DsRNA targeting cotton bollworm HaPburs gene and application thereof in prevention and treatment of cotton bollworm

Abstract

The application belongs to the technical field of biology, and particularly relates to a dsRNA of a target Helicoverpa armigera HaPburs gene and application thereof in prevention and treatment of the Helicoverpa armigera. HaPburs RNA interference mediated knockdown reduces the transcript level by 60.01%, and induces morphological abnormalities of pheromone glands (PG), which are irregular black protrusions; the silencing HaPburs reduces the main pheromone component Z 11-16: Ald content, while the male insect attraction rate and mating rate, cumulative egg production also significantly decrease, and the transcript level of the sex pheromone biosynthesis related genes HaPKA and HaACC is also significantly reduced. It is shown that HaPburs the genes participate in PG morphogenesis and regulate sex pheromone biosynthesis through a cAMP-PKA-ACC regulatory axis, thereby affecting the reproductive communication of the Helicoverpa armigera. The application provides a novel target and technical scheme for green and efficient prevention and control of the Helicoverpa armigera, and has important research and development value and application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and specifically relates to a dsRNA and its application in the control of cotton bollworm. Background Technology

[0002] cotton bollworm ( Helicoverpa armigera The cotton bollworm (Helicoverpa armigera) is one of the most damaging polyphagous lepidopteran pests in my country's agricultural production. It has a wide host range, infecting hundreds of important economic and food crops, including cotton, corn, tomato, and wheat. The larvae of the cotton bollworm feed on leaves, buds, fruits, and bolls, causing plant damage, flower and boll drop, and fruit rot. This leads to significant yield reductions and quality deterioration year after year, resulting in huge economic losses and seriously threatening my country's food security and the stable development of its agricultural industry. Currently, chemical pesticides remain the main means of controlling the cotton bollworm. However, long-term and high-frequency use has led to resistance in the cotton bollworm to various insecticides and Bt genetically modified crops, while also causing pesticide residues and environmental pollution. Therefore, developing novel, efficient, environmentally friendly, and resistance-resistant targeted control technologies for the cotton bollworm has become a research hotspot and urgent need in the field of agricultural pest control.

[0003] Bursicon is a heterodimeric neuropeptide hormone secreted by the central nervous system of insects. It was first observed in the red-headed blowfly in 1965 by Fraenkel and Hsiao. Calliphora erythrocephala This hormone was found in the hemolymph and was named the tanning hormone because of its key role in regulating epidermal tanning. The hormone consists of two subunits, bursicon α (Burs α) and bursicon β (Burs β), which are composed of... bursicon ( burs )and Partner of bursicon ( Pburs The genes encode these two subunits. Both subunits are highly conserved across insect species, and each subunit contains 11 cysteine ​​residues, which can form a characteristic cysteine ​​knot domain via disulfide bonds, crucial for maintaining protein structural stability. Although the Burs α / Burs β heterodimer is the classic ligand mediating epidermal tanning, each subunit itself can also independently form homodimers with different biological functions.

[0004] The tannin-rich repeat G protein-coupled receptor 2 (LGR2) belongs to the GPCR superfamily and contains an extracellular leucine-rich repeat domain. Its expression and distribution are found in the insect epidermis, nervous system, and other functional organs. Upon binding to LGR2, Bursicon triggers the cAMP-PKA signaling cascade, thereby promoting dopamine biosynthesis. Dopamine participates in epidermal tanning through two complementary mechanisms: on the one hand, its derivatives enhance the protein-chitin matrix through oxidative cross-linking, thereby increasing the mechanical strength of the epidermis; on the other hand, dopamine can be converted into insoluble melanin granules and deposited in the epidermis, leading to increased epidermal color. In *Drosophila melanogaster*... Drosophila melanogaster middle, burs Loss-of-function mutations result in defects in the cuticle hardening and abnormal wing expansion in newly emerged adults. Similarly, in the final instar of the fall white moth... Hyphantria cunea In larvae, the bursicon receptor gene was knocked down via RNA interference (RNAi). HLGR2 It will hinder the tanning of the pupal epidermis and significantly increase mortality.

[0005] Besides its classic role in epidermal tanning, studies have shown that tanning hormones are also involved in various physiological processes in insects, including wing expansion, reproduction, and innate immunity. In the Drosophila melanogaster... Drosophila melanogaster middle, burs The mutation inhibits wing expansion and results in the continued presence of intact wing epithelium within the unexpanded wing. Bursicon is also believed to be involved in insect immune defense. In Aedes aegypti... Aedes aegypti In this study, both Burs-α and Burs-β homodimers significantly induced the expression of antimicrobial peptide genes, including... Att , CecA and DefA This enhances the host's resistance to pathogen infection. Patent CN109456977A discloses a method for targeting the gypsy moth. Burs dsRNA control technology for the (tannin α subunit) gene, through silencing Burs The gene causes wing malformation in adult gypsy moths, hindering normal emergence and activity. However, its target pest is the gypsy moth, a forestry pest, and it is not applicable to cotton bollworms. Furthermore, it only achieves epidermal tanning and wing development interference, and does not reveal its regulatory effect on insect reproductive development. Therefore, it cannot simultaneously inhibit pest survival and population reproduction.

