Recombinant fungal cells and methods thereof for industrial scale production of lectins
Patent Information
- Application Number
- EP2024746869
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-30
- Filing Date
- 2024-07-01
- Publication Date
- 2026-05-06
AI Technical Summary
Current methods for producing lectins, such as griffithsin, face challenges in scalability and cost-effectiveness, particularly in recombinant expression systems like E. coli, which have low recovery rates and complex processes, while plant-based systems are more economical but limited in production capacity and require sterile conditions, making them unsuitable for large-scale industrial production.
Development of recombinant filamentous fungal cells expressing heterologous lectins, utilizing strong promoters and signal peptides for extracellular secretion, allowing for efficient production and purification of lectins in fermentation broths, thereby overcoming the limitations of existing systems.
The use of recombinant filamentous fungal cells enables cost-effective, high-yield production and recovery of lectins, improving the scalability and economic viability of lectin production for industrial applications.
Smart Images

Figure US2024036329_02012025_PF_FP_ABST
Abstract
Description
NB42133-WO-PCT[2] RECOMBIANT FUNGAL CELLS AND METHODS THEREOF FOR INDUSTRIAL SCALE PRODUCTION OF LECTINS CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit International Application No. PCT / CN2023 / 104906, filed June 30, 2023, which is hereby incorporated by reference in its entirety. FIELD
[0002] The present disclosure is generally related to the fields of microbial cells, molecular biology, fermentation, protein production, protein recovery, protein purification, protein preparations, and the like. Certain aspects of the disclosure are related to the industrial scale production and recovery of lectin proteins, recombinant filamentous fungal cells producing heterologous lectins, compositions and methods for recovering and / or purifying one or more lectins, enhanced purity lectin preparations thereof and the like. REFERENCE TO A SEQUENCE LISTING
[0003] The contents of the electronic submission of the text file Sequence Listing, named “NB42133-WO- PCT_SequenceListing.xml” was created on June 21, 2023, and is 185 KB in size, which is hereby incorporated by reference in its entirety. BACKGROUND
[0004] Lectins are generally defined as carbohydrate binding proteins that can recognize and bind simple or complex carbohydrates in a reversible and highly specific manner, while displaying no catalytic activity (Lagarda-Diaz et al., 2017). Lectin proteins were originally named hemagglutinins, due to their ability to agglutinate red blood cells (and other cells). More recently, lectins such as the red algae (Griffithsia sp.) griffithsin (GRFT) protein, the red algae (Kappaphycus alvarezii) KAA-2 protein, the concanavalin A (ConA) protein from jack-beans, the jacalin protein from jackfruit (A. heterophyllus), the cyanovirin-N (CV-N) protein from cyanobacteria (N. ellipsosporum) and the like, have been evaluated for their anti-viral activities (Whitley et al., 2013).
[0005] For example, PCT Publications WO2005 / 118627 and WO2007 / 064844, describe methods for isolating the native griffithsin (GRFT) lectin from red algae (Griffithsia sp.), cloning the wild-type (grft) gene thereof, generating recombinant polynucleotides thereof, fermenting and producing the same in E. coli host cells, followed by isolating the recombinant His-tagged GRFT protein from the E. coli host, and characterizing its anti-viral activity. PCT Publication No. WO2010 / 01424 generally describes methods of inhibiting a hepatitis C viral infection of a host comprising administering to the host an effective amount of a glycosylation resistant GRFT (variant) protein (or a polypeptide conjugate thereof) in combination withNB42133-WO-PCT[2] another anti-viral protein. For example, as described in this publication, the inventors noted that the anti- viral protein combination of scytovirin (SVN) and griffithsin (GRFT) have (nanomolar) activity against the Hepatitis C virus (HCV).
[0006] U.S. Patent Publication No. US20110263485 describes methods of inhibiting a human immunodeficiency virus (HIV) infection of a host comprising administering to the host an effective amount of a gp120 Griffithsin and a peptide selected from a gp41-binding protein, a CCR5-binding protein, a gp120-binding protein, or another griffithsin, which combinations are potent inhibitors to HIV infection. PCT Publication No. WO2016 / 130628 discloses variant griffithsin proteins having mutations that change the isoelectric point of the GRFT protein, which are reported to alter its solubility in various pH ranges allowing for improved product release. PCT Publication No. WO2019 / 108656 generally describes microbicidal compositions comprising an endosperm extract and an anti-HIV lectin, an anti-HIV antibody, or antigen binding antibody fragment thereof.
[0007] The recombinant production of GRFT in tobacco plants (Nicotiana benthamiana) has been described by O’Keefe et al. (2009), wherein the GRFT accumulates to a level of about 1 gram of recombinant GRFT per kilogram of Nicotiana benthamiana leaf material, when expressed via an infectious tobacco mosaic virus (TMV) based vector. For example, as contemplated in the O’Keefe et al. publication, despite the promise that biologics such as griffithsin have as HIV prophylactics, their practical application as topical microbicides is hampered by high production costs, wherein it is unlikely that any manufacturing system reliant on growth in sterile conditions can be competitive with the price of a male condom, which is necessary if the product is to be available for use by those at risk for sexual transmission of HIV.
[0008] Hirayama et al. (2016) have described the elucidated primary structure of KAA-2 lectin using peptide mapping and complementary DNA (cDNA) cloning and prepared its active recombinants using an E. coli expression system. Gengenbach et al. (2019) have described the transient expression of the mistletoe lectin named “viscumin” (Viscum album) in intact Nicotiana benthamiana plants, and purification of the recombinant viscumin from crude plant extracts by affinity chromatography, wherein the performance and economics of tobacco plant-based process was compared to the corresponding process based on E. coli expression. As summarized by Gengenbach et al., the E. coli process has a low recovery, requires extensive dilution and is complex, whereas the plant-based process included only half the number of steps. According to a direct cost comparison between the two processes performed in the Gengenbach et al. study, the plant expression system was 50% less expensive, in comparison with the native host V. album or the heterologous expression in E. coli host cells.
[0009] Petrova et al. (2016) have described a probiotic Lactobacillus rhamnosus strain (GR-1), documented to survive implantation onto the vaginal epithelium and interfere with urogenital pathogens. As set forth in this publication, a genomic region encoding a protein with homology to lectin-like proteinsNB42133-WO-PCT[2] was identified (i.e., llp1 gene encoding the lectin-like protein 1 (Llp1)), wherein phenotypic analysis of the knock-out mutant strain (GR-1_∆llp1) of the L. rhamnosus (GR-1) parent strain revealed a two-fold decreased adhesion to the vaginal and ectocervical epithelial cell lines compared to wild-type.
[0010] More recently, Petrova et al. (2018) described probiotic L. rhamnosus strains expressing (HIV- inhibiting lectins) actinohivin (AH) or griffithsin (GRFT) for in situ delivery. As generally summarized in this publication, L. rhamnosus strains were not able to produce intracellular or extracellular AH, postulating that the observed results might be that the AH is toxic during export out of the cell wall of L. rhamnosus strains, possibly by binding to essential glycosylated cell wall molecules, such as peptidoglycan, exopolysaccharides, or glycosylated proteins of the Sec pathway. Petrova et al. (2018) further describe L. rhamnosus strains constructed for the extracellular expression of GRFT, wherein the obtained results “suggest that L. rhamnosus strains can synthesize GRFT, but not to secrete it out of the cells under the tested conditions”. For example, as set forth in this publication, for recombinant strains CMPG10731, CMPG10734, CMPG10767 and CMPG10768, bands corresponding to GRFT were detected in the cell wall fractions, suggesting possible trapping of the recombinant protein in the cell wall.
[0011] Based on the foregoing, it is apparent that there remain ongoing and unmet needs in the art for improved host organisms capable of producing heterologous lectins for various anti-microbial uses, as well as ongoing and unmet needs for novel methods and compositions enabling the cost-effective industrial scale production, recovery and / or purification of lectins. SUMMARY
[0012] As described and exemplified hereinafter, the instant disclosure provides, inter alia, novel recombinant (modified) filamentous fungal cells (strains) expressing heterologous lectin proteins, polynucleotides (e.g., vectors, expression cassettes) comprising nucleic acids encoding heterologous lectins, methods and compositions for producing heterologous lectins in recombinant filamentous fungal host cells, methods and compositions for recovering and optionally purifying lectins, lectin protein preparations thereof and the like. As generally set forth and described hereinafter, certain one or more embodiments of the disclosure provide recombinant filamentous fungal cells producing heterologous lectin proteins, wherein the lectin proteins are secreted into the fermentation broth when grown / cultivated / fermented under suitable conditions for the production of the lectin. In certain other embodiments, heterologous lectin proteins (and nucleic acids (DNA) encoding heterologous lectins) are derived from plant cells, cyanobacterial cells, algae cells, bacterial cells, insect cells, animal cells and the like.
[0013] In certain other one or more embodiments, heterologous lectin proteins include, but are not limited to, a native griffithsin (GRFT) lectin or a functional GRFT variant derived therefrom, a native scytovirinNB42133-WO-PCT[2] (SVN) lectin or a functional SVN variant derived therefrom, a native cyanovirin-N (CVN) lectin or a functional CVN variant derived therefrom, a native K. alvarezii KAA-1 lectin or a functional KAA-1 variant derived therefrom, a native K. alvarezii KAA-2 lectin or a functional KAA-2 variant derived therefrom, a native Microcystis viridis (MVL) lectin or a functional MVL variant derived therefrom, a native DCSIGN lectin or a functional DCSIGN variant derived therefrom, a native Boodlea coacta agglutinin (BCA) lectin or a functional BCA variant derived therefrom, a native Artocarpus heterophyllus (Jacalin) lectin or a functional Jacalin variant derived therefrom, a native Musa acuminata (Banana) lectin or a functional Banana variant derived therefrom, a native Aaptos papilleta (Sponge) lectin or a functional Sponge variant derived therefrom, a native Abrus precatorius (Jequirty bean) lectin or a functional Jequirty bean variant derived therefrom, a native Aegapodium podagraria (Ground elder) lectin or a functional Ground elder variant derived therefrom, an Agaricus bisporus (Common mushroom) lectin or a functional Common mushroom variant derived therefrom, a native Albizzia julibrissin (Mimosa tree seed) lectin or a functional Mimosa tree seed variant derived therefrom, a native Allomyrina dichotoma (Japanese beetle) lectin or a functional Japanese beetle variant derived therefrom, a native Aloe arborescens (Aloe plant) lectin or a functional Aloe plant variant derived therefrom, a native Amphicarpaea bracteata (Hog peanut) lectin or a functional Hog peanut variant derived therefrom, a native Anguilla (Eel) lectin or a functional Eel variant derived therefrom, a native Aplysia depilans (Mollusca) lectin or a functional Mollusca variant derived therefrom, a native Arachis hypogaea (Peanut) lectin or a functional Peanut variant derived therefrom, a native Bauhinia purpurea (Camel’s foot tree) lectin or a functional Camel’s foot tree variant derived therefrom, a native Bryonia diocia (White bryony) lectin or a functional White bryony variant derived therefrom, a native Caragana Arborescens (Siberian pea tree) lectin or a functional Siberian pea tree variant derived therefrom, a native Carcinoscorpius rotundacauda (Horseshoe crab) lectin or a functional Horseshoe crab variant derived therefrom, a native Microcystis aeruginosa (cyanobacterium) microvirin (MVN) lectin or a functional MVN variant derived therefrom, a native Eucheuma serra (red algae) ESA-2 lectin or a functional ESA-2 variant derived therefrom, a native Musa acuminate (Banana) BanLec lectin or a functional BanLec variant derived therefrom, a native Aspidistra elatior AEL lectin or a functional AEL variant derived therefrom, a native Chaetopterus variopedatus (Marine worm) CVL lectin or a functional CVL variant derived therefrom, a Vicia faba (Fava bean) lectin or a functional Fava bean variant derived therefrom, a native Lens culinaris (lentil) or a functional lentil variant derived therefrom, a native Pisum sativum (pea) lectin or a functional pea variant derived therefrom, a jacalin-like lectin or functional jacalin-like variant derived therefrom, a CVN-like lectin or functional CVN-like variant derived therefrom, an OAA-like lectin or functional OAA-like variant derived therefrom, a galectin-1-like lectin or functional galectin-1-like variant derived therefrom, and a ricin-like lectin or functional ricin-like variant derived therefrom.NB42133-WO-PCT[2]
[0014] In certain other embodiments, one or more polynucleotides (e.g., expression cassettes) encoding heterologous lectin proteins are introduced into the cell. In certain related embodiments, polynucleotide (DNA) expression cassettes encoding such heterologous lectin proteins comprise at least an upstream (5ʹ) promoter region sequence operably linked to a downstream nucleic acid encoding a secretion (signal peptide) sequence operably linked to a downstream (3ʹ) nucleic acid encoding the heterologous lectin protein, optionally comprising a terminator sequence positioned downstream and operably linked to the nucleic acid encoding the heterologous lectin protein. In certain embodiments, the preferred upstream promoter region (DNA) sequence is a strong promoter region sequence functional in the recombinant cell. Examples of strong promoters functional Trichoderma sp. cells include, but are not limited to, cellobiohydrolase promoters (e.g., chb1 promoter, chb2 promoter), endoglucanase promoters (e.g., eg2 promoter), β-glucosidase promoters (bgl1 promoter), xylanase promoters (e.g., xyn3 promoter), rev3 promoters, bxl promoters, tkl1 promoters, dld1 promoters, axe1 promoters, hxk1 promoters, dic1 promoters, opt promoters, gut1 promoters, pki1 promoters and the like. In other embodiments, nucleic acid (DNA) sequences encoding secretion (signal peptide) sequences encode signal peptide sequences functional in the recombinant filamentous fungal cell. Functional secretion (signal peptide) sequences are protein signal sequence capable of being utilized the filamentous fungal (host) cell for the extracellular secretion of the heterologous lectin protein into the fermentation broth (supernatant). For instance, examples of secretion (signal) peptide sequences functional in Trichoderma sp. cells include, but are not limited to, cellobiohydrolase-1 secretion sequence (cbh1ss) of SEQ ID NO: 15 and the aspartic endopeptidase secretion sequence (pep1ss) of SEQ ID NO: 16.
[0015] In certain other one or more embodiments, heterologous lectin proteins are expressed as monomers, expressed as dimers, expressed as fusion proteins, or combinations thereof. In other embodiments, recombinant cells of the disclosure comprise genetic modifications rendering the cell deficient in the production of one or more endogenous proteins (e.g., one or more endogenous secreted enzymes).
[0016] Other embodiments are therefore related to expression cassettes encoding heterologous lectin proteins. In one or more embodiments, expression cassettes encoding heterologous lectin proteins comprise at least an upstream promoter region sequence (functional in an Ascomycete cell) operably linked to a downstream nucleic acid encoding a secretion sequence (functional in an Ascomycete cell) operably linked to a downstream nucleic acid encoding the heterologous lectin.
[0017] Thus, certain other embodiments of the disclosure provide, inter alia, methods for producing heterologous lectin proteins in filamentous fungal cells. In certain embodiments, such methods include, but are not limited to, obtaining a filamentous fungal (host) cell, introducing into the cell one or more expression cassettes encoding heterologous lectin proteins for secreted expression and growing / cultivating / fermenting the modified cell under suitable conditions for the production of the lectinNB42133-WO-PCT[2] protein(s). In certain one or more embodiments of the methods, polynucleotides (DNA, vectors, expression cassettes) encoding heterologous lectin proteins comprise at least an upstream promoter region sequence operably linked to a downstream nucleic acid encoding a secretion (signal peptide) sequence operably linked to a downstream nucleic acid encoding a heterologous lectin protein. In certain related embodiments or aspects, the lectin proteins are secreted into the fermentation broth (i.e., when grown / cultivated / fermented under suitable conditions for the production of the lectin). In other embodiments of the methods, one or more heterologous lectin proteins are derived from a plant cell, a cyanobacterial cell, an algae cell, a bacterial cell, a fungal cell, an insect cell, or an animal cell. In yet other embodiments, one or more expression cassettes encoding heterologous lectin proteins are integrated into the genome of cell. In certain other embodiments of the methods, heterologous lectin proteins may be expressed as lectin monomers, lectin dimers, lectin trimers and the like. In other related aspects, heterologous lectin proteins may be expressed as lectin fusion proteins. In certain other related embodiments, lectin multimers (i.e., lectin dimers, lectin trimers) may be constructed using amino acid linker sequences inserted between the N and C termini of the lectin proteins (e.g., a first and second lectin protein sequence with linker sequence comprising about 4-6 residues). Similarly, lectin fusion proteins may be constructed to have an N-terminal (protein) fusion and / or a C-terminal (protein) fusion.
[0018] In other embodiments of the methods, recombinant (modified) filamentous fungal (host) cells comprise one or more genetic modifications rendering the cell deficient in the production of one or more endogenous proteins (e.g., secreted endogenous enzymes). Thus, other embodiments of the methods include, but are not limited to harvesting the end of fermentation broth comprising the secreted lectin(s), performing a clarification process on the harvested broth, performing a concentration process on the clarified broth, recovering the lectin(s) from the clarified and concentrated broth, proteins preparations thereof and the like. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 shows the mature amino acid sequences of exemplary lectins such as the wild-type red algae (Griffithsia sp.) griffithsin protein (GRFT; SEQ ID NO: 1), the variant X31A griffithsin protein (A- GRFT; SEQ ID NO: 2), the variant M78Q griffithsin protein (Q-GRFT; SEQ ID NO: 4), a synthetic griffithsin dimer protein (GRFT.op1-dimer; SEQ ID NO: 6), the wild-type Kappaphycus alvarezil KAA-2 protein (SEQ ID NO: 4) and wild-type K. alvarezil KAA-1 protein (SEQ ID NO: 10). As presented in FIG.1, the wild-type griffithsin (WT GRFT) protein comprises 121 amino acid residues, wherein the amino acid “X” at position 31 of the WT GRFT is an unknown, non-naturally occurring amino acid residue (FIG.1A, SEQ ID NO: 1). As shown in FIG.1B, the variant X31A griffithsin (A-GRFT; SEQ ID NO: 2) comprises 121 amino acid residues, wherein the non-naturally occurring residue X at position 31 of the WT GRFT (FIG.1A; SEQNB42133-WO-PCT[2] ID NO: 1) has been substituted with an alanine (A) at position 31 of A-GRFT (SEQ ID NO: 2). As presented in FIG. 1C, the variant M78Q griffithsin (Q-GRFT; SEQ ID NO: 4) comprises 121 amino acid residues, wherein the non-naturally occurring residue X at position 31 of the WT GRFT (FIG. 1A; SEQ ID NO: 1) has been substituted with an alanine (A) at position 31 of Q-GRFT (SEQ ID NO: 4) and the methionine (M) residue at position 78 of the WT GRFT (FIG.1A; SEQ ID NO: 1) has been substituted with a glutamine (Q) at position 78 of Q-GRFT (SEQ ID NO: 4). As shown in FIG. 1D, a synthetic GRFT-dimer (i.e., fusion protein) was constructed (GRFT.op1-dimer; SEQ ID NO: 6), wherein the GRFT-dimer comprises two (2) copies of the GRFT fused with the linker peptide YGPGS. The wild-type KAA-2 lectin protein comprises 269 amino acid residues (SEQ ID NO: 8) as shown in FIG.1E, and the wild-type KAA-1 lectin protein comprises 134 amino acid residues (SEQ ID NO: 10) as shown in FIG.1F.
[0020] Figure 2 shows the mature amino acid sequences of exemplary lectins such as the wild-type Musa acuminate (Banlec) protein comprising 144 amino acid residues set forth in SEQ ID NO: 23 (FIG.2A), the wild-type red algae Renouxia sp. (AYR06195) protein comprising 121 amino acid residues set forth in SEQ ID NO: 25 (FIG.2B), the wild-type Artocarpus integrifolia (Jacalin) protein comprising 157 amino acid residues set forth in SEQ ID NO: 27 (FIG. 2C), the wild-type Nostoc ellipsosporum (CV-N) protein comprising 101 amino acid residues set forth in SEQ ID NO: 29 (FIG. 2D) and the wild-type Microcystis viridis (MVL) protein comprising 114 amino acid residues set forth in SEQ ID NO: 31 (FIG.2E).
[0021] Figure 3 presents schematic diagrams of exemplary lectin polynucleotide expression cassettes of the disclosure. More particularly, as shown in FIG. 3, expression cassettes may be constructed for extracellular expression / secretion of the lectin protein in a Gram positive (host) cell. As shown in FIG.3A and FIG.3B, the promoter sequence (abbreviated, “pro”), the signal sequence (abbreviated, “sig-seq”), and the optional terminator sequence (abbreviated, “term”) of the cassettes are generally selected so as to be functional in the desired host. As shown in FIG.3A, the DNA sequence (lectin) encoding the mature lectin protein is positioned downstream (3′) and is operably linked to the (5′) nucleic acid sequence (sig-seq) encoding the (secretion) signal peptide sequence. Likewise, FIG.3B shows the lectin cassette comprising an optional transcriptional terminator (term) DNA sequence positioned downstream (3′) and operably linked to the DNA sequence (lectin) encoding the mature lectin. For enhanced expression of the cassette in a specific filamentous (host) cell, the DNA sequence (lectin) encoding the mature lectin protein may be codon optimized using techniques and methods known to those skilled in the art.
[0022] Figure 4 shows SDS-PAGE analysis for the small-scale expression screening of griffithsin, griffithsin dimer and KAA-2 lectin expression strains with no pH treatment, wherein the red arrows indicate the presence of a lectin of the expected molecular weight. As presented in FIG.4, the wild type griffithsin protein was expressed with cassettes containing two different codon optimized sequences, wherein lanes 1-5 are clones from codon optimized griffithsin (GRFT-1 to GRFT-5, op2); lanes 6-8 clones from codonNB42133-WO-PCT[2] optimized griffithsin (GRFT-6 to GRFT-8, op1); lane 9 contains codon optimized M78Q variant of griffithsin and lane 10 contains the empty host strain (T. reesei).
[0023] Figure 5 shows SDS-PAGE analysis for the small-scale expression screening of griffithsin, griffithsin dimer and KAA-2 lectin expression strains with pH 2.3 treatment, wherein the red arrows indicate the presence of a lectin of the expected molecular weight. As shown in FIG.5, small-scale cultures of GRFT (codon optimized sequence: op1) and GRFT (codon optimized sequence: op2), as well as variant GRFT-M78Q (codon optimized sequence: op1) were incubated at pH 2.3. The cultures were centrifuged, and the supernatants were analyzed by SDS-PAGE. Lanes 1, 2, 4, 5, and 6 contain codon optimized GRFT (op2); lanes 7, 8 and 9 contain codon optimized GRFT (op1); and lanes 10 and 11 contain codon optimized GRFT-M78Q variant (op1). A protein band at approximately 14 kDa, similar to the molecular weight of the griffithsin protein (~12.7 kDa) is detected in most lanes (except lane 6 did not show expression). Lane 3 contains the empty host T. reesei strain.
[0024] Figure 6 shows SDS-PAGE analysis for the small-scale expression screening of a selected set lectins set forth and listed in the Table of FIG.6. As shown in FIG.6, red arrows indicate the presence of a lectin of the expected molecular weight, wherein the expression level was estimated as low (+), medium (++) and high (+++).
[0025] Figure 7 shows SDS-PAGE analysis for the small-scale expression screening of a selected set of lectins fused to the CBM21 protein, wherein the list of lectins screened are shown in the Table of FIG. 7. As presented in FIG. 7, red arrows indicate the presence of a lectin of the expected molecular weight, wherein the expression level was estimated as low (+), medium (++) and high (+++), and NA.
[0026] Figure 8 shows the total soluble proteins produced by three lectin expressing strains in 2-Liter fermentation runs, which included strain BFZ25 (griffithsin), strain BFZ72 (griffithsin dimer as fusion to CBH1core protein), and strain BFZ27 (KAA-2 as fusion to CBH1core protein).
