Edible medium composition having excellent cell proliferation activity

Abstract

The present application relates to a kind of edible culture medium compositions with excellent cell proliferation activity, the edible culture medium compositions according to the present application have the effect of improving cell proliferation activity, inhibiting cell aging.In addition, since the edible culture medium of the present application is entirely composed of human edible raw materials, it can be effectively used as a culture medium for cell culture food, and the cells cultured in the edible culture medium compositions of the present application have the advantages of higher food stability and lower price compared to cells cultured in traditional culture medium.

Description

Technical Field

[0001] This invention relates to an edible culture medium composition with excellent cell proliferation activity. Background Technology

[0002] According to a report by the Food and Agriculture Organization of the United Nations (FAO), the world's population is projected to increase from 7.6 billion in 2018 to 9.5 billion in 2050. However, due to abnormal climate conditions such as global warming, crop yields are expected to decrease, while the demand for feed grains is increasing, leading to higher production costs and reduced production area. As a result, livestock products, which are considered a food resource, are expected to become high-priced foods.

[0003] While animal-derived foods such as livestock products have higher energy and production costs, they have consistently made a direct contribution to human nutritional security because they are the best source of high-quality protein and micronutrients essential for normal human growth and health. Essential amino acids, in particular, are nutrients that the body cannot synthesize or can only synthesize in very small quantities, and must be obtained through food. Given that the projected demand for animal-derived foods will reach 550 million tons by 2050, double the current level, traditional livestock product production methods have limitations in meeting the protein needs for essential amino acids.

[0004] On the other hand, cell-cultured food products are one of the alternative food products that many companies around the world are focusing on developing to address public health, environmental and animal welfare issues related to animal husbandry and agriculture.

[0005] Currently, the culture media used for cell culture foods are highly refined or purified growth media, which are essential components that help plant or animal cell proliferation. This method is similar to the biotechnology used in pharmaceutical preparation.

[0006] That is, because the culture media used to culture cell culture foods use expensive and energy-intensive pharmaceutical-grade materials and processes, more resources are needed to refine the components contained in the culture media, which suggests that cell culture foods may inherently have a more adverse impact on the environment.

[0007] Therefore, there is a need to develop an edible culture medium that can reduce environmental impact in the future and improve performance while lowering the cost of cell culture media. Summary of the Invention

[0008] Technical issues The purpose of this invention is to provide an edible culture medium composition with excellent cell proliferation activity.

[0009] Furthermore, another object of the present invention is to provide a food composition comprising cells or cultures thereof cultured in the said edible culture medium composition.

[0010] Furthermore, another object of the present invention is to provide a method for preparing cell culture food using the aforementioned edible culture medium composition.

[0011] Furthermore, another object of the present invention is to provide a method for increasing the proliferative activity of cells.

[0012] Furthermore, another object of the present invention is to provide a method for inhibiting cell aging.

[0013] Problem-solving methods To achieve the above objectives, the present invention provides an edible culture medium composition with excellent cell proliferation activity, comprising: one or more amino acids selected from the group consisting of glycine, arginine, cystine, glutamine, histidine, isoleucine, leucine, lysine hydrochloride, methionine, phenylalanine, serine, threonine, tryptophan, tyrosine, and valine; and choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride. One or more vitamins selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.

[0014] Next, the present invention provides a food composition comprising cells or cultures thereof cultured in the said edible culture medium composition.

[0015] Next, the present invention provides a method for preparing cell cultured food, comprising: culturing animal cells, plant cells or microbial cells in an edible culture medium composition according to the present invention; and recovering the cultured cells or their cultures.

[0016] Next, the present invention provides a method for increasing cell proliferation activity, comprising: adding one or more amino acids selected from the group consisting of glycine, arginine, cystine, glutamine, histidine, isoleucine, leucine, lysine hydrochloride, methionine, phenylalanine, serine, threonine, tryptophan, tyrosine, and valine; and selecting choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, and pyridoxine. The steps of culturing in a culture medium composition consisting of one or more vitamins selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate; and a culture medium composition consisting of one or more inorganic salts selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.

[0017] Furthermore, the present invention provides a method for inhibiting cellular aging, comprising: incorporating into cells one or more amino acids selected from the group consisting of glycine, arginine, cystine, glutamine, histidine, isoleucine, leucine, lysine hydrochloride, methionine, phenylalanine, serine, threonine, tryptophan, tyrosine, and valine; and selecting from choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, and pyridoxine. The steps of culturing in a culture medium composition consisting of one or more vitamins selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate; and a culture medium composition consisting of one or more inorganic salts selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.

