Trichoderma reesei gene editing method based on ribonucleoprotein complex and application
By employing a dual sgRNA-RNP system for dual-site cleavage and homology repair in Trichoderma reesei, the problems of low editing efficiency and heterozygote generation in existing technologies have been solved, achieving efficient and safe homozygote acquisition, simplifying the operation process and improving biosafety.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ZHEJIANG UNIV OF TECH
- Filing Date
- 2026-03-17
- Publication Date
- 2026-06-09
Smart Images
Figure CN122168690A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a method and application of gene editing in Trichoderma reesei based on ribonucleoprotein complex (RNP). Background Technology
[0002] Trichoderma reesei is a filamentous fungus that is recognized as GRAS (Generally Recognized As Safe) and possesses highly efficient protein secretion capabilities. It is an important chassis strain for the industrial production of cellulase, hemicellulase, and other industrial enzyme preparations. Genetic modification of Trichoderma reesei using gene editing technology to enhance its enzyme yield, improve enzyme composition, or endow it with new functions is a research hotspot in synthetic biology and green manufacturing.
[0003] CRISPR / Cas9 gene editing technology provides a powerful tool for genetic manipulation in *Trichoderma reesei*. This technology guides the Cas9 nuclease via guide RNA (sgRNA) to create DNA double-strand breaks at specific sites in the genome, thereby utilizing the cell's own repair mechanisms to achieve gene knockout or precise editing. Currently, CRISPR / Cas9 editing in *Trichoderma reesei* primarily employs a plasmid-based delivery system, where the DNA expression cassette encoding the Cas9 protein and sgRNA (guide RNA) is constructed on the same plasmid and introduced into cells via protoplast transformation.
[0004] However, several inherent drawbacks of this traditional plasmid-based method limit its efficient and safe application in *Trichoderma reesei*: First, the editing efficiency is constrained by the plasmid transformation efficiency and the intracellular transcription and translation process, resulting in a long processing time and unstable efficiency. Second, the long-term presence of plasmid DNA within the cell may lead to persistent expression of the Cas9 protein, increasing the risk of off-target editing and potentially causing cytotoxicity. Third, there is a risk of unintended integration of plasmid DNA into the host genome, potentially triggering uncontrollable genetic alterations and posing biosafety risks. Fourth, and more critically, in filamentous fungi, the CRISPR / Cas9 system based on single-site cutting often results in heterozygous transformants, where only one allele is edited while the other remains wild-type. Obtaining homozygous mutants requires subsequent cumbersome screening and purification steps, significantly increasing workload and time costs.
[0005] Therefore, for Trichoderma reesei, an important industrial microorganism, developing a gene editing method that can simultaneously achieve high efficiency, high purity (directly obtaining homozygotes), high safety, and simple operation is of urgent need and great significance for accelerating its metabolic engineering and industrial application. Summary of the Invention
[0006] To improve the efficiency and purity of gene editing in *Trichoderma reesei*, this invention provides a gene editing method and application based on a ribonucleoprotein complex in *Trichoderma reesei*.
[0007] The specific technical solution of this invention is as follows:
[0008] In a first aspect, the present invention provides a gene editing method for *Trichoderma reesei* based on a ribonucleoprotein complex, comprising the following steps:
[0009] S1. Provide two sgRNAs that specifically target the Trichoderma reesei target gene, wherein the two sgRNAs are spaced 50-700 bp apart at their cleavage sites on the target gene;
[0010] S2. Incubate the Cas9 protein with the two sgRNAs provided in step S1 in vitro to obtain a ribonucleoprotein complex containing two sgRNAs.
[0011] S3. Deliver the ribonucleoprotein complex obtained in step S2 together with the exogenous donor DNA into Trichoderma reesei protoplasts.
[0012] S4. Culture the Trichoderma reesei protoplasts treated in step S3 and screen for successfully gene-edited Trichoderma reesei transformants.
[0013] In existing technologies, plasmid-based CRISPR / Cas9 systems suffer from low editing efficiency in Trichoderma reesei, are prone to producing heterozygotes, and pose a risk of exogenous DNA integration.
[0014] This invention combines a dual sgRNA-guided two-site cleavage strategy with direct RNP delivery. Two sgRNAs spaced 50-700 bp apart are designed for the target gene and pre-assembled with Cas9 protein in vitro to form an active RNP complex. This complex is then delivered together with exogenous donor DNA to Trichoderma reesei protoplasts. After the RNP complex enters the cell, dual-site cleavage is introduced at the target site, and precise editing is achieved under the guidance of exogenous donor DNA.
