Recombinant trichoderma reesei with high lactoferrin production and application thereof

By genetically engineering the Trichoderma reesei strain CJ2095Δku80, knocking out the 79644 protein and overexpressing the 53561, 43671, 102785, 111888 and 111955 proteins, the problem of low efficiency in the synthesis of lactoferrin by Trichoderma reesei was solved, and the efficient production of recombinant human lactoferrin was achieved.

CN122256153APending Publication Date: 2026-06-23JIANGNAN UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGNAN UNIV
Filing Date
2026-04-27
Publication Date
2026-06-23

Smart Images

  • Figure CN122256153A_ABST
    Figure CN122256153A_ABST
Patent Text Reader

Abstract

The present application relates to a kind of high-yield recombinant lactoferrin of Trichoderma reesei and its application, belong to microbial technology field.The present application first finds that the protein with Protein ID 79644, 43671, 53561, 102785, 111888 and 111955 can affect the synthesis of lactoferrin in recombinant Trichoderma reesei.Further, the present application finds that different proteins have great influence on the synthesis of lactoferrin by overexpressing the protein with Protein ID 53561, 43671, 102785, 111888 and 111955, and the yield of lactoferrin can be significantly improved by knocking out the protein with Protein ID 79644.When knocking out 79644 and overexpressing the two proteins of 53561 and 111888, the yield of lactoferrin is significantly improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a recombinant Trichoderma reesei that produces high levels of lactoferrin and its applications. Background Technology

[0002] Lactoferrin is a unique red protein found in milk, initially named lactoferrin because it is very similar to transferrin in its iron-binding capacity. Its discovery dates back to 1960 when it was first isolated from milk by ammonium sulfate precipitation and chromatography. Subsequent in-depth studies revealed the presence of lactoferrin in various exocrine fluids, including saliva, bile, tears, and especially breast milk, indicating that it is an important product secreted by epithelial cells. In the pharmaceutical and food industries, lactoferrin is widely used as a representative of multifunctional proteins.

[0003] Currently, the microbial synthesis of lactoferrin mainly relies on *Escherichia coli* (E. coli) and yeast as chassis cells. Ma et al. fused the lactoferrin gene with the α-factor signaling sequence of *S. cerevisiae*, and after expression in *P. pastoris*, produced 1.2 g·L⁻¹. -1 Recombinant human lactoferrin (published in the paper "High-level expression and production of human lactoferrin in Pichia pastoris"). As an important industrial strain for protein product production, *Trichoderma reesei* (T. reesei) possesses a robust post-translational modification system and protein secretion capacity. Therefore, establishing reliable *T. reesei* chassis cells for the production of recombinant lactoferrin is of great significance.

[0004] In the early stages of our research, we constructed a Trichoderma reesei strain that can stably synthesize recombinant human lactoferrin, increased the yield through gene editing, and established a high-throughput screening method and a highly economical method for detecting recombinant human lactoferrin (related content is disclosed in patents CN117487675A, CN119709441A, CN119985996A and CN121783929A).

[0005] Trichoderma reesei is a safe filamentous fungus that produces high levels of cellulase and possesses extremely strong protein synthesis capabilities. To further explore the advantages of Trichoderma reesei as a cellular factory for recombinant protein synthesis, we investigated related genes that promote the efficient synthesis of recombinant human lactoferrin, which is of great significance for addressing the problem of insufficient lactoferrin supply in my country. Summary of the Invention

[0006] Therefore, the technical problem to be solved by the present invention is to overcome the problem of low efficiency in the synthesis of lactoferrin by Trichoderma reesei in the prior art.

[0007] To address the aforementioned technical problems, this invention provides a recombinant *Trichoderma reesei* strain with high lactoferrin production and its applications. This invention is the first to discover that proteins with Protein IDs of 79644, 43671, 53561, 102785, 111888, and 111955 can influence lactoferrin synthesis in recombinant *Trichoderma reesei*. Furthermore, this invention, through overexpression of proteins with Protein IDs of 53561, 43671, 102785, 111888, and 111955, found that different proteins have a significant impact on lactoferrin synthesis, and that knocking out the protein with Protein ID 79644 significantly increases lactoferrin production. When 79644 is knocked out and proteins 53561 and 111888 are overexpressed, lactoferrin production is significantly increased.

[0008] The first objective of this invention is to provide a recombinant Trichoderma reesei strain that produces high levels of lactoferrin, wherein the recombinant Trichoderma reesei strain is derived from Trichoderma reesei CJ2095Δku80 and overexpresses one or more proteins with Protein IDs of 53561, 43671, 102785, 111888, and 111955.