[0018] Invention Effects The edible culture medium composition according to the present invention has the effects of improving cell proliferation activity and inhibiting cell senescence. Furthermore, since the edible culture medium of the present invention is composed entirely of human-edible raw materials, it can be effectively used as a culture medium for food cell culture. Cells cultured in the edible culture medium composition of the present invention have the advantages of higher food stability and lower cost compared to cells cultured in conventional culture media. Attached Figure Description

[0019] Figure 1 This is a diagram that briefly illustrates the process of making the culture medium edible in one embodiment of the present invention.

[0020] Figure 2This is a diagram illustrating the morphological comparison results of bovine adipose stem cells based on culture medium in one embodiment of the present invention.

[0021] Figure 3 This is a graph illustrating the results of a comparison of the cell proliferation capacity of P3 adipose-derived stem cells in a culture medium, as shown in one embodiment of the present invention.

[0022] Figure 4 This is a graph illustrating the results of a comparison of the cell proliferation capacity of P4 adipose-derived stem cells in a culture medium, as shown in one embodiment of the present invention.

[0023] Figure 5 This is a graph illustrating the results of comparing cell senescence levels after long-term culture of adipose-derived stem cells in a culture medium, according to one embodiment of the present invention.

[0024] Figure 6 This is a graph illustrating the results of comparing the expression levels of markers for adipose-derived stem cells and mesenchymal stem cells based on culture medium in one embodiment of the present invention. Detailed Implementation

[0025] Hereinafter, the present invention will be described in detail with reference to the accompanying drawings and specific embodiments thereof. However, the following specific embodiments are merely examples of the present invention, and detailed descriptions of well-known technologies or structures may be omitted where it is determined that such detailed descriptions would unnecessarily obscure the spirit of the present invention, and the present invention is not limited thereto. The present invention can be modified and applied in various ways within the scope of the claims described below and as interpreted therein.

[0026] Furthermore, the terminology used in this specification is for the proper expression of preferred embodiments of the invention and may vary depending on the intent of the user, operator, or convention in the field to which this invention pertains. Therefore, the definition of these terms should be based on the entire contents of this specification. Throughout this specification, when a portion "includes" a constituent element, unless otherwise stated, it does not exclude other constituent elements, but rather implies that other constituent elements may also be included.

[0027] Throughout the instruction manual, the percentage used to indicate the concentration of a specific substance is as follows, unless otherwise specified: solid / solid is (w / w)%, solid / liquid is (w / v)%, and liquid / liquid is (v / v)%.

[0028] The present invention will now be described in more detail.

[0029] In one aspect, the present invention relates to an edible culture medium composition with excellent cell proliferation activity, comprising: one or more amino acids selected from the group consisting of glycine, arginine, cystine, glutamine, histidine, isoleucine, leucine, lysine hydrochloride, methionine, phenylalanine, serine, threonine, tryptophan, tyrosine, and valine; and choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, and pyridoxine. One or more vitamins selected from the group consisting of Calcium Chloride, Ferrous Sulfate, Magnesium Sulfate, Potassium Chloride, Sodium Bicarbonate, Salt, and Sodium Dihydrogen Phosphate; and one or more inorganic salts selected from the group consisting of Calcium Chloride, Ferrous Sulfate, Magnesium Sulfate, Potassium Chloride, Sodium Bicarbonate, Salt, and Sodium Dihydrogen Phosphate.

[0030] In one embodiment of the invention, the arginine can replace arginine monohydrochloride, which is toxic when ingested orally.

[0031] In one embodiment of the present invention, the cystine can be used as a substitute for cystine dihydrochloride, which may cause burns to the digestive and respiratory systems when taken orally.

[0032] In one embodiment of the invention, the tyrosine can replace tyrosine disodium salt dihydrate, which is toxic when orally ingested.

[0033] In one embodiment of the invention, the ferrous sulfate can replace iron(III) nitrate nonahydrate, which is toxic when ingested orally.

[0034] In one embodiment of the invention, the edible culture medium composition may further contain a carbon source, but is not limited thereto.

[0035] Furthermore, the carbon source can be glucose, fructose, mannose, ribose, xylose, sucrose, melibiose, cellobiose, lactose, amylose, carbohydrates, raffinose, sorbitol, mannitol, glycerol, etc., as long as it is a substance known in the technical field of this invention as a carbon source for cell energy in culture media, and can be used without restriction.

