Anti-TL1a antigen binding proteins and uses thereof

HK40134589APending Publication Date: 2026-07-10AMGEN INC

Patent Information

Authority / Receiving Office
HK · HK
Patent Type
Applications
Current Assignee / Owner
AMGEN INC
Filing Date
2026-04-24
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Current treatments have limited effectiveness against inflammatory bowel disease and other autoimmune and inflammatory diseases, and approximately 40% of patients lose response after one year, necessitating more effective multi-pathway targeted therapies.

Method used

Bispecific antibodies that specifically bind to TL1A and TNF-α have been developed, including antibodies in heterologous immunoglobulin, IgG-scFv and IgG-Fab formats, which reduce the release of inflammatory factors by blocking the signal transduction pathways of TL1A and TNF-α.

Benefits of technology

These antibodies can effectively inhibit TL1A and TNF-α-mediated NF-κB activation and T cell activation, providing a durable therapeutic effect and showing significant efficacy against inflammatory bowel disease and other autoimmune diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000140_0000
    Figure 00000140_0000
  • Figure 00000141_0000
    Figure 00000141_0000
  • Figure 00000142_0000
    Figure 00000142_0000
Patent Text Reader

Abstract

The present invention concerns antigen binding proteins that bind TL1A, including bispecific antigen binding proteins (e.g., antibodies) to TL1A and TNF-α. Such bispecific antibodies can be in a tetrameric immunoglobulin format, in which one heavy chain-light chain pair of the antibody is directed to TL1A and the other to TNF-α. The bispecific antigen binding proteins may also be comprised in an IgG-scFv fusion, in which a conventional tetrameric antibody directed to one antigen is fused to a pair of single chain Fv units directed to the other. The bispecific antigen binding protein may also be comprised in an IgG-Fab fusion, in which a Fab molecule that binds to one antigen is fused to each heavy chain of a conventional tetrameric antibody directed to the other antigen. The invention further relates to uses of the anti-TL1A binding proteins and anti-TL1A / anti-TNF-α antigen binding proteins, and pharmaceutical formulations thereof.
Need to check novelty before this filing date? Find Prior Art

Description

(19) *EP004640705A2* (11) EP 4 640 705 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: 29.10.2025 Bulletin 2025 / 44 (21) Application number: 25197682.5 (22) Date of filing: 14.12.2016 (51) International Patent Classification (IPC): C07K 16 / 24 (2006.01) (52) Cooperative Patent Classification (CPC): A61P 1 / 04; A61P 19 / 02; A61P 37 / 00; C07K 16 / 241; C07K 16 / 2875; C07K 2317 / 21; C07K 2317 / 31; C07K 2317 / 55; C07K 2317 / 622; C07K 2317 / 66; C07K 2317 / 76; C07K 2317 / 90; C07K 2319 / 00 (84) Designated Contracting States: AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR Designated Extension States: BA ME Designated Validation States: MA MD (30) Priority: 16.12.2015 US 201562268432 P 06.05.2016 US 201662333063 P 15.09.2016 PCT / US2016 / 052006 (62) Document number(s) of the earlier application(s) in accordance with Art. 76 EPC: 16822583.7 / 3 390 444 (71) Applicant: Amgen Inc. Thousand Oaks, California 91320‑1799 (US) (72) Inventors: • HSU, Hailing Moorpark, California, 93021 (US) • KANNAN, Gunasekaran Daly City, California, 94015 (US) • WALKER, Kenneth W. Newbury Park, California, 91320 (US) • HORTTER, Michelle Camarillo, California, 93012 (US) • BELOUSKI, Edward J. Thousand Oaks, California, 91360 (US) (74) Representative: Grünecker Patent‑ und Rechtsanwälte PartG mbB Leopoldstraße 4 80802 München (DE) Remarks: •The complete document including Reference Table(s) and the Sequence Listing(s) can be downloaded from the EPO website •This application was filed on 22‑08‑2025 as a divisional application to the application mentioned under INID code 62. (54) ANTI‑TL1A ANTIGEN BINDING PROTEINS AND USES THEREOF (57) The present invention concerns antigen binding proteins that bind TL1A, including bispecific antigen binding proteins (e.g., antibodies) to TL1A and TNF-α. Such bispecific antibodies can be in a tetrameric immu- noglobulin format, in which one heavy chain-light chain pair of the antibody is directed to TL1A and the other to TNF-α. The bispecific antigen binding proteins may also be comprised in an IgG-scFv fusion, in which a conven- tional tetrameric antibody directed to oneantigen is fused to a pair of single chain Fv units directed to the other. The bispecific antigen binding proteinmay also be comprised in an IgG-Fab fusion, in which a Fab molecule that binds to one antigen is fused to each heavy chain of a conven- tional tetrameric antibody directed to the other antigen. The invention further relates to uses of the anti-TL1A binding proteins and anti-TL1A / anti-TNF-α antigen bind- ing proteins, and pharmaceutical formulations thereof. EP 4 64 0 70 5 A 2 Processed by Luminess, 75001 PARIS (FR) Description CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of Application No. PCT / US2016 / 052006, filed September 15, 2016, and U.S. Provisional Application Nos.: 62 / 268,432, filed December 16, 2015 and 62 / 333,063, filed May 6, 2016. Each of the foregoing applications is hereby incorporated by reference in its entirety. FIELD OF THE INVENTION