[0009] Furthermore, the recombinant Trichoderma reesei also had the gene encoding the protein with Protein ID 79644 knocked out.

[0010] Furthermore, Trichoderma reesei CJ2095Δku80 was used as the starting strain for modification, and Trichoderma reesei CJ2095Δku80 is disclosed in patent publication number CN120399900A.

[0011] Furthermore, the aforementioned Protein ID is derived from the Trichoderma reesei genome database (https: / / mycocosm.jgi.doe.gov / pages / search-for-genes.jsf?organism=Trire2), and the relevant sequence can be obtained through the Trichoderma reesei genome database.

[0012] Further, the gene sequence encoding the protein with Protein ID 79644 is shown in SEQ ID NO.1, the gene sequence encoding the protein with Protein ID 43671 is shown in SEQ ID NO.2, the gene sequence encoding the protein with Protein ID 53561 is shown in SEQ ID NO.3, the gene sequence encoding the protein with Protein ID 102785 is shown in SEQ ID NO.4, the gene sequence encoding the protein with Protein ID 111888 is shown in SEQ ID NO.5, and the gene sequence encoding the protein with Protein ID 111955 is shown in SEQ ID NO.6.

[0013] Furthermore, SEQ ID NO.1:

[0014]

[0015] Furthermore, SEQ ID NO.2:

[0016]

[0017] Further, SEQ ID NO.3:

[0018] ATGGACTCCCTCCCCTTCGAGCTCATCACCCAAATCCTCACCCACCTCCCCCGGCACGACCTCCCCTCCGCCCGCCTCACCTGCCACGCCTTCAACGCCGCCCTCGCGAAACCCACCTTCTCCGTCCTCGCCTCCTTCGTCGACCCGGCCGTCGCCCAGCAGACCATTGAGCACATCGCCGCCGACCTCAGCCGTCGTCCAAAAGCCATCTGGTCCCCCGGGTGCTCCGTCCCGCGCGGGCTTCCCGTCCCGGAGAGTTTCCTGTCTGCGATGCGTGCGGCGTTGAGGGGCGCCGAGGAGTGTCCTTGTCCTACTGCATCTTATACATCTTCTTCTTCTTTTTCGTCTTCTGCCTCATCGTCATCTCCCATGGCCCGCTCTCCTTCCATCTCATCATCATCGTGGTCTTCTTCTTCAGCAAGCAGCACCGCTGCATGGAGCGACGGTGAAGACAGCGATGCAGGCTCAGACATCACGACGTACAGTGGCGCCGAAGGGGAAAAGATTACGGCGGAGAACTTTGGGCGAAGCATTGGCATGGACGAGGTGACTGAGGACGTGCTGCGGCAGGCCTTGTTCCGGTATGCGCTCTACTTGAGCTACGTCTATACGGGAGAGGGCGAGGCGCCGCAGCTGTGGGTGATGAATTCGAAGAAGTGGGCGCAGCAGCAATGA。

[0019] Further, SEQ ID NO.4:

[0020]

[0021] Furthermore, SEQ ID NO.5:

[0022]

[0023] Furthermore, SEQ ID NO.6:

[0024]

[0025] Furthermore, the proteins with Protein IDs of 53561, 43671, 102785, 111888, and 111955 are expressed via the Padh promoter.

[0026] Furthermore, the nucleotide sequence of the promoter is shown in SEQ ID NO.7.

[0027] Furthermore, SEQ ID NO.7:

[0028]

[0029] A second objective of this invention is to provide a microbial preparation comprising the aforementioned recombinant Trichoderma reesei.

[0030] A third objective of this invention is to provide the application of the above-mentioned recombinant Trichoderma reesei or the above-mentioned microbial preparation in the production of lactoferrin.

[0031] A fourth objective of this invention is to provide a method for producing lactoferrin, wherein the method involves inoculating the recombinant Trichoderma reesei or the microbial preparation into a culture medium for fermentation.

[0032] Furthermore, the fermentation culture temperature is 25-35℃.

[0033] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:

[0034] This invention systematically investigated the effects of key gene knockout and overexpression on the efficient production of recombinant human lactoferrin in *Trichoderma reesei* strain CJ2095Δku80 using genetic engineering techniques. Fermentation experiments verified that key genes 53561, 111888, and 79644 significantly affected the efficient production of recombinant human lactoferrin in *T. reesei*. Finally, through optimized combination, efficient expression of recombinant human lactoferrin was achieved in the fermentation medium, with a shake-flask yield of 321.46 mg / L. Attached Figure Description

[0035] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0036] Figure 1 This was verified by PCR using an engineered strain of T. reesei that had undergone molecular modification.

