A method for detecting group b streptococcus without aerosol pollution by fluorescence colorimetric double-mode detection

Abstract

The application discloses a kind of fluorescence colorimetric double-mode detection streptococcus agalactiae without aerosol pollution method, comprising the following steps: (1) strain culture and DNA extraction;(2) the combination of UDG and LAMP;(3) UDG-LAMP-CRISPR fluorescence mode detection system;(4) colorimetric mode detection system: read image RGB value in G value, G value significantly increases, and it is positive result.This patent innovatively combines UDG, LAMP, CRISPR and G4, introduces connection probe to realize "fluorescence-colorimetric" single system double-mode detection.The two detection modes of the detection platform can be freely split or combined, and can meet the needs of different detection environments.By combining UDG system and LAMP technology, aerosol pollution possibly carried in amplification process is avoided.Connection probe is introduced, CRISPR fluorescence detection is combined with G4 colorimetric detection, a detection system with "fluorescence-colorimetric" two detection modes is established, which is used for quantitative identification and cross verification of streptococcus agalactiae.

Description

Technical Field

[0001] This invention relates to the field of Streptococcus agalactiae technology, and more specifically, to a method for detecting Streptococcus agalactiae using a fluorescent colorimetric dual-mode method without aerosol contamination. Background Technology

[0002] agalactococcus ( Streptococcus agalactiae Also known as Group B Streptococcus Streptococcus Streptococcus agalactiae (GBS) is a β-hemolytic, Gram-positive streptococcus that can cause invasive infections. This bacterium is widely present in aquaculture environments (such as water, sediment, fish surface, gills, and intestines) and is classified into 10 serotypes (Ia, Ib, II-IX) based on capsular polysaccharide antigens. Infection with GBS can lead to septicemia and systemic diseases such as meningitis and encephalitis in tilapia, causing symptoms such as exophthalmos, corneal opacity, abnormal swimming, depression, and decreased appetite, resulting in high mortality, reduced yields, and continuous transmission, leading to significant economic losses. Furthermore, reports indicate that this bacterium can infect humans through the consumption of raw or undercooked freshwater fish products, causing bacteremia and complications such as joint infections or meningitis. Therefore, establishing quantitative detection methods for GBS and implementing regular monitoring of water and fish samples is of significant practical importance for ensuring the safety of seafood.

[0003] Currently, traditional microbial culture methods are time-consuming and labor-intensive, failing to meet the requirements for early detection and diagnosis of Streptococcus agalactiae. PCR and qPCR technologies rely on professional operation and expensive equipment, limiting their application in on-site testing. While recombinase-mediated isothermal amplification (RAA) and loop-mediated isothermal amplification (LAMP) can be performed at isothermal temperatures, they still have drawbacks. For example, LAMP is prone to false-positive contamination. Compared to qPCR, RAA has lower sensitivity, and purification, gel electrophoresis, and other end-detection methods are relatively complex; furthermore, the transfer of amplified products can lead to aerosol contamination.

[0004] The advent of CRISPR / Cas technology has significantly propelled the development of nucleic acid detection technology. Its main principle is that CRISPR RNA (crRNA) guides the Cas12a nuclease to recognize the target sequence, triggering the trans-cleavage activity of Cas12a, which cleaves the adjacent single-stranded DNA probe and emits a signal. CRISPR / Cas technology is often combined with isothermal amplification to improve detection sensitivity. However, transferring isothermal amplification products to a Cas12a detection system can lead to amplification product contamination. Furthermore, most CRISPR / Cas12a studies achieve detection by measuring fluorescence changes, which somewhat limits the technology's application in the field.