[0015] Preferably, in step S3, the delivery method is electroporation conversion or polyethylene glycol (PEG)-mediated conversion.
[0016] Preferably, in step S1, the sgRNA is synthesized via in vitro transcription using an in vitro transcription template containing a T7 promoter, a specific guide sequence, an sgRNA backbone, and a pol III terminator.
[0017] Preferably, in step S3, the exogenous donor DNA includes a left homologous arm, an edited sequence, and a right homologous arm, wherein the left homologous arm and the right homologous arm are homologous to the genomic sequence outside the double cleavage site determined by the double sgRNA on the target gene.
[0018] The exogenous donor DNA, serving as a homology repair template, contains the "editing sequence" to be integrated, such as the target gene, antibiotic resistance gene expression cassette, or other target editing genes. The sequences flanking the target gene are left and right homologous arms, which are homologous to the genomic sequences upstream and downstream of the breakpoint of the target gene, respectively.
[0019] Further preferably, the lengths of the left homologous arm and the right homologous arm are each independently 500~1000 bp.
[0020] Preferably, the method is used to achieve gene knockout, gene knock-in, point mutation, or promoter replacement in *Trichoderma reesei*. The *Trichoderma reesei* gene editing method provided by this invention is characterized by high efficiency, precision, and safety. This method overcomes the long-standing technical bottlenecks in existing technologies, such as low editing efficiency and difficulty in obtaining homozygotes, by organically combining dual-sgRNA-guided dual-site cleavage with an RNP delivery strategy, providing powerful tool support for the genetic modification and industrial application of *Trichoderma reesei*. This method is not only applicable to gene knockout but can also be used for gene knock-in, point mutation, promoter replacement, and other editing types.
[0021] Secondly, the present invention provides a Trichoderma reesei gene-edited strain prepared by the above-described gene editing method.
[0022] Thirdly, the present invention provides a ribonucleoprotein complex for use in the *Trichoderma reesei* gene editing method according to claim 1, comprising a Cas9 protein and at least two sgRNAs, wherein the two sgRNAs specifically target different sites of the same target gene in the *Trichoderma reesei* genome, and the cleavage sites of the two sgRNAs on the target gene are spaced 50-700 bp apart.
[0023] Preferably, the Cas9 protein and the two sgRNAs are pre-assembled in vitro to form a complex with DNA cleavage activity.
[0024] Compared with the prior art, the present invention has the following technical effects:
[0025] (1) This invention employs a dual-sgRNA-mediated dual-site cleavage strategy to simultaneously establish two DNA double-strand breaks in the target gene region, significantly activating the cell's homologous recombination repair mechanism. Experimental results show that, using the dual-sgRNA strategy of this invention, the homologous targeted repair efficiency is increased to over 75%, while the initial editing efficiency of the control single-sgRNA system is only about 5%, achieving an efficiency improvement of up to 15 times. This significant effect can be attributed to the local chromosomal structural perturbation formed by the double breaks, which increases the contact opportunity between the repair template and the break site, while the region between the double breaks is more easily replaced by the homologous recombination mechanism.
[0026] (2) All transformants obtained by this invention are homozygous, requiring no additional screening and purification steps. In traditional single sgRNA editing systems, due to the single cleavage site, it is common for only one allele to be edited while the other remains wild-type heterozygous, requiring multiple rounds of screening or subcloning to obtain homozygous mutants. However, this invention, through simultaneous cleavage at two sites, efficiently edits both alleles, directly obtaining homozygous transformants, greatly simplifying the subsequent identification and screening workflow.
[0027] (3) This invention is based on the RNP delivery method. The Cas9 protein is pre-assembled into a complex with sgRNA in its active form, and it immediately exerts its function after entering the cell. It is rapidly degraded after editing, effectively eliminating the off-target risk that may be caused by continuous Cas9 expression. At the same time, it does not involve plasmid vectors, completely eliminating the possibility of foreign DNA fragments integrating into the host genome, and improving the biosafety of gene manipulation. The preparation of RNP complexes has a high degree of standardization, small batch-to-batch differences, and good reproducibility and stability. Attached Figure Description
[0028] Figure 1 A schematic diagram of the design of dual sgRNAs.
[0029] Figure 2 A schematic diagram of donor DNA construction.
[0030] Figure 3 To validate the efficiency of ACE1 gene editing mediated by dual sgRNA-RNP.