[0006] Although existing research has confirmed that the Bursicon gene plays a core role in the growth, reproduction, and immune regulation of various insects, its application in the green control of cotton bollworm is still a blank. Therefore, continuously exploring new target genes and control strategies to provide new targets and technical solutions for the green and efficient control of cotton bollworm has important research and development value and application prospects. Summary of the Invention

[0007] To address the aforementioned technical problems, this invention proposes a method for targeting cotton bollworms. HaPburs The dsRNA of the gene and its application in the control of cotton bollworm.

[0008] The technical solution of this invention is implemented as follows: The cotton bollworm is a globally important agricultural pest, and its wide distribution, broad host range, and strong destructive ability make it a representative model organism in insect physiology and behavioral research. Preliminary transcriptome screening results indicate that during the maturation of the pheromone gland (PG) in female cotton bollworms... HaPburs Elevated expression levels suggest HaPburs It may play a role in PG development and function. This application clones... HaPburs The full-length coding sequence was obtained and homology and phylogenetic analyses were performed. Subsequently, RNAi technology was used for characterization. HaPburs Regulatory functions in PG development and sex pheromone biosynthesis. Elucidating these mechanisms will help clarify... Pburs The role of bursicon in insect reproductive communication will further expand our understanding of bursicon-mediated regulatory networks in insects.

[0009] HaPburs It participates in the morphogenesis of tannin-producing hormones (PGs) in the cotton bollworm and may regulate sex pheromone biosynthesis through the cAMP-PKA-ACC signaling pathway, thereby participating in reproductive communication. These findings expand the functional scope of tannin-producing hormones and refine their regulatory network in insect reproduction. Furthermore, due to… HaPburs Silencing significantly reduced the mating and oviposition rates of cotton bollworms, and this pathway could serve as a potential target for developing environmentally friendly pest control strategies to disrupt the pest's reproductive cycle.

[0010] Based on this, the present invention provides a targeted cotton bollworm HaPburs The dsRNA of the gene, wherein the dsRNA comprises the nucleotide sequence shown in SEQ ID No. 1 and its reverse complementary nucleotide sequence. HaPburs The gene's GenBank accession number is XM_021326060.3.

[0011] Secondly, the present invention also provides primer pairs for in vitro synthesis of the above-mentioned dsRNA, wherein the primer pairs comprise a forward primer with the sequence shown in SEQ ID No. 2 and a reverse primer with the sequence shown in SEQ ID No. 3, and both the forward and reverse primers have a T7 promoter attached to their 5' ends, the T7 promoter sequence being shown in SEQ ID No. 4.

[0012] Using primers with the T7 promoter, cDNA was amplified from a mixed pool of adult and larval bollworms. HaPburs The target sequence was determined. Double-stranded RNA (dsRNA) was synthesized in vitro using the T7 RNAi Transcription Kit (Nanjing Novizan Biotechnology Co., Ltd.).

[0013] Thirdly, this invention applies for protection of a reagent for controlling cotton bollworm, wherein the active ingredient of the reagent is the aforementioned dsRNA.

[0014] Preferably, the concentration of the above-mentioned dsRNA is 1.0-5.0 μg / μL.

[0015] Fourthly, this invention applies to protect the use of the above-mentioned dsRNA or the above-mentioned reagent in the control of cotton bollworm.

[0016] Preferably, the above-mentioned dsRNA or reagent inhibits cotton bollworm. HaPburs Gene expression is used to control cotton bollworm.

[0017] Preferably, the above-mentioned inhibition of bollworms HaPburs Gene expression can cause abnormal morphology of pheromone glands and sex pheromone components ( Z )-11-hexadecenal( Z The content of 11-16:Ald) decreased, and the attraction and mating rates of male cotton bollworms decreased.

[0018] via ds HaPburs Following mediated RNAi treatment, with ds EGFP Compared to the group, HaPburs Transcriptional levels decreased significantly by approximately 60.01%. Morphological observation showed that 77% of ds HaPburs The treated female moths developed irregular, raised black spots on the PG surface.