[0005] Uracil-DNA glycosyltransferase (UDG) specifically recognizes dU-containing DNA and catalyzes the hydrolysis of the N-glycosidic bonds between uracil bases and the sugar phosphate backbone, without acting on the native DNA template. Therefore, in the amplification reaction, deoxyuridine triphosphate (dUTP) is used instead of deoxythymidine triphosphate (dTTP) to generate amplification products containing dU. Before amplification, UDG specifically acts on these dU-containing amplicons, rendering them incapable of amplification and thus eliminating false positive results caused by aerosol contamination. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for detecting Streptococcus agalactiae using a fluorescent colorimetric dual-mode method without aerosol contamination.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: A method for detecting agalactiae Streptococcus includes the following steps: A method for detecting agalactiae Streptococcus includes the following steps: (1) Bacterial culture and DNA extraction: Streptococcus agalactiae was activated by inoculating it onto Columbia blood agar plates. Single colonies from the plates were then inoculated into BHI liquid medium and cultured until the logarithmic growth phase. The bacterial culture in the logarithmic growth phase was then used to extract DNA using a bacterial genomic DNA extraction kit to obtain a DNA template, which was stored at -20°C for later use. (2) Combined use of UDG and LAMP: Prepare the UDG-LAMP reaction system as follows: 1× reaction buffer, 1 μL MgSO4 (200 mM), 1 μL Bst 2.0 DNA polymerase (8 U / μL), 1.4 μL of 25 mM dNTP, 0.35 μL of 50 mM dUTP, 0.5 μL thermosensitive UDG, 4 μL FIP and BIP (10 μM), 0.5 μL F3 and B3 (10 μM), 5 μL DNA template, HPLC water to a final volume of 25 μL, and finally add 20 μL paraffin oil. After the prepared UDG-LAMP reaction system was placed at room temperature for 5 min, it was incubated at 65℃ for 60 min. When performing UDG-qLAMP detection, 0.1 μL of 50× LAMP fluorescent dye was added to each reaction system to obtain the UDG-qLAMP reaction system. The fluorescence of the system was collected at 65℃ using a LightCycler480Ⅱ instrument. (3) UDG-LAMP-CRISPR fluorescence mode detection system 10 μL of the UDG-LAMP reaction system obtained in step (2) was dispensed into each PCR tube, and 20 μL of paraffin oil was added. After the prepared system was placed at room temperature for 5 min, it was incubated at 65℃ for 60 min. Prepare a CRISPR reaction mixture containing 1× NEBuffer. TM r2.1, 100 nM Cas12a, 200 nMcrRNA, 2 μL ligation probe (10 μM), and water were added to a final volume of 10 µL. This mixture was placed in the cap of a PCR tube containing a 10 μL UDG-LAMP reaction system, centrifuged, and mixed to obtain the UDG-LAMP-CRISPR reaction mixture. The UDG-LAMP-CRISPR reaction mixture was placed in a DHelix-Q5 instrument and reacted at 37°C for 30 min. The instrument recorded the fluorescence signal every 30 s. Only samples containing the target bacteria showed a fluorescence detection curve, indicating a positive result, while other non-agalactia streptococcal samples did not show a fluorescence detection curve, indicating a negative result. (4) Colorimetric mode detection system: The colorimetric platform reaction system consisted of 100 μL containing 20 μL of UDG-LAMP-CRISPR reaction mixture, 200 nM G4-a and G4-b, 1.5 μM heme, and 1× HEPES solution (1× HEPES solution containing 20 mM KCl, 200 mM NaCl, 0.05% Triton X-100, 25 mM HEPES, pH 5.3). The mixture was incubated in the dark at 37°C for 30 min. After incubation, 2 μL of ABTS (2 mM) and 2 μL of 3% H2O2 solution were added, and the results were observed visually. Then, an app on a smartphone was used to analyze the images, reading the G value from the RGB values. A significantly increased G value indicated a positive result.

[0008] In the above-mentioned method for detecting agalactia streptococci, the final concentration of dUTP in step (2) is 0.7 mM.

[0009] In the above-mentioned method for detecting agalactia-negative streptococci, the sequence of F3 is: AGGTATCACCAGCTCCTG; The sequence of B3 is GGTGATGCACCAGTTTCT; The sequence of the FIP is as follows: GATACTGTTGTTGACTGACTGACTGGAAGTCGATTACTTCAGAAGTTC; The sequence of the BIP is: TCCAGTAGCTAAAGTAGCACCGACTTTAACACTTGCCACTCT; The sequence of the crRNA is as follows: UAAUUUCUACUAAGGUAGUAGAUAGCGGCAACAGAAGCUGGUG; The sequence of the connection probes is as follows: FAM-ACTGGAGTGTCGTTATTCAGTCTCGTTGG-BHQ1; The sequence of G4-a is: CCAACGAGACTGTGGGTGGG; The sequence of G4-b is: GGGTGGGTCGACACTCCAGT.

