (2) Application in the preparation of drugs for the prevention or treatment of diseases related to KRAS G12D mutation.

9. An MHC tetramer for screening the TCR sequence targeting the KRAS G12D antigen as described in any one of claims 1-3, characterized in that, The MHC tetramer is a complex composed of four pMHC monomer molecules and a fluorescent dye. It is based on streptavidin with a signal label, which crosslinks four identical MHC monomer molecules to form an MHC tetramer.

10. The MHC tetramer according to claim 9, characterized in that, The pMHC monomer molecule is a single antigenic peptide-MHC molecule complex, and the antigenic peptide is a Kras-G12D mutant peptide with the amino acid sequence shown in SEQ ID NO: 14.

Images