Duplex fluorescent PCR detection primer probe group for duck salmonella enteritidis and salmonella typhimurium, kit, and use thereof

Abstract

A duplex fluorescent PCR detection primer probe group of duck Salmonella enteritidis and Salmonella typhimurium, a kit, and the use thereof. Comparative analysis on the whole genomes of Salmonella ent

Description

[0001] The present disclosure specifically relates to a duplex real-time PCR primer probe set and a kit for detecting Salmonella enteritidis and Salmonella typhimurium, and use thereof, belonging to the technical field of animal quarantine. BACKGROUND

[0002] Duck salmonellosis is a general term for a class of diseases caused by Salmonella enteritidis, Salmonella typhimurium, and Salmonella anatum. Ducks of all ages can be infected with such a disease, which mainly occurs in ducklings and can cause large-scale mortality. Shandong Province is a major duck-raising province. With the continuous improvement of intensification of large-scale duck farms and the increasing breeding density, the Salmonella infection in duck flocks has continued to increase. Once breaking out in a flock of ducks, this disease can spread rapidly, causing great harm to the duck fanning industry. Therefore, duck-derived Salmonella contamination should be of great concern.

[0003] Salmonella enteritidis (S. enteritidis) and Salmonella typhimurium (S. typhimurium) are the serotypes with the highest isolation rates in duck farms. Different serotypes of Salmonella have varying pathogenicity, host ranges, and target organisms. The identification of Salmonella serotypes by laboratories and diagnostic institutions is crucial for effective disease treatment. Multiplex polymerase chain reaction (PCR), in addition to its advantages of speed and sensitivity, also has the benefit of high throughput. The basic principle of this method is to incorporate multiple pairs of amplification primers into the same reaction system, allowing for the simultaneous amplification of several specific genes. This detection method is advantageous as it can save time and reduce costs. However, there are challenges in the multiplex PCR detection process. The amplification conditions of multiple targets may not be compatible, and the optimal PCR conditions for each pair of primers can vary. As a result, the amplification effect and the actual number of amplified fragments during practical operations may not meet expectations, leading to issues such as false positives and false negatives, especially when the concentration of the pathogenic bacteria in the sample is low. These problems may ultimately affect the detection results. SUMMARY

[0004] In view of this, the present disclosure provides a duplex real-time PCR primer probe set capable of simultaneously detecting S. enteritidis and S. typhimurium. The multiplex real-time PCR system established in the present disclosure not only inherits the advantages of multiplex PCR, but also further improves the sensitivity of detection. The system can help avoid false positives caused by the presence of impurities in the samples, as well as false negatives that may occur when the concentration of pathogenic bacteria in the sample is low, thereby further' ensuring the accuracy of the detection results.

[0005] The present disclosure further provides a kit containing the primer probe set, providing a simple method for quickly identifying S. enteritidis and S. typhimurium. The kit is characterized by its advantages of strong specificity and high sensitivity.

[0006] Another objective of the present disclosure is to provide use of the primer probe set or the kit.

[0007] To achieve the above objective, the present disclosure provides the following technical solutions:

[0008] The present disclosure provides a primer probe set for detecting S. enteritidis and S. typhimurium by duplex real-time PCR, where a primer pair for detecting the 5. enteritidis includes the nucleotide sequences of an upstream primer of 5'-CTTTTGTGCAGCGAGCAT-3' (SEQ ID NO: 1), and a downstream primer of 5'-ACAACAGGCTGATTTACTAAACC-3' (SEQ ID NO: 2), and a probe for detecting the S. enteritidis has the nucleotide sequence of 5'-ACCTCTAAGCCGGTCAATGAGTT-3' (SEQ ID NO: 3); and a primer pair for detecting the S. typhimurium includes the nucleotide sequences of an upstream primer of 5'-ACCTGAAGTATCTGTTGCG-3' (SEQ ID NO: 4), and a downstream primer of 5'-CAAATAACCCACGTTCAGT-3' (SEQ ID NO: 5), and a probe for detecting the S. typhimurium has the nucleotide sequence of 5’-CTTTCAGATCATCGTCGACATGC-3’ (SEQ ID NO: 6).