[0019] HaPburs -RNAi significantly reduced the main pheromone components Z 11-16: The content of Ald decreased by 42.66% compared with the control group. The male moth attraction rate and mating rate decreased to 59.15% and 56.25% of the corresponding control values, respectively. RNAi-mediated... HaPbursInhibition significantly reduced the level of the main sex pheromone component Z11-16:Ald in cotton bollworm, indicating that HaPburs It participates in the regulation of the biosynthesis and / or accumulation of PG neutral pheromones.

[0020] With ds EGFP In comparison, ds HaPburs The injection significantly reduced the cumulative number of eggs laid per female moth, decreasing by 137 eggs. HaPburs Effects of knockdown on genes related to the female cotton bollworm sex pheromone biosynthesis pathway: HaPburs After being knocked down, compared with the control, HaACC and HaPKA The transcription levels decreased by 56.07% and 48.44%, respectively.

[0021] Fifthly, this invention also claims protection for a method for controlling cotton bollworm, the steps of which are: microinjecting the above-mentioned dsRNA or the above-mentioned reagent into the abdomen of the female cotton bollworm.

[0022] The dosage of dsRNA used is 5-20 μg per cotton bollworm per injection; the injection volume of reagent is 2-8 μL per cotton bollworm per injection.

[0023] The preferred dosage of dsRNA is 10 μg per cotton bollworm per injection; the preferred injection volume is 4 μL per cotton bollworm per injection; and the injection time is 48 h before the female cotton bollworm pupae emerge.

[0024] The specific steps were as follows: In the RNAi treatment group, approximately 48 hours before female pupae emerged, 4 μL of a solution containing 10 μg ds was injected into the abdomen. HaPburs The newly emerged female was injected again with 10 μg ds solution (2.5 μg / μL). HaPburs They are kept separately to prevent mating.

[0025] The present invention has the following beneficial effects: This invention is the first to identify and functionally validate bollworms. HaPburs The key role of genes in reproductive regulation, sequence conservation, and phylogenetic relationship analysis indicate that... HaPburs It is conserved in insects and clusters with lepidopteran homologous proteins. qPCR results show that... HaPburs Expression levels were high in the head, abdomen, and PG of adult females, with expression in the PG peaking 48 h post-emergence during the dark period. RNA interference-mediated knockdown resulted in... HaPburs Transcript levels decreased by 60.01% and induced abnormal PG morphology, manifested as irregular melanized protrusions. Silencing HaPbursSubsequently, the main sex pheromone component (Z)-11-hexadecenal ( Z The content of 11-16:Ald) decreased by 42.66%, while the male insect attraction rate and mating rate decreased to 59.15% and 56.25% of the control level, respectively. The cumulative egg production also decreased, thus effectively suppressing the population reproduction of cotton bollworms. Furthermore, HaPburs After knockdown, genes related to the sex pheromone biosynthesis pathway... HaPKA and HaACC The transcript levels decreased by 48.44% and 56.07%, respectively, indicating that... HaPburs It participates in PG morphogenesis and influences sex pheromone biosynthesis through the cAMP-PKA-ACC regulatory axis, thereby affecting reproductive communication in the cotton bollworm. This application provides a novel target and technical solution for the green and efficient control of the cotton bollworm, possessing significant research value and application prospects. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 The nucleotide sequence of the Burs-β subunit of the cotton bollworm and its deduced amino acid sequence are shown; the gray shaded area represents ds HaPburs Target sequence, the boxed area represents the Burs-β subunit domain.

[0028] Figure 2 For cotton bollworm and 8 other insects Pburs Multiple sequence alignment of nucleotide sequences; species and GenBank accession numbers are as follows: HaPburs : H. armigera , XM_021326060.3; BmPburs : Bombyx mori , NM_001043824.1; BpPburs : Bombus pascuorum , XM_060957664.1; MpPburs : Myzus persicae , XM_022316017.1; RpPburs : Rhodnius prolixus , XM_074120606.1; TcPburs : Tribolium castaneum , NM_001114308.1; DmPburs : Drosophila melanogaster, NM_135868.2; SgPburs : Schistocerca gregaria , XM_049987824.1; FoPburs : Frankliniella occidentalis , XM_026424660.2; Sequence conservation is indicated by color shading: dark blue indicates 100% consistency; red indicates 75%-90% consistency; light blue indicates 50%-75% consistency; white indicates less than 50% consistency.