[0036] In one embodiment of the present invention, the edible culture medium composition may comprise: glycine 0.0255 to 0.0345 g / L, L-arginine 0.0589 to 0.0798 g / L, L-cysteine ​​0.041 to 0.0556 g / L, L-glutamine 0.4964 to 0.6716 g / L, L-histidine 0.0263 to 0.0357 g / L, L-isoleucine 0.0892 to 0.1208 g / L, L-leucine 0.0892 to 0.1208 g / L, L-lysine hydrochloride 0.1241 to 0.1679 g / L, L-methionine 0.0255 to 0.0345 g / L, and L-phenylalanine 0.0561 to 0.075 g / L. 9 g / L, L-serine 0.0357 to 0.0483 g / L, L-threonine 0.0807 to 0.1093 g / L, L-tryptophan 0.0136 to 0.0184 g / L, L-tyrosine 0.0612 to 0.0829 g / L, L-valine 0.0799 to 0.1081 g / L, choline chloride 0.0034 to 0.0046 g / L, calcium pantothenate 0.0034 to 0.0046 g / L, folic acid 0.0034 to 0.0046 g / L, inositol 0.0061 to 0.0083 g / L, nicotinamide 0.0034 to 0.0046 g / L, vitamin B6 hydrochloride 0.0034 to 0.0046 g / L, vitamin B2 0.0003 to 0.0005 g / L, vitamin B1 hydrochloride 0.0034 to 0.0046 g / L, calcium chloride 0.17 to 0.23 g / L, ferrous sulfate 0.0003 to 0.0005 g / L, magnesium sulfate 0.083 to 0.1124 g / L, potassium chloride 0.34 to 0.46 g / L, sodium bicarbonate 3.145 to 4.255 g / L, salt 5.44 to 7.36 g / L, sodium dihydrogen phosphate 0.1062 to 0.1438 g / L, and anhydrous crystalline glucose 3.825 to 5.175 g / L.

[0037] More preferably, the edible culture medium composition may comprise: glycine 0.026 to 0.032 g / L, L-arginine 0.06 to 0.07 g / L, L-cysteine ​​0.045 to 0.05 g / L, L-glutamine 0.5 to 0.6 g / L, L-histidine 0.027 to 0.032 g / L, L-isoleucine 0.09 to 0.110 g / L, L-leucine 0.09 to 0.110 g / L, L-lysine hydrochloride 0.14 to 0.15 g / L, L-methionine 0.028 to 0.032 g / L, L-phenylalanine 0.06 to 0.07 g / L, and L-serine 0. 0.035 to 0.045 g / L, L-threonine 0.09 to 0.1 g / L, L-tryptophan 0.015 to 0.017 g / L, L-tyrosine 0.07 to 0.08 g / L, L-valine 0.085 to 0.1 g / L, choline chloride 0.0038 to 0.0042 g / L, calcium pantothenate 0.0038 to 0.0042 g / L, folic acid 0.0038 to 0.0042 g / L, inositol 0.0065 to 0.0075 g / L, nicotinamide 0.0035 to 0.0042 g / L, vitamin B6 hydrochloride 0.0038 to 0.0045 g / L, vitamin B2 0.00038 to 0.00042 g / L, vitamin B1 hydrochloride 0.0038 to 0.0042 g / L, calcium chloride 0.19 to 0.22 g / L, ferrous sulfate 0.0004 to 0.00043 g / L, magnesium sulfate 0.09 to 0.1 g / L, potassium chloride 0.38 to 0.45 g / L, sodium bicarbonate 3.5 to 3.8 g / L, salt 6 to 6.6 g / L, sodium dihydrogen phosphate 0.11 to 0.13 g / L, and anhydrous crystalline glucose 4 to 4.6 g / L.

[0038] In one embodiment of the present invention, the edible culture medium composition can improve cell proliferation activity and inhibit cell senescence, but is not limited thereto.

[0039] In one embodiment of the present invention, the edible culture medium composition can be used to culture cell culture foods.

[0040] The term "cell-cultured food" as used in this invention refers to food produced or cultured using cells. Examples of cell-cultured foods include cell-cultured meat substitutes, proliferated lactic acid bacteria, cell-cultured protein substitutes, etc.

[0041] In one embodiment of the present invention, the cell cultured food may be cultured meat, fungal-based alternative meat, or algae-based alternative meat, but is not limited thereto.

[0042] The term "cultured meat" as used in this invention refers to meat substitutes produced using cell culture technology, and is a product obtained through the process of growing tissues or muscles using animal cells.