[0010] Compared with the prior art, the present invention has the following beneficial effects: Considering the complexity of detection environments and the diversity of application scenarios, this patent innovatively combines UDG, LAMP, CRISPR, and G4, introducing a ligation probe to achieve a dual-mode detection system based on fluorescence and colorimetry. The two detection modes of this platform can be freely separated or combined to meet the needs of different detection environments (e.g., only laboratory fluorescence detection, only on-site visualization detection, or both fluorescence and visualization for cross-validation of results). This method has the following characteristics: 1. By combining the UDG system and LAMP technology, aerosol contamination that may be carried during amplification is avoided. 2. The introduction of a ligation probe combines CRISPR fluorescence detection with G4 colorimetric detection, establishing a detection system with both fluorescence and colorimetric detection methods for quantitative identification and cross-validation of Streptococcus agalactiae. 3. This invention utilizes the ability of UDG enzymes to degrade dU-containing LAMP products, the trans-cleavage activity of the CRISPR system, and the colorimetric properties of G4 to construct a dual-mode detection technology with no aerosol contamination, for rapid screening of Streptococcus agalactiae in various detection scenarios. Attached Figure Description

[0011] Figure 1 Optimize the amount added to dUTP.

[0012] Figure 2 To verify the feasibility of UDG enzyme degradation.

[0013] Figure 3 Feasibility analysis of the CRISPR fluorescence detection system.

[0014] Figure 4 To verify the functionality of the connection probe.

[0015] Figure 5 Feasibility analysis for colorimetric visualization detection.

[0016] Figure 6 The fluorescence detection sensitivity of the UDG-LAMP-CIRSPR-G4 detection system.

[0017] Figure 7 The colorimetric detection sensitivity of the UDG-LAMP-CIRSPR-G4 detection system.

[0018] Figure 8 To enhance the fluorescence detection specificity of the UDG-LAMP-CIRSPR-G4 detection system.

[0019] Figure 9 To determine the colorimetric detection specificity of the UDG-LAMP-CIRSPR-G4 detection system. Detailed Implementation

[0020] Example 1: (1) Microbial culture and DNA extraction Streptococcus agalactiae glycerol agar plates stored at -80 ℃ were streaked onto Columbia blood agar plates and incubated at 37 ℃ for 18-24 h under 5% CO2 conditions. Single colonies from the plates were inoculated into BHI liquid medium, Vibrio strains into liquid 2216E medium, and other strains into LB broth. The cultures were incubated until the logarithmic growth phase. One mL of the logarithmic growth phase culture was used to extract DNA using a bacterial genomic DNA extraction kit and stored at -20 ℃ for later use.

[0021] (2) Construction of UDG-LAMP method without aerosol pollution The UDG-LAMP reaction system contained 1× reaction buffer, 1 μL MgSO4 (200 mM), 1 μL Bst 2.0 DNA polymerase (8 U / μL), 1.4 μL of 25 mM dNTP, 0.35 μL of 50 mM dUTP, 0.5 μL Heat-labile UDG, 4 μL FIP and BIP (10 μM), 0.5 μL F3 and B3 (10 μM), 5 μL DNA template, and HPLC water to a final volume of 25 μL. Finally, 20 μL of paraffin oil was added. After incubating at room temperature for 5 min, the system was incubated at 65°C for 60 min. For UDG-qLAMP detection, 0.1 μL of 50× LAMP fluorescent dye was added to each reaction system, and fluorescence was collected using a LightCycler 480Ⅱ instrument at 65°C.

[0022] (3) Optimization of dUTP addition amount and verification of the feasibility of UDG enzyme degradation Adjust the amount of dUTP added to the LAMP amplification system individually to determine the optimal amount of dUTP used. For example... Figure 1 As shown, when dUTP completely replaces dTTP in the LAMP amplification system (T / U=0%), LAMP amplification is completely inhibited, as evidenced by a significantly delayed amplification curve compared to the control group (U / T=0%). Therefore, while keeping the dTTP addition amount constant, the dUTP addition amount was varied to explore the optimal addition conditions. When the dUTP / dTTP ratio in the system was 50% and 70%, the peak time of LAMP was slightly delayed. Considering that more dUTP has a greater impact on LAMP amplification, 0.7 mM was chosen as the optimal dUTP incorporation concentration. To verify whether the amplification product generated at this concentration can be degraded by UDG enzyme, under the optimal incorporation ratio conditions obtained above, LAMP amplification products were used as templates and added to the UDG-qLAMP system to simulate carrier contamination. Figure 2 As shown, no obvious amplification curve appeared when the LAMP product doped with dUTP was used as a template, indicating that the established UDG-LAMP system has a good ability to eliminate aerosol contamination.