[0009] In the present disclosure, whole genome sequences of the S. enteritidis and the S. typhimurium are compared and analyzed, such that a specific fragment Sdf I of an lyg D gene of the S. enteritidis and a specific gene STM4497 of the S. typhimurium serve as identification targets. The specific sequence of the coding region in the specific gene lyg D of the 5. enteritidis is used as a target region, and the primers and probes of the S. enteritidis are designed based on multiple sequence alignment; the specific sequence of the coding region of the specific gene STM4497 of the S. typhimurium is used as a target region, and the primers and probes of the S. typhimurium are designed based on multiple sequence alignment. The primers have a length of about 20 bases, and a GC content of 50% to 60%. There is no secondary structure and repetitiveness in the primers, and there is also no complementary sequences between the primers. The melting temperature (Tm value) between the primers has a difference of not more than 2°C. The probe has a length of about 25 bases, and a Tm value of about 5°C higher than that of the primers.

[0010] Preferably, the probe is a probe modified with a fluorescent label and a quenching group. More preferably, the probe for S. enteritidis is modified with a FAM fluorescent label and a BHQ1 quencher, the 5' end of the S. enteritidis probe sequence is labeled with a reporter fluorophore FAM (namely 6-carboxy-fluorescein), and the 3' end is labeled with a quencher fluorophore BHQ1. and the probe for S. enteritidis is 5’ FAM-ACCTCTAAGCCGGTCAATGAGTT-BHQ1 3’. The probe for S. typhimurium is modified with a HEX real-time label and a BHQ1 quencher, the 5' end of the S. typhimurium probe sequence is labeled with a reporter fluorophore HEX (namely 5-hexachloro-fluorescein), and the 3' end is labeled with a quencher fluorophore BHQ1, and the probe for 5. typhimurium is 5’ HEX-CTTTCAGATCATCGTCGACATGC-BHQ1 3’.

[0011] The present disclosure provides use of the primer probe set in preparation of a product for detecting S. enteritidis and / or S. typhimurium.

[0012] In the present disclosure, the product is preferably selected from the group consisting of a reagent and a kit.

[0013] The present disclosure provides a kit for detecting 5. enteritidis and / or S. typhimurium, including the primer probe set.

[0014] In the present disclosure, the kit preferably further includes a real-time PCR master mix, a Taq DNA polymerase, and a positive control or a negative control. In the present disclosure, the real-time PCR master mix preferably includes: 1.5 volumes of an upstream primer for the S. enteritidis with a concentration of 10 pmol / L, 1.5 volumes of a downstream primer for the S. enteritidis with a concentration of 10 pmol / L, and 0.5 volumes of a probe for the S. enteritidis with a concentration of 10 pmol / L; 1 volume of an upstream primer for the 5. typhimurium with a concentration of 10 pmol / L, 1 volume of a downstream primer for the 5. typhimurium with a concentration of 10 pmol / L. and 0.3 volumes of a probe for the 5. typhimurium with a concentration of 10 pmol / L; and 10 volumes of a 2x buffer, 2 volumes of MgCh with a concentration of 25 mmol / L, 2 volumes of dNTP with a concentration of 2.5 mmol / L. and 0.2 volumes of diethyl pyrocarbonate (DEPC)-treated water. There is no particular limitation on specific sources of the above reagents. In the kit, the Taq DNA polymerase has a concentration of preferably 5 U / pL, and the negative control is preferably autoclaved diethyl pyrocarbonate (DEPC)-treated water. The positive control is preferably a DNA fragment of an identification target for the S. enteritidis and the S. typhimurium. More preferably, the identification target of the S. enteritidis as the positive control is a specific fragment Sdf I of an lyg D gene, and the identification target of the S. typhimurium as the positive control is a specific gene STM4497.

[0015] In the present disclosure, a real-time PCR buffer used includes but is not limited to dNTP and MgCF. The negative control used in the present disclosure is DEPC-treated water prepared by: distilling tap water twice, purifying by a Millipore MILLI-Q PF PLUS water purifier, and collecting water with a resistivity >18.0 MQ cm to obtain Millipore-Q purified water; adding DEPC to the Millipore-Q purified water to a final concentration of 0.1%, stirring at 37°C for 12 h, conducting autoclaving for 15 min using a 151bf / in2 (1.034x105 Pa). Preparation of positive control: the specific fragment Sdf I in the lyg D gene of the S. enteritidis and the specific gene STM4497 of the S. typhimurium are cloned by conventional methods to construct a recombinant plasmid to allow sequence determination. After the sequencing results were correct, the recombinant plasmid was transformed into Escherichia coli ToplO competent cells, expand-cultured, and a plasmid was extracted, and then a DNA fragment was then purified after enzyme digestion as the positive control.