[0027] Figure 9 shows SDS-PAGE analysis of the soluble fraction in the samples from the 2-Liter fermentation runs harvested after 180 hour of fermentation. As shown in FIG.9, lanes 1, 3 and 5 contain the soluble samples after treatment at pH 2.3 and clarification by centrifugation. Lanes 2, 4 and 6 contain the pH neutralized samples from lanes 1, 3 and 5 after treatment with the EndoH (endo-deglycosylase) enzyme.
[0028] Figure 10 is a schematic diagram of plasmid pGX256. As presented in FIG. 10, the abbreviation “TrTEL” is telomere of Trichoderma reesei, “KanR” is a kanamycin resistance gene, “AmpR” is an ampicillin resistance gene, “pyr2”is an orotate phosphoribosyl transferase coding gene, “cbh1 promoter” is the promoter of cellobiohydrolase 1, “cbh1 terminator” is the terminator of cellobiohydrolase 1 and “amdS_Ani_AAA33295” is an acetamidase coding gene.NB42133-WO-PCT[2]
[0029] Figure 11 is a schematic diagram of plasmid pGX256 with a lectin CDS. As presented in FIG. 11, the abbreviation “TrTEL” is telomere of Trichoderma reesei, “KanR” is a kanamycin resistance gene, “AmpR” is an ampicillin resistance gene, “pyr2” is an orotate phosphoribosyl transferase coding gene, “cbh1 promoter” is the promoter of cellobiohydrolase 1, “cbh1 terminator” is the terminator of cellobiohydrolase 1 and “amdS_Ani_AAA33295” is an acetamidase coding gene.
[0030] Figure 12 shows an SDS-PAGE analysis of the AFP fused lectins. More particularly, as presented in FIG. 12, the following lectins were expressed: the Griffithsia sp. lectin (GRFT; SEQ ID NO: 1), the wild-type Meristotheca papulosa lectin (MPA-2; SEQ ID NO: 58), the variant griffithsin M78Q (Q- GRFSEQ ID NO: 4), the wild-type Canavalia ensiformis lectin (Concanavalin A; SEQ ID NO: 60), the wild-type Nostoc ellipsosporum lectin (CV-N; SEQ ID NO: 29), the wild-type Artocarpus integrifolia lectin (Jacalin; SEQ ID NO: 27), the wild-type Microcystis viridis lectin (MVL; SEQ ID NO: 31), the wild-type Musa acuminate lectin (Banlec; SEQ ID NO: 23), the wild-type Scytonema varium lectin (Scytovirin; SEQ ID NO: 54), the wild-type Oscillatoria agardhii lectin (OAA like lectin; SEQ ID NO: 62), the wild-type Homo sapiens lectin (DCSIGN; SEQ ID NO: 35), the wild-type Eucheuma serra lectin (ESA-2; SEQ ID NO: 64), the wild-type Kappaphycus alvarezil lectin (KAA-1; SEQ ID NO: 10), the wild-type Microcystis aeruginosa lectin (MVN; SEQ ID NO: 33), the wild-type Eucheuma denticulatum lectin (EDA2; SEQ ID NO: 56), and the wild-type Mus musculus lectin (Galectin-1; SEQ ID NO: 66).
[0031] Figure 13 shows an SDS-PAGE analysis of the CBM21 fused lectins. More particularly, as presented in FIG.13, the following lectins were expressed: the variant griffithsin M78Q (SEQ ID NO: 4), the wild-type CV-N lectin (SEQ ID NO: 29), the wild-type MVL lectin (SEQ ID NO: 31), the wild-type Scytovirin lectin (SEQ ID NO: 54), the wild-type DCSIGN lectin (SEQ ID NO: 35), the wild-type KAA-1 lectin (SEQ ID NO: 10), the wild-type EDA2 lectin (SEQ ID NO: 56), the wild-type MPA-2 lectin (SEQ ID NO: 58), the wild-type Concanavalin A lectin (SEQ ID NO: 60), the wild-type Banlec lectin (SEQ ID NO: 23), the wild-type OAA like lectin (SEQ ID NO: 62), the wild-type ESA-2 lectin (SEQ ID NO: 64), the wild-type MVN lectin (SEQ ID NO: 33), and the wild-type Galectin-1 lectin (SEQ ID NO: 66).
[0032] Figure 14 shows a hemagglutination assay of the wild-type Jacalin protein (SEQ ID NO: 27)
[0033] Figure 15 shows hemagglutination assays of the GRFT protein (SEQ ID NO: 1), the Q-GRFT protein (SEQ ID NO: 4), the KAA-2 protein (SEQ ID NO: 8), the KAA-1 protein (SEQ ID NO: 10), the Jacalin protein (SEQ ID NO: 27), the CV-N protein (SEQ ID NO: 29) and the DCSIGN protein (SEQ ID NO: 35). BRIEF DESCRIPTION OF THE BIOLOGICAL SEQUENCES
[0034] SEQ ID NO: 1 is the amino acid sequence of the wild-type mature griffithsin (WT-GRFT) protein isolated from Griffithsia sp.NB42133-WO-PCT[2]
[0035] SEQ ID NO: 2 is the amino acid sequence of a variant GRFT (A-GRFT) protein having an alanine (A) substitution at the unknown “X” amino acid residue position 31 (X31A) of SEQ ID NO: 1.
[0036] SEQ ID NO: 3 is a DNA sequence encoding the variant A-GRFT protein of SEQ ID NO: 2, which DNA sequence has been codon optimized for expression in Trichoderma cells.
[0037] SEQ ID NO: 4 is the amino acid sequence of a variant griffithsin (Q-GRFT) protein having a methionine (M) to glutamine (Q) substitution at amino acid position 78 (M78Q).
[0038] SEQ ID NO: 5 is a DNA sequence encoding the variant Q-GRFT protein of SEQ ID NO: 4, which DNA sequence has been codon optimized for expression in Trichoderma cells.
[0039] SEQ ID NO: 6 is the amino acid sequence of a synthetic griffithsin dimer protein named “GRFT.op1-dimer”.
[0040] SEQ ID NO: 7 is a synthetic DNA sequence encoding the griffithsin dimer protein (GRFT.op1-dimer) of SEQ ID NO: 6.
[0041] SEQ ID NO: 8 is the amino acid sequence of the wild-type Kappaphycus alvarezil KAA-2 lectin.
[0042] SEQ ID NO: 9 is a synthetic DNA sequence encoding the KAA-2 lectin of SEQ ID NO: 8, which DNA sequence has been codon optimized for expression in Trichoderma cells.
[0043] SEQ ID NO: 10 is the amino acid sequence of the wild-type Kappaphycus alvarezil KAA-1 lectin.
[0044] SEQ ID NO: 11 is a synthetic DNA sequence encoding the KAA-1 lectin of SEQ ID NO: 10, which DNA sequence has been codon optimized for expression in Trichoderma cells.
[0045] SEQ ID NO: 12 is the amino acid sequence of the T. reesei Cbh1 core domain.
[0046] SEQ ID NO: 13 is a DNA sequence encoding the T. reesei Cbh1 core domain of SEQ ID NO: 12.
[0047] SEQ ID NO: 14 is a DNA sequence of the T. reesei cbh1 promoter (Pcbh1).
[0048] SEQ ID NO: 15 is a DNA sequence encoding a T. reesei Cbh1 signal sequence (Cbh1ss).
[0049] SEQ ID NO: 16 is a DNA sequence encoding a T. reesei Pep1 signal sequence (Pep1ss).
[0050] SEQ ID NO: 17 is a DNA sequence of the T. reesei cbh1 terminator (Tcbh1).
[0051] SEQ ID NO: 18 is a DNA sequence of the T. reesei pyr2 gene.
[0052] SEQ ID NO: 19 is a DNA sequence encoding a S. cerevisiae KEX2 cleavage site sequence.
[0053] SEQ ID NO: 20 is the amino acid sequence of the S. cerevisiae KEX2 site with improved cleavage efficiency.
[0054] SEQ ID NO: 21 is a synthetic DNA sequence encoding the amino acid linker sequence (YGPGS; SEQ ID NO: 22) of the GRFT dimer protein.
[0055] SEQ ID NO: 22 is the amino acid linker sequence of the GRFT dimer (fusion) protein (GRFT.op1- dimer; SEQ ID NO: 6).
[0056] SEQ ID NO: 23 is the amino acid sequence of the wild-type Musa acuminate Banlec lectin
[0057] SEQ ID NO: 24 is a synthetic DNA sequence encoding the Banlec lectin of SEQ ID NO: 23.NB42133-WO-PCT[2]
[0058] SEQ ID NO: 25 is the amino acid sequence of the wild-type Renouxia sp. red algae lectin AYR06195.
[0059] SEQ ID NO: 26 is a synthetic DNA sequence encoding the red algae lectin of SEQ ID NO: 25.
[0060] SEQ ID NO: 27 is the amino acid sequence of the wild-type Artocarpus integrifolia Jacalin lectin.
[0061] SEQ ID NO: 28 is a synthetic DNA sequence encoding the Jacalin lectin of SEQ ID NO: 27.
[0062] SEQ ID NO: 29 is the amino acid sequence of the wild-type Nostoc ellipsosporum CV-N lectin.
[0063] SEQ ID NO: 30 is a synthetic DNA sequence encoding the CV-N lectin of SEQ ID NO: 29.
[0064] SEQ ID NO: 31 is the amino acid sequence of the wild-type Microcystis viridis MVL lectin.
[0065] SEQ ID NO: 32 is a synthetic DNA sequence encoding the Microcystis viridis MVL lectin of SEQ ID NO: 31.
[0066] SEQ ID NO: 33 is the amino acid sequence of the wild-type Microcystis aeruginosa MVN lectin.
[0067] SEQ ID NO: 34 is a synthetic DNA sequence encoding the Microcystis aeruginosa MVN lectin of SEQ ID NO: 33.
[0068] SEQ ID NO: 35 is the amino acid sequence of the wild-type Homo sapiens DCSIGN lectin.
[0069] SEQ ID NO: 36 is a synthetic DNA sequence encoding the Homo sapiens DCSIGN lectin of SEQ ID NO: 35.
[0070] SEQ ID NO: 37 is a synthetic guide RNA sequence (TrC114F) targeting a single locus in T. reesei.
[0071] SEQ ID NO: 38 is a synthetic (DNA) plasmid named “pLH1061” [pI1-Pcbh1-GRFT.op1].
[0072] SEQ ID NO: 39 is a synthetic (DNA) plasmid named “pLH1065” [pI1-Pcbh1-GRFT.M78Q-op1].
[0073] SEQ ID NO: 40 is a synthetic (DNA) plasmid named “pLH1098” [pI1-Pcbh1-CBH1core-KEX2- GRFT.op1-linker-GRFT.op1].
[0074] SEQ ID NO: 41 is a synthetic (DNA) plasmid named “pLH1080” [pI1-Pcbh1-CBH1core-KEX2- KAA2].
[0075] SEQ ID NO: 42 is a 5′ DNA primer named “OT4268” [5′ primer for pI1 integration cassette at selected target locus (TrC114F)].
[0076] SEQ ID NO: 43 is a 3′ DNA primer named “OT4269” [3′ primer for pI1 integration cassette at target locus (TrC114F)].
[0077] SEQ ID NO: 44 is a 5′ DNA primer named “OT4333” [5′ diagnostic primer for integration cassettes at TrC114F locus].
[0078] SEQ ID NO: 45 is a 3′ DNA primer named “OT4334” [3′ diagnostic primer for integration cassettes at TrC114F locus].
[0079] SEQ ID NO: 46 is a synthetic DNA integration cassette named “HRD1” [Chromosomal integration cassette for GRFT.op1].NB42133-WO-PCT[2]
[0080] SEQ ID NO: 47 is a synthetic DNA integration cassette named “HRD2” [Chromosomal integration cassette for GRFT.M78Q.op1].
[0081] SEQ ID NO: 48 is a synthetic DNA integration cassette named “HRD3” [Chromosomal integration cassette for CBH1core-KEX2-GRFT.op1-linker-GRFT.op1].
[0082] SEQ ID NO: 49 is a synthetic DNA integration cassette named “HRD4” [Chromosomal integration cassette for CBH1core-KEX2-KAA2].
[0083] SEQ ID NO: 50 is a synthetic DNA integration cassette named “HRD5” [Chromosomal integration cassette for GRFT.op2].
[0084] SEQ ID NO: 51 is a codon optimized DNA sequence encoding the variant griffithsin (A-GRFT) protein [GRFT.op2].
[0085] SEQ ID NO: 52 is the amino acid sequence of the Rhizopus arrhizus CBM21 starch-binding domain.
[0086] SEQ ID NO: 53 is a synthetic DNA sequence encoding the R. arrhizus CBM21 starch-binding domain, which DNA sequence has been codon optimized for expression in Trichoderma cells.
[0087] SEQ ID NO: 54 is the amino acid sequence of the wild-type Scytonema varium HG-24-1 Scytovirin lectin.
[0088] SEQ ID NO: 55 is a synthetic DNA sequence encoding the Scytonema varium HG-24-1 Scytovirin lectin of SEQ ID NO: 54.
[0089] SEQ ID NO: 56 is the amino acid sequence of the wild-type Eucheuma denticulatum EDA2 lectin.
[0090] SEQ ID NO: 57 is a synthetic DNA sequence encoding the Eucheuma denticulatum EDA2 lectin of SEQ ID NO: 56.
[0091] SEQ ID NO: 58 is the amino acid sequence of the wild-type Meristotheca papulosa MPA-2 lectin.
[0092] SEQ ID NO: 59 is a synthetic DNA sequence encoding the Meristotheca papulosa MPA-2 lectin of SEQ ID NO: 58.
[0093] SEQ ID NO: 60 is the amino acid sequence of the wild-type Canavalia ensiformis Concanavalin A lectin.
[0094] SEQ ID NO: 61 is a synthetic DNA sequence encoding the Canavalia ensiformis Concanavalin A lectin of ASEQ ID NO: 60.
[0095] SEQ ID NO: 62 is the amino acid sequence of the wild-type Oscillatoria agardhii NIES-204 OAA like lectin.
[0096] SEQ ID NO: 63 is a synthetic DNA sequence encoding the Oscillatoria agardhii OAA like lectin of SEQ ID NO: 62.
[0097] SEQ ID NO: 64 is the amino acid sequence of the wild-type Eucheuma serra ESA-2 lectin.NB42133-WO-PCT[2]
[0098] SEQ ID NO: 65 is a synthetic DNA sequence encoding the Eucheuma serra ESA-2 lectin of SEQ ID NO: 64.
[0099] SEQ ID NO: 66 is the amino acid sequence of the wild-type Mus musculus Galectin-1 lectin.
[0100] SEQ ID NO: 67 is a synthetic DNA sequence encoding the Mus musculus Galectin-1 lectin of SEQ ID NO: 66.
[0101] SEQ ID NO: 68 is a DNA sequence encoding a T. reesei APF signal sequence (APFss).
[0102] SEQ ID NO: 69 is a DNA T. reesei TrTEL
[0103] SEQ ID NO: 70 is a DNA sequence comprising the E.coli KanR gene coding sequence (KanR CDS).
[0104] SEQ ID NO: 71 is a DNA sequence comprising the E.coli AmpR gene coding sequence (AmpR CDS).
[0105] SEQ ID NO: 72 is a DNA sequence comprising an Aspergillus nidulans amdS promoter (PamdS) sequence [FGSC A4].
[0106] SEQ ID NO: 73 is a DNA sequence comprising an A. nidulans amdS terminator (amdS term) sequence [FGSC A4].
[0107] SEQ ID NO: 74 is a DNA sequence comprising an A. nidulans amdS gene coding (amdS CDS) [FGSC A4].
[0108] SEQ ID NO: 75 is the amino acid sequence of the A. nidulans AmdS protein encoded SEQ ID NO: 74 [FGSC A4].
[0109] SEQ ID NO: 76 is a synthetic (DNA) sequence of plasmid pGX256 [Telomere-based cloning vector].
[0110] SEQ ID NO: 77 is a synthetic (DNA) sequence of plasmid pLH1053 [pI1-Pcbh1-GRF.op2].
[0111] SEQ ID NO: 78 is the amino acid sequence of the wild-type H. annuus lectin.
[0112] SEQ ID NO: 79 is a synthetic DNA sequence encoding the wild-type H. annuus lectin. DETAILED DESCRIPTION
[0113] As briefly set forth above, and described hereinafter, certain embodiments of the disclosure provide, inter alia, novel recombinant filamentous fungal cells expressing heterologous lectin proteins, wherein the lectin proteins can be the same lectin or combinations of different lectin proteins, recombinant polynucleotides (e.g., vectors, expression cassettes) encoding heterologous lectins for introducing (e.g., transforming) into filamentous fungal host cells for the expression of the heterologous lectins, fermentation broths comprising lectin proteins (and lectin preparations obtained therefrom), lectin proteins recovered from a fermentation broth (and lectin preparations obtained therefrom), purified lectin preparations, and theNB42133-WO-PCT[2] like. Certain embodiments of the disclosure therefore provide novel methods for the recovery and / or purification of lectins obtained from recombinant filamentous fungal cells expressing one or more lectins. I. DEFINITIONS
[0114] Prior to describing the present strains and methods in detail, the following terms are defined for clarity. Terms not defined should be accorded their ordinary meanings as used in the relevant art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present compositions and methods apply.
[0115] All publications and patents cited in this specification are herein incorporated by reference.
[0116] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the present compositions and methods. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the present compositions and methods, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the present compositions and methods.
[0117] Certain ranges are presented herein with numerical values being preceded by the term “about”. The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating un-recited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. For example, in connection with a numerical value, the term “about” refers to a range of -10% to+10% of the numerical value, unless the term is otherwise specifically defined in context. In another example, the phrase a “pH value of about 6” refers to pH values of from 5.4 to 6.6, unless the pH value is specifically defined otherwise.
[0118] The headings provided herein are not limitations of the various aspects or embodiments of the present compositions and methods which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.
[0119] In accordance with this Detailed Description, the following abbreviations and definitions apply. Note that the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “an enzyme” includes a plurality of such enzymes, and reference to “the dosage” includes reference to one or more dosages and equivalents thereof known to those skilled in the art, and so forth.NB42133-WO-PCT[2]
[0120] It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely”, “only”, “excluding”, “not including” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
[0121] It is further noted that the term “comprising”, as used herein, means “including, but not limited to”, the component(s) after the term “comprising”. The component(s) after the term “comprising” are required or mandatory, but the composition comprising the component(s) may further include other non-mandatory or optional component(s).
[0122] It is also noted that the term “consisting of,” as used herein, means “including and limited to”, the component(s) after the term "consisting of”. The component(s) after the term “consisting of” are therefore required or mandatory, and no other component(s) are present in the composition.
[0123] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present compositions and methods described herein. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.
[0124] As used herein, the terms “wild-type” and “native” are used interchangeably and refer to genes, proteins, fungal cells, or strains as found in nature.
[0125] As used herein, the terms “recombinant” or “non-natural” refer to an organism, microorganism, cell, nucleic acid molecule, or vector that has at least one engineered genetic alteration, or has been modified by the introduction of a heterologous nucleic acid molecule, or refer to a cell (e.g., a microbial cell) that has been altered such that the expression of a heterologous or endogenous nucleic acid molecule or gene can be controlled. Recombinant also refers to a cell that is derived from a non-natural cell or is progeny of a non-natural cell having one or more such modifications. Genetic alterations include, for example, modifications introducing expressible nucleic acid molecules encoding proteins, or other nucleic acid molecule additions, deletions, substitutions, or other functional alteration of a cell’s genetic material. For example, recombinant cells may express genes or other nucleic acid molecules that are not found in identical or homologous form within a native (wild-type) cell or may provide an altered expression pattern of endogenous genes, such as being over-expressed, under-expressed, minimally expressed, or not expressed at all.
[0126] “Recombination”, “recombining” or generating a “recombined” nucleic acid is generally the assembly of two or more nucleic acid fragments wherein the assembly gives rise to a chimeric gene.
[0127] As used herein, the term “gene” is synonymous with the term “allele” in referring to a nucleic acid that encodes and directs the expression of a protein or RNA. Vegetative forms of filamentous fungi areNB42133-WO-PCT[2] generally haploid, therefore a single copy of a specified gene (i.e., a single allele) is sufficient to confer a specified phenotype.
[0128] As used herein, the term “gene” means the segment of DNA involved in producing a polypeptide (protein) chain, that may or may not include regions preceding and following the coding region (e.g., 5′ untranslated (5′ UTR) or “leader” sequences, 3′ UTR or “trailer” sequences, promoter sequences, terminator sequences and the like) as well as intervening sequences (introns) between individual coding segments (exons). For example, a gene (DNA) sequence of interest (GOI) may encode a lectin protein of interest, a structural protein, commercially important industrial proteins, or peptides, such as enzymes (e.g., proteases, mannanases, xylanases, amylases, glucoamylases, cellulases, oxidases, phytases, lipases) and the like. The gene of interest may be a naturally occurring gene, a mutated (modified) gene or a synthetic gene.
[0129] As used herein, the term “promoter” refers to a nucleic acid sequence that functions to direct transcription of a downstream gene, or an open reading frame (ORF) thereof. The promoter will generally be appropriate to the host cell (e.g., a filamentous fungal cell) in which the target gene is being expressed. The promoter together with other transcriptional and translational regulatory nucleic acid sequences (also termed “control sequences”) is necessary to express a given gene. In general, the transcriptional and translational regulatory sequences include, but are not limited to, promoter and terminator sequences including a core promoter and enhancer or activator or repressor sequences, transcriptional and translational start and stop sequences. In certain embodiments, the promoter is an inducible promoter, or a constitutive promoter. In certain embodiments, the inducible promoter is an inducible cellulase gene promoter.
[0130] As used herein, the term “promoter activity” is the ability of a nucleic acid to direct transcription of a downstream (3′) polynucleotide in a host cell. To test promoter activity, the (promoter) nucleic acid may be operably linked to a downstream polynucleotide to produce a recombinant nucleic acid. The recombinant nucleic acid may be introduced into a cell, and transcription of the polynucleotide may be evaluated. In certain cases, the polynucleotide may encode a protein, and transcription of the polynucleotide can be evaluated by assessing production of the protein in the cell.
[0131] As used herein, the term “operably linked” refers to a functional linkage between two or more nucleic acid sequences. Thus, a nucleic acid sequence is operably linked when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter sequence or a terminator sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation; a nucleic acid sequence encoding a secretory leader (i.e., a signal peptide) is operably linked to a nucleic acid sequence (e.g., an ORF) encoding a polypeptide if it is expressed as a pre-protein that participates in the secretion of the polypeptide. Generally, “operably linked” means that the DNA (nucleic acid) sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase.NB42133-WO-PCT[2] However, enhancers do not have to be contiguous. Linking two or more nucleic acid sequences (i.e., operably linking) is accomplished using any of the methods to one of skill in the art.
[0132] As used herein, a “functional gene” is a gene capable of being used by cellular components to produce an active gene product, typically a protein. In contrast, a “non-functional gene” cannot be used by cellular components to produce an active gene product (i.e., a functional protein), or has a reduced ability to be used by cellular components to produce an active gene product (i.e., a functional protein).
[0133] As used herein, a “functional protein” is a protein that possesses a function or activity, such as an enzymatic function / activity, a binding function / activity (e.g., DNA binding), a surface-active property, and the like, and which has not been mutagenized, truncated, or otherwise modified to abolish or reduce that function / activity.
[0134] As used herein, the phrases “modified filamentous fungal cell(s)”, “mutant or variant filamentous fungal cell(s)”, “recombinant fungal cell(s)”, “modified filamentous fungal strain(s)”, and the like may be used interchangeably and refer to filamentous fungal cells that are derived (obtained) from a control or parental filamentous fungal cell belonging to the Pezizomycotina subphylum. For example, a “modified” filamentous fungal cell may be derived (obtained) from a control or parental filamentous fungal cell, wherein the modified cell comprises at least one genetic modification which is not found in the control or parental cell.
[0135] As used herein, the term “Ascomycete fungal cell” refers to any organism in the Division Ascomycota in the Kingdom Fungi. Examples of Ascomycetes fungal cells include, but are not limited to, filamentous fungi in the subphylum Pezizomycotina, such as Trichoderma sp., Aspergillus sp., Myceliophthora sp. and Penicillium sp.