[0037] Figure 2 This is a PDA plate growth status verification of engineered strains T. reesei CJ2095Δku80Δ79644, T. reesei CJ2095Δku80::43671, T. reesei CJ2095Δku80::53561, T. reesei CJ2095Δku80::111888, T. reesei CJ2095Δku80::111955, and T. reesei CJ2095Δku80::102785.

[0038] Figure 3The effects of engineered strains T. reesei CJ2095Δku80Δ79644, T. reesei CJ2095Δku80::43671, T. reesei CJ2095Δku80::53561, T. reesei CJ2095Δku80::111888, T. reesei CJ2095Δku80::111955, T. reesei CJ2095Δku80::102785, and T. reesei CJ2095Δku80Δ79644::53561::111888 on the synthesis of human lactoferrin content and biomass;

[0039] Figure 4 This is an SDS-PAGE image of the extracellular proteins of *T. reesei* after molecular modification. 1, 2, 3, 4, 5, 6, and 7 represent strains *T. reesei* CJ2095Δku80::102785, *T. reesei* CJ2095Δku80::111955, *T. reesei* CJ2095Δku80::53561, *T. reesei* CJ2095Δku80::111888, *T. reesei* CJ2095Δku80::43671, *T. reesei* CJ2095Δku80, and *T. reesei* CJ2095Δku80Δ79644, respectively. Detailed Implementation

[0040] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0041] Culture medium:

[0042] LB medium (1 L): 10g peptone, 10g NaCl, 5g yeast extract.

[0043] PDA medium (1 L): 37 g potato dextrose agar medium.

[0044] MM medium (1 L): 20 g glucose, 10 g (NH4)2SO4, 6.7 g YNB.

[0045] Malt extract agar medium (1 L): 30 g malt extract, 20 g agar powder.

[0046] Fermentation medium (1 L): 4 g KH2PO4, 2.8 g (NH4)2SO4, 0.6 g MgSO4·7H2O, 0.5 g CaCl2, 0.6 g urea, 3 g peptone, 1 g Tween-80, 5 g CaCO3, trace elements (0.005 g FeSO4·7H2O, 0.0016 g MnSO4·H2O, 0.0014 g ZnSO4·7H2O, 0.002 g CoCl2·6H2O), 20 g wheat bran, 30 g microcrystalline cellulose.

[0047] Seed culture medium (1 L): 20 g glucose, 15 g K2HPO4, 5 g (NH4)2SO4, 0.6 g MgSO4·7H2O, 0.6 g CaCl2, 2 g peptone, trace elements (0.005 g FeSO4·7H2O, 0.0016 g MnSO4·H2O, 0.0014 g ZnSO4·7H2O, 0.002 g CoCl2·6H2O).

[0048] IM medium (1 L): 1.45 g KH2PO4, 2.05 g K2HPO4, 0.5 g (NH4)2SO4, 0.5 g MgSO4·7H2O, 0.15 g NaCl, 5 g glycerol, 0.06 g CaCl2, 0.0025 g FeSO4·7H2O, 1.8 g glucose, 8.54 g 2-morpholinoethanesulfonic acid, 200 μM acetylsyleugenone.

[0049] Determination of T. reesei biomass:

[0050] Changes in the biomass of *T. reesei* were indirectly determined by measuring the DNA content within its cells. 1 mL of bacterial culture was transferred to a 2 mL EP centrifuge tube, centrifuged at 12000 × g, 4 °C for 3 min, and the precipitate was collected. The precipitate was washed three times with 1 mL of deionized water, and centrifuged again at 12000 × g, 4 °C for 3 min to remove the supernatant. 1 mL of 10% trichloroacetic acid solution was added to the washed mycelium, vortexed to mix, and incubated on ice for 3 min. The supernatant was then removed. 1 mL of 10% trichloroacetic acid solution was added again, vortexed to mix, and incubated on ice for 3 min. The mixture was then boiled in water for 30 min, cooled, and centrifuged at 12000 × g for 10 min. The supernatant was collected, and the absorbance (A260) at 260 nm was measured using a NanoDrop spectrophotometer (Hangzhou Ausen Instruments Co., Ltd., Hangzhou, China).