[0016] The present disclosure provides a method for detecting S. enteritidis and / or 5. typhimurium, including: subjecting a sample to be tested to duplex real-time PCR using the primer probe set or the kit, and then determining an obtained detection result.

[0017] Preferably, the duplex real-time PCR specifically includes: a first stage of initial denaturation at 50°C for 2 min; a second stage at 95°C for 3 min; athird stage of 40 cycles at 95°C for 15 s, extension at 60'C for 30 s; and then fluorescence collection during the extension at 60°C in each cycle of the third stage.

[0018] In the present disclosure, the detection result is read after- the real-time PCR. For a multichannel PCR instrument, the result is read using the FAM (465-510) channel and the HEX (VIC) (533-580); for an ABI instrument, the FAM and HEX channels are selected, and the result is read without a fluorescent quencher. Preferably, the detection result is determined to be:

[0019] negative when there is no Ct value or characteristic amplification curve in both FAM and HEX / VIC detection channels, indicating that there are 5. enteritidis or the S. typhimurium in the sample; or

[0020] positive when only the FAM detection channel shows a characteristic amplification curve and a Ct value less than or equal to 36, while the HEX / VIC detection channel shows no Ct value or characteristic amplification curve, indicating that there is no S. enteritidis in the sample;

[0021] when only the HEX / VIC detection channel shows a characteristic amplification curve and a Ct value less than or equal to 36, while the FAM detection channel shows no Ct value or characteristic amplification curve, it is determined that there is S. typhimurium in the sample; and

[0022] when both the FAM and HEX / VIC detection channels show a characteristic amplification curve and a Ct value less than or equal to 36, it is determined that both S. enteritidis and S. typhimurium are present in the sample.

[0023] In the detection method provided by the present disclosure, when the negative control reads data by the two detection channels, there should be no Ct value and no amplification curve; when the positive control reads data by the two detection channels, corresponding characteristic amplification curves should appear respectively, and the Ct values should be each <32; if the negative or positive control does not meet the above conditions, the experiment is deemed invalid. Samples with a Ct value >36 in any channel and a typical amplification curve are recommended to be retested. If the above result still appeared in the retest, it is determined as positive, otherwise determined as negative.

[0024] In the present disclosure, experiments have shown that the kit and the method can confirm whether S. enteritidis and S. typhimurium exist in the sample to be tested in one step.

[0025] In the present disclosure, the specific fragment Sdf I in the lyg D gene of S. enteritidis and the specific gene STM4497 of S. typhimurium are selected as target sequences, and primers and probes are designed. Meanwhile, a duplex real-time PCR kit for detecting the S. enteritidis and S. typhimurium is established and optimized, and exhibits the following excellent technical effects.

[0026] 1) Rapidness: the method monitors the PCR products in real time, enabling results to be obtain upon the completion of the PCR process. Compared with the traditional single real-time reverse-transcribed PCR (RT-PCR) detection, the method saves time, offering the advantage of rapid identification in one step.

[0027] 2) Sensitivity: due to specific fluorescent probes and high-sensitivity real-time PCR instruments, the method is 100-1,000 times more sensitive than traditional PCR methods; the method can detect plasmid RNA with a known copy number. The results show that the kit has a sensitivity of up to 10 copies / reaction.

[0028] 3) Specificity: due to the use of both specific primers and specific probes, the method exhibits a higher specificity than that of ordinary PCR methods; meanwhile, there is no crossreactivity with other pathogens such as Escherichia coli, Staphylococcus, Shigella, Listeria monocytogenes, and Vibrio parahaemolyticus, indicating a desirable specificity.

[0029] 4) Stability: the results of a repeatability test show that the established method has a desirable stability; the repeatability test on different concentrations of plasmid DNA with a known copy number shows a coefficient of variation of less than 5%.