[0031] Figure 4 To validate the stability of ACE1 gene editing mediated by dual sgRNA-RNP.
[0032] Figure 5 Fluorescence detection of double sgRNA-RNP gene-edited strains. Detailed Implementation
[0033] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.
[0034] In the following embodiments, the preparation methods of the relevant experimental materials are as follows:
[0035] Protoplast preparation: *Trichoderma reesei* conidial glycerol fungus was inoculated onto PDA solid plates and cultured at 28 °C for 7 days. Fresh conidia were washed away with sterile water and transferred to seed culture medium, where they were germinated at 28 °C and 200 rpm for 24 h. After centrifugation and discarding the supernatant, snailase was added to a final concentration of 10 mg / mL and digested for 0.5 h. After centrifugation and discarding the supernatant, OMB solution and PTB solution (2:1 volume ratio) were added sequentially. After centrifugation, the two reagents separated into layers; the milky white suspension at the interface was the protoplast. This was collected and placed in STC solution for storage at 4 °C.
[0036] OMB solution (100 mL): 1.2 M MgSO4 14 g, 10 mM SPB, pH adjusted to 5.8 with 1 M Na2HPO4, stored at 4℃.
[0037] PTB solution (100 mL): 10 g sorbitol, 0.1 M Tris-HCl pH 7.0. Sterilize at 121 °C for 20 min, store at 4 °C.
[0038] RNP preparation: Nuclease-free pipette tips and centrifuge tubes were used throughout the process. sgRNA was diluted to 500 ng / μL with DEPC water, and Cas9 protein (Yisheng, Cas9 Nuclease, 14701ES60) was diluted to 1 ug / μL with DEPC water. 20 μL RNP incubation system: 1) 6 μL sgRNA; 2) 5 μL Cas9; 3) 2 μL 10 Reaction Buffer; 4) 7 μL DEPC water. Mix gently by pipetting and incubate at 37°C for 15 min.
[0039] Transformation system and screening: The experimental group's 200 μL transformation system consisted of: 1) 150 μL protoplasts; 2) 25 μL donor DNA; and 3) 25 μL RNP. The mixture was gently pipetted to mix. The mixture was incubated on ice for 20 min. 1 mL of PTC was added, and the mixture was gently pipetted to mix. The mixture was incubated at room temperature for 50 min. The transformed samples were transferred to 5 mL of PDA regeneration liquid medium and incubated at 28°C, 200 rpm for 24 h. The mixed transformed samples were then transferred to 50 mL of PDA solid medium, gently shaken to mix, and poured into plates. The plates were incubated at 28°C for 3 days. Transformants were transferred to hygromycin-resistant PDA plates, and a small amount of fresh conidia were scraped for genomic verification.
[0040] PTC Solution (20 mL): 60% PEG 12 g, 50 mM CaCl2 0.111 g, 10 mM Tris-HCl pH 7.5, sterilized at 121℃ for 20 min, stored at room temperature.
[0041] PDA regeneration liquid medium (50 mL): 42 mL PDA medium, 5 g sorbitol. Sterilize at 115℃ for 30 min.
[0042] Example 1: Knockout of the ACE1 gene in Trichoderma reesei using a double sgRNA-RNP strategy
[0043] This embodiment uses Trichoderma reesei strain RUT-C30 (a common Trichoderma reesei strain, purchased from the market) as the starting species. A double sgRNA-guided RNP delivery strategy was employed to knock out the Trichoderma reesei transcription factor gene ACE1 (a negative regulator of cellulase expression). Simultaneously, a fluorescent protein expression cassette and a hygromycin resistance marker were introduced. The specific implementation steps are as follows:
[0044] Based on the Trichoderma reesei ACE1 gene sequence (JGI accession number: TrG0785W), two target sites were selected within its open reading frame, and two sgRNAs were designed, named T1 and T2, respectively. The cleavage sites of the two sgRNAs are approximately 610 bp apart, and their specific sequences are as follows:
[0045] T1 sequence: 5'-GAGTCATGGCAATACGACGACGG-3', as shown in SEQ NO.1;
[0046] T2 sequence: 5'-TGTCGCTTGAATGCATCGGACGG-3', as shown in SEQ NO.2.