[0051] Detection of recombinant human lactoferrin content:

[0052] Take an appropriate amount of fermentation broth, centrifuge at 12,000 × g and 4℃ for 3 min, and remove the supernatant. Take 100 μL of the supernatant and detect the content of recombinant human lactoferrin according to the lactoferrin ELISA kit (Sangon Biotech (Shanghai) Co., Ltd., Shanghai, China).

[0053] SDS-PAGE analysis:

[0054] Take 30 μL of fermentation broth supernatant, add 10 μL of 4× loading buffer, and incubate in a boiling water bath for 3 min. Take 3 μL of the sample for SDS-PAGE analysis.

[0055] Determination of enzyme activity on filter paper:

[0056] Cellulase filter paper enzyme activity was determined using the DNS method: Three 6 mm diameter filter papers (Whatman) were placed in a 2 mL EP centrifuge tube, and 180 μL of pH 4.8 0.05 M sodium citrate buffer was added. 20 μL of enzyme solution was added, and the reaction was carried out at 50°C for 60 min. 300 μL of DNS reagent was added, and the mixture was boiled in a water bath for 5 min, followed by ice bath cooling. 50 μL of the final reaction mixture was mixed with 150 μL of deionized water, and the absorbance (A540) at 540 nm was measured. Cellulase filter paper enzyme activity (U) is defined as the amount of enzyme required to catalyze the production of 1 μmol of glucose per minute under the above conditions; one unit of enzyme activity (U) is defined as this amount of enzyme.

[0057] Unless otherwise specified, the experimental methods described in the following examples can be performed in accordance with conventional methods or the instructions of the manufacturer of the product used. Unless otherwise specified, the materials and reagents used can be obtained commercially.

[0058] The primer sequences involved in the following examples are shown in Table 1.

[0059] Table 1 Primers used in the study

[0060]

[0061] Example 1 Construction of recombinant plasmid

[0062] For the construction of gene overexpression plasmids, taking the construction of the gene 53561 overexpression plasmid pCAMBIA1303-LB-RB-UPku80-Padh-53561-pyr4 cassette-DOWNku80 as an example: using the Trichoderma reesei CJ2095Δku80 genome as a template, and using Δku80-up-FW / RS and Δku80-down-FW / RS as primers, PCR amplification was performed to obtain the upstream and downstream homologous arms of gene ku80, UPku80 (1.15 kb) and DOWNku80 (1.2 kb). The PCR amplification conditions were: 95℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 55℃ annealing for 30 s, 72℃ extension (1 min extension per kb according to fragment length), 30 cycles; 72℃ extension for 10 min. Using plasmid pCAMBIA1303-TrpC-Hygro-gpdA-GFP as a template and backbone-FW and backbone-RS as primers, the gene fragment pCAMBIA1303-LB-RB amplified by PCR was used as the vector backbone. The Trichoderma reesei CJ2095Δku80 genome was used as a template, and the genes Padh, 53561, and pyr4 cassette (53561)-FW / pyr4 cassette-RS were amplified by PCR to obtain the genes Padh, 53561, and pyr4 cassette, respectively. All PCR-amplified gene fragments UPku80, DOWNku80, pyr4 cassette, pCAMBIA1303-LB-RB, Padh, and 53561 were ligated using the ClonExpress MultiS One Step Cloning Kit. The ligation solution was transformed into E. coli JM109 competent cells and cultured at 37°C for 10 h on solid LB medium containing a final concentration of 25 μg / mL kanamycin. PCR amplification and verification were performed using Δuniversal validation-FW and Δuniversal validation-RS primers, followed by gene sequencing verification, and positive clones were screened. Finally, the recombinant plasmid pCAMBIA1303-LB-RB-UPku80-Padh-53561-pyr4 cassette-DOWNku80 was obtained using the EndoFree Plasmid Mini Kit. The construction procedure for recombinant plasmids overexpressing genes 43671, 102785, 111888, and 111955 was the same.