[0136] As used herein, the term “filamentous fungus” refers to all filamentous forms of the subdivision Eumycota and Oomycota. For example, filamentous fungi include, without limitation, Acremonium, Aspergillus, Emericella, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Scytalidium, Thielavia, Tolypocladium, or Trichoderma species. In some embodiments, the filamentous fungus may be an Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae.
[0137] In some embodiments, the filamentous fungus is a Fusarium sp. such as Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, and the like. In other embodiments, the filamentous fungus is Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Scytalidium thermophilum, Thielavia terrestris and theNB42133-WO-PCT[2] like. In certain other embodiments, a filamentous fungus is a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, Trichoderma viride and the like.
[0138] As used herein, exemplary parental Trichoderma reesei strains include, but are not limited to, T. reesei strain QM6a (ATCC Deposit No. 13631), T. reesei strain RL-P37 (NRRL Deposit No. 15709) and T. reesei strain RUT-C30 (ATCC Deposit No.56765); exemplary parental Aspergillus niger strains include, but are not limited to, A. niger strain designated as ATCC Deposit No.1015; exemplary parental Aspergillus oryzae strains include, but are not limited to A. oryzae strain RIB40 (ATCC Deposit No. 42149); and exemplary parental Myceliophthora thermophila strains include, but are not limited to, M. thermophila strain designated as ATCC Deposit No.42464. For example, Trichoderma strains RUT-C30 and RL-P37 are mutagenized (cellulase overproducing) derivatives of Trichoderma natural isolate QM6a (Sheir-Neiss and Montenecourt, 1984), with strain NG14 being the last common ancestor. In certain aspects, suitable Trichoderma strains may be derived / obtained from T. reesei strains comprising a deletion of the T. reesei pyr2 gene (∆pyr2), as generally described by Sheir-Neiss and Montenecourt (1984) and PCT Publication No. WO2011 / 153449 (specifically incorporated herein by reference in its entirety).
[0139] As used herein, the phrases “lignocellulosic degrading enzymes”, “cellulase enzymes”, and / or “cellulases” are used interchangeably, and include glycoside hydrolase (GH) enzymes, such as cellobiohydrolases, xylanases, endoglucanases, and β-glucosidases, that hydrolyze the β-(1,4)-linked glycosidic bonds of cellulose (hemi-cellulose) to produce glucose.
[0140] In certain embodiments, cellobiohydrolases include enzymes classified under Enzyme Commission No. (EC 3.2.1.91), endoglucanases include enzymes classified under EC 3.2.1.4, endo-β-1,4-xylanases include enzymes classified under EC 3.2.1.8, β-xylosidases include enzymes classified under EC 3.2.1.37, and β-glucosidases include enzymes classified under EC 3.2.1.21.
[0141] As used herein, “endoglucanase” proteins may be abbreviated as “EG”, “cellobiohydrolase” proteins may be abbreviated “CBH”, “β-glucosidase” proteins may be abbreviated “BG” and “xylanase” proteins may be abbreviated “XYL”. Thus, as used herein, a gene (gene CDS or ORF) encoding a EG protein may be abbreviated “eg”, a gene (or ORF) encoding a CBH protein may be abbreviated “cbh”, a gene (or ORF) encoding a BG protein may be abbreviated “bg”, and a gene (or ORF) encoding a XYL protein may be abbreviated “xyl”.
[0142] As used herein, the terms “polypeptide” and “protein” (and / or their respective plural forms) are used interchangeably to refer to polymers of any length comprising amino acid residues linked by peptide bonds. The conventional one-letter or three-letter codes for amino acid residues are used herein. The polymer can be linear or branched, it can comprise modified amino acids, and it can be interrupted by non- amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation,NB42133-WO-PCT[2] or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art.
[0143] In certain embodiments, one or more lectin proteins of interest may be designed and constructed as fusion proteins. For example, in certain non-limited aspects, lectin fusion proteins may comprise a N- terminus fusion (“N-fusion”) of one or more amino acid residues and / or a C-terminus fusion (“C-fusion”) of one or more amino acid residues.
[0144] As used herein, the term “derivative polypeptide / protein” refers to a protein which is derived or derivable from a protein by addition of one or more amino acids to either or both the N- and C-terminal end(s), substitution of one or more amino acids at one or a number of different sites in the amino acid sequence, deletion of one or more amino acids at either or both ends of the protein or at one or more sites in the amino acid sequence, and / or insertion of one or more amino acids at one or more sites in the amino acid sequence. The preparation of a protein derivative can be achieved by modifying a DNA sequence which encodes for the native protein, transformation of that DNA sequence into a suitable host, and expression of the modified DNA sequence to form the derivative protein.
[0145] Related (and derivative) proteins include “variant proteins”. Variant proteins differ from a reference / parental protein (e.g., a wild-type protein) by substitutions, deletions, and / or insertions at a small number of amino acid residues. The number of differing amino acid residues between the variant and parental protein can be one or more, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more amino acid residues. Variant proteins can share at least about 50%-60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99%, or more, amino acid sequence identity with a reference protein. A variant protein can also differ from a reference protein in selected motifs, domains, epitopes, conserved regions, and the like.
[0146] As used herein, the term “analogous sequence” refers to a sequence within a protein that provides similar function, tertiary structure, and / or conserved residues as the protein of interest (i.e., typically the original protein of interest). For example, in epitope regions that contain an α-helix or a β-sheet structure, the replacement amino acids in the analogous sequence preferably maintain the same specific structure. The term also refers to nucleotide sequences, as well as amino acid sequences. In some embodiments, analogous sequences are developed such that the replacement of amino acids result in a variant enzyme showing a similar or improved function. In some embodiments, the tertiary structure and / or conserved residues of the amino acids in the protein of interest are located at or near the segment or fragment of interest. Thus, whereNB42133-WO-PCT[2] the segment or fragment of interest contains, for example, an α-helix or a β-sheet structure, the replacement amino acids preferably maintain that specific structure.
[0147] As used herein, the term “homologous protein” refers to a protein that has similar activity and / or structure to a reference protein. It is not intended that homologues necessarily be evolutionarily related. Thus, it is intended that the term encompass the same, similar, or corresponding protein(s) (i.e., in terms of structure and function) obtained from different organisms. In some embodiments, it is desirable to identify a homologue that has a quaternary, tertiary and / or primary structure similar to the reference protein.
[0148] The degree of homology between sequences can be determined using any suitable method known in the art (e.g., programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI). As presented and described below in Section II, other lectin gene / protein homologues may be identified by reference to one or more exemplary lectin proteins, which lectin proteins are well suited for production in one or more modified filamentous fungal strains of the disclosure.
[0149] For example, PILEUP is a useful program to determine sequence homology levels. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pair-wise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng and Doolittle (1987). Useful PILEUP parameters including a default gap weight of 3.00, a default gap length weight of 0.10, and weighted end gaps. Another example of a useful algorithm is the BLAST algorithm. One particularly useful BLAST program is the WU-BLAST-2 program. Parameters “W,” “T,” and “X” determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word- length (W) of 11, the BLOSUM62 scoring matrix alignments (B) of 50, expectation (E) of 10, M′5, N′-4, and a comparison of both strands.
[0150] As used herein, the phrases “substantially similar” and “substantially identical”, in the context of at least two nucleic acids or polypeptides, typically means that a polynucleotide or polypeptide comprises a sequence that has at least about 40% to 100% sequence identity. Thus, in one or more embodiments, a substantially similar or substantially identical nucleic acid or polypeptide of the disclosure comprises at least about 40%, 50%, 60%, 70%, 80%, 90% or 100% identity to one or more sequences set forth herein. In certain related embodiments, one or more nucleic acid sequences and / or one or more protein sequences of the disclosure comprise at least about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 50%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to one or more sequences set forth herein. Sequence identity can be determined using known programs such as BLAST, ALIGN, and CLUSTAL using standard parameters. Software for performing BLAST analyses isNB42133-WO-PCT[2] publicly available through the National Center for Biotechnology Information. Also, databases can be searched using FASTA. One indication that two polypeptides are substantially identical is that the first polypeptide is immunologically cross-reactive with the second polypeptide. Typically, polypeptides that differ by conservative amino acid substitutions are immunologically cross-reactive. Thus, a polypeptide is substantially identical to a second polypeptide, for example, where the two peptides differ only by a conservative substitution. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions (e.g., within a range of medium to high stringency).
[0151] As used herein, “nucleic acid” refers to a nucleotide or polynucleotide sequence, and fragments or portions thereof, as well as to DNA, cDNA, and RNA of genomic or synthetic origin, which may be double- stranded or single-stranded, whether representing the sense or antisense strand.
[0152] As used herein, the term “expression” refers to the transcription and stable accumulation of sense (mRNA) or anti-sense RNA, derived from a nucleic acid molecule of the disclosure. Expression may also refer to translation of mRNA into a polypeptide. Thus, the term “expression” includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, secretion and the like.
[0153] As used herein, the terms “modification” and “genetic modification” are used interchangeably and include, but are not limited to: (a) the introduction, substitution, or removal of one or more nucleotides in a gene, or the introduction, substitution, or removal of one or more nucleotides in a regulatory element required for the transcription or translation of the gene, (b) gene disruption, (c) gene conversion, (d) gene deletion, (e) the down-regulation of a gene (e.g., antisense RNA, siRNA, miRNA, and the like), (f) specific mutagenesis (including, but not limited to, CRISPR / Cas9 based mutagenesis) and / or (g) random mutagenesis of any one or more the genes disclosed herein.
[0154] As used herein, “the introduction, substitution, or removal of one or more nucleotides in a gene encoding a protein”, such genetic modifications include the gene’s coding sequence (i.e., exons) and non- coding intervening (introns) sequences.
[0155] As used herein, “disruption of a gene”, “gene disruption”, “inactivation of a gene” and “gene inactivation” are used interchangeably and refer broadly to any genetic modification that substantially disrupts / inactivates a target gene. Exemplary methods of gene disruptions include, but are not limited to, the complete or partial deletion of any portion of a gene, including a polypeptide coding sequence (CDS), a promoter, an enhancer, or another regulatory element, or mutagenesis of the same, where mutagenesis encompasses substitutions, insertions, deletions, inversions, and any combinations and variations thereof which disrupt / inactivate the target gene(s) and substantially reduce or prevent the expression / production ofNB42133-WO-PCT[2] the functional gene product. In certain embodiments of the disclosure, such gene disruptions prevent a host cell from expressing / producing the encoded lov gene product.
[0156] In other embodiments, a protein of interest (e.g., a lectin POI) expressed / produced by the fungal cells of the disclosure may be detected, measured, assayed and the like, by protein quantification methods, gene transcription methods, mRNA translation methods and the like, including, but not limited to, protein migration / mobility (SDS-PAGE), mass spectrometry, HPLC, size exclusion, ultracentrifugation sedimentation velocity analysis, transcriptomics, proteomics, fluorescent tags, epitope tags, fluorescent protein (GFP, RFP, etc.) chimeras / hybrids and the like.
[0157] As used herein, functionally and / or structurally similar proteins are considered to be “related proteins”. Such related proteins can be derived from organisms of different genera and / or species, or even different classes of organisms (e.g., bacteria and fungi). Related proteins also encompass homologues and / or orthologues determined by primary sequence analysis, determined by secondary or tertiary structure analysis, or determined by immunological cross-reactivity.
[0158] The term “promoter” as used herein refers to a nucleic acid sequence capable of controlling the expression of a coding sequence (CDS) or functional RNA. In general, a coding sequence (CDS) is located downstream (3′) to a promoter (pro) sequence. Promoters may be derived in their entirety from a native gene or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleic acid segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity.
[0159] As defined herein, the term “introducing”, as used in phrases such as “introducing into a fungal cell” at least one polynucleotide open reading frame (ORF), or a gene thereof, or a vector thereof, includes methods known in the art for introducing polynucleotides into a cell, including, but not limited to protoplast fusion, natural or artificial transformation (e.g., calcium chloride, electroporation), transduction, transfection and the like.
[0160] As used herein, “transformed” or “transformation” mean a cell has been transformed by use of recombinant DNA techniques. Transformation typically occurs by insertion of one or more nucleotide sequences (e.g., a polynucleotide, an ORF or gene) into a cell. The inserted nucleotide sequence may be a heterologous nucleotide sequence (i.e., a sequence that is not naturally occurring in the cell that is to be transformed).NB42133-WO-PCT[2]
[0161] As used herein, “transformation” refers to introducing an exogenous DNA into a host cell so that the DNA is maintained as a chromosomal integrant or a self-replicating extra-chromosomal vector. As used herein, “transforming DNA”, “transforming sequence”, and “DNA construct” refer to DNA that is used to introduce sequences into a host cell. The DNA may be generated in vitro by PCR or any other suitable techniques. In some embodiments, the transforming DNA comprises an incoming sequence, while in other embodiments it further comprises an incoming sequence flanked by homology boxes. In yet a further embodiment, the transforming DNA comprises other non-homologous sequences, added to the ends (i.e., stuffer sequences or flanks). The ends can be closed such that the transforming DNA forms a closed circle, such as, for example, insertion into a vector.
[0162] As used herein “an incoming sequence” refers to a DNA sequence that is introduced into the fungal cell chromosome. In some embodiments, the incoming sequence is part of a DNA construct. In other embodiments, the incoming sequence encodes one or more proteins of interest. In some embodiments, the incoming sequence comprises a sequence that may or may not already be present in the genome of the cell to be transformed (i.e., it may be either a homologous or heterologous sequence). In some embodiments, the incoming sequence encodes one or more proteins of interest, a gene, and / or a mutated or modified gene. In alternative embodiments, the incoming sequence encodes a functional wild-type gene or operon, a functional mutant gene or operon, or a nonfunctional gene or operon. In some embodiments, an incoming sequence is a non-functional sequence inserted into a gene to disrupt function of the gene. In another embodiment, the incoming sequence includes a selective marker. In a further embodiment the incoming sequence includes two homology boxes.
[0163] As used herein, “homology box” refers to a nucleic acid sequence, which is homologous to a sequence in the fungal cell chromosome. More specifically, a homology box is an upstream or downstream region having between about 80 and 100% sequence identity, between about 90 and 100% sequence identity, or between about 95 and 100% sequence identity with the immediate flanking coding region of a gene or part of a gene to be deleted, disrupted, inactivated, down-regulated and the like, according to the invention. These sequences direct where in the fungal cell chromosome a DNA construct is integrated and directs what part of the fungal cell chromosome is replaced by the incoming sequence. While not meant to limit the present disclosure, a homology box may include about between 1 base pair (bp) to 200 kilobases (kb). Preferably, a homology box includes about between 1 bp and 10.0 kb; between 1 bp and 5.0 kb; between 1 bp and 2.5 kb; between 1 bp and 1.0 kb, and between 0.25 kb and 2.5 kb. A homology box may also include about 10.0 kb, 5.0 kb, 2.5 kb, 2.0 kb, 1.5 kb, 1.0 kb, 0.5 kb, 0.25 kb and 0.1 kb. In some embodiments, the 5' and 3' ends of a selective marker are flanked by a homology box wherein the homology box comprises nucleic acid sequences immediately flanking the coding region of the gene.NB42133-WO-PCT[2]
[0164] As used herein, the term “selectable marker-encoding nucleotide sequence” refers to a nucleotide sequence which is capable of expression in the host cells and where expression of the selectable marker confers to cells containing the expressed gene the ability to grow in the presence of a corresponding selective agent or lack of an essential nutrient.
[0165] As used herein, the terms “selectable marker” and “selective marker” refer to a nucleic acid (e.g., a gene) capable of expression in host cell which allows for ease of selection of those hosts containing the vector. Examples of such selectable markers include, but are not limited to, antimicrobials. Thus, the term “selectable marker” refers to genes that provide an indication that a host cell has taken up an incoming DNA of interest or some other reaction has occurred. Typically, selectable markers are genes that confer antimicrobial resistance or a metabolic advantage on the host cell to allow cells containing the exogenous DNA to be distinguished from cells that have not received any exogenous sequence during the transformation.
[0166] As defined herein, a host cell “genome”, a fungal cell “genome”, or a filamentous fungus cell “genome” includes chromosomal and extrachromosomal genes.
[0167] As used herein, the terms “plasmid”, “vector” and “cassette” refer to extrachromosomal elements, often carrying genes which are typically not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, phage, or nucleotide sequences, linear or circular, of a single- stranded or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell.
[0168] As used herein, the term “vector” refers to any nucleic acid that can be replicated (propagated) in cells and can carry new genes or DNA segments (e.g., an “incoming sequence”) into cells. Thus, the term refers to a nucleic acid construct designed for transfer between different host cells. Vectors include viruses, bacteriophage, pro-viruses, plasmids, phagemids, transposons, and artificial chromosomes such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), PLACs (plant artificial chromosomes), and the like, that are “episomes” (i.e., replicate autonomously) or can integrate into the chromosome of a host cell.
[0169] A used herein, a “transformation cassette” refers to a specific vector comprising a gene and having elements in addition to the gene that facilitate transformation of a particular host cell.
[0170] As used herein, “expression vector” refers to a vector that has the ability to incorporate and express heterologous DNA in a cell. Many prokaryotic and eukaryotic expression vectors are commerciallyNB42133-WO-PCT[2] available and know to one skilled in the art. Selection of appropriate expression vectors is within the knowledge of one skilled in the art.
[0171] As used herein, the terms “expression cassette” refers to a nucleic acid construct generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a target cell (e.g., vectors or vector elements described above). The recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter. In some embodiments, DNA constructs also include a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a target cell. In certain embodiments, a DNA construct of the disclosure comprises a selective marker and an inactivating chromosomal or gene or DNA segment as defined herein.
[0172] As used herein, a “targeting vector” is a vector that includes polynucleotide sequences that are homologous to a region in the chromosome of a host cell into which the targeting vector is transformed and that can drive homologous recombination at that region. For example, targeting vectors find use in introducing genetic modifications into the chromosome of a host cell through homologous recombination. In some embodiments, a targeting vector comprises other non-homologous sequences, e.g., added to the ends (i.e., stuffer sequences or flanking sequences). The ends can be closed such that the targeting vector forms a closed circle, such as, for example, insertion into a vector.
[0173] As used herein, the terms “purified”, “isolated” or “enriched” are meant that a biomolecule (e.g., a polypeptide or polynucleotide) is altered from its natural state by virtue of separating it from some, or all of, the naturally occurring constituents with which it is associated in nature. Such isolation or purification may be accomplished by art-recognized separation techniques such as ion exchange chromatography, affinity chromatography, hydrophobic separation, dialysis, protease treatment, heat treatment, ammonium sulphate precipitation or other protein salt precipitation, crystallization, centrifugation, size exclusion chromatography, filtration, microfiltration, gel electrophoresis or separation on a gradient to remove whole cells, cell debris, impurities, extraneous proteins, or enzymes undesired in the final composition. It is further possible to then add constituents to a purified or isolated biomolecule composition which provide additional benefits, for example, activating agents, anti-inhibition agents, desirable ions, compounds to control pH or other enzymes or chemicals.
[0174] As used herein, a “protein preparation” is any material, typically a solution, generally aqueous, comprising one or more proteins.
[0175] As used herein, the terms “broth”, “cultivation broth”, “fermentation broth” and / or “whole fermentation broth” may be used interchangeably and refer to a preparation produced by cellularNB42133-WO-PCT[2] fermentation that undergoes no processing steps after the fermentation is complete. For example, whole fermentation broths are typically produced when microbial cultures are grown to saturation, incubated under carbon-limiting conditions to allow protein synthesis (e.g., expression of proteins by host cells; and optionally, secretion of the proteins into cell culture medium). Typically, the whole fermentation broth is unfractionated and comprises spent cell culture medium, metabolites, extracellular polypeptides, and microbial cells.
[0176] As used herein, the phrase “treated broth” refers to broth that has been conditioned by making changes to the chemical composition and / or physical properties of the broth. Broth “conditioning” may include one or more treatments such as cell lysis, pH modification, heating, cooling, addition of chemicals (e.g., calcium, salt(s), flocculant(s), reducing agent(s), enzyme activator(s), enzyme inhibitor(s), and / or surfactant(s)), mixing, and / or timed hold (e.g., 0.5 to 200 hours) of the broth without further treatment.
[0177] As used herein, a “cell lysis” process includes any cell lysis technique known in the art, including, but not limited to, enzymatic treatments (e.g., lysozyme, proteinase K treatments), chemical means (e.g., ionic liquids), physical means (e.g., French pressing, ultrasonic), simply holding culture without feeds, and the like.
[0178] The terms “recovery”, “recovered” and “recovering” as used herein refer to at least partial separation of a protein from one or more components of a microbial broth and / or at least partial separation from one or more solvents in the broth (e.g., water or ethanol).
[0179] In certain aspects, broths in which host cells have been fermented for the production of lectin proteins, with or without broth treatment, are clarified. As used herein, a “clarified” broth means a broth which has been subjected to at least one clarification process to remove cell debris and / or other insoluble components. Clarification processes, as understood in the art include, but are not limited to, centrifugation techniques, cross-flow membrane filtration techniques, solid / liquid filtration techniques, and the like.
[0180] “Cell debris” refers to cell walls and other insoluble components that are released or formed after disruption of the cell membrane (e.g., after performing a cell lysis process).
[0181] In certain aspects, separation of solvents, as understood in the art include, but are not limited to ultrafiltration, evaporation, spray drying, freezer drying. The obtained solution is referred to as “clarified broth concentrate”, “UF concentrate”, or “ultrafiltrate concentrate”.
[0182] As used herein, the term “cell mass” refers to the cell component (including intact and lysed cells) present in a liquid (submerged) culture. Cell mass can be expressed in dry cell weight (DCW) or wet cell weight (WCW).
[0183] As used herein, the terms “lectin(s)” and “lectin proteins” are used interchangeably and refer to carbohydrate binding proteins (or glycoproteins) that can recognize and bind simple or complex carbohydrates in a reversible and highly specific manner, while displaying no catalytic activity. Thus, lectinNB42133-WO-PCT[2] proteins described herein have the same meaning as lectins described in art (e.g., see Lagarda-Diaz et al., 2017).
[0184] As used herein, the term “functional lectin variant(s)” and “when used in phrases such as a “native lectin and functional (lectin) variants thereof”, the “native griffithsin (GRFT) protein and functional GRFT variants thereof”, and the like, refers to variant (mutant) lectins derived from a native (parent) lectin protein, wherein the functional (lectin) variants comprise carbohydrate binding activity. In certain aspects, functional lectin variants may comprise reduced carbohydrate binding activity relative to the parent (native) lectin, the same carbohydrate binding activity relative to the parent (native) lectin, or increased carbohydrate binding activity relative to the parent (native) lectin. II. LECTIN PROTEINS
[0185] As briefly set forth above, lectins are proteins (or glycoproteins) that possess non-catalytic carbohydrate-binding sites. As generally understood in the art, lectins differ from enzymes because their carbohydrate-binding properties never change, and they are unlike antibodies because they are not induced as an immune response. For example, some of the most well-known lectins are found in leguminous seeds, which are believed to be responsible for innate immunity and defense mechanisms in plants (Peumans and Van Damme, 1998). More recently, the use of lectins in mitigating viral infections (e.g., HIV, MERS- CoV, SARS-CoV-2, HCV, Ebola and the like) has received significant attention (PCT Publication No. WO2005 / 118627, WO2007 / 064844, WO2010 / 01424, WO2016 / 130628, WO2019 / 108656 and US Publication No. US20110263485). However, as described above in the Background, the economics of recombinant lectin production (e.g., using currently available host expression systems and downstream recovery process thereof) has significantly limited acceptance and / or use of lectins as anti-microbial compositions.