[0047] Each sgRNA's in vitro transcription template was constructed via overlap extension PCR and contained a T7 promoter, a 20 bp specific guide sequence, an sgRNA backbone, and a pol III terminator, as follows: Figure 1 As shown. Figure 1 In the diagram, the blue sequence represents the T7 promoter, the red sequence represents the specific guide sequence, the yellow sequence represents the sgRNA backbone, and the green sequence represents the pol III terminator. After purification of the PCR product, in vitro transcription was performed using the HiScribe T7 Quick High Yield RNA Synthesis Kit, incubated at 37 °C for 4 h, followed by DNase I treatment to remove the DNA template. The sgRNA was then purified by phenol-chloroform extraction, and after concentration determination, aliquots were stored at -80 °C.
[0048] Donor DNA was constructed using fusion PCR, and its structural diagram is shown below. Figure 2The specific element sequence is as follows: left homologous arm (1000 bp upstream of ACE1) - fluorescent protein (mScarlet3) expression cassette - hygromycin B phosphotransferase (hph) expression cassette - right homologous arm (1000 bp downstream of ACE1). Both homologous arms are located 3 bp upstream of the two PAM cleavage sites (T1 / T2). mScarlet3 serves as a reporter gene for easy observation of transformation efficiency, and hph serves as a selection marker. The left and right homologous arms were obtained by PCR amplification from Trichoderma reesei genomic DNA. The final donor DNA was purified by agarose gel electrophoresis and dissolved in sterile water for later use.
[0049] The Cas9 protein and two sgRNAs were combined to prepare a double sgRNA-RNP complex using the method described above, and then transformed into Trichoderma reesei protoplasts to obtain ACE1 knockout recombinant Trichoderma reesei transformants.
[0050] Example 2: Validation of the efficiency of ACE1 gene editing mediated by dual sgRNA-RNP
[0051] To systematically evaluate the impact of the dual sgRNA strategy on gene editing efficiency in *Trichoderma reesei*, this example applies the dual sgRNA-RNP system constructed in Example 1 to *Trichoderma reesei* protoplast transformation and quantitatively analyzes the editing efficiency. Details are as follows:
[0052] Maintaining the same Cas9 protein configuration and donor DNA structure as in Example 1, a pre-assembled RNP complex containing both T1 and T2 sgRNAs was co-transformed with donor DNA into Trichoderma reesei protoplasts. Hygromycin B resistance was used as a selection marker, and transformants were identified by PCR and sequencing. Two pairs of specific primers were used for PCR verification of the transformants: the first pair of primers, A33-TS-F / R, located within the target site region of the ACE1 gene, amplified a 652 bp specific band in wild-type strains, while positive transformants showed no band amplification due to target region replacement; the second pair of primers, A33-SD-F / R, located upstream of the left homologous arm genomic sequence and within the hph expression frame, respectively, amplified no product in wild-type strains due to the lack of corresponding binding sites, while positive transformants amplified a 1820 bp band, confirming that the donor DNA was precisely integrated into the predetermined target site through homologous recombination.
[0053] Experimental results showed that in randomly selected hygromycin-resistant transformants, the ACE1 gene substitution efficiency mediated by the homology-directed repair pathway reached 75%, meaning that 75 out of every 100 resistant transformants were correct gene knockout events. As a control, RNP transformation experiments using the same experimental conditions but with only a single sgRNA (T1 or T2 alone) showed a homology-directed repair efficiency of only about 5%, and all positive transformants obtained were heterozygous. Therefore, the dual sgRNA strategy achieved a 15-fold efficiency improvement compared to the initial single sgRNA system.
[0054] Experimental results are as follows Figure 3 As shown, this data fully demonstrates that increasing the cleavage density of target sites is significantly more effective than a single strategy of optimizing the nuclear localization ability of the Cas9 protein. Sanger sequencing analysis of the obtained 50 μg / mL hygromycin B-resistant transformants revealed that in all randomly selected positive transformants, the sequencing maps of the ACE1 gene integration site region showed a single nucleotide signal peak, with no residual wild-type sequence or any overlapping peaks observed. This proves that the dual-sgRNA-induced dual-site cleavage pressure effectively promoted the synchronized editing of all nuclei in the multinucleate mycelium, thus completely avoiding the generation of heterozygotes. These results validate, from multiple perspectives, the reliability and superiority of the dual-sgRNA-RNP system in achieving efficient, precise, and homologous concordant recombination in *Trichoderma reesei*.