[0029] Figure 3 Phylogenetic relationships of tannin-β subunits in different insect species; species and GenBank accession numbers are as follows: Helicoverpa armigera (XP_021181735.3) Spodoptera litura (XP_022828187.1) Bombyx mori (NP_001037289.1) Plutella xylostella (XP_037969689.1) Bombus pascuorum (XP_060813647.1) Solenopsis invicta (XP_039302708.1) Anopheles gambiae (XP_313804.4) Drosophila melanogaster (NP_609712.1) Chrysoperla carnea (XP_044726777.1) Tribolium castaneum (NP_001107780.1) Photinus pyralis (XP_031343674.1) Leptinotarsa decemlineata (XP_023014169.1) Schistocerca gregaria (XP_049843781.1) Zootermopsis nevadensis (XP_021930558.1) Macrosteles quadrilineatus (XP_054271697.1) Rhodnius prolixus (XP_073976707.1) Myzus persicae (XP_022171709.1) Thrips palmi (XP_034238241.1) Frankliniella occidentalis (XP_026280445.1); All amino acid sequences used for analysis were obtained from the NCBI database. Phylogenetic trees were constructed using the neighbor-joining method in MEGA v.12.0. Support for clustering of related taxa was assessed using a bootstrap analysis with 1,000 replicates; the percentage above a branch indicates the frequency with which related taxa clustered into the same branch in the replicated tree.

[0030] Figure 4 Female cotton bollworm HaPburs Tissue-specific and developmental stage expression patterns were analyzed. Tissue-specific expression was analyzed in the head, thorax, abdomen, and pheromone glands (PGs) of virgin female moths 48 h post-emergence. Developmental stage expression in PGs was analyzed 48 h before emergence, immediately after emergence (0 h), and 48 h post-emergence. Data are presented as mean ± SEM of three biological replicates, each replicate consisting of tissues or PG mixtures from 10 female moths. Different letters on the columns indicate significant differences between groups (…). p <0.05).

[0031] Figure 5 for HaPburs - Effects of RNAi on the morphology of pheromone glands in female cotton bollworms; Figure (a) shows the effect of ds HaPburs After injection, the pheromone glands (PG) of adult female moths contain... HaPburs Knockout efficiency, injection ds EGFP Female moths were used as controls. Data are presented as mean ± SEM of four biological replicates, with asterisks indicating differences compared to ds according to Student's t-test. EGFP The difference was statistically significant compared to the control group (**) p <0.01), (b) is ds HaPburs The representative PG phenotype of the injected female moth, (c) is ds EGFP Representative PG phenotypes of injected female moths, scale bar = 1 mm in (b) and (c).

[0032] Figure 6 for HaPburs The effects of RNAi on the levels of sex pheromone components and reproductive behavior in cotton bollworm, as shown in Figure (a). HaPburs -RNAi in the female moth's pheromone gland (PG) Z 11-16: The relative content of Ald, (b) is HaPburs - The relative content of Z9-16:Ald in PGs of female moths after RNAi, for (a) and (b), each biological replicate consists of 10 PGs, and (c) is the female moth. HaPburs The effect of RNAi on the ability of treated female moths to attract male moths, after injecting an equal amount of ds EGFP Female moths were used as a negative control for RNAi, and female moths injected with an equal volume of RNase-free water were used as a solvent control. Each replicate and treatment contained 20 female moths, and 40 virgin male moths were used for attraction evaluation. (d) represents the ds. HaPburs Treatment of female moths and ds EGFP Mating frequency of female moths was treated, with each replicate containing 20 pairs of male and female moths per treatment. Data are expressed as the mean ± SEM of three independent biological replicates. An asterisk indicates significant differences between treatments within each plate (Student's...).t test:* p <0.05,** p <0.01, *** p <0.001; ns, no significant difference).

[0033] Figure 7 for HaPburs The effects of RNAi on the total and daily oviposition of female cotton bollworms are shown in Figure (a) as total oviposition and (b) as daily oviposition. EGFP Female moths were used as controls. Data are expressed as mean ± SEM of 9 biological replicates, each replicate containing 1 female moth; asterisks indicate the difference between the control and the control. EGFP The difference was statistically significant compared to the control group (Student's t-test, *). p <0.05).

[0034] Figure 8 for HaPburs The effects of RNAi on the expression of genes related to sex pheromone biosynthesis in female cotton bollworms, as shown in Figure (a). HaACC (b) is HaPKA (c) is HaCaN (d) is HaPBANR (e) is HaFAR2 , (f) is HaDes11 ; in ds HaPburs and ds EGFP Gene expression was detected in the pheromone glands (PG) of female moths after injection of ds EGFP Female moths were used as a control. Data are presented as mean ± SEM of three biological replicates, each replicate consisting of 10 pooled PGs. Actin EF1α was used as an internal reference gene for normalization; asterisks indicate significant differences between treatments within each plate (Student's). t test:* p <0.05,** p <0.01, *** p <0.001; ns, no significant difference). Detailed Implementation

[0035] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0036] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0037] This application explores, from the perspective of reproductive communication, HaPburs Regulatory roles of tannin-producing hormones in the development of pheromone glands (PGs) and the biosynthesis of sex pheromones in adult female cotton bollworms. These findings expand the functional range of tannin-producing hormones and provide a potential molecular basis for developing pest control strategies based on reproductive disruption.