[0186] For example, PCT Publications WO2005 / 118627 and WO2007 / 064844 describe methods for isolating the native griffithsin (GRFT) lectin from the red algae (Griffithsia sp.), cloning the wild-type (grft) gene thereof, generating recombinant polynucleotides thereof, fermenting and producing the same in E. coli host cells, followed by isolating the recombinant His-tagged GRFT protein from the E. coli host, and characterizing its anti-viral activity. However, as described in WO2005 / 118627 and WO2007 / 064844, the recombinant GRFT protein (and a C-terminal His-tagged GRFT protein thereof) encoded by the nucleic acids of Example 2, did not efficiently translocate to the periplasmic fraction of E. coli following GRFT protein expression, wherein the majority of the produced GRFT proteins accumulated in the inclusion bodies of E. coli, without the cleavage of the pelB signal sequence located at the N-terminus of the griffithsin protein. Thus, steps were taken to express griffithsin in the cytosolic fraction of E. coli, using the N-terminal (His) tagged GRFT, or His-tagged variants of GRFT, as described above.NB42133-WO-PCT[2]
[0187] Likewise, PCT Publication No. WO2010 / 01424 generally describes methods of inhibiting a hepatitis C viral infection of a host comprising administering to the host an effective amount of a glycosylation resistant GRFT protein (or a polypeptide conjugate thereof) in combination with another anti- viral protein. For example, as described in this publication, the inventors noted that the anti-viral protein combination of scytovirin (SVN) and griffithsin (GRFT) have (nanomolar) activity against the Hepatitis C virus (HCV). US Patent Publication No. US20110263485 further describes methods of inhibiting a human immunodeficiency virus (HIV) viral infection of a host comprising administering to the host an effective amount of a gp120 Griffithsin and a peptide selected from a gp41-binding protein, a CCR5-binding protein, a gp120-binding protein, or another griffithsin, which combinations are potent inhibitors to HIV infection.
[0188] PCT Publication No. WO2016 / 130628 discloses variant griffithsin proteins having mutations that change the isoelectric point of the GRFT protein, which are reported to alter its solubility in various pH ranges allowing for improved product release.
[0189] PCT Publication No. WO2019 / 108656 generally describes microbicidal compositions comprising an endosperm extract and an anti-HIV lectin, an anti-HIV antibody, or antigen binding antibody fragment thereof. More particularly, the inventors utilized transgenic plants expressing two or more cyanovirin-N (CVN) proteins, griffithsin (GRFT) proteins, scytovirin (SVN) proteins, other anti-HIV lectin proteins. However, as stated in WO2019 / 108656, the production of such microbicidal components is expensive because fermenter based expression platforms are required, and the downstream processing facilities must be compliant with good manufacturing practice (GMP) to ensure the removal of viruses or endotoxins, wherein the capacity, scalability and cost issues affecting fermenters are exacerbated when two or three separate products with individual manufacturing processes are required for each microbicide.
[0190] The recombinant production of GRFT in tobacco plants (Nicotiana benthamiana) has been described by O’Keefe et al. (2009), wherein the GRFT accumulates to a level of about 1 gram of recombinant GRFT per kilogram of Nicotiana benthamiana leaf material, when expressed via an infectious tobacco mosaic virus (TMV) based vector. Hirayama et al. (2016) have described the elucidated primary structure of KAA-2 lectin using peptide mapping and complementary DNA (cDNA) cloning and prepared its active recombinants using an E. coli expression system.
[0191] Gengenbach et al. (2019) have described the transient expression of the mistletoe lectin named “viscumin” (Viscum album) in intact Nicotiana benthamiana plants and purification of the recombinant viscumin from crude plant extracts by affinity chromatography, wherein the performance and economics of tobacco plant-based process was compared to the corresponding process based on E. coli expression. For example, as described in Gengenbach et al., the full‐length viscumin was produce in N. benthamiana leaves at levels of up to 7 mg / kg of purified product, wherein the yield of full‐length viscumin was comparable with that of plant lectins expressed in yeast, but approximately 6‐fold lower than refoldedNB42133-WO-PCT[2] viscumin A and B chains expressed in E. coli. As summarized by Gengenbach et al., the E. coli process has a low recovery, requires extensive dilution and is complex, whereas the plant-based process included only half the number of steps. According to a direct cost comparison between the two processes performed in the Gengenbach et al. study, the plant expression system was 50% less expensive, in comparison with the native host V. album or the heterologous expression in E. coli host cells.
[0192] Based on the foregoing, the instant disclosure addresses numerous ongoing and unmet needs in the art related to the lectin proteins. More particularly, as described herein and set forth in the Examples section, Applicant has surprisingly discovered that recombinant (modified) filamentous fungal cells / strains are particularly suitable for use in the industrial-scale production of heterologous (foreign) lectin proteins.
[0193] For instance, as generally described in Example 1, filamentous fungal cells were designed, constructed, and evaluated for their ability to express exemplary lectin proteins such as the griffithsin variant M78Q (Q-GRFT; SEQ ID NO: 4), a GRFT dimer (fusion) protein (GRFT.op1-dimer; SEQ ID NO: 6) and the K. alvarezii KAA-2 lectin (SEQ ID NO: 8), as shown in FIG.1. Likewise, Example 2 generally describes the design and construction of vectors for expressing other heterologous lectin proteins (e.g., see FIG. 2 and TABLE 1), such as the wild-type Musa acuminate lectin (Banlec; SEQID NO: 23), the wild- type H. annuus lectin (SEQ ID NO: 78), the wild-type Renouxia sp. lectin (AYR06195; SEQ ID NO: 25), the wild-type Artocarpus integrifolia lectin (Jacalin; SEQ ID NO: 27), the wild-type Nostoc ellipsosporum lectin (CV-N; SEQ ID NO: 29), the wild-type Microcystis viridis lectin (MVL; SEQ ID NO: 31), the wild- type Microcystis aeruginosa PCC7806 lectin (MVN; SEQ ID NO: 33) and the wild-type human DCSIGN lectin (SEQ ID NO: 35). Example 3 further describes methods for integrating lectin expression cassettes into the genome of suitable filamentous fungal host cells (e.g., via Cas9 guided, targeted integration).
[0194] As set forth in Example 4, screening of the lectin expression clones (Examples 1-3) was initially performed in small-scale cultures (24-well Microtiter plates) for five days at 28°C and assessed via SDS- PAGE analysis (e.g., see FIG. 4-FIG. 7). For instance, as presented in FIG. 4 (no pH 2 treatment) and FIG. 5 (pH 2 treatment), expression analysis of Trichoderma host strains transformed with integration cassette HRD1 (see, TABLE 2) were evaluated, wherein 5 μL of the culture supernatants from each clone were loaded on SDS-PAGE gel (FIG.4 and FIG.5). As shown in FIG.4, lanes 1-5 are clones from codon optimized griffithsin sequence-op2 (GRFT-1 through GRFT-5); lanes 6-8 are clones from codon optimized griffithsin sequence-op1 (GRFT-6 through GRFT-8); lane 9 contains the codon optimized M78Q (op1) variant and lane 10 contains the empty host strain (T. reesei). For example, as indicated by the red arrows in the gel image (FIG. 4), lanes 1-9 each contain a protein band at approximately (~) 14kDa, which is similar to the molecular weight of the griffithsin (GRFT) protein (~12.7 kDa).
[0195] Likewise, as shown in FIG. 5, some of the small-scale cell cultures were treated at pH 2 in order to access purification the lectins based on their stability at lower pH ranges. In particular, small-scaleNB42133-WO-PCT[2] cultures of GRFT codon optimized sequences “op1” and “op2”, and the codon optimized GRFT variant (M78Q; op1) were incubated in 100 mM NaH2PO4buffer at pH 2 for two hours at 28°C, the cultures centrifuged, and the supernatants analyzed by SDS-PAGE (FIG. 5). For instance, as indicated by the red arrows in the gel image (FIG.5), lanes 1-11 contain a protein band at ~14 kDa (i.e., similar to the molecular weight (~12.7 kDa) of the GRFT), wherein the intensities of the (14 kDa) bands are generally higher than the (14 kDa) bands in FIG. 4 (with no pH 2 treatment), indicating that the GRFT protein can be partially purified by low pH treatments (e.g., about pH 2). In addition, clones with “op1” GRFT codon optimization (i.e., based on the enhanced small-scale screening expression profile vs. “op2”) were selected for further study in two-liter bioreactors, such as the GRFT-op1 strain named “BFZ25”.
[0196] Using a similar small-scale culture screening process, Trichoderma transformants comprising different integration cassettes (e.g., see TABLE 2) were assessed, such as strain BFZ72 encoding a GRFT fusion protein (e.g., CBH1core-KEX2-GRFT.op1-linker-GRFT.op1) and strain BFZ27 encoding a KAA-2 fusion protein (CBH1core-KEX2-KAA2). More particularly, as generally set forth in FIG. 6 and FIG.7, results from the small-scale expression screening of additional lectins in T. reesei included GRFT, Q-GRFT, CV-N, MVL, SVN, DCSIGN, KAA-1, EDA2, MPA-2, ConA, Jacalin, BanLec, OAA, ESA-2, MVN, and Galectin-1, which were expressed under control of the chb1 promoter (Pcbh1) and comprise a starch- binding domain (CBM21) fusion.
[0197] As described in Example 5, the production of secreted lectins were further assessed via fed-batch fermentations performed in two-liter bioreactors. More particularly, as set forth in Example 5, fed-batch fermentations were performed on T. reesei strain BFZ25 (Pcbh1-GRFT.op1) for expression of the griffithsin (GRFT) monomer under control of the cbh1 promoter (Pchb1), T. reesei strain BFZ72 (Pcbh- cbh1core-Kex2-GRFT.op1-linker-GRFT.op1) for expression of the griffithsin (GRFT) dimer as a fusion protein to Cbh1 core protein (CBH1core) and Kex2 linker (KEX2) under control of the cbh1 promoter (Pcbh1) and T. reesei strain BFZ27 (Pcbh1-cbh1core-KEX2-KAA) for expression of the KAA-2 lectin (KAA) as a fusion protein to Cbh1 core protein (CBH1core) and Kex2 linker (KEX2) under the control of the cbh1 promoter (Pcbh1). For example, as described in Example 5 and presented in FIG.8, whole broth samples of the fed-batch fermentations were taken every twenty-four (24) hours, wherein the total fermentation time was 188 hours. As shown in FIG. 8, the total soluble proteins secreted in the fermentation run were plotted versus the effective fermentation time (EFT, hours) for the three fermentation runs (strains BFZ25, BFZ27 and BFZ72). Likewise, the fermentation supernatants were analyzed by SDS- PAGE as shown in FIG.9, wherein the major protein bands were detected at ~12.7 kDa (GRFT monomer), ~25.8 kDa (GRFT dimer), ~27.9 kDa (KAA-2). The presence of the GRFT monomer, GRFT dimer and KAA-2 was further confirmed by protein mass spectrometry analysis of the total secreted proteins in theNB42133-WO-PCT[2] fermentation culture supernatants, wherein total protein secretion titers at the end of the 188-hour fermentation run are shown in TABLE 4 (Example 5).
[0198] Example 6 of the disclosure further describes the design, construction, and evaluation of exemplary filamentous fungal strains expressing / producing other heterologous lectins. More particularly, Example 6 describes polynucleotides (expression cassettes) encoding heterologous lectins such as jacalin-like lectins, CVN-like lectins, OAA-like lectins, ricin-like lectins, galectin-1 like lectins, SVN-like lectins, DC-SIGN- like lectins, and ConA-like lectins, which polynucleotide cassettes (e.g., see FIG. 10 and FIG. 11) were introduced into exemplary filamentous fungal cells and evaluated in 96-well plates and 1-liter bioreactors. For example, as shown in FIG.12 and FIG.13, expression of the griffithsin, jacalin-like, CVN-like, OAA- like, ricin-like, galectin-like, SVN-like, DC-SIGN, ConA-like lectins in the broth supernatants was evaluated via SDS-PAGE. As presented FIG.12 and FIG.13, the griffithsin (monomer) proteins, jacalin- like lectins, CVN-like lectins, and DC-SIGN-like lectin appear as single bands with a molecular weight between about 10 kDa to16 kDa, and the OAA-like lectins appear as a single band with a molecular weight between about 10 kDa to 40 kDa.
[0199] Thus, as briefly set forth above and further described in the following sections, the instant disclosure demonstrates that recombinant filamentous fungal cells are particularly suitable host expression systems for the production of heterologous lectins, which was surprising and unexpected in view of the current state of the lectin art, i.e., recombinant lectins produced and recovered from plant expression systems (e.g., tobacco) and / or recombinant lectins produced and recovered from Gram-negative expression systems (e.g., E. coli). More particularly, the instant disclosure addresses various ongoing and unmet needs in the art for improved host organisms capable of producing heterologous lectins for various anti-microbial uses, as well as ongoing and unmet needs for novel methods and compositions enabling the cost-effective industrial scale production, recovery and / or purification of lectins. Thus, certain one or more embodiments of the disclosure are related to, inter alia, recombinant filamentous fungal (host) cells producing heterologous lectins, fermenting host cells expressing heterologous lectins, industrial scale production of lectins, the recovery and purification of one or more lectins produced and the like. For instance, in certain embodiments, recovery and purification of a lectin may be performed as generally described below in Example 7. In certain other embodiments, fermentation and recovery of lectins may be performed as generally described below in Section IV (Fermentation and Recovery of Lectins).
[0200] Thus, in certain other embodiments, the disclosure provides methods for assaying the hemagglutination activity of lectins. In particular, lectin hemagglutination capability (activity) was evaluated using erythrocytes from fifteen (15) different animal sources (i.e., dog, rabbit, guinea pig, mouse, rat, human, chicken, turkey, duck, goose, pig, bovine, horse, sheep, and goat) as described in Example 8. For instance, as presented in FIG. 14 and FIG. 15, the hemagglutination activity of lectin samples couldNB42133-WO-PCT[2] be easily determined by visually distinguishing the even suspension with no signs of clumping in wells for hemagglutination-positive (+) samples and a sediment button at the bottom of the wells for hemagglutination-negative (-) samples. More particularly, as shown in FIG. 15, the most significant positive results were recorded in FIG.15 and the corresponding effective animal erythrocytes summarized in TABLE 6 (Example 8).
[0201] Thus, as contemplated and described herein, certain embodiments of the disclosure are related to, inter alia, nucleic acids encoding lectin proteins, recombinant cells expressing / producing one or more lectin proteins, the recovery of lectin proteins, the purification of lectin proteins, lectin (protein) preparations and the like. More particularly, in certain embodiments, native and / or variant lectin proteins and / or DNA (nucleic acid) sequences encoding the same, may be derived / obtained from known lectin proteins. In certain aspects, lectin proteins are derived from a host organism which naturally produces the lectin protein. Thus, in certain embodiments, a lectin protein of the disclosure is derived from a eukaryotic cell, or a cyanobacterial cell. In certain aspects, a eukaryotic cell is photosynthetic plant cell, an insect cell or an animal cell.
[0202] In certain embodiments, a lectin protein may be derived from one or more of the antiviral lectins described in US Patent Publication Nos. US20040204365, US20020127675, US20110189105 and US20110263485, and / or PCT Publication Nos. WO2005 / 118627, WO2008 / 022303, WO2010 / 014248, WO2014 / 197650, WO2016 / 130628 and WO2019 / 108656 (each incorporated herein by reference in its entirety). Thus, in certain aspects, a lectin protein is a scytovirin (SVN), a griffithsin (GRFT), a cyanovirin- N (CVN), functional fragments thereof, and / or functional variants (mutants) thereof.
[0203] In other embodiments, a lectin protein is one or more of the antiviral lectins described in PCT Publication No. WO2019 / 108656, such as the Artocarpus heterophyllus (jacalin) lectin, the Musa acuminata (banana) lectin, the Boodlea coacta lectin, the Microcystis viridis lectin, etc. and / or functional fragments thereof, and / or functional variants thereof that retain the ability to bind to carbohydrates on viral envelopes described therein.
[0204] In other embodiments, a lectin protein is derived from a eukaryotic lectin source described in Singh and Sarathi (2012), including but not limited to, the Aaptos papilleta (Sponge) lectin, the Abrus precatorius (Jequirty bean) lectin, the Aegapodium podagraria (Ground elder) lectin, the Agaricus bisporus (Common mushroom) lectin, the Albizzia julibrissin (Mimosa tree seed) lectin, the Allomyrina dichotoma (Japanese beetle) lectin, the Aloe arborescens (Aloe plant) lectin, the Amphicarpaea bracteata (Hog peanut) lectin, the Anguilla Anguilla (Eel) lectin, the Aplysia depilans (Mollusca; Mediterranean sea) lectin, the Arachis hypogaea (Peanut) lectin, the Artocarpus heterophullus (Jacalin) lectin, the Bauhinia purpurea (Camel’s foot tree) lectin, the Bryonia diocia (White bryony) lectin, the Caragana Arborescens (Siberian pea tree) lectin, the Carcinoscorpius rotundacauda (Horseshoe crab) lectin, and / or functional fragments thereof,NB42133-WO-PCT[2] and / or functional variants thereof that retain the ability to bind to a specified carbohydrate (moiety) described in the Singh and Sarathi (2012) reference.
[0205] In certain aspects, a lectin protein of the disclosure may be classified into groups, including, but not limited to, “galactose (Gal)” specific lectins, “glucose (Glu)” specific lectins, “fucose (Fuc)” specific lectins, “mannose (Man)” specific lectins, “N-acetylgalactosamine (GalNAc)” specific lectins, “N- acetylglucosamine (GluNAc)” specific lectins, “sialic acid” specific lectins, and the like.
[0206] Thus, in certain aspects, lectins suitable for use according of the instant disclosure may be derived / isolated from eukaryotic lectin source organisms. For example, in certain embodiments, a lectin (protein) can be isolated from the eukaryotic (source) organism using affinity chromatography processes known to one of skill in the art (i.e., one of the aforementioned carbohydrate moieties (Gal, Man, GalNAc, etc.) are attached the inert (chromatographic) matrix such that lectin proteins having binding specificity to the carbohydrate moiety will be retained.
[0207] In certain other embodiments, a lectin protein is a microvirin (MVN) lectin derived from the cyanobacterium Microcystis aeruginosa (PCC7806), which MVN lectin comprises mannose-specific affinity. For example, as described in Breitenbach Barroso Coelho et al. 2018 (incorporated herein by reference), the MVN lectin can inhibit HIV-1 infection, syncyntium formation between infected and uninfected CD4 T cells, and HIV-1 transmission. In other embodiments, a lectin protein is a scytovirin (SVN) derived from the cyanobacterium Scytonema varium, which binds with high affinity to mannose residues on the envelope glycoproteins of viruses and inhibits the virus replication, as observed with the Zaire Ebola virus (e.g., see Breitenbach Barroso Coelho et al., 2018). In yet other aspects, a lectin protein is an ESA-2 lectin derived from the red alga Eucheuma serra, which ESA-2 lectin exhibits anti-HIV activity and potent inhibition on influenza A virus (H1N1) infection (e.g., see Breitenbach Barroso Coelho et al., 2018). In another embodiment, a lectin protein is a BanLec (jacalin-related) lectin derived from the fruit of bananas (Musa acuminate), which recognizes high-mannose glycans found on viral envelopes such as HIV-1 (e.g., see Breitenbach Barroso Coelho et al., 2018).
[0208] In certain other embodiments, a lectin protein is a mannose-binding plant lectin derived from the rhizomes of Aspidistra elatior (AEL) which has been demonstrated to have significant in vitro inhibitory activity against the vesicular stomatitis virus, Coxsackie virus B4 and respiratory syncytial virus (e.g., see Breitenbach Barroso Coelho et al., 2018).
[0209] In certain other embodiments, a lectin protein is a CVL lectin (β-galactose-specific) derived from the marine worm Chaetopterus variopedatus having anti-HIV-1 activity (e.g., see Breitenbach Barroso Coelho et al., 2018).
[0210] In certain other embodiments, a lectin protein of the disclosure may be derived from the seeds of Vicia faba (fava bean), Lens culinaris (lentil), and Pisum sativum (pea), as generally described in El-ArabyNB42133-WO-PCT[2] et al., 2020 (incorporated herein by reference). As generally set forth in the El-Araby et al. (2020) reference, crude extracts of the three leguminous were purified by affinity chromatography using mannose agarose, wherein the purified fava bean, lentil, and pea lectins comprised molecular weights of 18 kDa, 14 kDa, and 17 kDa, respectively, as determined by amino acid sequence analysis. For example, the minimum inhibitory concentration (MIC) values of these purified lectins when tested against bacteria (Pseudomonas aeruginosa, Staphylococcus aureus, Klebsiella pneumonia) and fungi (Candida albicans) ranged from 1.95 µg / ml to 250 µg / ml.
[0211] In another embodiment, a lectin protein of the disclosure is an antitumoral (anticancer) lectin derived from Viscum album (Mistletoe), such as the mistletoe lectin I (MLI) and mistletoe lectin III (MLIII) B-subunits described in Pevzner et al., 2004, and Gengenbach et al., 2019 (incorporated herein by reference).
[0212] As contemplated herein, native lectins and / or one or more variant lectins derived therefrom may be assessed for function or activity by means including, but not limited to, hemagglutination activity assays (Example 8), carbohydrate / glycan binding affinity assays, antimicrobial inhibition assays, combinations thereof and the like, as set forth and described in El-Araby et al. (2020). Thus, in certain aspects, native lectins and / or variant lectins of the disclosure comprise antimicrobial activity (e.g., antiviral activity, antifungal activity, antibacterial activity).
[0213] Thus, certain embodiments of the disclosure provide recombinant filamentous fungal cells expressing one or more heterologous nucleic acids (polynucleotides) encoding lectin proteins. In certain embodiments, a recombinant filamentous fungal cell expresses a heterologous polynucleotide encoding native a lectin protein, or a functional variant derived from the native lectin protein. In certain aspects, heterologous polynucleotides encoding lectin proteins are expression cassettes introduced into the recombinant cell. In certain embodiments, at least one expression cassette is introduced in the filamentous fungal cell. In other embodiments, at least two expression cassettes are introduced in the filamentous fungal cell. For example, FIG. 3 presents schematic diagrams of exemplary lectin polynucleotide cassettes suitable for extracellular expression / secretion (e.g., FIG.3A-3B) of lectin proteins. Thus, in certain aspects filamentous fungal host cells of the disclosure comprise one or more lectin expressions cassette introduced therein, wherein the host cells express and secrete the lectins when cultivated under suitable conditions.
[0214] In certain embodiments, filamentous fungal cells / strains of the disclosure are selected, derived, or obtained from Ascomycete fungal cells. Examples of Ascomycete (filamentous) fungal cells include, but are not limited to, the subphylum Pezizomycotina, such as Trichoderma sp., Aspergillus sp., Myceliophthora sp. and Penicillium sp. In other embodiments, filamentous fungi include, without limitation, Acremonium, Aspergillus, Emericella, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Scytalidium, Thielavia, Tolypocladium, or Trichoderma species.NB42133-WO-PCT[2]
[0215] In some embodiments, the filamentous fungus is an Aspergillus sp. such as Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae.
[0216] In some embodiments, the filamentous fungus is a Fusarium sp. such as Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, and the like.
[0217] In other embodiments, the filamentous fungus is Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Scytalidium thermophilum, Thielavia terrestris and the like.
[0218] In yet other embodiments, the filamentous fungus is a Trichoderma sp. such as Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, Trichoderma viride and the like. III. RECOMBIANT POLYNUCLOETIDES AND MOLECULAR BIOLOGY
[0219] As set forth above, certain embodiments of the disclosure are related to modified filamentous fungal strains expressing / producing / secreting heterologous lectin proteins. Thus, certain embodiments of the disclosure are related to, inter alia, molecular biology, genetic modifications, polynucleotides, genes, gene coding sequences (CDS), ORFs, vectors, expression cassettes, fusion proteins, protein linker sequences, cleavable protein linker sequences and the like.
[0220] In certain embodiments, expression cassettes include or comprise nucleic acid (DNA) sequence(s) encoding fusion proteins, such as upstream (5′) DNA fused sequences (N-terminal fusions) and / or downstream (3′) DNA fused sequences (C-terminal fusions), and the like.