[0043] The term "fungus-based meat substitute" as used in this invention refers to meat substitutes produced by culturing fungi, utilizing fungal cells or mycelia, and obtained through cell culture technology or fermentation processes.

[0044] The term "algae-based meat alternative" as used in this invention refers to meat alternatives produced by cultivating microalgae (e.g., Chlorella and Spirulina), which are known to have much higher growth rates, higher protein content, and superior nutritional quality compared to terrestrial crops used as plant protein.

[0045] In one aspect, the present invention relates to a food composition comprising cells or cultures thereof cultured in the said edible culture medium composition.

[0046] In one embodiment of the present invention, the cell may be an animal cell, a plant cell, or a microbial cell, but is not limited thereto.

[0047] In the embodiments of the present invention, it was confirmed that when adipose-derived stem cells were cultured using the culture medium composition according to the present invention, the cell proliferation activity was significantly superior compared to DMEM.

[0048] The term "culture" as used in this invention refers to the product obtained after culturing cells, including both morphologies containing cultured cells and morphologies in which cultured cells have been removed.

[0049] In one aspect, the present invention relates to a method for preparing cell-cultured food, comprising: culturing animal cells, plant cells or microbial cells in the edible culture medium composition of claim 1; and recovering the cultured cells or their cultures.

[0050] The term "culture" as used in this specification can be performed according to cell culture methods commonly used in the technical field to which this invention pertains.

[0051] Furthermore, the cell culture in this invention can be carried out using various methods established in industrial biotechnology, such as various fermentation methods established in industrial biotechnology. Continuous and non-continuous cell culture methods can be performed using the edible culture medium composition according to the invention. Other known reactor technologies, such as perfusion technology, can also be used. A batch method is a preferred embodiment.

[0052] Batch cell culture includes fed-batch culture or simple batch culture. The term "fed-batch cell culture" refers to a cell culture in which mammalian cells and cell culture medium are initially supplied to the culture vessel, and supplemental culture nutrients are continuously or discontinuously added to the culture during the culture process, with periodic or non-harvesting of cells and / or products before the end of the culture. The term "simple batch culture" refers to a procedure in which all components required for cell culture, including mammalian cells and cell culture medium, are supplied to the culture vessel at the beginning of the culture process.

[0053] According to a preferred embodiment of the invention, the culture is supplied using a fed-batch method. This supply is beneficial for replenishing culture medium components and nutrients that are depleted in the culture medium during the culture process. Typically, the supply solution contains amino acids, one or more carbohydrates as an energy source, trace elements, vitamins, or specific ions. The supply solution is added according to the needs of the cells, which are based on a predetermined schedule determined for a specific cell line or cell clone and product, or determined during the culture process. Using a concentrated supply solution is particularly advantageous to prevent significant volume increases and culture medium dilution. In some embodiments, having two or more different supply solutions may also be useful. This allows for the independent application of two or more different groups of nutrients and components to the cells, thereby enabling better regulation of the supply conditions for optimal supply of specific nutrients.

[0054] In one aspect, the present invention relates to a method for increasing cell proliferation activity, comprising: ingesting cells containing one or more amino acids selected from the group consisting of glycine, arginine, cystine, glutamine, histidine, isoleucine, leucine, lysine hydrochloride, methionine, phenylalanine, serine, threonine, tryptophan, tyrosine, and valine; and selecting choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, and pyridoxine. The steps of culturing in a culture medium composition consisting of one or more vitamins selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate; and a culture medium composition consisting of one or more inorganic salts selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.

[0055] In one aspect, the present invention relates to a method for inhibiting cellular senescence, comprising: ingesting cells containing one or more amino acids selected from the group consisting of glycine, arginine, cystine, glutamine, histidine, isoleucine, leucine, lysine hydrochloride, methionine, phenylalanine, serine, threonine, tryptophan, tyrosine, and valine; and selecting choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, and pyridoxine. The steps of culturing in a culture medium composition consisting of one or more vitamins selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate; and a culture medium composition consisting of one or more inorganic salts selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.