[0055] In this embodiment, the site-specific integration verification primer was A33-SD-F / R, and the target site region was amplified using primer A33-TS-F / R to confirm the deletion status of the ACE1 gene. The primer sequences are as follows:
[0056] A33-TS-F (5'-3'): CAAGCCGTCGTCGTATTGCC, as shown in SEQ NO.3;
[0057] A33-TS-R (5'-3'): TGATGCATCGGACGGACG, as shown in SEQ NO.4;
[0058] A33-SD-F (5'-3'): AGTGGAAACCGACGCCC, as shown in SEQ NO.5;
[0059] A33-SD-R (5'-3'): GGAGAATTGAGGCTCGCCCAG, as shown in SEQ NO.6.
[0060] Example 3: Validation of the stability of ACE1 gene editing mediated by dual sgRNA-RNPs
[0061] To evaluate the genetic stability of gene-edited strains obtained using the dual sgRNA-RNP system, this example conducted a continuous passage stability experiment without selection pressure on the homozygous mutant strains that tested positive in Example 2. Homozygous ACE1 knockout mutants, confirmed by PCR and sequencing, were randomly selected and inoculated onto PDA slant media without hygromycin B. The cultures were incubated at 28°C for 5 days until sporulation. Spores were collected and inoculated again onto fresh PDA medium without hygromycin B, and this process was repeated for multiple passages. Genomic DNA was extracted from mycelium at each generation until 10 consecutive passages were completed. The genomic DNA from the 10th generation was amplified by PCR using the site-specific integration verification primer A33-SD-F / R described in Example 2. Simultaneously, the target site region was amplified using primer A33-TS-F / R to confirm the deletion status of the ACE1 gene. The experimental results are as follows: Figure 4 As shown. Figure 4 In the image, (A) shows the genotype verification results of the transformants; (B) shows the growth morphology of the transformants on hygromycin-resistant plates.
[0062] Experimental results showed that positive transformants mediated by dual sgRNA-RNP, after 10 generations of culture without selection pressure, could still stably amplify a specific band of 1820 bp using A33-SD-F / R primers, and the band size was completely consistent with that of the first generation, with no unexpected small fragment amplification products appearing; no amplification bands were observed using A33-TS-F / R primers, confirming that the ACE1 gene had not undergone reversion mutation (e.g., Figure 4 (As shown).
[0063] This result fully demonstrates that double sgRNA-RNP-mediated gene editing events have good genetic stability under no selection pressure, and the integrative elements can be stably maintained in the host genome for a long time.
[0064] Furthermore, this embodiment also conducted a parallel comparison of the phenotypic stability of transformants obtained by double sgRNA-RNP and single sgRNA-RNP. Positive homozygous strains obtained by double sgRNA-RNP and resistant transformants obtained by single sgRNA-RNP (some of which were identified as false positives) were inoculated onto PDA plates containing 50 μg / mL hygromycin B and control plates without hygromycin, respectively. Growth was observed after incubation at 28°C for 3 days. The results showed that the positive homozygous strains mediated by double sgRNA-RNP grew well on the hygromycin-resistant plates, with normal colony morphology, and no significant difference in growth status compared to those on the hygromycin-free plates; however, among the transformants mediated by single sgRNA-RNP, some strains showed obvious growth restriction on the hygromycin-resistant plates, manifested as reduced colony diameter, sparse hyphae, or cessation of growth (e.g., Figure 4(As shown in the figure). This result further highlights the advantages of the dual sgRNA strategy in improving editing accuracy and reducing false positive rate, and also indirectly confirms the genetic and phenotypic stability of the positive strains obtained by dual sgRNA-RNP.
[0065] In summary, the dual sgRNA-RNP system not only enables efficient gene knockout and homozygous mutant acquisition in Trichoderma reesei, but also produces engineered strains with excellent genetic stability, meeting the needs of long-term passaging and large-scale application in industrial fermentation processes.
[0066] Example 4: Fluorescence detection of transformants mediated by dual sgRNA-RNP
[0067] To visually verify the functional expression of exogenous genes mediated by the dual sgRNA-RNP system in *Trichoderma reesei*, this embodiment uses the novel red fluorescent protein mScarlet3 as a reporter gene to observe the mycelial fluorescence of the positive transformants obtained in Example 2. The transformants used in this embodiment were derived from the ACE1 knockout homozygous strain verified by PCR and sequencing in Example 2, whose donor DNA contained the Pcbh1-driven mScarlet3 expression cassette. The positive transformants were inoculated into PDA medium and cultured at 28°C for 3 days. When mycelial growth was vigorous, a small amount of mycelium was picked up with sterile forceps and placed on a glass slide. A drop of sterile water was added, and a coverslip was gently pressed down. The slide was immediately placed under a fluorescence microscope for observation. A 40x objective lens was used, with an excitation wavelength of 560 nm, an emission wavelength of 610 nm, an exposure time of 600 ms, and a gain of 100 ms. Bright-field and fluorescence images were simultaneously acquired in the same field of view. The experimental results are as follows: Figure 5 As shown.