[0221] In other embodiments, one or more expression cassettes are integrated into the genome of the filamentous fungal cell. In certain embodiments, filamentous fungal cells comprise at least two introduced expression cassettes encoding the same or different lectin proteins. In certain other embodiments, recombinant filamentous fungal cells are rendered deficient in the production of one or more endogenous genes encoding one or more proteases. In certain embodiments, one or more proteases include, but are not limited to, subtilisin-like serine proteases, aspartic proteases, trypsin-like serine proteases, glutamic proteases, and aminopeptidases. As described herein, various molecular biology methodologies are available (e.g., gene disruptions, gene deletions, down-regulated genes, etc.) for rendering filamentous fungal strains deficient in the expression / production of such secreted proteases. For example, as contemplated herein, to mitigate protease degradation of lectin proteins secreted into the fermentation broth,NB42133-WO-PCT[2] in certain embodiments, it may be advantageous to eliminate (or reduce) production of these highly expressed and secreted proteases.
[0222] In other embodiments, recombinant filamentous fungal cells comprise one or more introduced expression cassettes encoding protease inhibitors. A non-limiting example of a protease inhibitor protein is the native “barley amylase subtilisin inhibitor” (BASI) protein. In certain one or more embodiments, the wild-type gene encoding the protease inhibitor (e.g., BASI) is codon optimized for expression in a filamentous fungal cell, wherein the protease inhibitor is secreted into the fermentation broth. Other suitable protease inhibitors and genes encoding same are known in the art and may be used to mitigate unwanted / undesirable protease degradation of the lectin protein secreted into the fermentation broth.
[0223] In certain other embodiments, recombinant filamentous fungal cells are rendered deficient in the production of one or more endogenous genes encoding one or more lignocellulosic degrading enzymes. In certain embodiments, one or more secreted lignocellulosic degrading enzymes include, but are not limited to, cellobiohydrolases (e.g., CBH1, CBH2), endoglucanases (e.g., EG1, EG2), β-glucosidases (BG), and xylanases (e.g., XYL). As described herein, various molecular biology methodologies are available (e.g., gene disruptions, gene deletions, down-regulated genes, etc.) for rendering filamentous fungal strains deficient in the expression / production of such secreted lignocellulosic degrading enzymes. For example, as contemplated herein, to reduce burden on the filamentous fungal cell’s protein expression / secretion pathways, in certain embodiments, it may be advantageous to eliminate (or reduce) production of these highly expressed and secreted lignocellulosic degrading enzymes.
[0224] In certain embodiments, the disclosure provides recombinant nucleic acids (polynucleotides) comprising a gene or gene CDS encoding a lectin protein. In particular, certain embodiments provide polynucleotide constructs (e.g., expression cassettes) encoding lectin proteins for the expression and secretion of the lectin protein into the media / fermentation broth. In certain aspects, one or more expression cassettes for the secretion of a lectin protein may be generically presented by one or more schematics.
[0225] For example, an expression cassette encoding a secreted lectin protein may be presented schematically as: 5′-[pro]-[sig-seq]-[lectin CDS]-3′; wherein the expression cassette comprises (in the 5′ to 3′ direction) a promoter (pro) region sequence operably linked to a nucleic acid (sig-seq) encoding a protein (signal) secretion sequence operably linked to a nucleic acid (lectin CDS) encoding the lectin protein. In certain embodiments, the promoter (pro) region sequence is a strong promoter functional in the host filamentous fungal strain. As an example, strong promoters (pro) region sequences functional in Trichoderma sp. fungal cells include, but are not limited to, the T. reesei cellobiohydrolase promoters (e.g., Pcbh1, Pcbh2), xylanase promoters (e.g., xyn3), glucoamylase promoters (e.g., gla1), endoglucanase promoters (e.g., egl2), etc. Although certain promoter (pro) sequences are exemplified herein, one of skill in the art may screen, identify, and select other suitable promotor sequences active / functional in the hostNB42133-WO-PCT[2] filamentous fungal cell. Likewise, although certain protein (signal) secretion sequences (sig-seq) are exemplified herein (e.g., Cbh1 secretion sequence (SEQ ID NO: 15), Pep1 secretion sequence (SEQ ID NO: 16), one of skill in the art may screen, identify, and select other suitable protein signal / secretion sequences functional in filamentous fungal cells. For example, in certain aspects, lectin protein secretion in one or more filamentous fungal cells of the disclosure can be identified using one or more signal (secretion) peptide sequences from highly secreted filamentous fungal proteins known in the art. In certain other embodiments, lectin protein secretion in one or more filamentous fungal cells may be screened and identified by reference to one or more native protein secretion / signal sequences and functional variants thereof, including, but not limited to, a Talaromyces sp. β-mannanase secretion sequence, a Talaromyces sp. glucoamylase secretion sequence, a Trichoderma sp. Cbh2 secretion sequence, a Trichoderma sp. glucoamylase secretion sequence, a Humicola sp. Cel45 secretion sequence, a Neurospora sp. chitin synthase secretion sequence, an Aspergillus sp. α-galactosidase (GlaA) secretion sequence, an Aspergillus sp. PepN secretion sequence, a Trichoderma harzianum aspartyl protease (PapA) secretion sequence, a Myceliophthora sp. IMI 387099 Xylanase secretion sequence, and the like.
[0226] In certain other embodiments, one or more cassettes comprise one or more upstream (N-linkers) and / or downstream (C-linkers) nucleic acids encoding one or more (protein / peptide / amino acid) linker amino acid sequences. In certain embodiments, a protein / peptide / amino acid linker sequence is a cleavable sequence (e.g., a KEX2 cleavage site). For example, during protein secretion in a fungal cell, certain proteins are cleaved by KEX2, a member of the KEX2 or “kexin' family of serine peptidase (EC 3.4.21.61). As described in US Patent Publication No. US2014 / 0024067 and US Patent No. 8,936,917 (each incorporated herein by reference in its entirety), KEX2 is a highly specific calcium-dependent endopeptidase that cleaves the peptide bond immediately C-terminal to a pair of basic amino acids (the “KEX2 site”) in a protein substrate (e.g., lectin) during secretion of that (lectin) protein. For example, KEX2 (cleavage) sites may be included in the construction of expression cassettes encoding one or more lectin proteins, as generally described in US Patent Publication No. US2014 / 0024067. Likewise, US Patent No. 8,936,917 describes a modified KEX2 cleavage site with a pre-sequence (VAVE) that improves the cleavage efficiency at the KEX2 site following the pre-sequence. Although the KEX2 cleavage site has been exemplified, other protease cleavage sites functional in filamentous fungal cells can be used for the cleavage of a peptide linker between a protein fusion partner and the lectin protein. Examples of additional protease cleavable linkers include, but are not limited to, STE13 described in La Maquer et al. (2019) and the self-cleaving 2A peptide described in Subramanian et al. (2017).
[0227] In other embodiments, one or more cassettes encoding a lectin protein comprise a terminator region sequence (term) operably linked and positioned at the 3′ end.NB42133-WO-PCT[2]
[0228] In certain embodiments, a polynucleotide of the disclosure may comprise one or more selectable markers. Selectable markers for use in filamentous fungi include, but are not limited to, alsl, amdS, hygR, pyr2, pyr4, pyrG, sucA, a bleomycin resistance marker, a blasticidin resistance marker, a pyrithiamine resistance marker, a chlorimuron ethyl resistance marker, a neomycin resistance marker, an adenine pathway gene, a tryptophan pathway gene, a thymidine kinase marker and the like. In a particular embodiment, the selectable marker is pyr2, which compositions and methods of use are generally set forth in PCT Publication No. WO2011 / 153449.
[0229] Standard techniques for transformation of filamentous fungi and culturing the fungi (which are well known to one skilled in the art) are used to transform a fungal host cell of the disclosure. Thus, the introduction of a DNA construct or vector into a fungal host cell includes techniques such as transformation, electroporation, nuclear microinjection, transduction, transfection (e.g., lipofection mediated and DEAE- Dextrin mediated transfection), incubation with calcium phosphate DNA precipitate, high velocity bombardment with DNA-coated micro-projectiles, gene gun or biolistic transformation, protoplast fusion and the like. General transformation techniques are known in the art.
[0230] Often, transformation of Trichoderma sp. fungal cells uses protoplasts or cells that have been subjected to a permeability treatment, typically at a density of 105to 107per mL, particularly about 2x106 / mL. A volume of 100 μL of these protoplasts or cells in an appropriate solution (e.g., 1.2 M sorbitol and 50 mM CaCl2) is mixed with the desired DNA. Generally, a high concentration of polyethylene glycol (PEG) is added to the uptake solution. Additives, such as dimethyl sulfoxide, heparin, spermidine, potassium chloride and the like, may also be added to the uptake solution to facilitate transformation. Similar procedures are available for other fungal host cells (e.g., see US6,022,725 and US6,268,328, both of which are incorporated by reference).
[0231] Thus, the methods and compositions of instant disclosure generally rely on routine techniques in the field of recombinant genetics. For example, in certain embodiments, a gene encoding a heterologous lectin protein of interest is introduced into a filamentous fungal (host) cell. In certain embodiments, the gene (or gene CDS) is cloned into an intermediate vector, before being transformed into a filamentous fungal (host) cell for replication and / or expression. These intermediate vectors can be prokaryotic vectors, such as, e.g., plasmids, or shuttle vectors. In certain embodiments, the expression of the gene or gene CDS encoding the lectin protein is under the control of a heterologous promoter, which can be a heterologous constitutive promoter or a heterologous inducible promoter, particularly a strong promoter capable of over- expressing the lectin protein.
[0232] The expression vector typically contains a transcription unit or “expression cassette” that contains all the additional elements required for the expression of the heterologous sequence. For example, a typical expression cassette contains an upstream (5′) promoter operably linked to a nucleic acid sequence encoding aNB42133-WO-PCT[2] protein of interest and may further comprise nucleic acid sequences encoding protein (signal) secretion sequences, nucleic acid sequences required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination sequences. Additional elements of the cassette may include enhancers and, if genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.
[0233] In addition to a promoter sequence, the expression cassette may also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes. Although any fungal terminator is likely to be functional in the present invention, preferred terminators include: the terminator from Trichoderma cbh1 gene, the terminator from Aspergillus nidulans trpC gene and the Aspergillus awamori or Aspergillus niger glucoamylase genes.
[0234] The particular expression vector used to transport the genetic information into the cell is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells may be used. Standard bacterial expression vectors include bacteriophages λ and M13, as well as plasmids such as pBR322 based plasmids, pSKF, pET23D, and fusion expression systems such as MBP, GST, and LacZ. Epitope tags can also be added to recombinant proteins to provide convenient methods of isolation, e.g., c-myc.
[0235] The elements that can be included in expression vectors may also be a replicon, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, or unique restriction sites in nonessential regions of the plasmid to allow insertion of heterologous sequences. The particular antibiotic resistance gene chosen is not dispositive either, as any of the many resistance genes known in the art may be suitable. The prokaryotic sequences are preferably chosen such that they do not interfere with the replication or integration of the DNA in the filamentous fungal host.
[0236] The methods of transformation of the present invention may result in the stable integration of all or part of the transformation vector into the genome of the filamentous fungus. However, transformation resulting in the maintenance of a self-replicating extra-chromosomal transformation vector is also contemplated. Many standard transfection methods can be used to produce filamentous fungal cell lines that express large quantities of the heterologous protein, and as such, any of the known procedures for introducing foreign nucleotide sequences into fungal host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, biolistics, liposomes, microinjection, plasma vectors, viral vectors, and any of the other known methods for introducing cloned genomic DNA, cDNA, synthetic DNA, or other foreign genetic material into a host cell. Also of use is the Agrobacterium-mediated transfection method such as the one described in U.S. Patent No. 6,255,115.
[0127] After the expression vector is introduced into the cells, the transformed cells are cultured under conditions favoring expression of gene. Large batches of transformed cells can be cultured as describedNB42133-WO-PCT[2] herein. Finally, the protein product is recovered from the culture using standard techniques. Thus, the disclosure provides for the expression and enhanced production of desired proteins of interest, as described herein.
[0237] In certain one or more embodiments or aspects of the disclosure, filamentous fungal cells (strains) may comprise one or more genetic modifications, including, but is not limited to, (a) the introduction, substitution, or removal of one or more nucleotides in a gene (gene CDSs, or ORF thereof), or the introduction, substitution, or removal of one or more nucleotides in a regulatory element required for the transcription or translation of the gene (gene CDS or ORF), (b) a gene disruption, (c) a gene conversion, (d) a gene deletion, (e) a gene down- regulation, (f) specific mutagenesis and / or (g) random mutagenesis of a gene (gene CDS or ORF thereof).
[0238] As generally set forth above and described hereinafter, one skilled in the art may readily perform one or more genetic modifications and construct recombinant / modified / variant filamentous fungal strains thereof, by reference to one or more nucleic acid sequences and / or protein sequence disclosed herein. For example, gene deletion techniques enable the partial or complete removal of the gene, thereby eliminating or reducing expression / production of the protein, and / or thereby eliminating or reducing expression / production the encoded protein. In such methods, the deletion of the gene may be accomplished by homologous recombination using an integration plasmid / vector that has been constructed to contiguously contain the 5′ and 3′ regions flanking the gene. The contiguous 5′ and 3′ regions may be introduced into a filamentous fungal cell, for example, on an integrative plasmid / vector in association with a selectable marker to allow the plasmid to become integrated in the cell.
[0239] In other embodiments, a modified strain of filamentous fungus comprises genetic modifications which disrupt or inactivate a gene of interest. Exemplary methods of gene disruption / inactivation include disrupting any portion of the gene, including the polypeptide coding sequence (CDS), promoter, enhancer, or another regulatory element, which disruption includes substitutions, insertions, deletions, inversions, and combinations thereof and variations thereof. A non-limiting example of a gene disruption technique includes inserting (integrating) into one or more of the genes of the disclosure an integrative plasmid containing a nucleic acid fragment homologous to the gene of interest, which will create a duplication of the region of homology and incorporate (insert) vector DNA between the duplicated regions. In certain other non-limiting examples, a gene disruption technique includes inserting into a gene of interest an integrative plasmid containing a nucleic acid fragment homologous to the gene of interest, which will create a duplication of the region of homology and incorporate (insert) vector DNA between the duplicated regions, wherein the vector DNA inserted separates, e.g., the promoter of the gene from the protein coding region, or interrupts (disrupts) the coding, or non-coding, sequence of the gene, resulting in an enhanced protein productivity phenotype. A disrupting construct may be a selectable marker gene (e.g., pyr2) accompanied by 5′ and 3′ regions homologous to the gene of interest. The selectable marker enables identification of transformants containing the disruptedNB42133-WO-PCT[2] gene. Thus, in certain embodiments, gene disruption includes modification of control elements of the gene, such as the promoter, ribosomal binding site (RBS), untranslated regions (UTRs), codon changes, and the like.
[0240] In other embodiments, a modified strain of filamentous fungus is constructed (i.e., genetically modified) by introducing, substituting, or removing one or more nucleotides in the gene, or a regulatory element required for the transcription or translation thereof. For example, nucleotides may be inserted or removed so as to result in the introduction of a pre-mature stop codon, the removal of the start codon, or a frame-shift of the open reading frame (ORF). Such a modification may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art.
[0241] In other embodiments, a modified strain of filamentous fungus is constructed by the process of gene conversion. For example, in the gene conversion method, a nucleic acid sequence corresponding to the target gene is mutagenized in vitro to produce a defective nucleic acid sequence, which is then transformed into the parental cell to produce a variant cell comprising a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous gene. It may be desirable that the defective gene or gene fragment also encodes a marker which may be used for selection of transformants containing the defective gene. For example, the defective gene may be introduced on a non- replicating or temperature- sensitive plasmid in association with a selectable marker. Selection for integration of the plasmid is affected by selection for the marker under conditions not permitting plasmid replication. Selection for a second recombination event leading to gene replacement is affected by examination of colonies for loss of the selectable marker and acquisition of the mutated gene.
[0242] In other embodiments, a modified strain of filamentous fungus is constructed by established anti- sense (gene-silencing) techniques, using a nucleotide sequence complementary to the nucleic acid sequence of the gene of interest. More specifically, expression of a gene by a filamentous fungus strain may be reduced (down-regulated) or eliminated by introducing a nucleotide sequence complementary to the nucleic acid sequence of the gene, which is transcribed in the cell and is capable of hybridizing to the mRNA produced in the cell. Under conditions allowing the complementary anti-sense nucleotide sequence to hybridize to the mRNA, the amount of protein translated is thus reduced or eliminated. Such anti-sense methods include, but are not limited to, RNA interference (RNAi), small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, and the like, all of which are well known to the skilled artisan.
[0243] In other embodiments, a modified strain of filamentous fungus is constructed by random or specific mutagenesis using methods well known in the art, including, but not limited to, chemical mutagenesis and transposition. Modification of the gene may be performed by subjecting the parental cell to mutagenesis and screening for mutant cells in which expression of the gene has been reduced or eliminated. The mutagenesis, which may be specific or random, may be performed, for example, by use of a suitable physical or chemicalNB42133-WO-PCT[2] mutagenizing agent, use of a suitable oligonucleotide, or subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the mutagenesis may be performed by use of any combination of these mutagenizing methods. Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N- nitrosoguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues. When such agents are used, the mutagenesis is typically performed by incubating the parental cell to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions and selecting for mutant cells exhibiting reduced or no expression of the gene.
[0244] In certain other embodiments, a modified strain of filamentous fungus is constructed by means of site-specific gene editing techniques. For example, in certain embodiments, a variant strain of filamentous fungus is constructed (i.e., genetically modified) by use of transcriptional activator like endonucleases (TALENs), zinc-finger endonucleases (ZFNs), homing (mega) endonuclease and the like. More particularly, the portion of the gene to be modified (e.g., a coding region, a non-coding region, a leader sequence, a pro- peptide sequence, a signal sequence, a transcription terminator, a transcriptional activator, or other regulatory elements required for expression of the coding region) is subjected genetic modification by means of ZFN gene editing, TALEN gene editing, homing (mega) endonuclease and the like, which modification methods are well known and available to one skilled in the art.
[0245] In certain other embodiments, a modified strain of filamentous fungus is constructed by means of CRISPR / Cas9 editing. More specifically, compositions and methods for fungal genome modification by CRISPR / Cas9 systems are described and well known in the art (e.g., see, PCT Publication Nos: WO2016 / 100571, WO2016 / 100568, WO2016 / 100272, WO2016 / 100562 and the like). Thus, a gene of interest can be disrupted, deleted, mutated, or otherwise genetically modified by means of nucleic acid guided endonucleases, that find their target DNA by binding either a guide RNA (e.g., Cas9) or a guide DNA (e.g., NgAgo), which recruits the endonuclease to the target sequence on the DNA, wherein the endonuclease can generate a single or double stranded break in the DNA. This targeted DNA break becomes a substrate for DNA repair and can recombine with a provided editing template to disrupt or delete the gene. For example, the gene encoding the nucleic acid guided endonuclease (e.g., a Cas9 from S. pyogenes, or a codon optimized gene encoding the Cas9 nuclease) is operably linked to a promoter active in the filamentous fungal cell and a terminator active in filamentous fungal cell, thereby creating a filamentous fungal Cas9 expression cassette. Likewise, one or more target sites unique to the gene of interest are readily identified by a person skilled in the art. For example, to build a DNA construct encoding a gRNA-directed to a target site within the gene of interest, the variable targeting domain (VT) will comprise nucleotides of the target site which are 5′ of the (PAM) proto-spacer adjacent motif (TGG), which nucleotides are fused to DNA encoding the Cas9NB42133-WO-PCT[2] endonuclease recognition domain for S. pyogenes Cas9 (CER). The combination of the DNA encoding a VT domain and the DNA encoding the CER domain thereby generate a DNA encoding a gRNA. Thus, a filamentous fungal expression cassette for the gRNA is created by operably linking the DNA encoding the gRNA to a promoter active in filamentous fungal cells and a terminator active in filamentous fungal cells.
[0142] In certain embodiments, the DNA break induced by the endonuclease is repaired / replaced with an incoming sequence. For example, to precisely repair the DNA break generated by the Cas9 expression cassette and the gRNA expression cassette described above, a nucleotide editing template is provided, such that the DNA repair machinery of the cell can utilize the editing template. For example, about 500bp 5′ of targeted gene can be fused to about 500bp 3′ of the targeted gene to generate an editing template, which template is used by the filamentous fungal host’s machinery to repair the DNA break generated by the RGEN (RNA-guided endonuclease).
[0246] The Cas9 expression cassette, the gRNA expression cassette and the editing template can be co- delivered to filamentous fungal cells using many different methods (e.g., protoplast fusion, electroporation, natural competence, or induced competence). The transformed cells are screened by PCR, by amplifying the target locus with a forward and reverse primer. These primers can amplify the wild-type locus or the modified locus that has been edited by the RGEN. These fragments are then sequenced using a sequencing primer to identify edited colonies.
[0247] Another way in which a gene of interest can be genetically modified is by altering the expression level of the gene of interest. For example, nuclease-defective variants of such nucleotide-guided endonucleases (e.g., Cas9 D10A, N863A or Cas9 D10A, H840A) can be used to modulate gene expression levels by enhancing or antagonizing transcription of the target gene. These Cas9 variants are inactive for all nuclease domains present in the protein sequence but retain the RNA-guided DNA binding activity (i.e., these Cas9 variants are unable to cleave either strand of DNA when bound to the cognate target site). Thus, the nuclease-defective proteins (i.e., Cas9 variants) can be expressed as a filamentous fungus expression cassette and when combined with a filamentous fungus gRNA expression cassette, such that the Cas9 variant protein is directed to a specific target sequence within the cell. The binding of the Cas9 (variant) protein to specific gene target sites can block the binding or movement of transcription machinery on the DNA of the cell, thereby decreasing the amount of a gene product produced. Thus, any of the genes disclosed herein can be targeted for reduced gene expression using this method. Gene silencing can be monitored in cells containing the nuclease defective Cas9 expression cassette and the gRNA expression cassette(s) by using methods such as RNAseq. IV. FERMENTATION AND RECOVERY OF LECTINS
[0249] As further detailed hereinafter and presented in the Examples, the instant disclosure describes and exemplifies particularly suitable processes (methods) for harvesting, clarifying, recovering, purifying andNB42133-WO-PCT[2] the like fermentation broths in which one or more lectin proteins have been secreted. Thus, certain embodiments are related to, inter alia, collecting broths at the end of fermentation, harvesting collected broths, recovering one or more lectins from a harvested broth (e.g., such as clarifying harvested broths, concentrating clarified broths, purifying clarified broth concentrates, etc.). In certain aspects, purified lectin (protein) preparations are derived from fermentation broths collected and harvested as described herein.
[0250] In certain one or more embodiments, the disclosure provides recombinant filamentous cells producing lectin proteins of interest. One or more embodiments are therefore related to cultivating (fermenting) filamentous fungal cells for the production of lectin proteins. In general, fermentation methods well known in the art are used to ferment the filamentous fungal cells. In some embodiments, the fungal cells are grown under batch or continuous fermentation conditions.
[0251] A classical batch fermentation is a closed system, where the composition of the medium is set at the beginning of the fermentation and is not altered during the fermentation. At the beginning of the fermentation, the medium is inoculated with the desired organism(s). In this method, fermentation is permitted to occur without the addition of any components to the system. Typically, a batch fermentation qualifies as a “batch” with respect to the addition of the carbon source, and attempts are often made to control factors such as pH and oxygen concentration. The metabolite and biomass compositions of the batch system change constantly up to the time the fermentation is stopped. Within batch cultures, cells progress through a static lag phase to a high growth log phase and finally to a stationary phase, where growth rate is diminished or halted. If untreated, cells in the stationary phase eventually die. In general, cells in log phase are responsible for the bulk of production of product.
[0252] A suitable variation on the standard batch system is the “fed-batch fermentation” system. In this variation of a typical batch system, the substrate is added in increments as the fermentation progresses. Fed-batch systems are useful when catabolite repression likely inhibits the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium. Measurement of the actual substrate concentration in fed-batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors, such as pH, dissolved oxygen, and the partial pressure of waste gases, such as CO2. Batch and fed-batch fermentations are common and well known in the art.