[0038] Materials and methods used in this invention 1. Insects cotton bollworm ( H. armigera The samples were originally collected from Jiyuan City, China. The laboratory population was continuously reared for multiple generations under controlled conditions of 26 ± 1℃, relative humidity of 75 ± 10%, and photoperiod of 16 h:8 h (light:dark). Larvae were fed artificial feed, and adults were supplemented with 5% (w / v) honey water.

[0039] 2. Target gene cloning Total RNA was extracted from a mixed sample of adult and larval bollworms using the Trizol Up Plus RNA Kit (Beijing TransGen Biotech Co., Ltd.). First-strand cDNA was synthesized using the HiScript III RT SuperMix (Nanjing Novizan Biotechnology Co., Ltd.). PCR amplification was performed using the KOD One PCR Master Mix (Toyobo (Shanghai) Biotechnology Co., Ltd.). HaPburs ; The amplification program was as follows: 95℃ for 5 min; followed by 36 cycles, each consisting of 95℃ for 30 s, 54℃ for 30 s and 72℃ for 1 min; and finally extended at 72℃ for 10 min.

[0040] The purified PCR product was cloned into the ZT4-Blunt vector using the ZT4-Blunt Fast Cloning Kit (Beijing Zhuangmeng International Biotechnology Co., Ltd.). The recombinant plasmid was then transformed into... Escherichia coli In DH5α competent cells, the cultures were incubated at 37°C for 12–16 h. Positive clones were screened by colony PCR and verified by Sanger sequencing (Beijing Qingke Biotechnology Co., Ltd.). Primer sequences are shown in Table 1.

[0041] Table 1 Primer sequences used in this invention

[0042]

[0043] T7 sequence: GGATCCTAATACGACTCACTATAGG (SEQ ID No. 4).

[0044] ds HaPburs The target fragment sequence is shown in SEQ ID No.1 and is 366 bp in length.

[0045] 3. Data Analysis Statistical analysis was performed using IBM SPSS Statistics 23.0. All data are expressed as mean ± standard error (mean ± SEM). For spatiotemporal expression analysis, one-way ANOVA combined with Tukey's multiple comparison test was used to analyze the differences between different tissues and between different PG developmental stages. HaPburs Differences in expression levels. Using Student's... t Test analysis ds HaPburs With ds EGFP Differences between treatments were investigated in RNAi efficiency, expression levels of sex pheromone biosynthesis-related genes, relative content of pheromone components extracted from PG, mating rate, and oviposition parameters. For the male attraction experiment, paired Student's t-tests were used because the females in the treatment and control groups were measured in parallel in each biological replicate. The statistical significance level was set at [value missing]. p <0.05.

[0046] Example 1: Phylogenetic Analysis

[0047] Identification was performed using a BLAST search in the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Pburs Homologous sequences. Multiple sequence alignment was performed using DNAMAN v.9.0, and conserved domains were predicted using InterProScan (http: / / www.ebi.ac.uk / interpro / ). Phylogenetic reconstruction was performed in MEGA v.12.0 using the Neighbor-Joining method, and node support was evaluated through 1,000 bootstrap repetitions.

[0048] cotton bollworm HaPburs Sequence analysis: HaPburs The transcript contains a 477 bp open reading frame encoding a 158-amino acid protein. The deduced molecular weight of the Burs-β protein is 18.15 kDa, with a theoretical isoelectric point of 5.27. Structural analysis indicates that the protein possesses a typical tannin-β subunit domain at amino acid residues 34-158.Figure 1 ). HaPburs In insects Pburs The β-domain of the tannin-containing homologous protein exhibits high conservation, suggesting that it retains its conserved physiological function.

[0049] Multiple nucleotide sequence alignment results show that HaPburs With silkworms ( Bombyx mori The sequence identity of was the highest, at 62.89%; it was also the highest compared to western flower thrips ( Frankliniella occidentalis The consistency rate was the lowest, at 32.29%. HaPburs With bumblebees ( Bombus pascuorum ), Peach aphid ( Myzus persicae ), kissing bug ( Rhodnius prolixus ), Red Valley Beetle ( Tribolium castaneum ), Drosophila melanogaster ( Drosophila melanogaster ) and desert locusts ( Schistocerca gregaria The homology range among the homologous sequences was 49.69%-53.77%, indicating that... Pburs It exhibits moderate to high conservation across different insect groups. Figure 2 ).