[0068] Fluorescence microscopy revealed that the positive strains mediated by dual sgRNA-RNP showed a distinct red fluorescence signal at the corresponding excitation wavelength (e.g., Figure 5As shown in the image, the hyphal cytoplasm is filled with uniformly distributed red fluorescence, and fluorescence signals are also visible through the hyphal septa, indicating that mScarlet3 is efficiently expressed and correctly folded within the Trichoderma reesei cells. Under the same imaging parameters, the wild-type control strain showed no autofluorescence background, which contrasted sharply with the strong red fluorescence of the positive transformants. Statistical observation of multiple fields of view showed that all identified positive transformants exhibited uniform fluorescence signals, and no chimerism with varying fluorescence intensities was observed, further confirming the homogeneity of transformants obtained by the dual sgRNA strategy. This example visually confirms the functional expression of exogenous genes mediated by the dual sgRNA-RNP system through fluorescence microscopy, and also verifies the applicability of mScarlet3 as a novel fluorescent reporter gene in Trichoderma reesei. This system provides a reliable live-cell imaging tool for subsequent studies on gene expression dynamics, protein localization, and cell biological processes in Trichoderma reesei.
[0069] Unless otherwise specified, all raw materials and equipment used in this invention are commonly used in the field; all methods used in this invention are conventional methods in the field. Unless otherwise specified, the experimental methods and operations in this invention are based on Molecular Cloning: A Laboratory Manual (4th Edition), translated by He Fuchu, Chen Wei, Yang Xiaoming, et al.
[0070] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.
Claims
1. A gene editing method for *Trichoderma reesei* based on a ribonucleoprotein complex, characterized in that: Includes the following steps: S1. Provide two sgRNAs that specifically target the Trichoderma reesei target gene, wherein the two sgRNAs are spaced 50-700 bp apart at their cleavage sites on the target gene; S2. Incubate the Cas9 protein with the two sgRNAs provided in step S1 in vitro to obtain a ribonucleoprotein complex containing two sgRNAs. S3. Deliver the ribonucleoprotein complex obtained in step S2 together with the exogenous donor DNA into Trichoderma reesei protoplasts. S4. Culture the Trichoderma reesei protoplasts treated in step S3 and screen for successfully gene-edited Trichoderma reesei transformants.
2. The *Trichoderma reesei* gene editing method as described in claim 1, characterized in that: In step S3, the delivery method is electroporation conversion or polyethylene glycol-mediated conversion.
3. The *Trichoderma reesei* gene editing method as described in claim 1, characterized in that: In step S1, the sgRNA is synthesized via in vitro transcription using an in vitro transcription template containing a T7 promoter, a specific guide sequence, an sgRNA backbone, and a pol III terminator.
4. The *Trichoderma reesei* gene editing method as described in claim 1, characterized in that: In step S3, the exogenous donor DNA includes a left homologous arm, an edited sequence, and a right homologous arm, wherein the left and right homologous arms are homologous to the genomic sequence outside the double cleavage site determined by the double sgRNA on the target gene.
5. The *Trichoderma reesei* gene editing method as described in claim 4, characterized in that: The lengths of the left and right homologous arms are each independently 500~1000 bp.
6. The *Trichoderma reesei* gene editing method as described in claim 1, characterized in that: The method is used to achieve gene knockout, gene knock-in, point mutation, or promoter substitution in Trichoderma reesei.
7. A Trichoderma reesei gene-edited strain prepared by the gene-editing method according to any one of claims 1 to 6.
8. A ribonucleoprotein complex used in the *Trichoderma reesei* gene editing method of claim 1, characterized in that: It contains a Cas9 protein and at least two sgRNAs, which specifically target different sites of the same target gene in the Trichoderma reesei genome, and the two sgRNAs have a cleavage site interval of 50-700 bp on the target gene.
9. The ribonucleoprotein complex as described in claim 8, characterized in that: The Cas9 protein and the two sgRNAs are pre-assembled in vitro to form a complex with DNA cleavage activity.