[0253] Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor, and an equal amount of conditioned medium is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density, where cells are primarily in log phase growth. Continuous fermentation allows for the modulation of one or more factors that affect cell growth and / or product concentration. For example, in one embodiment, a limiting nutrient, such as the carbon source or nitrogen source, is maintained at a fixed rate and all other parametersNB42133-WO-PCT[2] are allowed to moderate. In other systems, a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions. Thus, cell loss due to medium being drawn off should be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes, as well as techniques for maximizing the rate of product formation, are well known in the art of industrial microbiology.
[0254] In addition to the carbon and energy source, oxygen, assimilable nitrogen, and an inoculum of the microorganism, it is necessary to supply suitable amounts in proper proportions of mineral nutrients to assure proper microorganism growth, maximize the assimilation of the carbon and energy source by the cells in the microbial conversion process and achieve maximum cellular yields with maximum cell density in the fermentation media.
[0255] The composition of the aqueous mineral medium can vary over a wide range, depending in part on the microorganism and substrate employed, as is known in the art. The mineral media should include, in addition to nitrogen, suitable amounts of phosphorus, magnesium, calcium, potassium, sulfur, and sodium, in suitable soluble assimilable ionic and combined forms, and also present preferably should be certain trace elements such as copper, manganese, molybdenum, zinc, iron, boron, and iodine, and others, again in suitable soluble assimilable form, all as known in the art.
[0256] The fermentation reaction is an aerobic process in which the molecular oxygen needed is supplied by a molecular oxygen-containing gas such as air, oxygen-enriched air, or even substantially pure molecular oxygen, provided to maintain the contents of the fermentation vessel with a suitable oxygen partial pressure effective in assisting the microorganism species to grow in a thriving fashion.
[0257] The microorganisms also require a source of assimilable nitrogen. The source of assimilable nitrogen can be any nitrogen-containing compound or compounds capable of releasing nitrogen in a form suitable for metabolic utilization by the microorganism. While a variety of organic nitrogen source compounds, such as protein hydrolysates, can be employed, usually cheap nitrogen-containing compounds such as ammonia, ammonium hydroxide, urea, and various ammonium salts such as ammonium phosphate, ammonium sulfate, ammonium pyrophosphate, ammonium chloride, or various other ammonium compounds can be utilized. Ammonia gas itself is convenient for large scale operations and can be employed by bubbling through the aqueous ferment (fermentation medium) in suitable amounts. At the same time, such ammonia can also be employed to assist in pH control.
[0258] The pH range in the aqueous microbial ferment (fermentation admixture) should be in the exemplary range of about 2.0 to 8.0. With filamentous fungi, the pH normally is within the range of about 2.5 to 8.0; with T. reesei, the pH normally is within the range of about 3.0 to 7.0. Preferences for pH range of microorganisms are dependent on the media employed to some extent, as well as the particularNB42133-WO-PCT[2] microorganism, and thus change somewhat with change in media as can be readily determined by those skilled in the art.
[0170] In certain aspects, the fermentation is conducted in such a manner that the carbon- containing substrate can be controlled as a limiting factor, thereby providing good conversion of the carbon-containing substrate to cells and avoiding contamination of the cells with a substantial amount of unconverted substrate. The latter is not a problem with water-soluble substrates since any remaining traces are readily washed off. It may be a problem, however, in the case of non-water-soluble substrates, and require added product-treatment steps such as suitable washing steps.
[0259] As described above, the time to reach this level is not critical and may vary with the particular microorganism and fermentation process being conducted. However, it is well known in the art how to determine the carbon source concentration in the fermentation medium and whether or not the desired level of carbon source has been achieved.
[0260] The fermentation can be conducted as a batch or continuous operation, fed batch operation may be preferred for ease of control, production of uniform quantities of products, and most economical uses of all equipment.
[0261] If desired, part or all of the carbon and energy source material and / or part of the assimilable nitrogen source such as ammonia can be added to the aqueous mineral medium prior to feeding the aqueous mineral medium to the fermenter.
[0262] Each of the streams introduced into the reactor preferably is controlled at a predetermined rate, or in response to a need determinable by monitoring such as concentration of the carbon and energy substrate, pH, dissolved oxygen, oxygen, or carbon dioxide in the off-gases from the fermenter, cell density measurable by dry cell weights, light transmittancy, or the like. The feed rates of the various materials can be varied so as to obtain as rapid a cell growth rate as possible, consistent with efficient utilization of the carbon and energy source, to obtain as high a yield of microorganism cells relative to substrate charge as possible.
[0263] In either a batch, or the preferred fed batch operation, all equipment, reactor, or fermentation means, vessel or container, piping, attendant circulating, or cooling devices, and the like, are initially sterilized, usually by employing steam such as at about 121°C for at least about 15 minutes. The sterilized reactor then is inoculated with a culture of the selected microorganism in the presence of all the required nutrients, including oxygen, and the carbon-containing substrate. The type of fermenter employed is not critical.
[0264] The collection and purification of lectin proteins from the fermentation broth can be done by procedures known to one of skill in the art. For instance, as described above, the recombinant fungal strains of the disclosure can be constructed to secret one or more lectin proteins into the fermentation broth, simplifying the lectin protein recovery process (e.g., no cell lysis required), thereby reducing costsNB42133-WO-PCT[2] of lectin protein production. The fermentation broth will generally contain cellular debris, including cells, various suspended solids, and other biomass contaminants, as well as the desired lectin proteins, which are removed from the fermentation broth by means known in the art.
[0265] Thus, in certain aspects, a lectin protein preparation is recovered according to the compositions and methods of the disclosure. In other aspects, a lectin preparation is recovered and purified according to the methods of the disclosure. As used herein, the terms “purified”, “isolated” or “enriched” with regard to a “lectin” (protein) means that the lectin is transformed from a less pure state by virtue of separating it from some, or all of, the contaminants with which it is associated. Contaminants include, but are not limited to, microbial cells, metabolites, solvents, chemicals, color, inactive forms of the target lectin, aggregates, process aids, inhibitors, fermentation media, cell debris, nucleic acids, proteins other than the target lectin, host cell proteins, cross-contaminants from the production equipment and the like.
[0266] Thus, in the context of a “purified lectin” as used herein, purification may be accomplished by any art-recognized separation techniques, including, but not limited to, ion exchange chromatography, affinity chromatography, hydrophobic separation, dialysis, protease treatment, heat treatment, ammonium sulphate precipitation or other protein salt precipitation, crystallization, centrifugation, size exclusion chromatography, filtration, microfiltration, gel electrophoresis, or separation on a gradient to remove whole cells, cell debris, impurities, extraneous proteins, or enzymes undesired in the final composition.
[0267] It is further possible to then add constituents to a purified or isolated lectin composition which provide additional benefits, for example, activating agents, anti-inhibition agents, desirable ions, compounds to control pH or other enzymes or chemicals.
[0268] As used herein, lectin “purity” is a relative term, and is not meant to be limiting, when used in phrases such as a “recovered lectin is of higher purity, the same purity, or lower purity than prior to the recovery process”. For example, the relative “purity” of a lectin (protein), before and after a recovery process, may be determined using methods known in the art, including but not limited to, general quantification methods (e.g., Bradford, UV-Vis, activity assays), electrophoretic analysis (SDS-PAGE), analytical HPLC, mass spectrometry, hydrophobic interaction chromatography and the like.
[0269] Non-limiting examples for accessing the relative purity of a lectin, include, but are not limited to, SDS-PAGE analysis and / or the A280ratio of non-lectin (impurities) relative to lectin.
[0270] For example, the relative lectin purity via SDS-PAGE can be determined by visual abundance of lectin (protein) band compared to non-lectin protein (unwanted contaminants; impurities) bands present in the preparation. Alternatively, the relative purity of a lectin can be determined by the non-lectin to lectin (A280) ratio. For example, the A280ratio is a measure of amount of 280 nm absorbance contributed by non-lectin impurities for 1 unit 280 nm absorbance contributed by lectin in a protein preparation (e.g., non-lectin A280 / lectin A280), wherein a smaller number means higher purity. More particularly, the methodNB42133-WO-PCT[2] for determining the lectin (A280) concentration can be measured by HPLC using a purified lectin as the standard, wherein the concentration by HPLC is converted to lectin A280using 1 mg / mL lectin = 0.936 at 280 nm absorbance. The method for determining the non-lectin (A280) concentration in the preparation can be measured using a 1 cm path glass cuvette zeroed with MilliQ water, diluted to A280< 1 with MilliQ water as needed, wherein non-lectin A280 concentration is calculated by subtracting the lectin A280 from the preparation measurement.
[0271] Thus, according to certain aspects, lectin (protein) preparations are recovered from fermentation broths, wherein the recovered lectin preparations are of higher purity after performing one or more recovery processes described herein. For example, a fermentation broth (e.g., a whole broth at the end of fermentation) may be subjected to one or more protein recovery processes including, but not limited to, broth conditioning processes, broth clarification processes, protein enrichment and / or protein purification processes (e.g., protein concentration, filtration, precipitation, crystallization, crystal separation, crystal sludge dissolution processes and the like), buffer exchange processes, sterile filtration processes and the like. In certain aspects, the fermentation broth is subjected to a broth treatment (broth conditioning) process to improve subsequent broth handling properties. In certain other one or more embodiments or aspects, purified lectin (protein) preparations may be derived or recovered from fermentation broths collected and harvested.
[0272] Thus, as described herein, the methods / processes of the disclosure are not meant to be limiting, as one of skill may readily adapt or modify one or more of the compositions and / or methods disclosed herein for the recovery of specific lectin proteins, and / or combinations thereof. In general, a fermentation broth obtained by fermenting filamentous fungal cells expressing and secreting lectin proteins can be processed by harvesting, clarifying, and concentrating the broth, as generally described herein.
[0273] In certain other embodiments, a modified filamentous fungal cell comprising an introduced cassette encoding a lectin may be described by volumetric productivity, which is defined as the amount of protein produced (g) during the fermentation per nominal volume (L) of the bioreactor per total fermentation time (h). For example, volumetric productivities can be measured by methods known in the art (e.g., ELISA, HPLC, Bradford assay, LC / MS and the like).
[0274] In certain other embodiments, a modified filamentous fungal cell comprising an introduced cassette encoding a lectin may be described according to total protein yield, wherein total protein yield is defined as the amount of protein produced (g) per gram of carbohydrate fed, relative to the (unmodified) parental strain. Thus, as used herein, total protein yield (g / g) may be calculated using the following equation: Yf = Tp / Tc wherein “Yf” is total protein yield (g / g), “Tp” is the total protein produced during the fermentation (g) and “Tc” is the total carbohydrate (g) fed during the fermentation (bioreactor) run.NB42133-WO-PCT[2]
[0275] Total protein yield may also be described as carbon conversion efficiency / carbon yield, for example, as in the percentage (%) of carbon fed that is incorporated into total protein. Thus, in certain embodiments, a modified filamentous fungal cell comprising an introduced cassette may be described according to carbon conversion efficiency (e.g., an increase in the percentage (%) of carbon fed that is incorporated into total protein).
[0276] In certain other embodiments, a modified filamentous fungal cell comprising an introduced cassette may be described according to specific productivity (Qp) of the lectin protein. For example, the detection of specific productivity (Qp) is a suitable method for evaluating rate of lectin protein production, wherein the Qp can be determined using the following equation: “Qp = gP / gDCW•hr” wherein, “gP” is grams of protein produced in the tank; “gDCW” is grams of dry cell weight (DCW) in the tank and “hr” is fermentation time in hours from the time of inoculation, which includes the time of production as well as growth time. V. EXEMPLARY EMBODIMENTS
[0277] Non-limiting embodiments of the disclosure include, but are not limited to:
[0278] 1. A recombinant filamentous fungal cell expressing a polynucleotide encoding a heterologous lectin.
[0279] 2. The recombinant cell of embodiment 1, wherein the lectin is secreted into the broth when cultivated / fermented under suitable conditions for the production of the lectin.
[0280] 3. The recombinant cell of embodiment 1, wherein the lectin is derived from a plant cell, a cyanobacterial cell, an algae cell, a bacterial cell, a fungal cell, an insect cell,, or an animal cell.
[0281] 4. The recombinant cell of embodiment 1, wherein the lectin is selected from the group consisting of a native griffithsin (GRFT) lectin or a variant GRFT lectin derived therefrom, a native scytovirin (SVN) lectin or a variant SVN lectin derived therefrom, a native cyanovirin-N (CVN) lectin or a variant CVN lectin derived therefrom, a native K. alvarezii KAA-1 lectin or a variant KAA-1 lectin derived therefrom, a native K. alvarezii KAA-2 lectin or a variant KAA-2 lectin derived therefrom, a native Microcystis viridis (MVL) lectin or a variant MVL lectin derived therefrom, a native DCSIGN lectin or a variant DCSIGN lectin derived therefrom, a native Boodlea coacta agglutinin (BCA) lectin or a variant BCA lectin derived therefrom, a native Artocarpus heterophyllus (Jacalin) lectin or a variant Jacalin lectin derived therefrom, a native Musa acuminata (Banana) lectin or a variant Banana lectin derived therefrom, a native Aaptos papilleta (Sponge) lectin or a variant Sponge lectin derived therefrom, a native Abrus precatorius (Jequirty bean) lectin or a variant Jequirty bean lectin derived therefrom, a native Aegapodium podagraria (Ground elder) lectin or a variant Ground elder lectin derived therefrom, an Agaricus bisporus (Common mushroom) lectin or a variant Common mushroom lectin derived therefrom, a native Albizzia julibrissin (Mimosa treeNB42133-WO-PCT[2] seed) lectin or a variant Mimosa tree seed lectin derived therefrom, a native Allomyrina dichotoma (Japanese beetle) lectin or a variant Japanese beetle lectin derived therefrom, a native Aloe arborescens (Aloe plant) lectin or a variant Aloe plant lectin derived therefrom, a native Amphicarpaea bracteata (Hog peanut) lectin or a variant Hog peanut lectin derived therefrom, a native Anguilla (Eel) lectin or a variant Eel lectin derived therefrom, a native Aplysia depilans (Mollusca) lectin or a variant Mollusca lectin derived therefrom, a native Arachis hypogaea (Peanut) lectin or a variant Peanut lectin derived therefrom, a native Bauhinia purpurea (Camel’s foot tree) lectin or a variant Camel’s foot tree lectin derived therefrom, a native Bryonia diocia (White bryony) lectin or a variant White bryony lectin derived therefrom, a native Caragana Arborescens (Siberian pea tree) lectin or a variant Siberian pea tree lectin derived therefrom, a native Carcinoscorpius rotundacauda (Horseshoe crab) lectin or a variant Horseshoe crab) lectin derived therefrom, a native Microcystis aeruginosa (cyanobacterium) microvirin (MVN) lectin or a variant MVN lectin derived therefrom, a native Eucheuma serra (red algae) ESA-2 lectin or a variant ESA-2 lectin derived therefrom, a native Musa acuminate (Banana) BanLec lectin or a variant BanLec lectin derived therefrom, a native Aspidistra elatior AEL lectin or a variant AEL lectin derived therefrom, a native Chaetopterus variopedatus (Marine worm) CVL lectin or a variant CVL lectin derived therefrom, a Vicia faba (Fava bean) lectin or a variant Fava bean lectin derived therefrom, a native Lens culinaris (lentil) or a variant lentil lectin derived therefrom, a native Pisum sativum (pea) lectin or a variant pea lectin derived therefrom, a jacalin-like lectin or variant jacalin-like lectin derived therefrom, a CVN-like lectin or variant CVN-like lectin derived therefrom, an OAA-like lectin or variant OAA-like lectin derived therefrom, a galectin-1-like lectin or variant galectin-1-like lectin derived therefrom, and a ricin-like lectin or variant ricin-like lectin derived therefrom.
[0282] 5. The recombinant cell embodiment 1, wherein polynucleotide encoding the lectin is an introduced expression cassette comprising at least an upstream (5ʹ) promoter sequence operably linked to a downstream nucleic acid encoding a secretion (signal peptide) sequence operably linked to a downstream (3ʹ) nucleic acid encoding the lectin, optionally comprising a terminator sequence positioned downstream and operably linked to the nucleic acid encoding the lectin.
[0283] 6. The recombinant cell of embodiment 1, wherein the polynucleotide encoding the lectin is integrated into the genome of cell.
[0284] 7. The recombinant cell of embodiment 1, comprising at least two introduced polynucleotides encoding the lectin.
[0285] 8. The recombinant cell of embodiment 1, wherein the cell is an Ascomycete filamentous fungal cell.
[0286] 9. The recombinant cell of embodiment 1, wherein the cell is selected from the group consisting of an Acremonium sp. cell, Aspergillus sp. cell, Emericella sp. cell, Fusarium sp. cell, Humicola sp. cell,NB42133-WO-PCT[2] Mucor sp. cell, Myceliophthora sp. cell, Neurospora sp. cell, Penicillium sp. cell, Scytalidium sp. cell, Thielavia sp. cell, Tolypocladium sp. cell and Trichoderma sp. cell.
[0287] 10. The recombinant cell of embodiment 5, wherein the promoter is further defined as a strong promoter functional in the recombinant cell.
[0288] 11. The recombinant cell of embodiment 10, wherein the strong promoter is selected from the group consisting of a cellobiohydrolase promoter, an endoglucanase promoter, a β-glucosidase promoter, a xylanase promoter, a rev3 promoter, a bxl promoter, a tkl1 promoter, a dld1 promoter, an axe1 promoter, a hxk1 promoter, a dic1 promoter, an opt promoter, a gut1 promoter and a pki1 promoter.
[0289] 12. The recombinant cell of embodiment 5, wherein the promoter is a functional cellobiohydrolase-1 promoter (Pcbh1) comprising at least 95% sequence identity to SEQ ID NO: 14.
[0290] 13. The recombinant cell of embodiment 5, wherein the nucleic acid encoding the secretion (signal peptide) sequence encodes a cellobiohydrolase-1 secretion sequence (cbh1ss) comprising at least 95% sequence identity to SEQ ID NO: 15.
[0291] 14. The recombinant cell of embodiment 5, wherein the nucleic acid encoding the secretion (signal peptide) sequence encodes a functional aspartic endopeptidase secretion sequence (pep1ss) comprising at least 95% sequence identity to SEQ ID NO: 16.
[0292] 15. The recombinant cell of embodiment 1 or embodiment 2, wherein the lectin is a monomer.
[0293] 16. The recombinant cell of embodiment 1 or embodiment 2, wherein the lectin is a dimer.
[0294] 17. The recombinant cell of embodiment 1 or embodiment 2, wherein the lectin is a fusion protein.
[0295] 18. The recombinant cell of embodiment 16, wherein the lectin dimer comprises an amino acid linker sequence between the first (1st) and second (2nd) lectin protein sequences, wherein the linker sequence comprises about four (4) to about six (6) amino acid residues.
[0296] 19. The recombinant cell of embodiment 18, wherein the linker amino acid sequence comprises SEQ ID NO: 22.
[0297] 20. The recombinant cell of embodiment 17, wherein the lectin fusion protein comprises an N- terminal protein fusion and / or comprises a C-terminal protein fusion.
[0298] 21. The recombinant cell of embodiment 20, comprising an N-terminal starch-binding domain (SBD) protein operably linked to the C-terminal lectin protein and / or comprising a C-terminal SBD protein operably linked to the N-terminal lectin protein.
[0299] 22. The recombinant cell of embodiment 21, wherein the SBD protein comprises about 95% identity to the Rhizopus arrhizus SBD protein of SEQ ID NO: 52.
[0300] 23. The recombinant cell of embodiment 20, comprising an N-terminal cellobiohydrolase-1 core (Cbh1-core) protein comprising about 95% sequence identity to SEQ ID NO: 12 operably linked to the C-NB42133-WO-PCT[2] terminal lectin protein and / or comprising a C-terminal Cbh1-core protein comprising about 95% sequence identity to SEQ ID NO: 12 operably linked to the N-terminal lectin protein.
[0301] 24. The recombinant cell of embodiment 20, comprising an amino acid linker sequence positioned between the N-terminal protein fusion and the C-terminal lectin protein.
[0302] 25. The recombinant cell of embodiment 20, comprising an amino acid linker sequence positioned between the C-terminal protein fusion and the N-terminal lectin protein.
[0303] 26. The recombinant cell of embodiment 24 or embodiment 25, wherein the linker sequence comprises about 95% identity to the Kex2 amino acid sequence of SEQ ID NO: 20.
[0304] 27. The recombinant cell of embodiment 1, comprising a genetic modification rendering the cell deficient in the production of one or more endogenous enzymes.
[0305] 28. The recombinant cell of embodiment 27, wherein the cell is deficient in the production of one or more secreted lignocellulosic degrading enzymes.
[0306] 29. The recombinant cell of embodiment 27, wherein the cell is deficient in the production of one or more secreted proteases.
[0307] 30. The recombinant cell of embodiment 1, comprising an introduced polynucleotide encoding a protease inhibitor.
[0308] 31. An expression cassette comprising an upstream promoter sequence functional in an Ascomycete cell operably linked to a downstream nucleic acid encoding a secretion (signal peptide) sequence functional in an Ascomycete cell operably linked to a downstream nucleic acid encoding a heterologous lectin.
[0309] 32. The cassette of embodiment 31, wherein nucleic acid encoding the heterologous lectin encodes a lectin monomer.
[0310] 33. The cassette of embodiment 31, wherein nucleic acid encoding the heterologous lectin encodes a lectin dimer.
[0311] 34. The cassette of embodiment 31, wherein nucleic acid encoding the heterologous lectin encodes a lectin fusion protein.
[0312] 35. A method for producing a lectin in a filamentous fungal cell comprising: (a) obtaining a filamentous fungal cell and introducing into the cell an expression cassette comprising an upstream promoter sequence operably linked to a downstream nucleic acid encoding a secretion (signal peptide) sequence operably linked to a downstream nucleic acid encoding the lectin, and (b) fermenting the modified cell under suitable conditions for the production of the lectin, wherein the lectin is secreted into the fermentation broth.
[0313] 36. The method of embodiment 35, wherein the lectin is derived from a plant cell, a cyanobacterial cell, an algae cell, a bacterial cell, a fungal cell, an insect cell, or an animal cell.NB42133-WO-PCT[2]
[0314] 37. The method of embodiment 35, wherein the lectin is selected from the group consisting of a native griffithsin (GRFT) lectin or a variant GRFT lectin derived therefrom, a native scytovirin (SVN) lectin or a variant SVN lectin derived therefrom, a native cyanovirin-N (CVN) lectin or a variant CVN lectin derived therefrom, a native K. alvarezii KAA-1 lectin or a variant KAA-1 lectin derived therefrom, a native K. alvarezii KAA-2 lectin or a variant KAA-2 lectin derived therefrom, a native Microcystis viridis (MVL) lectin or a variant MVL lectin derived therefrom, a native DCSIGN lectin or a variant DCSIGN lectin derived therefrom, a native Boodlea coacta agglutinin (BCA) lectin or a variant BCA lectin derived therefrom, a native Artocarpus heterophyllus (Jacalin) lectin or a variant Jacalin lectin derived therefrom, a native Musa acuminata (Banana) lectin or a variant Banana lectin derived therefrom, a native Aaptos papilleta (Sponge) lectin or a variant Sponge lectin derived therefrom, a native Abrus precatorius (Jequirty bean) lectin or a variant Jequirty bean lectin derived therefrom, a native Aegapodium podagraria (Ground elder) lectin or a variant Ground elder lectin derived therefrom, an Agaricus bisporus (Common mushroom) lectin or a variant Common mushroom lectin derived therefrom, a native Albizzia julibrissin (Mimosa tree seed) lectin or a variant Mimosa tree seed lectin derived therefrom, a native Allomyrina dichotoma (Japanese beetle) lectin or a variant Japanese beetle lectin derived therefrom, a native Aloe arborescens (Aloe plant) lectin or a variant Aloe plant lectin derived therefrom, a native Amphicarpaea bracteata (Hog peanut) lectin or a variant Hog peanut lectin derived therefrom, a native Anguilla (Eel) lectin or a variant Eel lectin derived therefrom, a native Aplysia depilans (Mollusca) lectin or a variant Mollusca lectin derived therefrom, a native Arachis hypogaea (Peanut) lectin or a variant Peanut lectin derived therefrom, a native Bauhinia purpurea (Camel’s foot tree) lectin or a variant Camel’s foot tree lectin derived therefrom, a native Bryonia diocia (White bryony) lectin or a variant White bryony lectin derived therefrom, a native Caragana Arborescens (Siberian pea tree) lectin or a variant Siberian pea tree lectin derived therefrom, a native Carcinoscorpius rotundacauda (Horseshoe crab) lectin or a variant Horseshoe crab) lectin derived therefrom, a native Microcystis aeruginosa (cyanobacterium) microvirin (MVN) lectin or a variant MVN lectin derived therefrom, a native Eucheuma serra (red algae) ESA-2 lectin or a variant ESA-2 lectin derived therefrom, a native Musa acuminate (Banana) BanLec lectin or a variant BanLec lectin derived therefrom, a native Aspidistra elatior AEL lectin or a variant AEL lectin derived therefrom, a native Chaetopterus variopedatus (Marine worm) CVL lectin or a variant CVL lectin derived therefrom, a Vicia faba (Fava bean) lectin or a variant Fava bean lectin derived therefrom, a native Lens culinaris (lentil) or a variant lentil lectin derived therefrom, a native Pisum sativum (pea) lectin or a variant pea lectin derived therefrom, a jacalin-like lectin or variant jacalin-like lectin derived therefrom, a CVN-like lectin or variant CVN-like lectin derived therefrom, an OAA-like lectin or variant OAA-like lectin derived therefrom, a galectin-1-like lectin or variant galectin-1-like lectin derived therefrom, and a ricin-like lectin or variant ricin-like lectin derived therefrom.NB42133-WO-PCT[2]
[0315] 38. The method of embodiment 35, wherein the cassette comprises an upstream (5ʹ) promoter sequence operably linked to a downstream nucleic acid encoding a secretion (signal peptide) sequence operably linked to a downstream (3ʹ) nucleic acid encoding the lectin, optionally comprising a terminator sequence positioned downstream and operably linked to the nucleic acid encoding the lectin.