[0056] In one embodiment of the present invention, the culture medium composition may comprise: glycine 0.0255 to 0.0345 g / L, L-arginine 0.0589 to 0.0798 g / L, L-cysteine ​​0.041 to 0.0556 g / L, L-glutamine 0.4964 to 0.6716 g / L, L-histidine 0.0263 to 0.0357 g / L, L-isoleucine 0.0892 to 0.1208 g / L, L-leucine 0.0892 to 0.1208 g / L, L-lysine hydrochloride 0.1241 to 0.1679 g / L, L-methionine 0.0255 to 0.0345 g / L, and L-phenylalanine 0.0561 to 0.0759 g / L. g / L, L-serine 0.0357 to 0.0483 g / L, L-threonine 0.0807 to 0.1093 g / L, L-tryptophan 0.0136 to 0.0184 g / L, L-tyrosine 0.0612 to 0.0829 g / L, L-valine 0.0799 to 0.1081 g / L, choline chloride 0.0034 to 0.0046 g / L, calcium pantothenate 0.0034 to 0.0046 g / L, folic acid 0.0034 to 0.0046 g / L, inositol 0.0061 to 0.0083 g / L, nicotinamide 0.0034 to 0.0046 g / L, vitamin B6 hydrochloride 0.0034 to 0.0046 g / L, vitamin B2 0.0003 to 0.0005 g / L, vitamin B1 hydrochloride 0.0034 to 0.0046 g / L, calcium chloride 0.17 to 0.23 g / L, ferrous sulfate 0.0003 to 0.0005 g / L, magnesium sulfate 0.083 to 0.1124 g / L, potassium chloride 0.34 to 0.46 g / L, sodium bicarbonate 3.145 to 4.255 g / L, salt 5.44 to 7.36 g / L, sodium dihydrogen phosphate 0.1062 to 0.1438 g / L, and anhydrous crystalline glucose 3.825 to 5.175 g / L.

[0057] More preferably, the culture medium composition may comprise: glycine 0.026 to 0.032 g / L, L-arginine 0.06 to 0.07 g / L, L-cysteine ​​0.045 to 0.05 g / L, L-glutamine 0.5 to 0.6 g / L, L-histidine 0.027 to 0.032 g / L, L-isoleucine 0.09 to 0.110 g / L, L-leucine 0.09 to 0.110 g / L, L-lysine hydrochloride 0.14 to 0.15 g / L, L-methionine 0.028 to 0.032 g / L, L-phenylalanine 0.06 to 0.07 g / L, and L-serine 0. 0.035 to 0.045 g / L, L-threonine 0.09 to 0.1 g / L, L-tryptophan 0.015 to 0.017 g / L, L-tyrosine 0.07 to 0.08 g / L, L-valine 0.085 to 0.1 g / L, choline chloride 0.0038 to 0.0042 g / L, calcium pantothenate 0.0038 to 0.0042 g / L, folic acid 0.0038 to 0.0042 g / L, inositol 0.0065 to 0.0075 g / L, nicotinamide 0.0035 to 0.0042 g / L, vitamin B6 hydrochloride 0.0038 to 0.0045 g / L, vitamin B2 0.00038 to 0.00042 g / L, vitamin B1 hydrochloride 0.0038 to 0.0042 g / L, calcium chloride 0.19 to 0.22 g / L, ferrous sulfate 0.0004 to 0.00043 g / L, magnesium sulfate 0.09 to 0.1 g / L, potassium chloride 0.38 to 0.45 g / L, sodium bicarbonate 3.5 to 3.8 g / L, salt 6 to 6.6 g / L, sodium dihydrogen phosphate 0.11 to 0.13 g / L, and anhydrous crystalline glucose 4 to 4.6 g / L.

[0058] In one embodiment of the invention, the culture medium composition may further contain a carbon source, but is not limited thereto.

[0059] Furthermore, the carbon source can be glucose, fructose, mannose, ribose, xylose, sucrose, melibiose, cellobiose, lactose, amylose, carbohydrates, raffinose, sorbitol, mannitol, glycerol, etc., as long as it is a substance known in the technical field of this invention as a carbon source contained in a culture medium and used as a source of energy for cells, it can be used without restriction.

[0060] In one embodiment of the present invention, the cell may be an animal cell, a plant cell, or a microbial cell, but is not limited thereto.

[0061] Hereinafter, embodiments of the present invention will be described in more detail with reference to the accompanying drawings. However, the following embodiments are only used to illustrate the content of the present invention, and the present invention is not limited thereto.

[0062] <Preparation Example> Isolation of Adipose-Derived Mesenchymal Stem Cells 2.2g of subcutaneous fat was isolated from bovine skin and thoroughly washed with DPBS (Gibco) to remove blood. The tissue was chopping using forceps / scissors, and collagenase (sigma) was added followed by shaking at 37°C. When the tissue was completely decomposed and single cells were visible, an equal volume of FBS was added to terminate the enzymatic reaction. To separate any undecomposed tissue, the tissue decomposition products were filtered through a 100μm nylon mesh, followed by a second filtration through a 70μm mesh to obtain only single cells. After centrifugation (1500rpm, 5 minutes), the cells were washed with 1×DPBS to obtain a cell pellet of autologous adipose-derived stem cells (SVF), which was then cultured in a culture flask (FALCON).