[0030] 5) Low pollution: the reaction is fully-closed without post-PCR processing, ensuring safe handling.

[0031] 6) Enhancement of detection The successful establishment of a duplex real-time PCR-based method for detecting S. enteritidis and S. typhimurium can help enhance the detection of S. in duck farming. The method is useful for controlling the disease at the source and formulating effective control measures; moreover, the method effectively promotes the purification of salmonellosis, promotes the healthy and sustainable development of regional industries, and helps rural revitalization, thereby playing a desirable role of technical guidance. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIG.1 is a graph showing the result of a test for the sensitivity of the kit for duplex realtime PCR detection of S. enteritidis / S. typhimurium according to an example of the present disclosure on S. typhimurium',

[0033] FIG. 2 is a graph showing the result of a test for the sensitivity of the kit for duplex realtime PCR detection of S. enteritidis / S. typhimurium according to an example of the present disclosure on S. enteritidis',

[0034] FIG. 3 is a graph showing the result of a test for the specificity of the kit for duplex realtime PCR detection of S. enteritidis / S. typhimurium according to an example of the present disclosure on S. typhimurium; and

[0035] FIG. 4 is a graph showing the result of a test for the specificity of the kit for duplex realtime PCR detection of S. enteritidis / S. typhimurium according to an example of the present disclosure on S. enteritidis. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0036] The embodiments for the present disclosure will be described in detail below with reference to the examples, but they should not be construed as limiting the claimed scope of the present disclosure.

[0037] In the following examples, all methods are conventional methods, unless otherwise specified.

[0038] The materials, reagents, and the like used in the following examples are all commercially available, unless otherwise specified.

[0039] Example 1

[0040] Design of primers and probes

[0041] 1. Design principles of primers and probes

[0042] To ensure the conservation and specificity of primers and probes, specific sequences of the coding regions of specific genes (fragments) of 5. enteritidis and S. typhimurium were selected as target regions.

[0043] Most of the primers in the art are directly generated by software, and then an optimal primer sequence is selected. The primer sequences involved in the example are obtained by manual design on the basis of software design; the primer and probe sequences involved in the example can guarantee no missed detection, and allows for rapid identification and detection of 5. enteritidis and S. typhimurium.

[0044] 2. Design of primers and probes

[0045] The whole genome sequences of S. typhimurium, S. enteritidis, S. pullorum, and S. typhi were downloaded from NCBI for comparison, and the specific gene STM4497 of S. typhimurium and the specific sequence Sdf I of the lyg D gene coding region of S. enteritidis were identified. 26 specific sequences of the coding region of the STM4497 gene of S. typhimurium and 26 specific sequences of the coding region of the lyg D gene of the 5. enteritidis were also downloaded from NCBI. The primer probes for S. enteritidis and .S', typhimurium were designed using the primer design software Prime 5.0, respectively. After preliminary screen, manual design was conducted, and specific primers and probes were designed on the basis of multiple sequence alignment. Part of reference strains of 5. typhimurium used for primer and probe design and part of reference strains of 5. enteritidis used for primer and probe design are specifically shown in Tables 1 and 2.

[0046] Table 1 Part of 5. typhimurium reference strains used for primer and probe design