[0050] Phylogenetic analysis showed that the Burs-β sequence of the cotton bollworm is related to that of the beet armyworm (Spodoptera litura). Spodoptera litura The Burs-β sequences of these two insects cluster together, consistent with their taxonomic position within the Noctuidae family. These two Noctuidae insects are further related to the silkworm (…). Bombyx mori ) and diamondback moth ( Plutella xylostella Clustering revealed a Lepidoptera-specific branch with a high self-support rate (96%), indicating strong evolutionary conservation of Burs-β in Lepidoptera. Furthermore, Burs-β sequences from Hymenoptera, Coleoptera, Diptera, Hemiptera, and Orthoptera formed distinct branches, reflecting an order-specific evolutionary pattern for the Burs-β subunit. The self-support rates of deeper nodes separating major insect orders were relatively low (…). Figure 3 ).

[0051] Example 2: Cotton bollworm HaPburs Expression analysis

[0052] To analyze tissue-specific expression, the head, thorax, abdomen, and pheromone glands (PGs) were dissected in virgin females 48 h post-emergence. To assess the expression of PGs... HaPbursDevelopmental changes in expression were observed by collecting protoplasts (PGs) 48 h before molting, immediately after molting (0 h), and 48 h after molting. Mixed samples were prepared for each tissue type or developmental stage, and total RNA was extracted for qPCR analysis. Real-time quantitative PCR (qPCR) was performed using a Hieff qPCR SYBR Green Master Mix (Yisheng Biotechnology (Shanghai) Co., Ltd.) on an Applied Biosystems 7500 Fast Real-Time PCR System. Two... -ΔΔCt The method calculates the relative expression level and uses cotton bollworm as an example. actin (GenBank accession number: XM_021337727.3) and EF1α (XM_021329969.3) were used as internal reference genes for normalization. Three biological replicates were set up for each tissue or developmental stage, and each replicate consisted of a mixture of 10 samples. Primer sequences are shown in Table 1.

[0053] qPCR analysis results showed that female cotton bollworms... HaPburs Significant spatiotemporal differences were observed in its expression. At 48 hours post-emergence, i.e., 2 hours into the dark phase, HaPburs The expression levels in the head and abdomen were significantly higher than those in the chest. p <0.05; Figure 4 In the pheromone gland (PG), HaPburs Expression levels varied with developmental stage, reaching their highest level 48 h post-emergence, which was 2.04 times and 2.68 times higher than those 48 h before emergence and 0 h post-emergence, respectively. p <0.05; Figure 4 ).

[0054] In female adult cotton bollworms, HaPburs It exhibits higher expression in the head and abdomen, consistent with its function as a neurohormones in the synthesis and secretion of hormones in the central nervous system. Notably, HaPburs The relatively high expression in PG suggests that it may be involved in PG function and PG-mediated reproductive communication, especially in the biosynthesis and release of sex pheromones.

[0055] Example of implementation results: HaPburs Effects of knockdown on PG morphology, pheromone production, reproductive behavior, and oviposition in female cotton bollworms

[0056] 1. RNA interference (RNAi) experiment: Using primers with the T7 promoter, cDNA was amplified from a mixed pool of adult and larval bollworms. HaPbursThe target sequence was determined. Double-stranded RNA (dsRNA) was synthesized in vitro using the T7 RNAi Transcription Kit (Nanjing Novizan Biotechnology Co., Ltd.) according to the manufacturer's instructions. In the RNAi-treated group, 4 μL of dsRNA containing 10 μg of dsRNA was injected into the abdomen of each female pupa approximately 48 h before emergence. HaPburs The solution (2.5 μg / μL). Newly emerged females were injected again with 10 μg ds HaPburs They were kept separately to prevent mating. With equal amounts of ds EGFP (U76561.1) was injected as a control. Forty-eight hours after the second injection, four females were randomly selected to assess RNAi efficiency, and PG morphology was observed simultaneously. During the second dark period after emergence (two hours after entering the dark period), PGs were dissected to detect the expression of key pheromone production-related genes, including pheromone biosynthesis activating neuropeptide receptor (PBANR), calcineurin (CaN), acetyl-CoA carboxylase (ACC), protein kinase A (PKA), fatty acyl-CoA reductase 2 (FAR2), and desaturase 11 (Des11). Three biological replicates were set up for each treatment, with each replicate containing 10 PGs.