[0316] 39. The method of embodiment 35, wherein the cassette is integrated into the genome of cell.
[0317] 40. The method of embodiment 35, comprising at least two introduced cassettes encoding the lectin.
[0318] 41. The method of embodiment 35, wherein the cell is an Ascomycete filamentous fungal cell.
[0319] 42. The method of embodiment 35, wherein the cell is selected from the group consisting of an Acremonium sp. cell, Aspergillus sp. cell, Emericella sp. cell, Fusarium sp. cell, Humicola sp. cell, Mucor sp. cell, Myceliophthora sp. cell, Neurospora sp. cell, Penicillium sp. cell, Scytalidium sp. cell, Thielavia sp. cell, Tolypocladium sp. cell and Trichoderma sp. cell.
[0320] 43. The method of embodiment 38, wherein the promoter is selected from the group consisting of a cellobiohydrolase promoter, an endoglucanase promoter, a β-glucosidase promoter, a xylanase promoter, a rev3 promoter, a bxl promoter, a tkl1 promoter, a dld1 promoter, an axe1 promoter, a hxk1 promoter, a dic1 promoter, an opt promoter, a gut1 promoter and a pki1 promoter.
[0321] 44. The method of embodiment 38, wherein the promoter is a functional cellobiohydrolase-1 promoter (Pcbh1) comprising at least 95% sequence identity to SEQ ID NO: 14.
[0322] 45. The method of embodiment 38, wherein the nucleic acid encoding the secretion (signal peptide) sequence encodes a cellobiohydrolase-1 secretion sequence (cbh1ss) comprising at least 95% sequence identity to SEQ ID NO: 15.
[0323] 46. The method of embodiment 38, wherein the nucleic acid encoding the secretion (signal peptide) sequence encodes a functional aspartic endopeptidase secretion sequence (pep1ss) comprising at least 95% sequence identity to SEQ ID NO: 16.
[0324] 47. The method of embodiment 35, wherein the lectin is a monomer.
[0325] 48. The method of embodiment 35, wherein the lectin is a dimer.
[0326] 49. The method of embodiment 35, wherein the lectin is a fusion protein.
[0327] 50. The method of embodiment 48, wherein the lectin dimer comprises an amino acid linker sequence between the first (1st) and second (2nd) lectin protein sequences, wherein the linker sequence comprises about four (4) to about six (6) amino acid residues.
[0328] 51. The method of embodiment 50, wherein the linker amino acid sequence comprises SEQ ID NO: 22.
[0329] 52. The method of embodiment 49, wherein the lectin fusion protein comprises an N-terminal protein fusion and / or comprises a C-terminal protein fusion.NB42133-WO-PCT[2]
[0330] 53. The method of embodiment 52, comprising an N-terminal starch-binding domain (SBD) protein operably linked to the C-terminal lectin protein and / or comprising a C-terminal SBD protein operably linked to the N-terminal lectin protein.
[0331] 54. The method of embodiment 53, wherein the SBD protein comprises about 95% identity to the Rhizopus arrhizus SBD protein of SEQ ID NO: 52.
[0332] 55. The method of embodiment 52, comprising an N-terminal cellobiohydrolase-1 core (Cbh1- core) protein comprising about 95% sequence identity to SEQ ID NO: 12 operably linked to the C-terminal lectin protein and / or comprising a C-terminal Cbh1-core protein comprising about 95% sequence identity to SEQ ID NO: 12 operably linked to the N-terminal lectin protein.
[0333] 56. The method of embodiment 52, comprising an amino acid linker sequence positioned between the N-terminal protein fusion and the C-terminal lectin protein.
[0334] 57. The method of embodiment 52, comprising an amino acid linker sequence positioned between the C-terminal protein fusion and the N-terminal lectin protein.
[0335] 58. The method of embodiment 56 or embodiment 57, wherein the linker sequence comprises about 95% identity to the Kex2 amino acid sequence of SEQ ID NO: 20.
[0336] 59. The method of embodiment 35, comprising a genetic modification rendering the cell deficient in the production of one or more endogenous enzymes.
[0337] 60. The method of embodiment 59, wherein the cell is deficient in the production of one or more secreted lignocellulosic degrading enzymes.
[0338] 61. The method of embodiment 59, wherein the cell is deficient in the production of one or more secreted proteases.
[0339] 62. The method of embodiment 35, comprising an introduced polynucleotide encoding a protease inhibitor.
[0340] 63. The method of embodiment 35, further comprising harvesting the end of fermentation broth comprising the secreted lectin.
[0341] 64. The method of embodiment 63, wherein the harvested broth is subjected to a clarification process.
[0342] 65. The method of embodiment 64, wherein the clarified broth is subjected to a concentration process.
[0343] 66. The method of embodiment 65, wherein the lectin is recovered from the clarified and concentrated broth.
[0344] 67. The method of embodiment 63, wherein the pH of the harvested broth is adjusted to a pH of about 2.0 to about 2.5.NB42133-WO-PCT[2] EXAMPLES
[0345] Certain aspects of the present invention may be further understood in light of the following examples, which should not be construed as limiting. Modifications to materials and methods will be apparent to those skilled in the art. Standard recombinant DNA and molecular cloning techniques used herein are well known in the art (Ausubel et al., 1987; Sambrook et al., 1989). EXAMPLE 1 EXPRESSION AND SECRETION OF HETEROLOGOUS LECTIN PROTEINS
[0346] As briefly described above, Applicant has contemplated, designed, and constructed recombinant (modified) filamentous fungal cells capable of producing heterologous lectin proteins. In certain one or more embodiments, recombinant polynucleotides (e.g., expression cassettes) encoding lectin proteins are introduced into a filamentous fungal cell of the disclosure. For example, in certain embodiments, an expression cassette encoding a secreted lectin (fusion) protein comprises in the 5′ to 3′ direction a promoter (pro) region sequence operably linked to a nucleic acid (sig-seq) encoding a pre-protein (signal) secretion sequence operably linked to a nucleic acid (lectin CDS) encoding a lectin protein of interest, and the like. A. Construction of Vectors for the Expression of Griffithsin Monomer as a Secreted Protein
[0347] To establish the expression of heterologous lectin proteins in filamentous fungal strains, the lectin gene coding sequence (CDS) was operably combined (linked) with DNA encoding a signal (secretion) sequence, and operably linked with a strong promoter DNA sequence, such as the T. reesei cellobiohydrolase I (cbh1) gene promoter (abbreviated, Pcbh1). In certain embodiments, the lectin gene CDS (e.g., Griffithsin gene; GI: 90101331) encodes a griffithsin (GRFT) protein, wherein the lectin gene CDS was codon optimized for expression in T. reesei (SEQ ID NO: 3). For example, a synthetic DNA sequence comprising the codon optimized Griffithsin gene (herein named “GRFT.op1”) was synthesized (Twist Biosciences, San Francisco, CA) that comprises a native Cbh1 signal sequence (SEQ ID NO: 15; Cbh1ss) or a native Pep1 signal sequence (SEQ ID NO: 16; Pep1ss), and assembled as follows into the Griffithsin expression vector pLH1061 (SEQ ID NO: 38) using the GeneArt Seamless Cloning and Assembly Enzyme Mix (Thermo Fisher Scientific, Carlsbad, CA).
[0348] The backbone of the expression vector pLH1061 was amplified from a plasmid that comprises the following features: a 1 kb upstream (5′) flanking homology sequence (5′-flank) suitable for integration into a genomic locus of the T. reesei strain, a cbh1 promoter (Pcbh1) sequence (SEQ ID NO: 14), a Cbh1 protein secretion sequence (SEQ ID NO: 15; Cbh1ss) or a Pep1 protein secretion sequence (SEQ ID NO: 16; Pep1ss), a cbh1 terminator (Tcbh1) region sequence (SEQ ID NO: 17), a T. reesei pyr2 gene marker sequence (SEQ ID NO: 18) for transformation in T. reesei, a 1 kb downstream (3′) flanking homology sequence (3′-flank) suitable for integration into a genomic locus of the T. reesei strain, and bacterial vector sequences for the selection and maintenance of the plasmid in E.coli. The synthetic DNA (GRFT.op1)NB42133-WO-PCT[2] encoding the griffithsin protein ( contains a 25 bp 5′ flanking sequence that overlaps with cbh1 promoter (Pcbh1) region and contains a 25 bp 3′ flanking sequence that overlaps with the cbh1 terminator (Tcbh1) region.
[0349] In particular, this construction generated the griffithsin expression vector named “pLH1061” ([pI1- Pcbh1-GRFT.op1]; SEQ ID NO: 38), as shown TABLE 2 (Example 2). Likewise, a plasmid named “pLH1063” ([pI1-Pcbh1-GRFT.op2]; SEQ ID NO: 77) was constructed similarly for the expression of a second codon optimized wild type griffithsin gene under control of the Pcbh1 promoter, while a plasmid named “pLH1065” ([pI1-Pcbh1-GRFT.M78Q-op1]; SEQ ID NO: 39) was constructed similarly for secreted expression of the Q-GRFT (M78Q) variant protein. Both of the codon optimized GRFT sequences (op1 vs. op2) were generated by an internal algorithm with the purpose of maximizing the use of the most frequently used codons in T. reesei. B. Construction of Vectors for the Expression of Griffithsin dimer as a Secreted Fusion Protein
[0350] The native Griffithsin (GRFT) protein from the red algae Griffithsia sp. forms a stable dimeric structure from two identical GRFT monomers. To assess and / or improve the stability of the GRFT protein expressed in T. reesei, a dimeric GRFT sequence was contemplated and designed, based on the codon optimization scheme for GRFT.op1 gene. More particularly, a synthetic DNA encoding the GRFT dimer ([GRFT.op1-dimer]; SEQ ID NO: 7) was synthesized (Twist Biosciences), and the expression vector containing the integration cassette was built by Seamless Assembly. The expression vector comprises the following features: a 1 kb upstream (5′) flanking homology sequence (5′-flank) suitable for integration into a genomic locus of the T. reesei strain, a cbh1 promoter (Pcbh1) sequence (SEQ ID NO: 14), a Cbh1 protein secretion sequence (Cbh1ss; SEQ ID NO: 15), a Cbh1-core protein sequence (CBH1-core; SEQ ID NO: 13), a Kex2 linker sequence (SEQ ID NO: 19), followed by a tandem dimer of the GRFT.op1 gene (containing a linker DNA sequence (SEQ ID NO: 21) between the two tandem copies of the GRFT.op1 gene; SEQ ID NO: 7), and a cbh1 terminator (Tcbh1) region sequence (SEQ ID NO: 17), a T. reesei pyr2 gene marker sequence (SEQ ID NO: 18) for transformation in T. reesei, a 1 kb downstream (3′) flanking homology sequence (3′-flank) suitable for integration into a genomic locus of the T. reesei strain, and bacterial vector sequences for the selection and maintenance of the plasmid in E.coli. This vector construction generated the GRFT dimer expression vector named “pLH1098” ([pI1-Pcbh1-CBH1core- Kex2-GRFT.op1-linker-GRFT.op1]; SEQ ID NO: 40), as shown in TABLE 2 (Example 2) C. Construction of Vectors for the Expression of KAA-2 as a Secreted Fusion Protein
[0351] The red algae (Kappaphycus alvarezii) KAA-2 protein is another lectin with anti-viral activities. In the instant example, the KAA-2 gene was codon optimized and expressed as a fusion protein to the CBH1core protein in T. reesei. More specifically, a synthetic DNA encoding the KAA-2 lectin was designed, and codon optimized for expression in T. reesei, wherein the expression vector was constructedNB42133-WO-PCT[2] similarly as that of the GRFT dimer above, which generates the expression vector named “pLH1080” ([pI1- Pcbh1-CBH1core-KEX2-KAA2]; SEQ ID NO: 41), as shown in TABLE 2 (Example 2) EXAMPLE 2 CONSTRUCTION OF VECTORS FOR EXPRESSION OF ADDITIONAL LECTINS AS SECRETED FUSION PROTEINS
[0352] Several additional lectin proteins of interest, including a Banlec lectin, a H. annuus lectin, an AYR06195 lectin, a Jacalin lectin, a CV-N lectin, a MVL lectin, a MVN lectin and a DCSIGN lectin were codon optimized (TABLE 1) and subcloned for expression in T. reesei. In particular, each expression vector contained the Pcbh1 promoter, the Cbh1 protein secretion sequence (cbh1ss; SEQ ID NO:15), a starch-binding domain peptide sequence (CBM21; SEQ ID NO: 52), a kex2 linker sequence (SEQ ID NO: 19), followed by the codon optimized lectin gene of interest, and a cbh1 terminator (Tcbh1) region sequence (SEQ ID NO:17), a T. reesei pyr2 gene marker sequence (SEQ ID NO:18) for transformation in T. reesei. For the expression of the starch binding domain (CBM21)-lectin fusion proteins, each expression vector was directly transformed into T. reesei host strain and selected for stable transformants on Vogel agar media. Alternatively, the AFP signal peptide sequence (AFPss; SEQ ID NO: 68) was used instead of the Cbh1 protein secretion sequence, followed by the codon optimized gene of interest, a cbh1 terminator and the pyr2 selection marker.NB42133-WO-PCT[2] TABLE 1 LECTIN EXPRESSION CASSETTE GENETIC ELEMENTS Name (Abbreviation) Description / Function SEQ ID cbh1 promoter (Pcbh1)Promote transcription of cbh1, Griffithsin & KAA-214NB42133-WO-PCT[2] TABLE 2 CHROMOSOME INTEGRATION VECTORS FOR EXPRESSION OF LECTINS Plasmid Plasmid Description Pro Sig N-term Gene CDS Integration PCR 5′ PCR 3′ Name (5′ ^3′) Fusion Cassette Primer Primer 4269 4269 4269 4269 4269CAS9 GUIDED TARGETED INTEGRATION OF LECTIN EXPRESSION CASSETTES INTO T. REESEI GENOME
[0353] In the instant example, lectin expressing T. reesei strains were generated by Cas9 guided targeted integration into the genome, via homologous recombination (HR) or non-homologous end joining (NHEJ) mechanisms. The Cas9-Ribonucleoprotein complex (Cas9RNP) comprises the Cas9 protein and a single chain guide RNA (sgRNA). Upon protoplast transformation of the Cas9RNP complex and the targeted integration of cassette into T. reesei cells, the Cas9RNP enters the nucleus via the Nucleus Location Signal (NLS) at the C-terminus of the Cas9 protein. The guide RNA then directs the Cas9RNP to the targeted genomic locus to perform a double stranded cut, which is subsequently repaired by either the integration cassette that contains homologous sequences to both ends of the cutting site, or by various DNA repair mechanisms such as NHEJ. For targeting via the homologous recombination approach, typically 50 bp to 1000 bp of sequences that are homologous to both the 5ʹ and 3ʹ ends of the integration locus are included in the integration cassette. For the integration cassettes constructed for lectins, typically 1 kb of 5ʹ and 3ʹ homologous sequences are included to improve the efficiency of chromosomal integration and homology- based recombination at the desired locus.
[0354] For the construction of the lectin expression strains, certain linear expression cassettes were amplified by PCR using primers OT4268 and OT4269 (see, TABLE 3 below), to generate the DNA fragments that contain 5′ and 3′ one (1) kb flanking sequences for Cas9 targeted chromosomal integration at the chromosome locus.NB42133-WO-PCT[2] TABLE 3 PCR PRIMER FOR AMPLIFICATION OF CHROMOSOMAL INTEGRATION CASSETTES Primer Sequence (5′ ^ 3′) Purpose OT4268 TGTGCGAGATCCATGACTGCGTT 5′ primer for pI1 integration cassette at selected sreaction per tube, in a total volume of 1.2 mL. The 5′ PCR primer (OT4268) and the 3′ PCR primer (OT4269) were each added to the final concentration of 0.5 µM, with 0.5 µg / mL of the template DNA plasmids (TABLE 3). The PCR reaction was performed using the NEB-NEXT PCR Master Mix (New England Biolabs, MA), with the following condition: 98oC, 30 seconds; 35 cycles (98oC, 10 seconds; 70oC, 30 seconds; 72oC, 4 minutes); 72oC, 4 minutes. The final PCR products (HRD1-HRD4, TABLE 2) were digested with DpnI enzyme (New England Biolabs) to remove the plasmid template DNA. The reaction mixture was purified using the Zymo DNA Clean and Concentrator following manufacture’s protocols (Zymo Research, Irvine, CA), and dissolved in Elution buffer provided in the kit to 0.5-1.0 µg / µL final concentration.
[0356] The Cas9RNP complex used for the targeted chromosomal integration of the above expression cassettes was produced as follows: The sgRNA targeting the locus TrC114F (SEQ ID NO: 39, not including the protospacer adjacent motif (PAM) sequence “GGG”) in the T. reesei genome was obtained from Synthego (South San Francisco, CA), with the RNA sequence of SEQ ID NO: 37, and dissolved to 100 µM in TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0). The Cas9RNP assembly reaction contains 12 µM of Cas9 protein (New England Biolabs), 12 µM of sgRNA-EclipseA, in 1x NEB 3.1 buffer (New England Biolabs). The reaction is incubated at room temperature for 10 minutes and stored on ice until the protoplast transformation is performed. Protoplast transformation of T. reesei host was performed by combining 5 µL of the Cas9RNP complex, 4 µg of the PCR product of the linear integration cassette, and 300 µL of T. reesei protoplasts (108per mL), following standard procedures. The transformation reactions were plated on Vogel agar media and incubated at 32oC for 5 days. Single colonies were picked from the Vogel agar plates and transferred onto fresh Vogel agar plates and incubated at 32oC for 3 days.
[0357] Colonies were then screened for the expression of lectins as described in Example 4 below. The integration of the linear expression cassettes at the desired locus was screened and verified by colony PCR amplification from the T. reesei transformants using OT4333 and OT4334 as primers.NB42133-WO-PCT[2] EXAMPLE 4 SCREENING OF LECTIN EXPRESSION CLONES IN SMALL SCALE CULTURES
[0358] Expression of lectins in the transformed T. reesei strains were screened by inoculating one (1) mL NREL media and growing in 24-well microtiter plates for five (5) days at 28oC. An SDS-PAGE analysis was performed to identify the presences of the target proteins of interest, e.g., the Griffithsin protein (12.7 kDa), the Griffithsin dimer protein (25.8 kDa), the KAA-2 protein (27.9 kDa), etc. In particular, FIG. 4 shows the expression analysis of T. reesei host strain transformed by the integration cassette HRD1 (pI1- Pcbh1-GRFT.op1, TABLE 2). Five (5) microliters of the culture supernatants from each clone were loaded on SDS-PAGE gel, wherein lanes 1-5 are clones from codon optimized Griffithsin (GRFT-1 to GRFT-5, op2); lanes 6-8 clones from codon optimized Griffithsin (GRFT-6 to GRFT-8, op1); lane 9 contains codon optimized M78Q variant of Griffithsin and lane 10 contains the empty host strain (T. reesei). As indicated by the red arrows in the gel image (FIG. 4), lanes 1-9 each contain a protein band at approximately (~) 14kDa, which is similar to the molecular weight of the Griffithsin protein (~ 12.7 kDa); while lane 10 does not contain an expressed protein at this molecular weight.
[0359] As set forth in FIG.5, some of the small-scale cell cultures were treated at pH 2 in order to purify the lectins based on their stability at lower pH ranges. As shown in FIG. 5, small-scale cultures of GRFT (codon optimized sequence: op1) and GRFT (codon optimized sequence: op2), as well as variant GRFT- M78Q (codon optimized sequence: op1) were incubated in 130 mM NaH2PO4, pH 2.3 for 2 hours at 28C (each 0.5 mL supernatant was added to 1 mL 200 mM NaH2PO4 pH 2.3 buffer). The cultures were centrifuged, and the supernatants were analyzed by SDS-PAGE. As indicated by the red arrows (FIG.5), lanes 1-11 contain a protein band at ~14 kDa, similar to the molecular weight of the Griffithsin protein (~12.7 kDa); while lane 3 (empty host T. reesei strain) does not contain an expressed protein at this molecular weight. The intensities of the 14 kDa bands in FIG. 5 are generally higher than the 14 kDa bands in FIG. 4 (no pH treatment) , indicating that the Griffithsin protein can be partially purified by low pH treatments (e.g., about pH 2). In addition, clones with GRFT-op1 codon optimization give better expression than the clones with GRFT-op2 codon optimization. For instance, from the microtiter plate expression screening, clone GRFT-op1 was selected for further study in the 2-liter fermenter. This GRFT- op1 strain was named BFZ25. In a similar process, screening of the T. reesei transformants of HRD3 integration cassette (pI1-Pcbh1-CBH1core-KEX2-GRFT.op1-linker-GRFT.op1) resulted in the selection of the top expression clone named BFZ72; and screening of the T. reesei transformants of HRD4 integration cassette (pI1-Pcbh1-CBH1core-KEX2-KAA2) yielded the top expression clone named BFZ27.
[0360] In particular, results from the small-scale expression screening of additional lectins in T. reesei are shown in FIG.6 and FIG.7. As presented in the right-side Table of FIG.6 (GRFT, Q-GRFT, CV-N, MVL, SVN, DCSIGN, KAA-1, EDA2, MPA-2, ConA, Jacalin, BanLec, OAA, ESA-2, MVN, & Galectin-1) theNB42133-WO-PCT[2] listed lectins were expressed under control of the Pcbh1 promoter with CBM21 protein as a fusion. As presented in the right-side Table of FIG.7 (Lectin Names), the same listed lectins were further expressed as fusions proteins (CBM21) under control of the same Pcbh1 promoter . Additionally, the right-side Table of FIG. 6 (Expression Level) and the right-side Table of FIG. 7 (Fusion with CBM21 Expression Level) present semi-quantitative expression data from the strains expressing the lectin with (FIG.7) and without (FIG. 6) the CBM21 fusion. . The expression level of the lectin in each strain is indicated as low (+), medium (++), and high (+++). EXAMPLE 5 PRODUCTION OF SECRETED LECTINS BY FED-BATCH FERMENTATION
[0361] Small scale fed-batch fermentations were performed in two (2) L bioreactors for the following three T. reesei strains: (1) BFZ25 (Pcbh1-GRFT.op1) for direct expression of the Griffithsin (GRFT) monomer under the cbh1 promoter, (2) BFZ72 (Pcbh1-cbh1core-KEX2-GRFT.op1 dimer) for expression of the Griffithsin dimer as a fusion protein to Cbh1 core protein and Kex2 linker under the cbh1 promoter and (3) BFZ27 (Pcbh1-cbh1core-KEX2-KAA), for expression of the KAA-2 lectin as a fusion protein to Cbh1 core protein and Kex2 linker under the cbh1 promoter.