[0047] Gene accession number Strain name Gene accession number Strain name LR792438 ■S. enterica subsp. enterica serovar Typhimurium isolate SV68791 CP034719 S. enterica subsp. enterica serovar Typhimurium strain RSE04 CP050753 S. enterica subsp. enterica serovar Typhimurium strain ST45 CP028318 S’. enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 CP050731 5. enterica subsp. enterica serovar Typhimurium strain ST10 CP029567 S. enterica subsp. enterica serovar Typhimurium strain DA34821 CP050745 ■S. enterica subsp. enterica serovar Typhimurium strain ST53 CP022070 S. enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 CP041976 S. enterica subsp. enterica serovar Typhimurium strain NCCP 16207 CP025555 S. enterica subsp. enterica serovar Typhimurium strain PIR00538 CP045949 S', enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 CP027414 S. enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 CP044967 ■S’. enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 CP022062 S. enterica subsp. enterica serovar Typhimurium var. 5- strain FDAARGOS_312 CP040900 S. enterica subsp. enterica serovar Typhimurium strain SAP18-6199 CP024619 S. enterica subsp. enterica serovar Typhimurium strain BL10 CP034479 ■S’, enterica subsp. enterica serovar Typhimurium strain 14028 LT795114 S', enterica subsp. enterica serovar Typhimurium isolate VNB151-SC-2315230 CP040564 ■S. enterica subsp. enterica serovar Typhimurium strain SAP17-7699 CP022168 S. enterica subsp. enterica serovar Typhimurium strain WW012 APO 19375 S. enterica subsp. enterica serovar 4,[5],12:i:-L-3841 DNA CP014971 5. enterica subsp. enterica serovar Typhimurium str. USDA-ARS- USMARC-1898 CP036168 S. enterica subsp. enterica serovar Typhimurium strain sg_wt7 CP019442 S. enterica subsp. enterica serovar Typhimurium strain 81741 CP034230 S. enterica subsp. enterica serovar Typhimurium strain ATCC 14028 CP017728 S. enterica subsp. enterica serovar Typhimurium str. SARAI 3 CP034968 S. enterica subsp. enterica serovar Typhimurium strain B3589 CP014975 5. enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 0048] Table 2 Part of 5. enteritidis reference strains used for primer and probe design

[0049] Gene accession number Strain name Gene accession number Strain name CP030196 S. enterica strain SA20051401 chromosome CP007340 S. enterica subsp. enterica serovar Enteritidis str. EC20120686 CP019415 S', enterica subsp. enterica serovar Moscow str. S-1843 CP007335 S. enterica subsp. enterica serovar Enteritidis str. EC20120580 CP007469 S. enterica subsp. enterica serovar Enteritidis str. SA20094301 CP007319 S. enterica subsp. enterica serovar Enteritidis str. SA20095440 CP007422 S. enterica subsp. enterica serovar Enteritidis str. EC20090531 CP007312 S. enterica subsp. enterica serovar Enteritidis str. SA2009435 CP007358 S. enterica subsp. enterica serovar Enteritidis str. EC20100130 CP007305 5. enterica subsp. enterica serovar Enteritidis str. SA20093543 CP007379 S. enterica subsp. enterica serovar Enteritidis str. EC20120969 CP007356 S’, enterica subsp. enterica serovar Enteritidis str. EC20100089 CP007376 S. enterica subsp. enterica serovar Enteritidis str. EC20120927 CP007298 S. enterica subsp. enterica serovar Enteritidis str. EC20090530 CP007309 S. enterica subsp. enterica serovar Enteritidis str. SA20093977 CP007286 S. enterica subsp. enterica serovar Enteritidis str. SA19981522 CP007334 5. enterica subsp. enterica serovar Enteritidis str. SA20092320 CP007291 S. enterica subsp. enterica serovar Enteritidis str. SAI 9992322 CP007364 S', enterica subsp. enterica serovar Enteritidis str. EC20120555 CP007277 S. enterica subsp. enterica serovar Enteritidis str. SAI 9930684 CP007374 S. enterica subsp. enterica serovar Enteritidis str. EC2012174 CP007292 S. enterica subsp. enterica serovar Enteritidis str. SA19994216 CP007405 S. enterica subsp. enterica serovar Enteritidis str. EC20120775 CP007280 S. enterica subsp. enterica serovar Enteritidis str. SAI 9960848 CP007352 S. enterica subsp. enterica serovar Enteritidis str. EC20120498 CP007300 5. enterica subsp. enterica serovar Enteritidis str. SA2009087 0050] 3. Design features of primers and probes

[0051] The pilmers had a length of about 20 bases, and a GC content of 50% to 60%. There was no secondary structure and repetitiveness in the primers, and there were no complementary sequences either within or between the primers. The melting temperature (Tm value) between the primers had a difference of less than 2°C. The probe had a length of about 25 bases, and had a Tm value of about 5°C higher than that of the primers. The names and sequence sources of other primers and probes used for screening and comparison are shown in Table 3.