[0063] <Example 1> Development of Edible Culture Medium Reference Figure 1 Based on the commercially available basal media (Gibco) sold as cell culture medium, an edible culture medium was developed by replacing the inedible components with edible ones.

[0064] The components of existing basal media for cell culture are publicly available. However, since each component is composed of reagents developed for research purposes, there is a problem that cells cultured in these media cannot be directly applied to food. Therefore, to prepare an edible culture medium, it is proposed to replace the inedible components with edible components based on the composition of the aforementioned basal media. Some of these components are unusable because they were not originally developed for food. For these components, similar edible components were sought to prepare the culture medium, and cell proliferation activity was tested.

[0065] Ultimately, the edible culture medium developed in this invention was named SPEM (Simple planet Edible Medium), and its composition is shown in Table 1.

[0066]

[0067] <Experimental Example 1> Morphological Comparison of P2 Generation Bovine Adipose Stem Cells To confirm the cell growth pattern of the edible culture medium prepared in Example 1, passage 2 (P2) bovine adipose tissue stem cells were seeded in the edible culture medium (SPEM) or DMEM (Dulbecco's Modified Eagle Medium, Gibco) of Example 1, and cell adhesion, proliferation rate, and morphology were observed visually. Each culture medium was prepared by adding FBS (10%, Gibco) + an antibiotic-antimycotic solution (1%, Sigma) to DMEM or edible media. To observe adhesion, the two conditions were compared on day 1 after seeding, and the proliferation rate was compared over 3-4 days. On day 1 after seeding, the cells showed RUO-level adhesion, and the proliferation rates were similar. When the cells reached 90% confluence, trypsin EDTA (Welgene) was treated, incubated at 37°C for 2 minutes, and then FBS was added to inhibit the enzyme reaction. Detached cells were collected in 15 ml centrifuge tubes and centrifuged (1500 rpm, 5 min) to obtain cells, which were then washed once with DPBS. After obtaining the cell pellet (Pellet), the total cell count was confirmed by staining with trypan blue and counting only viable cells.

[0068] The results are as follows Figure 2 As shown, in the culture of adipose-derived mesenchymal stem cells, when comparing cell adhesion, proliferation, and morphology in existing DMEM and the edible culture medium of Example 1, the initial cell adhesion and proliferation showed a similar pattern to the existing culture medium, but it was confirmed that the cells cultured in the edible culture medium of Example 1 maintained a smaller size than the cells cultured in DMEM.

[0069] <Experimental Example 2> Comparison of the Proliferative Capacity of P3 Generation Bovine Adipose-Derived Stem Cells To confirm the cell proliferation capacity of the edible culture medium prepared in Example 1 above, passage 3 (P3) bovine adipose tissue stem cells were passaged and cultured, and then 3 × 10⁶ cells were seeded in each 100 mm culture dish (falcon). 5The cells were cultured in SPEM (Dietary Medium) or DMEM (Dulbecco's Modified Eagle Medium, Gibco) as described in Example 1. The morphology and size of the cells were observed with the naked eye, and the number of cells was counted in the same way as in Experiment 1 above. The population doubling time (PDT) was measured.

[0070] The results of culturing P3 generation adipose-derived stem cells, such as Figure 3 As shown, during culture, the cells in the DMEM group were longer, with some senescent cells visible, while the cells in the SPEM (storage medium) group of Example 1 were smaller and exhibited faster proliferation. Furthermore, cell counting results showed that the DMEM group had a cell size of 9.9 × 10⁻⁶. 5 The food culture medium (SPEM) for Example 1 was 1.26 × 10⁻⁶. 6 Compared to DMEM, approximately 27% more cells were observed in SPEM, and PDT was measured at a lower level in SPEM.

[0071] In terms of stem cell characteristics, small size and rapid proliferation are evaluated as high activity. Therefore, it is confirmed that stem cells cultured in the edible culture medium developed in this invention maintain high activity.