[0063] The construction of the gene knockout plasmid, pCAMBIA1303-LB-RB-UP79644-pyr4 casssette-DOWN79644, for gene 79644 was as follows: Using the Trichoderma reesei CJ2095Δku80 genome as a template, and using Δ79644-up-FW / RS and Δ79644-down-FW / RS as primers, PCR amplification was performed to obtain the upstream and downstream homologous arms of gene 79644, UP79644 (1.15 kb) and DOWN79644 (1.2 kb). The PCR amplification conditions were: 95℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 55℃ annealing for 30 s, 72℃ extension (1 min extension per kb according to fragment length), 30 cycles; and 72℃ extension for 10 min. Using plasmid pCAMBIA1303-TrpC-Hygro-gpdA-GFP as a template and backbone-FW and backbone-RS as primers, the gene fragment pCAMBIA1303-LB-RB was amplified by PCR and used as the vector backbone. The Trichoderma reesei CJ2095Δku80 genome was used as a template, and the gene pyr4 cassette was amplified by PCR using pyr4 cassette(79644)-FW / pyr4 cassette-RS as primers. All PCR-amplified gene fragments UP79644, DOWN79644, pyr4 cassette, and pCAMBIA1303-LB-RB were ligated using the ClonExpress MultiS One Step Cloning Kit. The ligation solution was transformed into E. coli JM109 competent cells and cultured at 37°C for 10 h on solid LB medium containing a final concentration of 25 μg / mL kanamycin. PCR amplification and verification were performed using Δ79644 validation-FW and Δ universal validation-RS primers, followed by gene sequencing verification and screening for positive clones. Finally, the recombinant plasmid pCAMBIA1303-LB-RB-UP79644-pyr4 casssette-DOWN79644 was obtained using the EndoFree Plasmid Mini Kit.

[0064] Example 2: Construction of Recombinant T. reesei

[0065] Molecular modification of *T. reesei* was performed using *A. tumefaciens*-mediated transformation. *A. tumefaciens* containing the recombinant plasmid constructed in Example 1 and *T. reesei* were plated on solid IM medium covered with cellophane and co-cultured at 24°C in the dark for 48 h. The cellophane was then transferred to new MM solid selection medium (containing 200 mg / L cefotaxime sodium) and cultured at 30°C for 2–7 days. Single colonies that grew were picked and cultured on secondary screening solid medium for 2–3 days. Hyphae were then picked and cultured in EP tubes containing 1 mL of seed medium for 2 days. Genomic DNA was extracted and verified. Figure 1 Positive clones were streaked on PDA solid medium containing 0.1% (v / v) Triton-X 100 for 2-3 days. Single spores were isolated and inoculated into PDA medium for sporulation culture for 5-7 days to preserve the strain. The resulting engineered strains were: T. reesei CJ2095Δku80Δ79644, T. reesei CJ2095Δku80::43671, T. reesei CJ2095Δku80::53561, T. reesei CJ2095Δku80::111888, T. reesei CJ2095Δku80::111955, and T. reesei CJ2095Δku80::102785.

[0066] Example 3: Verification of the growth status of recombinant T. reesei on PDA plates

[0067] Three μL of spore suspensions of the engineered strains *T. reesei* CJ2095Δku80Δ79644, *T. reesei* CJ2095Δku80::43671, *T. reesei* CJ2095Δku80::53561, *T. reesei* CJ2095Δku80::111888, *T. reesei* CJ2095Δku80::111955, and *T. reesei* CJ2095Δku80::102785 constructed in Example 2 were placed in the center of a PDA solid medium plate and incubated at 30°C for 5 days. The growth status of the recombinant strains was then observed. Figure 2It can be seen that, compared with the control strain T. reesei CJ2095Δku80, the constructed engineered strains T. reesei CJ2095Δku80Δ79644, T. reesei CJ2095Δku80::43671, T. reesei CJ2095Δku80::53561, T. reesei CJ2095Δku80::111888, T. reesei CJ2095Δku80::111955, and T. reesei CJ2095Δku80::102785 showed no significant difference in growth. Figure 2 The knockout or overexpression of the relevant genes did not significantly affect its growth.

[0068] Example 4: Fermentation production of recombinant human lactoferrin from recombinant T. reesei after overexpression of key genes.

[0069] The engineered strains *T. reesei* CJ2095Δku80::43671, *T. reesei* CJ2095Δku80::53561, *T. reesei* CJ2095Δku80::111888, *T. reesei* CJ2095Δku80::111955, and *T. reesei* CJ2095Δku80::102785 constructed in Example 2 were cultured on malt extract agar medium for approximately 7 days. Mature spores from the malt extract agar medium were eluted using spore elution buffer (physiological saline containing 0.05% Tween-80) and inoculated into seed culture medium, with a final spore concentration of 1 × 10⁻⁶. 6 Cells / mL, incubated at 30℃ and 200 rpm for 48 h.

[0070] The seed culture was transferred to 100 mL of fermentation medium with microcrystalline cellulose as the carbon source at an inoculum of 10%, and cultured at 30℃ and 200 rpm for 7 days. After overexpressing genes 53561 and 111888 in *T. reesei*, compared with the control strain, the recombinant human lactoferrin yield of the recombinant strain increased by 45.59% and 40.99%, respectively, with yields of 295.12 mg / L and 285.79 mg / L, respectively. Figure 3 and 4 ).