[0052] Table 3 Names and sequences of primers and probes used for screening and comparison

[0053] Primer name Primer nucleotide sequence (5'-3') Source ijE'-r. 5’ - CTTTTGTGCAGCGAGCAT - 3’ (SEQ ID NO: 1) Present disclosure SE-R: 5’- ACAACAGGCTGATTTACTAAACC - 3’ (SEQ ID NO: 2) SE-P: 5’ FAM - ACCTCTAAGCCGGTCAATGAGTT - BHQ1 3’ (SEQ ID NO: 3) ST-F: 5’ - ACCTGAAGTATCTGTTGCG - 3’ (SEQ ID NO: 4) ST-R: 5’ - CAAATAACCCACGTTCAGT - 3’ (SEQ ID NO: 5) ST-P: 5’ - HEX- CTTTCAGATCATCGTCGACATGC - BHQ1 3’ (SEQ ID NO: 6) SEl-F: 5’ - TTGATGTGGTTGGTTCGTCACT - 3’ (SEQ ID NO: 7) Software design SE1-R: 5’ - CGAATGGTGAGCAGACAACAGG - 3’ (SEQ ID NO: 8) SE1-P: 5’ FAM - CAGCGAGCATGTTCTGGAAAGCCT - BHQ1 3’ (SEQ ID NO: 9) ST1-F: 5’ - AAAGGACCACAAGTTCGC - 3’ (SEQ ID NO: 10) ST1-R: 5’ - CAAATAACCCACGTTCAGT - 3’ (SEQ ID NO: 11) ST1-P: 5’ HEX - CTTTCAGATCATCGTCGACATGC - BHQ1 3’ (SEQ ID NO: 12)

[0054] The primers in the artificially designed primer probe set for detecting 5. enteritidis and S. typhimurium had similar Tm values, allowing for consistent reaction parameters and comparable sensitivity when the two bacteria were detected at the same time. No base mismatch was found according to the BLAST analysis. In contrast, the primers designed solely by software for the dual detection of S. enteritidis and X typhimurium exhibited inconsistent optimal reaction parameters. BLAST analysis revealed the presence of base mismatches, and the Tm value of the probe was close to that of the primer, preventing the attainment of ideal effects. Therefore, the nucleotide sequence of the primer probe was finally determined as shown in Table 4:

[0055] Table 4 Nucleotide sequences of primer probes

[0056] S. enteritidis upstream primer SE-F (SEQ ID NO: 1): 5’ - CTTTTGTGCAGCGAGCAT -3’ & enteritidis downstream primer SE-R (SEQ ID NO: 2): 5’- ACAACAGGCTGATTTACTAAACC -3’ S. enteritidis probe SE-P (SEQ ID NO: 3): 5’ FAM-ACCTCTAAGCCGGTCAATGAGTT -BHQ1 3’ S. typhimurium upstream primer ST-F (SEQ ID NO: 4): 5'- ACCTGAAGTATCTGTTGCG -3’ S. typhimurium downstream primer ST-R (SEQ ID NO: 5): 5’- CAAATAACCCACGTTCAGT -3’ 5. typhimurium probe ST-P (SEQ ID NO: 6): 5’ HEX- CTTTCAGATCATCGTCGACATGC -BHQ1 3’

[0057] Example!

[0058] Establishment of a duplex real-time PCR reaction system for S. enteritidis and S. typhimurium

[0059] On the basis of multiple sequence alignment, a primer probe set that could quickly identify and detect S. enteritidis and S. typhimurium simultaneously was designed. A real-time PCR detection method was preliminarily established, and optimized using a Taguchi method to find out the optimal concentration range of primers, probes and Mg2+. Corresponding adjustments were made according to the optimal concentration range, resulting in specific concentrations of the primers, the probes and the Mg2+. Therefore, optimal conditions for the detection method were determined. The reaction system has a total volume of 25 pL. including three parts: a real-time PCR master mix, an enzyme mixture and a template. The real-time PCR master mix included: 1.5 volumes of an upstream primer for the S. enteritidis with a concentration of 10 pmol / L, 1.5 volumes of a downstream primer for the S. enteritidis with a concentration of 10 pmol / L, and 0.5 volumes of a probe for the 5. enteritidis with a concentration of 10 pmol / L; 1 volume of an upstream primer for the S. typhimurium with a concentration of 10 umol / L. 1 volume of a downstream pilmer for the S. typhimurium with a concentration of 10 pmol / L, and 0.3 volumes of a probe for the S. typhimurium with a concentration of 10 pmol / L; and 10 volumes of a 2* buffer, 2 volumes of MgCh with a concentration of 25 mmol / L, 2 volumes of dNTP with a concentration of 2.5 mmol / L, and 0.2 volumes of diethyl pyrocarbonate (DEPC)-treated water.