[0072] <Experimental Example 3> Comparison of the Proliferative Capacity of P4 Generation Bovine Adipose-Derived Stem Cells To confirm the cell proliferation capacity of the edible culture medium prepared in Example 1 above, passage 4 (P4) bovine adipose tissue stem cells were cultured at a rate of 2 × 10⁻⁶. 5 Cells were inoculated into 100 mm plates and cultured in SPEM (Dulbecco's Modified Eagle Medium, Gibco) or DMEM (Dulbecco's Modified Eagle Medium, Gibco) as described in Example 1. Cell morphology and size were then observed visually, and cell numbers were counted using the same method as in Example 1 to determine PDT (Population doubling time).

[0073] The results of culturing P4 generation adipose-derived stem cells, such as Figure 4 As shown, the cells in the DMEM group were longer during culture, with some senescent cells visible, while the cells in the SPEM group of Example 1 were smaller and exhibited faster proliferation. In particular, in terms of cell yield, the SPEM group of Example 1 yielded 44% more cells during the same culture period, presumably due to fewer senescent cells and lower PDT.

[0074] <Experimental Example 4> Comparison of aging in bovine adipose-derived stem cells Cells cultured in DMEM showed an increase in cell size with increasing passage size, while this phenomenon was almost not observed in the Edible media group. To confirm whether this difference was due to differences in cell senescence rates, staining for cell senescence markers was performed.

[0075] To confirm the degree of senescence of cells cultured in the edible medium prepared in Example 1 above, bovine fat-derived stem cells were cultured for a long period in the edible medium (SPEM) or DMEM (Dulbecco's Modified Eagle Medium, Gibco) of Example 1, and the senescent cells were confirmed by beta-galactosidase assay.

[0076] For staining, cells were prepared at a concentration of 1×10⁻⁶. 5 After seeding into 6-well plates, cells were cultured in each medium until they reached over 90% confluence. The culture medium was then discarded, and the cells were washed with 2 ml of DPBS. 2 ml of 1× Fixing buffer (diluted with deionized H2O, 1:10) was added, and the cells were fixed at room temperature for 10 minutes, followed by washing twice with 2 ml of DPBS. 2 ml of X-gal staining mix was added, and the cells were incubated at 37°C for 12 hours. The number of stained cells was then determined using an optical microscope.

[0077] The result, such as Figure 5 As shown, it was confirmed that the senescence level of cells cultured in the edible culture medium of Example 1 was reduced by approximately 50% compared to that of cells cultured in GM.

[0078] <Experimental Example 5> Comparison of Mesenchymal Stem Cell Marker Expression Bovine adipose stem cells are a type of mesenchymal stem cells. ISCT has designated three markers (CD73, CD90, and CD105) as essential expression markers.

[0079] To confirm whether the adipose-derived stem cells cultured in the edible culture medium prepared in Example 1 maintained stem cell characteristics, P4 generation bovine adipose-derived stem cells were cultured in the edible culture medium (SPEM) or DMEM (Dulbecco's Modified Eagle Medium, Gibco) of Example 1. Using the mRNA of each cell (GM, SPEM) as a template, RT-PCR was performed using primer sets targeting CD73, CD90, and CD105, which are known as markers of mesenchymal stem cells, to determine the mRNA expression levels of the above markers.

[0080] Specifically, after cell seeding, harvest cells in a confluent state, taking 5-10 × 10⁶ cells. 6Add 1 ml of Trizol (15596026, TRIzol™ Reagent, invitrogen) to each centrifuge tube and incubate at room temperature for 5 minutes. Add 0.2 ml of chloroform, mix by inverting, and incubate at room temperature for 5 minutes, then centrifuge at 14,000 × g, 4 °C for 20 minutes. Transfer the colorless, transparent supernatant to a new centrifuge tube, add 0.5 ml of isopropanol, incubate at room temperature for 10 minutes, then centrifuge at 14,000 × g, 4 °C for 10 minutes. Discard the supernatant, add 1 ml of 75% ethanol, centrifuge at 14,000 × g, 4 °C for 5 minutes, discard the supernatant, and leave the tube cap open to dry for 5 to 10 minutes. After dissolving the RNA precipitate in 20 μl of RNase-free water, the absorbance at 260 nm was measured using a micro-spectrophotometer (ND-ONEC, NanoDrop™ One / OneC MicrovolumeUV / VIS Spectrophotometer, Thermo Fisher Scientific) to calculate the RNA concentration. 1 μg of RNA was synthesized using a cDNA synthesis kit (18080051, SuperScript™ III First-Strand Synthesis System, Invitrogen). 1 μl of the synthesized cDNA was mixed with CD90 (Forward: TTTAGCAGGTGTGGTTGCT (Sequence No. 1), Reverse: TTTCACCCGTGTCCCATTTG (Sequence No. 2)), CD73 (Forward: AAGGTTCCTGTGGTCCAGGCCT (Sequence No. 3), Reverse: TGCATTCTCGAAAGCGGCAGGA (Sequence No. 4)), CD105 (Forward: GAGCCTTCGTCTAGACTGCC (Sequence No. 5), Reverse: CTGGCCTAGTGACCCCATTG (Sequence No. 6)) primers and SYBR Green Master mix (A25918, PowerUp™ SYBR™ Green Master Mix, Applied Biosystems™), and the mRNA expression level was confirmed using a PCR instrument (A28572, QuantStudio™ 3 Real-Time PCR System, Applied Biosystems™).