[0071] Example 5: Fermentation production of recombinant human lactoferrin from recombinant T. reesei strain with gene 79644 knocked out.

[0072] The engineered strain *T. reesei* CJ2095Δku80Δ79644 constructed in Example 2 was cultured on malt extract agar medium for approximately 7 days. Mature spores from the malt extract agar medium were eluted using spore elution buffer (physiological saline containing 0.05% Tween-80) and inoculated into seed culture medium, with a final spore concentration of 1 × 10⁻⁶. 6 Cells / mL, incubated at 30℃ and 200 rpm for 48 h.

[0073] The recombinant human lactoferrin yield of the engineered strain T. reesei CJ2095Δku80Δ79644 reached 290.02 mg / L, which is 43.07% higher than that of the original strain T. reesei CJ2095Δku80. Figure 3 and Figure 4 ).

[0074] Example 6: Efficient Synthesis of Recombinant Human Lactoferrin by Combining Key Genes

[0075] To further enhance the ability of *T. reesei* to synthesize recombinant human lactoferrin, gene 111888 was overexpressed and gene 79644 was knocked out on the engineered strain *T. reesei* CJ2095Δku80::53561, resulting in the engineered strain *T. reesei* CJ2095Δku80Δ79644::53561::111888. Figure 3 It can be seen that, compared with the original strain T. reesei CJ2095Δku80, the recombinant human lactoferrin yield of the engineered strain T. reesei CJ2095Δku80Δ79644::53561::111888 reached 321.46 mg / L, which is 58.58% higher.

[0076] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A recombinant Trichoderma reesei strain that produces high levels of lactoferrin, characterized in that, The recombinant Trichoderma reesei strain uses Trichoderma reesei CJ2095Δku80 as the starting strain and overexpresses one or more proteins with Protein IDs of 53561, 43671, 102785, 111888, and 111955.

2. The recombinant Trichoderma reesei according to claim 1, characterized in that, The recombinant Trichoderma reesei also had the gene encoding the protein with Protein ID 79644 knocked out.

3. The recombinant Trichoderma reesei according to claim 2, characterized in that, The gene sequence encoding the protein with Protein ID 79644 is shown in SEQ ID NO.

1.

4. The recombinant Trichoderma reesei according to claim 1, characterized in that, The gene sequence encoding the protein with Protein ID 43671 is shown in SEQ ID NO.2, the gene sequence encoding the protein with Protein ID 53561 is shown in SEQ ID NO.3, the gene sequence encoding the protein with Protein ID 102785 is shown in SEQ ID NO.4, the gene sequence encoding the protein with Protein ID 111888 is shown in SEQ ID NO.5, and the gene sequence encoding the protein with Protein ID 111955 is shown in SEQ ID NO.

6.

5. The recombinant Trichoderma reesei according to claim 1, characterized in that, The proteins with protein IDs of 53561, 43671, 102785, 111888, and 111955 were expressed via the Padh promoter.

6. The recombinant Trichoderma reesei according to claim 5, characterized in that, The nucleotide sequence of the promoter is shown in SEQ ID NO.

7.

7. A microbial preparation comprising the recombinant Trichoderma reesei as described in any one of claims 1-6.

8. The use of the recombinant Trichoderma reesei according to any one of claims 1-6 or the microbial preparation according to claim 7 in the production of lactoferrin.

9. A method for producing lactoferrin, characterized in that, The method involves inoculating the recombinant Trichoderma reesei according to any one of claims 1-6 or the microbial preparation according to claim 7 into a culture medium for fermentation.

10. The method according to claim 9, characterized in that, The fermentation culture temperature is 25-35℃.

Citation Information

Patent Citations

  • Trichoderma reesei strain capable of stably expressing human lactoferrin and application of trichoderma reesei strain

    CN117487675A

  • Recombinant trichoderma reesei for producing lactoferrin and application of recombinant trichoderma reesei

    CN119709441A

  • Human lactoferrin indirect competitive enzyme-linked immunosorbent assay kit and application thereof

    CN119985996A

  • Construction method for improving gene editing efficiency of Trichoderma reesei engineering strain

    CN120399900A

  • Method for screening high-yield recombinant human lactoferrin through nucleic acid aptamer-assisted mutagenesis of trichoderma reesei strain and application

    CN121783929A