[0060] The final amplification conditions specifically included: a first stage of initial denaturation at 50°C for 2min; a second stage at 95°C for 3min; a third stage of 40 cycles at 95°C for 15 s, and extension at 60°C for 30 s; and then fluorescence collection at the extension at 60°C in each cycle of the third stage.

[0061] After the real-time RT-PCR reaction was completed: the dual detection channels had no Ct value and no characteristic amplification curve, indicating that there was no 5. enteritidis and 5. typhimurium in the sample; the Ct values of the dual detection channels were each <32.0, and a typical amplification curve appeared, indicating that there were S. enteritidis and S. typhimurium in the sample; when only the FAM detection channel showed a characteristic amplification curve and a Ct value <36, while the HEX / VIC detection channel showed no Ct value or characteristic amplification curve, the sample contained the S. enteritidis', when only the HEX / VIC detection channel showed a characteristic amplification curve and a Ct value <36, while the FAM detection channel showed no Ct value or characteristic amplification curve, the sample to be tested contained the S. typhimurium; and when both the FAM and HEX / VIC detection channels showed a characteristic amplification curve and a Ct value <36, both the S. enteritidis and the S. typhimurium were present in the the sample.

[0062] In the detection method provided by the present disclosure, when the data were read from the two detection channels for the negative control, there was no Ct value and no amplification curve; when the data were read from the two detection channels for the positive control, corresponding characteristic amplification curves appeared respectively, and the Ct values were each <32; when the negative or positive control did not meet the above conditions, the experiment was deemed invalid. Samples with a Ct value >36 in any channel and a typical amplification curve were recommended to be retested. When the above result still appeared in the retest, it was determined as positive, otherwise determined as negative.

[0063] Examples

[0064] Table 5 showed the assembly of a duplex real-time PCR kit for S', enteritidis and S. typhimurium.

[0065] Table 5 Composition list of kit

[0066] Component Specification real-time PCR master mix 1000 pL / tubexl tube Taq enzyme 30 pL / tubex 1 tube Negative control 1000 pL / tubexl tube Positive control 1000 pL / tubexl tube Description for kit 1 part

[0067] Example 4

[0068] Test on sensitivity of duplex real-time PCR kit for S. enteritidis and S. typhimurium

[0069] Nucleic acids were extracted from positive quality control materials of S. enteritidis and S. typhimurium (a copy number was 0.2xl05 copies / pL) using DEPC-treated water, and dilutions of 1:10, 1:100, 1:1,000, 1:10,000 and 1:100,000 were made as sensitivity quality control samples. According to the method of Example 2, the sensitivity quality control samples of S. enteritidis and S. typhimurium (the copy numbers were 104, 103, 102, 101, and 10° copies / reaction, respectively) were tested. The results are as follows: quality control products of the 1:10, 1:100 and 1:1,000 dilutions were all positive, quality control product of the 1:10,000 dilution was positive, and quality control product of the 1:100,000 was negative. This indicated that the kit had a detection limit up to 1:10,000, namely 101 copies / reaction, as shown in FIG. 1 and FIG. 2.

[0070] Examples

[0071] Test on specificity of duplex real-time PCR kit for 5. enteritidis and 5. typhimurium

[0072] Escherichia coli, Staphylococcus, Shigella, Listeria monocytogenes, and Vibrio parahaemolyticus were detected to verify the specificity of the kit, and the specific detection method was the same as that in Example 2. The results showed that there was no positive crossreactivity, as shown in FIG. 3 and FIG. 4.

[0073] The above arc merely preferred embodiments of the present disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present disclosure.

Claims

1. A primer probe set for detecting S. enteritidis and 5. typhimurium by duplex real-time polymerase chain reaction (PCR), wherein a primer pair for detecting the S. enteritidis has the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 2, and a probe for detecting the S. enteritidis has the nucleotide sequence of SEQ ID NO: 3; and a primer pair for detecting the S. typhimurium has the nucleotide sequences of SEQ ID NO: 4 to SEQ ID NO: 5, and a probe for detecting the S. typhimurium has the nucleotide sequence of SEQ ID NO: 6.