[0023] (4) UDG-LAMP-CRISPR fluorescence mode detection system 10 μL of UDG-LAMP reaction mixture was aliquoted into each PCR tube, and 20 μL of paraffin oil was added. The mixture was incubated at room temperature for 5 min, then incubated at 65°C for 60 min to obtain 10 µL of LAMP product. The CRISPR reaction mixture contained 1×NEBuffer. TM r2.1, 100 nM Cas12a, 200 nM crRNA, 2 μL ligation probe (10 μM), and water were added to a final volume of 10 μL. This mixture was then placed in the cap of a 10 μL UDG-LAMP reaction tube and centrifuged to mix. The UDG-LAMP-CRISPR reaction system was placed in a DHelix-Q5 instrument and reacted at 37°C for 30 min. The instrument recorded the fluorescence signal every 30 s.

[0024] (5) Colorimetric mode detection system: The colorimetric platform reaction system consisted of 100 μL containing 20 μL of UDG-LAMP-CRISPR reaction mixture, 200 nM G4-a and G4-b, 1.5 μM heme, and 1× HEPES solution (1× HEPES solution containing 20 mM KCl, 200 mM NaCl, 0.05% Triton X-100, 25 mM HEPES, pH 5.3). The mixture was incubated in the dark at 37°C for 30 min. After incubation, 2 μL of ABTS (2 mM) and 2 μL of 3% H2O2 solution were added, and the results were observed visually. Then, an app on a smartphone was used to analyze the images and read the G value from the RGB values.

[0025] (6) Feasibility and correlation analysis of fluorescence-colorimetric dual-mode detection To investigate the impact of key components of the CRISPR system on fluorescence detection and whether linking probes can serve as functional linkers for fluorescence and colorimetric modes, we conducted component absence verification. For example... Figure 3 As shown, a clear fluorescence curve appears only when the target DNA is present and the CRISPR system is intact, indicating that the ligation probe can serve as an indicator probe for fluorescence detection in the CRISPR system. Figure 4 As shown, the solution changes from colorless to green and a colorimetric reaction only occurs when the linker probe is present and intact. These results demonstrate that the linker probe in this patent can serve as a functional linker, combining fluorescence detection with colorimetric detection to establish a dual-mode detection system for Streptococcus agalactiae.

[0026] (7) Feasibility analysis of colorimetric visualization When the ligation probe is intact, it can polymerize two split G4 fragments to form a complete G4 structure. After binding with heme, G4 becomes a DNAzyme with peroxidase-like activity, capable of catalyzing the color change of ABTS solution from colorless to green in the presence of H2O2. This patent further explores the feasibility of color visualization, such as... Figure 5 As shown, only when G4-a and G4-b (two split G4 fragments) assemble into a complete G4 structure with the assistance of the connecting probe can they bind to heme, exhibiting the highest catalytic activity and causing a significant color change in the solution. When other components are present, there is no significant color change in the solution.

[0027] (8) Sensitivity detection: DNA was extracted from *Streptococcus agalactiae* strains, and the DNA concentration was determined using nanodrop. The DNA was then serially diluted 10-fold to obtain a concentration of 6.85 × 10⁻⁶. 5 copies / μL - 6.85×101 DNA samples of copies / μL were used for LAMP amplification. Fluorescence detection results are as follows: Figure 6 As shown, when the bacterial DNA concentration is 6.85 × 10⁻⁶... 2 At concentrations of copies / μL and above, fluorescence detection showed a clear detection curve. As the concentration decreased, the fluorescence pattern showed a clearer curve at 6.85 × 10⁻⁶. 1 copies / μL - 6.85×10 2 No fluorescence curve appeared between copies / μL; therefore, the detection limit for Streptococcus agalactiae based on the dual-mode detection technology is approximately 6.85 × 10⁻⁶. 2 copies / μL. For colorimetric detection results, as shown... Figure 7 As shown in the figure, it can be clearly seen that when the template concentration reaches 6.85×10 2 When the number of copies / μL or higher is reached, the G value increases significantly, indicating a positive result. Therefore, the detection limit for Streptococcus agalactiae based on the colorimetric mode of dual-mode detection technology is also 6.85 × 10⁻⁶. 2 copies / μL.

[0028] (9) Specific detection Genomic DNA was extracted from each of the bacteria listed in Table 2, and quantitative detection was performed using a dual-mode detection method under optimal detection conditions to verify the specificity of the established method. Figure 8 As shown, in fluorescence detection mode, only samples containing the target bacteria showed fluorescence detection curves, while other non-target bacteria (non-agalactia streptococci) did not show fluorescence detection curves, resulting in negative results. The colorimetric mode detection results are consistent with the fluorescence mode results, as shown... Figure 9 As shown, only the sample solution containing *Streptococcus agalactiae* did not produce a significant colorimetric change, while all other non-target bacteria samples showed colorimetric changes, with values ​​comparable to the negative control (G value). Therefore, the aerosol-free "fluorescence-colorimetric" dual-mode detection method established in this patent exhibits good specificity.