[0081] The result, such as Figure 6As shown, it was confirmed that the cells cultured in the edible culture medium of Example 1 had significantly higher mRNA expression levels of CD73, CD90, and CD105 compared to the cells cultured in GM.

[0082] The above results confirm that when cells are cultured in the edible culture medium developed in this invention, compared with the culture medium used in general, cell proliferation activity can be improved and cell senescence can be inhibited. In addition, since the edible culture medium of this invention is composed of only edible ingredients, it can be effectively used as a culture medium for cell culture food.

[0083] As described above, although specific embodiments of the present invention have been described in detail, those skilled in the art who understand the inventive concept can readily propose other regressive inventions or other embodiments within the scope of the inventive concept by adding, modifying, or deleting other constituent elements. Therefore, the embodiments described above should be understood as exemplary in all respects and not limiting. The scope of the present invention should be defined by the claims described below rather than by the detailed description above, and the meaning and scope of the claims, as well as all modifications or variations derived from their equivalents, should be interpreted as being included within the scope of the present invention.

Claims

1. An edible culture medium composition with excellent cell proliferation activity, wherein, Include: Choose one or more amino acids from the group consisting of glycine, arginine, cysteine, glutamine, histidine, isoleucine, leucine, lysine hydrochloride, methionine, phenylalanine, serine, threonine, tryptophan, tyrosine, and valine. Choose one or more vitamins from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and Select one or more inorganic salts from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.

2. The edible culture medium composition with excellent cell proliferation activity according to claim 1, wherein, The edible culture medium composition also contains a carbon source.

3. The edible culture medium composition with excellent cell proliferation activity according to claim 2, wherein, The carbon source is selected from one or more of the group consisting of glucose, fructose, mannose, ribose, xylose, sucrose, melibiose, cellobiose, lactose, amylose, carbohydrates, raffinose, sorbitol, mannitol, and glycerol.

4. The edible culture medium composition with excellent cell proliferation activity according to claim 1, wherein, The edible culture medium composition enhances cell proliferation activity and inhibits cell senescence.

5. The edible culture medium composition with excellent cell proliferation activity according to claim 1, wherein, The edible culture medium composition is used for culturing cell culture foods.

6. The edible culture medium composition with excellent cell proliferation activity according to claim 5, wherein, The cell-cultured food is cultured meat, fungal-based alternative meat, or algae-based alternative meat.

7. A food composition comprising cells or cultures thereof cultured in the edible culture medium composition of claim 1.

8. The food composition according to claim 7, wherein, The cells are animal cells, plant cells, or microbial cells.

9. A method for preparing cell-cultured food, wherein, include: The step of culturing animal cells, plant cells or microbial cells in the edible culture medium composition of claim 1; as well as The steps for recovering cultured cells or their cultures.

10. A method for increasing cell proliferation activity, wherein, This includes the use of one or more amino acids selected from the group consisting of glycine, arginine, cystine, glutamine, histidine, isoleucine, leucine, lysine hydrochloride, methionine, phenylalanine, serine, threonine, tryptophan, tyrosine, and valine; one or more vitamins selected from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and calcium chloride. The step of culturing in a culture medium composition consisting of one or more inorganic salts from the group consisting of ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.

11. A method for inhibiting cellular senescence, wherein, This includes cells containing one or more amino acids selected from the group consisting of glycine, arginine, cystine, glutamine, histidine, isoleucine, leucine, lysine hydrochloride, methionine, phenylalanine, serine, threonine, tryptophan, tyrosine, and valine. Choose one or more vitamins from the group consisting of choline chloride, calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, and thiamine hydrochloride; and The steps of culturing in a culture medium composition consisting of one or more inorganic salts selected from the group consisting of calcium chloride, ferrous sulfate, magnesium sulfate, potassium chloride, sodium bicarbonate, salt, and sodium dihydrogen phosphate.

Images