2. The primer probe set according to claim 1, wherein the probe is a quencher-modified probe with a fluorescent label.

3. The primer probe set according to claim 2, wherein the probe for detecting the S. enteritidis is modified with a 6-carboxy-fluorescein (FAM) fluorescent label and a Black Hole Quencher® 1 (BHQ1) quencher.

4. The primer probe set according to claim 2, wherein the probe for detecting the S. typhimurium is modified with a 5-hexachloro-fluorescein (HEX) fluorescent label and a BHQ1 quencher.

5. Use of the primer probe set according to any one of claims 1 to 4 in preparation of a product for detecting S. enteritidis and / or S. typhimurium.

6. The use according to claim 5, wherein the product is selected from the group consisting of a reagent and a kit.

7. A kit for detecting S. enteritidis and / or S. typhimurium, comprising the primer probe set according to any one of claims 1 to 4.

8. The kit according to claim 7, further comprising a real-time PCR master mix, a Taq DNA polymerase, and a positive control or a negative control.

9. The kit according to claim 8, wherein the real-time PCR master mix comprises: 1.5 volumes of an upstream primer for the S. enteritidis with a concentration of 10 nmol / L. 1.5 volumes of a downstream primer for the 5. enteritidis with a concentration of 10 pmol / L, and 0.5 volumes of aprobe for the S. enteritidis with a concentration of 10 pmol / L; 1 volume of an upstream primer for the S. typhimurium with a concentration of 10 pmol / L, 1 volume of a downstream primer for the S. typhimurium with a concentration of 10 pmol / L, and 0.3 volumes of a probe for the S. typhimurium with a concentration of 10 pmol / L: and 10 volumes of a 2* buffer, 2 volumes of MgCL with a concentration of 25 mmol / L, 2 volumes of dNTP with a concentration of 2.5 mmol / L, and 0.2 volumes of diethyl pyrocarbonate (DEPC)-treated water.

10. The kit according to claim 8, wherein the Taq DNA polymerase has a concentration of 5 U / pL.

11. The kit according to claim 8, wherein the negative control is autoclaved DEPC-treated water.

12. The kit according to claim 8, wherein the positive control is a DNA fragment of an identification target for the S. enteritidis and the S. typhimurium.

13. The kit according to claim 12, wherein the identification target for the S. enteritidis as the positive control is a specific fragment Sdf I of an lyg D gene.

14. The kit according to claim 12, wherein the identification target for the S. typhimurium as the positive control is a specific gene STM4497.

15. A method for detecting 5. enteritidis and / or S. typhimurium, comprising: subjecting a sample to be tested to duplex real-time PCR using the primer probe set according to any one of claims 1 to 4 or the kit according to any one of claims 7 to 14, and then determining an obtained detection result.

16. The method according to claim 15, wherein the duplex real-time PCR specifically comprises: a first stage of initial denaturation at 50°C / 2 min; a second stage at 95°C / 3 min; a third stage of 40 cycles at 95°C for 15 s and extension at 60°C for 30 s; and then fluorescence collection during the extension at 60°C in each cycle of the third stage.

17. The method according to claim 15, wherein the obtained detection result is:negative when there is no Ct value or characteristic amplification curve in both FAM and HEX / VIC detection channels, indicating the absence of the S. enteritidis or the 5. typhimurium inthe sample to be tested; orpositive when only the FAM detection channel shows a characteristic amplification curve and a Ct value less than or equal to 36, while the HEX / VIC detection channel shows no Ct value or characteristic amplification curve, indicating the presence of S. Enteritidis in the sample to be tested;if only the HEX / VIC detection channel shows a characteristic amplification curve and a Ct value less than or equal to 36, while the FAM detection channel shows no Ct value or characteristic amplification curve, it is determined that the sample to be tested contains no S. typhimurium'. andif both the FAM and HEX / VIC detection channels show a characteristic amplification curve and a Ct value less than or equal to 36, it is determined that the sample to be tested contains both the 5. enteritidis and the S. typhimurium.

Images