[0057] 2. Determination of pheromone component content in PG Sex pheromone components (Z11-16:Ald and Z9-16:Ald) from dissected cotton bollworm PGs were extracted using 200 μL of n-hexane (purity >99%) for 24 h. Two μL of the extract was analyzed using an Agilent 7890A gas chromatograph equipped with an HP-5 capillary column (30 m × 0.32 mm × 0.25 μm) and a flame ionization detector (FID) at 260 °C. Nitrogen was used as the carrier gas at a flow rate of 25 mL / min. The column temperature program was: 150 °C increased to 230 °C at 30 °C / min, followed by an increase to 260 °C at 20 °C / min. Three biological replicates were set for each treatment, with each sample containing 10 PGs.

[0058] 3. Measurement of male insect attraction behavior 48 hours before female pupae emerge, 10 μg ds was microinjected into the posterior abdominal segment. HaPbursOn the morning of the emergence day, the newly emerged female was injected again with 10 μg ds HaPburs They were kept separately to ensure virginity. An equal amount of ds was injected. EGFP Female insects were used as a negative control for RNAi, and female insects injected with an equal volume of RNase-free water were used as a solvent control. Twenty treated female insects were randomly selected and placed in a trap box, along with 20 ds... EGFP The treated control females were placed in another identical trap box. The locations of the trap boxes for the treatment and control groups were randomly assigned in each experimental replicate. Each trap box measured 50 × 50 × 50 cm and was equipped with a ventilation system at an airflow rate of 1.5 L / min. A separate release box containing 40 unmated males was used for evaluation. Pburs - RNAi treatment altered the attraction of female insects to male insects. Trapping experiments were conducted in darkness at 26°C, and the number of male insects captured in each trap was recorded at 06:00 the following day. Each treatment was performed in triplicate.

[0059] 4. Mating rate determination Forty-eight hours before emergence, female cotton bollworm pupae were microinjected abdominally with 10 μg ds per pupa. HaPburs Newly emerged adults were re-injected to enhance the RNAi effect. Control individuals were injected with the same amount of ds. EGFP Twenty treated females and twenty unmated males were placed in mating cages measuring 50 × 50 × 50 cm and reared in complete darkness at 26°C. The females were dissected at 06:00 the following day to check for the presence of spermatophores to confirm mating. Three biological replicates were set up for each treatment.

[0060] 5. Measurement of egg-laying behavior Forty-eight hours before emergence, female cotton bollworm pupae were microinjected abdominally with 10 μg ds per pupa. HaPburs Newly emerged adults were injected again, and a third injection was given 48 hours after emergence to enhance the RNAi effect. Control individuals were injected with an equal amount of ds. EGFP To assess oviposition, each treated female was paired with two unmated males and placed in a custom-made oviposition cage. Oviposition was monitored daily. Nine biological replicates were set up for each treatment, with each replicate containing one female.

[0061] via ds HaPburs Following mediated RNAi treatment, with ds EGFP Compared to the group, HaPburs Transcription levels decreased significantly by approximately 60.01% ( p <0.01; Figure 5 a). Meanwhile, morphological observations show that 77% of ds HaPbursThe treated female moths developed irregular, raised black spots on the PG surface. Figure 5 bc). HaPburs After knockdown, 77% of female bollworm moths developed irregular blackened protrusions on their secretory prion (PG) surface. As a crucial exocrine tissue responsible for the biosynthesis and release of sex pheromones, the normal function of the PG depends not only on the regulation of biosynthetic pathways but also on the structural integrity required for pheromone secretion, storage, and release. Therefore, observed PG morphological abnormalities may disrupt the integrity of secretory epithelial cells, interfere with neuroendocrine regulation and intracellular transport, thereby limiting the efficient release of sex pheromones.

[0062] HaPburs -RNAi significantly reduced the main pheromone components Z 11-16: The content of Ald decreased by 42.66% compared with the control group ( p <0.01; Figure 6 a), while the minor component Z9-16:Ald did not change significantly ( p >0.05; Figure 6 b). The male moth attraction rate and mating rate decreased to 59.15% and 56.25% of the corresponding control values, respectively. p <0.05; Figure 6 cd). RNAi-mediated. HaPburs Inhibition significantly reduced the main sex pheromone components of cotton bollworm Z 11-16: The level of Ald indicates HaPburs It participates in the regulation of the biosynthesis and / or accumulation of PG neutral pheromones. HaPburs After silencing, the attraction rate and mating success rate of male moths decreased significantly, which is likely due to... Z 11-16: This study relates to decreased Ald levels because pheromone titers and component ratios are key determinants of male attraction responses in moths. This study provides experimental evidence linking tannin hormone signaling to the regulation of insect sex pheromone production, extending its functional scope to the early stages of reproductive communication, and providing new insights into the multi-level regulatory role of tannin hormones in insect reproductive networks.