[0362] Cells were first grown in minimal medium containing 75 g / L glucose until glucose was depleted. The production phase was initiated with the combined feeding of glucose and sophorose at pH 4.5 for the induction of protein expression under the control of the cbh1 promoter (Pcbh1). A 10 mL whole broth sample was taken every twenty-four (24) hours and frozen at -20oC, wherein the total fermentation time was 188 hours. For example, as presented in FIG.8, the total soluble proteins secreted in the fermentation run is plotted versus the effective fermentation time (EFT, hours) for the three fermentation runs (strains BFZ25, BFZ27 and BFZ72) described above. The fermentation supernatants were analyzed by SDS-PAGE as shown in FIG.9, wherein the major protein band is detected at 12.7 kDa (Griffithsin protein), 25.8 kDa (Griffithsin dimer protein), 27.9 kDa (KAA-2 protein). For example, lanes 1, 3 and 5 (FIG. 9) contain the fermentation samples purified by lowering the pH to 2. The Griffithsin monomer appears to form the dimeric structure that is resistant to the denaturation condition before loading SDS gel. Lanes 2, 4 and 6 contain the purified samples from the pH 2 treatment, which were further treated with EndoH enzyme (endoglycosidase, prepared internally from T. reesei) after neutralization of the supernatants to pH 7.0. There is a loss of molecular weight for all three proteins (Griffithsin, Griffithsin dimer and KAA-2), indicating that these proteins are glycosylated as they are produced in T. reesei, and the glycosylated groups are fully or partially removed by the EndoH enzyme. The presence of the Griffithsin, Griffithsin dimer and KAA-2 was further confirmed by protein mass spectrometry analysis of the total secreted proteins in theNB42133-WO-PCT[2] fermentation culture supernatants. The total protein secretion titers at the end of the 188-hour fermentation run are presented below in TABLE 4. TABLE 4 TOTAL SECRETED PROTEIN TITERS FROM TWO LITER FERMENTATION Strain ID Lectin Protein Total Protein Total Protein (g / L) (g / L) After pH 2.3 TreatmentEXAMPLE 6 EXPRESSION OF JACALIN-LIKE, CVN-LIKE, OAA-LIKE, DC-SIGN LECTINS IN FUNGAL CELLS
[0363] In the instant example, Applicant has designed, constructed, and evaluated exemplary fungal host cells for their ability to express / produce heterologous (foreign) lectins. More particularly, as described herein, it was surprisingly observed that recombinant filamentous fungal cells (e.g., Trichoderma sp. cells) can express / produce significant amounts of heterologous (i.e., eukaryotic) lectins known as jacalin-like lectins, CVN-like lectins, and OAA-like lectins. As set forth and exemplified in the following sections, polynucleotides (expression cassettes) encoding the Griffithsin, Jacalin-like, CVN-like, OAA-like, Ricin- like, Galectin-like, SVN, DC-SIGN, ConA lectins were constructed and evaluated in 96-well plate and DASGIP fermenter. A. Construction of Expression Plasmids and Trichoderma Strains Expressing Griffithsin, Jacalin- like, CVN-like, OAA-like, Ricin-like, Galectin-like, SVN, DC-SIGN, ConA lectins
[0364] To facilitate high throughput cloning and expression, telomere (TrTEL) based expression constructs were made for the lectin encoding genes. The TrTEL based expression vectors can replicate independently in T. reesei, and would likely integrate into the genome at random locations. Under certain circumstances, there may be multiple copies of the expression cassette integrated into the genome. The lectin expression cassettes were subcloned into plasmid pGX256 (FIG. 10). The expression vectors were constructed using restriction digestion and ligation method as follows: (1) synthesize the codon optimized gene of interest (GOI) , (2) fuse the AFP signal peptide sequence or CBM21 coding sequence using PCR method, (3) digest the synthetic GOI and pGX256 using AvrII and NotI, (4) ligate the enzyme-digested products. All elements in the plasmid are shown in SEQ ID NO: 70 through SEQ ID NO: 77 of theNB42133-WO-PCT[2] Biological Sequences. Upon sequence confirmation, the expression plasmids were directly transformed into T. reesei without vector linearization. All clones on the transformation plate were scraped for expression without PCR analysis of individual clones.
[0365] Sixteen (16) expression plasmids (e.g., see FIG. 11) encoding the Griffithsin, Jacalin-like, CVN- like, OAA-like, Ricin-like, Galectin-like, SVN, DC-SIGN, ConA lectins were constructed for expression of the mature lectins in Trichoderma reesei strain. Likewise, TABLE 5 below presents additional details of certain lectins cloned and expressed herein. More particularly, in the instant example, sixteen (16) lectin production strains were generated, which are based on the auxotroph T. reesei strain StarAGX. Generally, the lectin gene coding sequences (with AFP signal peptide or fused with the cbm1 domain) were codon- optimized based on Trichoderma reesei codon preference and cloned into the NotI and AvrII restriction enzyme in pGX256 vector (FIG. 11) using double digestion and ligation method. The plasmid contained a cbh1 promoter followed by AFP signal peptide or CBM21 domain, codon-optimized nucleotide sequence encoding the lectin protein, acetamidase (amdS) and orotate phosphoribosyl transferase (pyr2) as selection markers for transformation. The constructed vectors were transformed into the protoplast of T. reesei strain StarAGX and plated on AMDS plates with acetamide as sole nitrogen source. After culturing in an illumination incubator at 28°C for 6 days, the spores on the plate were scraped and spread on a new AMDS plate and culture for another 6 days in illumination incubator.NB42133-WO-PCT[2] TABLE 5 DETAILS OF GRIFFITHISIN, JACALIN-LIKE, CVN-LIKE, OAA-LIKE AND DC-SIGN LECTINS CLONED AND EXPRESSED Lectin NCBI Expression ClassName SID Fold Source SpeciesTaxonomy Type LevelB. Evaluation of Secreted Lectins Produced in 96-well plate and DASGIP
[0366] Thus, expression of certain lectin proteins in T. reesei strain StarAGX were assessed in 96-well plate and one (1) L bioreactors and recovered as generally described herein. For the expression evaluation of lectins, the lectin production strains were grown in fermentation medium (Glycine medium) with cell growth nutrients containing carbon sources such as sugars, alcohols, organic and amino acids, nitrogen sources like ammonium and nitrate salts, phosphate salts, magnesium salts, potassium and sodium salts, trace metals salts containing like iron, manganese, zinc, copper, cobalt, molybdate, calcium, boron, to make high amounts of cell mass. A slice of the recombinant strains on AMDS plate was inoculated into the 96- well plate with 300 ul glycine medium in each well. Strains were cultured in oxygen chamber at 28°C for 6 days with oxygen concentration of 80%. Equal volume of 100 mM sodium phosphate(pH 2.3)was added into the broth after fermentation and incubated with shaking for one (1) hour at room temperature to release the lectins which binding to the cell wall.NB42133-WO-PCT[2] C. Fermentation and Recovery
[0367] The lectin production strains were grown in fermentation medium (Glycine medium) with cell growth nutrients containing carbon sources like sugars, alcohols, organic and amino acids, nitrogen sources like ammonium and nitrate salts, phosphate salts, magnesium salts, potassium and sodium salts, trace metals salts containing like iron, manganese, zinc, copper, cobalt, molybdate, calcium, boron, to make high amounts of cell mass. Cell banks of the recombinant strains were maintained in frozen state, first inoculated a slice of strain on AMDS plate, then inoculate the spore and hypha into glycine medium to prepare seed for DASGIP fermenter fermentation. Seed cells were further grown in batch of fermentation medium. Fermentation temperature was maintained at 28°C for 6 days.
[0368] In the instant example, fermentation broth was recovered to a clarified concentrate, which may be performed via a variety of methods generally starting with a broth treatment which includes lysis (e.g., natural or chemically induced lysis, natural in this example), heat treatment, pH and temperature control, water or buffer dilution, and with or without flocculation. For example, cell separation can be done in a variety of methods including, but not limited to, centrifugation, depth filtration or membrane-based operations. Concentration is performed via ultrafiltration membrane operations. In certain aspects, the resulting clarified concentrate is further purified as described in subsequent examples hereinafter. Additional details regarding recovery process can be found in subsequent examples and the specification of the disclosure. D. Expression evaluation
[0369] More specifically, as shown in FIG. 12 and FIG. 13 , expression of the Griffithsin, Jacalin-like, CVN-like, OAA-like, Ricin-like, Galectin-like, SVN, DC-SIGN, ConA lectins in the broth supernatants was evaluated via SDS-PAGE, wherein fifteen microliters (15 µL) of samples were evaluated by SDS- PAGE, along with the Invitrogen broad spectrum molecular weight standard followed by staining and detaining of the gel using standard molecular biology procedures. As presented in the SDS-PAGE gels (FIG. 12 and FIG. 13), the griffithsin proteins (SEQ ID NO: 1; FIG. 1A and SEQ ID NO: 4; FIG. 1B) appear as a single band with a molecular weight approximately between 10 kDa and 16 kDa, all the lanes are the supernatant broth. As presented in the SDS-PAGE gels (FIG. 12 and FIG. 13) the jacalin-like proteins (SEQ ID NO: 23; FIG.2A and SEQ ID NO 27;; FIG.2B) appear as a single band with a molecular weight approximately between 10 kDa and 16 kDa, all the lanes contain the supernatant broth from the small-scale cultures. The molecular weight of CVN-like lectin (SEQ ID NO: 29) is about 10-16 kDa as shown in the SDS-PAGE. As presented in the SDS-PAGE gel (FIG. 12 and FIG. 13), the OAA-like proteins (SEQ ID NO: 10;) appear as a single band with a molecular weight between about 10 kDa and 40 kDa, all the lanes are the supernatant broth. As presented in the SDS-PAGE gel (FIG. 12 and FIG. 13),NB42133-WO-PCT[2] the DC-SIGN-like protein (SEQ ID NO: 35) appear as a single band with a molecular weight between about 10 kDa and 16 kDa, the lane is the supernatant broth. EXAMPLE 7 RECOVERY AND OPTIONAL PURIFICATION OF GRIFFITHISIN, JACALIN-LIKE, CVN- LIKE, OAA-LIKE, DC-SIGN LECTINS PRODUCED IN FUNGAL CELLS
[0370] The instant example describes methods to recover Griffithsin, Jacalin-like, CVN-like, OAA-like, DC-SIGN lectins, in substantially pure form from a fermentation broth in which recombinant host cells (e.g., bacterial cells, plant cells, insect cells, and the like) have been fermented. More particularly, such exemplary purification methods including acid treatment by adding 200mM NaPi (pH2.3), ion affinity separation via chromatography column, that separate into two (2) or more fractions, one of which fractions comprises the lectin. Before the purification, lectins which fused with CBM21 were digested with protease and the CBM21 was captured by resin with dextrin.
[0371] In particular, as exemplified herein, equal volume of 200 mM NaPi (pH2.3) was add into the fermentation broth of OAA-like lectin(SEQ ID NO: 62), then centrifuged at 10000 g to remove the background proteins. The final concentrated sample of OAA-like lectin was formulated with 20 mM NaCitrate, pH 3.5, 150 mM NaCl buffer and 40% w / w glycerol.
[0372] In particular, as exemplified herein, equal volume of 200 mM NaPi (pH2.3) was add into the fermentation broth of jacalin-like lectin (SEQ ID NO: 27), then centrifuge at 10000g to remove the background proteins. Then, ammonium sulfate was added to the final concentration of 1 mole. The solution was loaded onto a HIC column pre-equilibrated with 20 mM NaAC, pH 5.0 supplemented with 1 M ammonium sulfate. The target lectin protein was eluted with 0 to 1 M ammonium sulfate gradient. The fractions containing target protein were pooled and buffer exchanged into 20 mM Tris-HCl (pH 7.5), then incubated at 4°C for overnight to facilitate the isoelectric precipitation. The resulting target protein pellet was resuspended in 20 mM NaCitrate, pH 3.5, 150 mM NaCl buffer and 40% w / w glycerol.
[0373] In particular, as exemplified herein, equal volume of 200 mM NaPi (pH2.3) was add into the fermentation broth of Griffithsin (SEQ ID NO: 1; SEQ ID NO: 4), Jacalin (SEQ ID NO: 27), CVN (SEQ ID NO: 29), and DC-SIGN (SEQ ID NO: 35) lectins, then centrifuge at 10000g to remove the background proteins. The lectins which in the supernatant were collected and the pH was adjust to neutral by adding 2 mole sodium hydroxide. Then, the buffer of the samples which contain lectins were changed to 20mM NaCitrate, pH 3.5, 150 mM NaCl using 3kDa filter. The final concentrated samples were formulated with 20 mM Tris, pH 7.5, 150 mM NaCl buffer and 40% w / w glycerol.NB42133-WO-PCT[2] EXAMPLE 8 ASSAYING HEMAGGLUITINATION ACTIVITY OF LECTINS
[0374] The instant example describes methods to screen the binding activity of one or more purified and / or crude lectins described above using a hemagglutination assay. The principle is that active lectins react with specific carbohydrate moieties on red blood cell surfaces, resulting in the formation of a diffuse matrix, while non-active lectins cannot bind red blood cells resulting in the formation of noticeable clumps. This allows for a clear visual distinction between active and non-active lectin samples. More particularly, lectin hemagglutination capability (activity) was evaluated using erythrocytes from fifteen (15) different animal sources (i.e., dog, rabbit, guinea pig, mouse, rat, human, chicken, turkey, duck, goose, pig, bovine, horse, sheep, and goat) and processed according to the Materials and Methods described herein. A. Materials
[0375] Materials included the following: (i) Animal erythrocytes in Alsever’s solution (Sbjbio company, Nanjing, China), including dog, rabbit, guinea pig, mouse, rat, human, chicken, turkey, duck, goose, pig, bovine, horse, sheep, and goat erythrocytes, (ii) 200 mM phosphate buffer (PB, pH 7.4), and (iii) 96-well round bottom microwell plate (Nunc, Thermo Scientific, USA). B. Methods
[0376] (i) Hemagglutination test was used to detect lectins in both purified and crude samples. Purified lectin samples were diluted to an initial concentration of 1-800 ^g / ml using PB buffer, then dispensed 50 ^L of each to the sample well of a 96-well round bottom microplate. Crude samples were diluted by estimating the protein expression level based on the SDS-PAGE gel. (ii) 50 ^l of host strain supernatant was dispensed to the control wells of the above microplate and used as the negative controls. A column of 50 ^L PB buffer was also included in the above microplate to determine the possible buffer effect. (iii) Animal erythrocytes were diluted to an initial concentration of 2% (v / v) using PB buffer, and then added 50 ^l of each to the above samples. (iv) The mixture was pipetted for 30 seconds to combine, then allow the plate to settle at room temperature for 60 minutes. (v) The hemagglutination activity was determined by visual examination. Active lectins were characterized by the formation of a diffuse network, whereas non-active lectins were observed to form a sediment button at the bottom of the well. C. Results
[0377] As shown in FIG. 14 and FIG. 15, the hemagglutination capability of lectin samples could be easily determined by visually distinguishing the even suspension with no signs of clumping in wells for hemagglutination-positive samples and a sediment button at the bottom of the wells for hemagglutination- negative samples. PB buffer and host strain supernatant showed no hemagglutination capability (FIG.14). A dose-response pattern of hemagglutination activity for active samples was detected at different doses of lectins on 1% mouse erythrocytes showing that lectin hemagglutination capability was dose-dependentNB42133-WO-PCT[2] (FIG.14). This result indicates that the hemagglutination assay is a feasible method to differentiate “strong positive” (400 ^g / ml of SEQ ID NO: 27 on dog and rabbit erythrocytes in FIG. 14), “weak positive” (50 and 200 ^g / ml of SEQ ID NO: 27 on dog erythrocytes in FIG.14), “intermediate positive” (400 ^g / ml of SEQ ID NO: 27 on guinea pig erythrocytes in FIG.14), and negative results (SEQ ID NO: 27 on chicken, turkey, and duck erythrocytes in FIG. 14). The lectin hemagglutination was stable for about 1-2 hours at room temperature and the observations and interpretations can vary from test to test, the batch of animal erythrocytes, the type and concentration of lectins, as well as the incubation time and temperature used in the assay. Therefore, in the present example, the hemagglutination assay was not intended to be used as a quantitative method, but rather to detect samples with positive hemagglutination activities. To ensure data accuracy, at least two replicate plates were made for each test and all results showed good reproducibility. The most significant positive results were recorded in FIG. 15 and the corresponding effective animal erythrocytes are summarized below in TABLE 6. TABLE 6 HEMAGGLUTINATION ACTIVITY OF LECTINS PRODUCED SEQ ID Sample Concentration (µg / ml) Hemagglutination capability 1 Crude - Rabbit sheeNB42133-WO-PCT[2] REFERENCES PCT Publication No. WO2002 / 14490 PCT Publication No. WO2003 / 083125 PCT Publication No. WO2005 / 118627 PCT Publication No. WO2007 / 064844 PCT Publication No. WO2008 / 022303 PCT Publication No. WO2010 / 014248 PCT Publication No. WO2014 / 197650 PCT Publication No. WO2016 / 130628 PCT Publication No. WO2019 / 108656 US Patent Publication No. US20020127675 US Patent Publication No. US20040204365 US Patent Publication No. US20110189105 US Patent Publication No. US20110263485 Ausubel et al., “Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987). Ayouba et al., “Legume lectins interact with muramic acid and N-acetylmuramic acid”, FEBS, 289(1): 12- 104, 1991. Cole et al., “Differentiation of Bacillus anthracis and Other Bacillus Species by Lectins”, J. Clinical Microbiol., 19(1): 48-54, 1984. El-Araby et al., “Characterization and antimicrobial activity of lectins purified from three Egyptian leguminous seeds”, AMB Express, 10:90 (pages 1-14), 2020. Gengenbach et al., “Comparison of microbial and transient expression (tobacco plants and plant‐cell packs) for the production and purification of the anticancer mistletoe lectin viscumin”, Biotechnology and Bioengineering, 116, pages 2236–2249, 2019. Hirayama et al., “High-Mannose Specific Lectin and Its Recombinants from a Carrageenophyta Kappaphycus alvarezii Represent a Potent Anti-HIV Activity Through High-Affinity Binding to the Viral Envelope Glycoprotein gp120”, Mar. Biotechnol., Vol 18, pages 144–160, 2016.NB42133-WO-PCT[2] Lagarda-Diaz et al., “Legume Lectins: Proteins with Diverse Applications”, Int. J. Mol. Sci., 18, 1242, 2017. O’Keefe et al., “Scaleable manufacture of HIV-1 entry inhibitor griffithsin and validation of its safety and efficacy as a topical microbicide component”, PNAS, Vol.106, No.15, pages 6099–6104, 2009. Petrova et al., “Engineering Lactobacillus rhamnosus GG and GR-1 to express HIV-inhibiting griffithsin”, International Journal of Antimicrobial Agents, volume 52, issue 5, pages 599-607, 2018. Petrova et al., “The lectin-like protein 1 in Lactobacillus rhamnosus GR-1 mediates tissue-specific adherence to vaginal epithelium and inhibits urogenital pathogens”, Scientific Reports 6, Article No.37437, 2016. Peumans and Van Damme, “Plant Lectins: Versatile Proteins with Important Perspectives in Biotechnology”, Biotechnology and Genetic Engineering Reviews, 15:1, 199-228, 1998. Pevzner et al., “Differences in amino acid sequences of mistletoe lectin I and III B-subunits determining carbohydrate binding specificity”, Biochimica et Biophysica Acta 1675: 155-164, 2004. Sambrook et al., “Molecular Cloning: A Laboratory Manual” Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y. (1989), (2001) and (2012). Singh and Sarathi, “Insights of Lectins–A review”, International J. Scientific & Engineering Res., Volume 3, Issue 4, 2012. Whitley et al., “Burkholderia oklahomensis agglutinin is a canonical two-domain OAA-family lectin: structures, carbohydrate binding, and anti-HIV activity”, FEBS J., 280(9): 2056–2067, 2013.
Claims
NB42133-WO-PCT[2] CLAIMS 1. A recombinant filamentous fungal cell expressing a polynucleotide encoding a heterologous lectin.
2. The recombinant cell of claim 1, wherein the lectin is secreted into the broth when fermented under suitable conditions for the production of the lectin.
3. The recombinant cell of claim 1, wherein the lectin is derived from a plant cell, a cyanobacterial cell, an algae cell, a bacterial cell, a fungal cell, an insect cell, or an animal cell.
4. The recombinant cell claim 1, wherein polynucleotide encoding the lectin is an introduced expression cassette comprising an upstream promoter sequence operably linked to a downstream nucleic acid encoding a signal sequence operably linked to a downstream nucleic acid encoding the lectin.
5. The recombinant cell of claim 1, wherein the polynucleotide encoding the lectin is integrated into the genome of cell.
6. The recombinant cell of claim 1, wherein the cell is an Ascomycete filamentous fungal cell.
7. The recombinant cell of claim 1, wherein the lectin is a monomer.
8. The recombinant cell of claim 1, wherein the lectin is a dimer.
9. The recombinant cell claim 1, wherein the lectin is a fusion protein.
10. The recombinant cell of claim 1, comprising a genetic modification rendering the cell deficient in the production of one or more endogenous enzymes.
11. An expression cassette comprising an upstream promoter sequence functional in an Ascomycete cell operably linked to a downstream nucleic acid encoding a secretion sequence functional in an Ascomycete cell operably linked to a downstream nucleic acid encoding a heterologous lectin.
12. The cassette of claim 11, wherein the encoded lectin is a monomer or a dimer.
13. The cassette of claim 11, wherein the encoded lectin is a fusion protein.
14. A method for producing a heterologous lectin in a filamentous fungal cell comprising: (a) obtaining a filamentous fungal cell and introducing into the cell an expression cassette comprising an upstream promoter operably linked to a downstream nucleic acid encoding a secretion sequence operably linked to a downstream nucleic acid encoding the lectin, and (b) fermenting the modified cell under suitable conditions for the production of the lectin, wherein the lectin is secreted into the fermentation broth.NB42133-WO-PCT[2] 15. The method of claim 14, wherein the lectin is derived from a plant cell, a cyanobacterial cell, an algae cell, a bacterial cell, a fungal cell, an insect cell, or an animal cell.
16. The method of claim 14, wherein the cassette is integrated into the genome of cell.
17. The method of claim 14, wherein the cell is an Ascomycete filamentous fungal cell.
18. The method of claim 14, wherein the lectin is a monomer.
19. The method of claim 14, wherein the lectin is a dimer.
20. The method of claim 14, wherein the lectin is a fusion protein.
21. The method of claim 19, wherein the lectin dimer comprises an amino acid linker sequence between the first and second lectin sequences, wherein the linker sequence comprises about four (4) to about six (6) amino acid residues.
22. The method of claim 20, wherein the lectin fusion protein comprises an N-terminal protein fusion and / or comprises a C-terminal protein fusion.
23. The method of claim 14, wherein the cell comprises a genetic modification rendering the cell deficient in the production of one or more endogenous enzymes.
24. The method of claim 14, comprising harvesting the end of fermentation broth comprising the secreted lectin.
25. The method of claim 24, wherein the harvested broth is subjected to a clarification process 26. The method of claim 25, wherein the clarified broth is subjected to a concentration process.
27. The method of claim 26, wherein the lectin is recovered from the clarified and concentrated broth.
28. A lectin protein preparation obtained by the method of claim 14.