[0002] This invention relates to biopharmaceuticals, particularly to therapeutic antigen bindingproteins,methods of use thereof, pharmaceutical compositions thereof, and processes of making them. In particular, this invention relates to therapeutic antigen binding proteins that are capable of binding the cytokines TL1A and TNF-α . BRIEF DESCRIPTION OF THE SEQUENCE LISTING

[0003] Incorporated herein by reference in its entirety is a Sequence Listing entitled, "A‑1937-WO-PCT_ST25.txt", comprising SEQ ID NO:1 through SEQ ID NO:2136, which includes nucleic acid and / or amino acid sequences disclosed herein. TheSequence Listing has been submitted herein in ASCII text format via EFS, and thus constitutes both the paper and computer readable form thereof. TheSequenceListingwas first created usingPatentIn onNovember 22, 2016, and is 3.45 MB in size. BACKGROUND OF THE INVENTION

[0004] Cytokines are soluble, small proteins that mediate a variety of biological effects concerning the immune system. Such biological effects include induction of immune cell proliferation, development, differentiation, and / or migration; regulation of the growth and differentiation of many cell types; an inflammatory response through local or systemic accumulation of immune cells; and host-protective effects. See, for example, Arai et al., Annu. Rev. Biochem. 59:783 (1990); Mosmann, Curr. Opin. Immunol. 3:311 (1991); Paul et al., Cell, 76:241 (1994)). Such immune effects can produce pathological consequences when the effect leads to excessive and / or chronic inflammation, as in autoimmune disorders (such as multiple sclerosis) and cancer / neoplastic diseases. Oppenheim et al., eds., Cytokine Reference, Academic Press,SanDiego,Calif. (2001); vonAndrianetal.,NewEngl. J.Med., 343:1020 (2000);Davidsonetal.,NewEngl. J.Med., 345:340 (2001); Lu et al., Mol. Cancer Res., 4:221 (2006); Dalgleish et al., Cancer Treat Res., 130:1 (2006).