[0063] In addition, with ds EGFP In comparison, ds HaPburs The injection significantly reduced the cumulative number of eggs laid per female moth, decreasing by 137 eggs. p <0.01; Figure 7 a). ds HaPburs Treatment of female moths and ds EGFP The daily oviposition patterns of the treated female moths were similar, with both groups reaching their peak oviposition on the same day. Figure 7 b).

[0064] HaPbursEffects of knockdown on genes related to the female cotton bollworm sex pheromone biosynthesis pathway: HaPburs After being knocked down, compared with the control, HaACC and HaPKA The transcriptional levels decreased by 56.07% and 48.44%, respectively (respectively). p <0.01 and p <0.05; Figure 8 ab). In comparison, HaCaN The expression was unaffected ( p >0.05; Figure 8 c), and HaPBANR , HaFAR2 and HaDes11 The expression levels of these substances were significantly upregulated to varying degrees (respectively...). p <0.01、 p <0.001 and p <0.01; Figure 8 df).

[0065] The RNAi-mediated invention HaPburs Silencing significantly reduced the relative expression level of PKA. PKA is a core effector in the cAMP signaling pathway involved in sex pheromone biosynthesis. As a key effector of cAMP signaling, reduced PKA expression may weaken the transcriptional regulation of downstream target genes dependent on phosphorylation, thereby affecting sex pheromone biosynthesis. Further analysis showed that ACC expression also decreased synchronously by 56.07%. Taken together, these findings suggest... HaPburs It may regulate the biosynthesis of cotton bollworm sex pheromone precursors through the cAMP-PKA-ACC-dependent pathway, ultimately affecting the release titer of the main pheromone components. HaFAR2 and HaDes11 These two genes, which catalyze acyl reduction and desaturation reactions respectively, may have increased expression reflecting a compensatory mechanism to partially offset the insufficient precursor supply caused by decreased ACC expression. Or HaPburs Silence-induced endocrine and metabolic disorders may also indirectly upregulate HaFAR2 and HaDes11 These two genes are involved in a variety of physiological regulatory processes.

[0066] In conclusion, HaPburs It participates in the morphogenesis of tannin-producing hormones (PGs) in the cotton bollworm and may regulate sex pheromone biosynthesis through the cAMP-PKA-ACC signaling pathway, thereby participating in reproductive communication. These findings expand the functional scope of tannin-producing hormones and refine their regulatory network in insect reproduction. Furthermore, due to… HaPburs Silencing significantly reduced the mating and oviposition rates of cotton bollworms, and this pathway could serve as a potential target for developing environmentally friendly pest control strategies to disrupt the pest's reproductive cycle.

[0067] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A targeted method for cotton bollworm HaPburs The dsRNA of a gene is characterized by: The dsRNA comprises the nucleotide sequence shown in SEQ ID No. 1 and its reverse complementary nucleotide sequence. HaPburs The gene's GenBank accession number is XM_021326060.

3.

2. Primer pair for in vitro synthesis of the dsRNA of claim 1, characterized in that: The primer pair includes a forward primer with the sequence shown in SEQ ID No. 2 and a reverse primer with the sequence shown in SEQ ID No.

3. The 5' end of both the forward and reverse primers is connected to a T7 promoter, the sequence of which is shown in SEQ ID No.

4.

3. A reagent for controlling cotton bollworm, characterized in that: The active ingredient of the reagent is the dsRNA as described in claim 1.

4. The reagent according to claim 3, characterized in that: The concentration of dsRNA in the reagent is 1.0-5.0 μg / μL.

5. The use of the dsRNA of claim 1 or the reagent of claim 3 or 4 in controlling cotton bollworm or reducing the reproductive capacity of cotton bollworm.

6. The application according to claim 5, characterized in that: The dsRNA or reagent inhibits bollworms. HaPburs Gene expression is used to control cotton bollworm.

7. The application according to claim 6, characterized in that: Suppressing cotton bollworms HaPburs Gene expression can cause abnormal morphology of pheromone glands and changes in sex pheromone components. Z 11-16: The content of Ald decreased, and the attraction and mating rates of male cotton bollworms decreased.

8. A method for controlling cotton bollworm, characterized in that, The steps are as follows: microinject the dsRNA of claim 1 or the reagent of claim 4 into the abdomen of the female cotton bollworm.

9. The method according to claim 8, characterized in that: The dosage of dsRNA used is 5-20 μg dsRNA per cotton bollworm per injection; the injection volume of the reagent is 2-8 μL per cotton bollworm per injection.

10. The method according to claim 9, characterized in that: The preferred dosage of dsRNA is 10 μg per cotton bollworm per injection; the preferred injection volume is 4 μL per cotton bollworm per injection; and the injection time is 48 h before the female cotton bollworm pupae emerge.

Images