[0029] Table 1. Primer sequences used in this patent

[0030] Table 2. Specific results of this patent using strains .

Claims

1. A method for detecting agalactiae (Streptococcus agalactiae), characterized in that... Includes the following steps: (1) Bacterial culture and DNA extraction: Streptococcus agalactiae was activated by inoculating it onto Columbia blood agar plates. Single colonies from the plates were then inoculated into BHI liquid medium and cultured until the logarithmic growth phase. The bacterial culture in the logarithmic growth phase was then used to extract DNA using a bacterial genomic DNA extraction kit to obtain a DNA template, which was stored at -20°C for later use. (2) Combined use of UDG and LAMP: Prepare the UDG-LAMP reaction system as follows: 1× reaction buffer, 1 μL MgSO4 (200 mM), 1 μL Bst 2.0 DNA polymerase (8 U / μL), 1.4 μL of 25 mM dNTP, 0.35 μL of 50 mM dUTP, 0.5 μL thermosensitive UDG, 4 μL LFIP and BIP (10 μM), 0.5 μL F3 and B3 (10 μM), 5 μL DNA template, HPLC water to a final volume of 25 μL, and finally add 20 μL paraffin oil. After the prepared UDG-LAMP reaction system was placed at room temperature for 5 min, it was incubated at 65℃ for 60 min. When performing UDG-qLAMP detection, 0.1 μL of 50× LAMP fluorescent dye was added to each reaction system to obtain the UDG-qLAMP reaction system. The fluorescence of the system was collected at 65℃ using a LightCycler480Ⅱ instrument. (3) UDG-LAMP-CRISPR fluorescence mode detection system 10 μL of the UDG-LAMP reaction system obtained in step (2) was dispensed into each PCR tube, and 20 μL of paraffin oil was added. After the prepared system was placed at room temperature for 5 min, it was incubated at 65℃ for 60 min. Prepare a CRISPR reaction mixture containing 1× NEBuffer. TM r2.1, 100 nM Cas12a, 200 nM crRNA, 2 μL ligation probe (10 μM), and water were added to a final volume of 10 μL. This mixture was placed in the cap of a PCR tube containing a 10 μL UDG-LAMP reaction system, centrifuged, and mixed to obtain the UDG-LAMP-CRISPR reaction mixture. The UDG-LAMP-CRISPR reaction mixture was placed in a DHelix-Q5 instrument and reacted at 37°C for 30 min. The instrument recorded the fluorescence signal every 30 s. Only samples containing the target bacteria showed a fluorescence detection curve, indicating a positive result, while other non-agalactia streptococcal samples did not show a fluorescence detection curve, indicating a negative result. (4) Colorimetric mode detection system: The colorimetric platform reaction system consisted of 100 μL containing 20 μL of UDG-LAMP-CRISPR reaction mixture, 200 nM G4-a and G4-b, 1.5 μM heme, and 1× HEPES solution (1× HEPES solution containing 20 mM KCl, 200 mM NaCl, 0.05% Triton X-100, 25 mM HEPES, pH 5.3). The mixture was incubated in the dark at 37°C for 30 min. After incubation, 2 μL of ABTS (2 mM) and 2 μL of 3% H2O2 solution were added, and the results were observed visually. Then, an app on a smartphone was used to analyze the images, reading the G value from the RGB values. A significantly increased G value indicated a positive result.

2. The method for detecting agalactia-negative streptococci as described in claim 1, characterized in that, The final concentration of dUTP in step (2) is 0.7 mM.

3. The method for detecting agalactia-negative streptococci as described in claim 1, characterized in that, The sequence of F3 is: AGGTATCACCAGCTCCTG; The sequence of B3 is GGTGATGCACCAGTTTCT; The sequence of the FIP is as follows: GATACTGTTGTTGACTGACTGACTGGAAGTCGATTACTTCAGAAGTTC; The sequence of the BIP is: TCCAGTAGCTAAAGTAGCACCGACTTTAACACTTGCCACTCT; The sequence of the crRNA is as follows: UAAUUUCUACUAAGGUAGUAGAUAGCGGCAACAGAAGCUGGUG; The sequence of the connection probes is as follows: FAM-ACTGGAGTGTCGTTATTCAGTCTCGTTGG-BHQ1; The sequence of G4-a is: CCAACGAGACTGTGGGTGGG; The sequence of G4-b is: GGGTGGGTCGACACTCCAGT.

Images