[0005] TLIA (TNFSF15) is a cytokine, a TNF-α familymember involved in Tcell activation (Richard et al., J Leukoc Biol. 2015Sep, 98(3):333‑45). It is the ligand forDeathReceptor 3 (DR3), also knownasTNFRSF25.TL1A ismainly expressed at lowbasal level inmonocytes, dendritic cellsandendothelial cells, but highly inducedafter immunecomplexandcytokine and microbes stimulation. Multiple genome-wide association studies (GWAS) demonstrated TL1A single nucleotide polymorphisms (SNPs) associated with Crohn’s disease in various ethnic populations. In addition, TL1A inflammatory bowel disease (IBD) risk SNPswere reported to be associatedwith Crohn’s disease severity (Hirano, IBD 19: 526, 2013). In the preclinical studies, TL1A protein treatment exacerbated colitis development in the colitis prone mdr1a‑ / ‑mice, but not in the wild-typemice. Altogether, human genomic data and preclinical colitis model data demonstrate that TL1A plays an important role in IBD development, and its blockage will be beneficial for IBD treatment.

[0006] Tumor Necrosis Factor-α (TNF-α) is a cytokine involved in the regulation of various physiological and patho- logical process (Buetler, et al., J Rheumatol Suppl. 57: 16‑21, 1999). It is implicated in tumor regression, septic shock, cachexia, and a number of inflammatory and autoimmune conditions. Fransen et al. (June 1985), "Molecular cloning of mouse tumor necrosis factor cDNA and its eukaryotic expression," Nucleic Acids Res. 13 (12): 4417‑29; Kriegler et al. (April 1988), "A novel form of TNF-α / cachectin is a cell surface cytotoxic transmembrane protein: ramifications for the complex physiology of TNF-α ," Cell 53 (1): 45‑53. TNF-α inhibitors are a class of therapeutics approved to treat rheumatoid arthritis, psoriatic arthritis, juvenile idiopathic arthritis, ankylosing spondylitis, plaque psoriasis, Crohn’s disease, and ulcerative colitis (Sethi et al., Adv Exp Med Biol. 2009;647:37‑51). TNF-α inhibitors include etanercept, adalimumab, certolizumab pegol, infliximab, and goliniuinat).

[0007] Approximately 30% of patients respond to treatment with TNF inhibitors. However, only approximately 40% of those patients maintain responses after one year of treatment. Therefore, there is strong need for therapeutics with large effect sizewith durable response.Wehypothesize that targetingmultiple inflammatory pathways, such as TNFand TL1A, will likely achieve larger effect size with anticipated safety profile. 2 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 SUMMARY OF THE INVENTION

[0008] This invention relates to the development of antigen binding proteins, particularly fully human antibodies that specifically bind TL1A. Preferred antigen binding proteins have strong binding affinity to both human and cynomolgus TL1A, andblockTL1AmediatedNF-kBactivation andTcell activation. Theseantigenbindingproteins havepotential to be used as therapeutics for treatment of inflammatory bowel disease (IBD) and other autoimmune and inflammatory conditions.

[0009] The invention further relates to bispecific antigen binding proteins, particularly bispecific antibodies. Bispecific antigen binding proteins of the invention comprise a TL1A binding entity and a TNF-α binding entity. TL1A blocking proteins and TNF-α blocking proteins have different effects in studies measuring inhibition of induction of cytokines IFNγ, IL‑5, IL‑6, IL‑8, and IL‑10. TL1A but not TNF-α induces Tcell activation in vivo. TL1A and TNF-α induce NF-κB in different cell types in human peripheral blood monocytes (PBMCs). TL1A and TNF-α further induce different cytokines in human PBMCs. TL1A and TNF-α induce some of the same genes but in different cell types (16 overlapping genes induced by TL1A in whole blood and TNF-α in NCM460 cells; 13 overlapping genes induced by TL1A in whole blood and TNF-α in PBMCs). There is a strong genetic association of TL1Awith inflammatory bowel disease (IBD) and anti-TNF agents are clinically validated for treatment of IBD. Such bispecific antigen binding proteins thus are useful for treatment of IBD and other autoimmune and inflammatory conditions. For these and other reasons, there is a benefit to bispecific antigen binding proteins that specifically bind TL1A and TNF-α .

[0010] One format for such bispecific antigen binding proteins is heterodimeric immunoglobulins (hetero Ig). Such hetero Ig antigen binding proteins have one heavy chain-light chain pair directed to TL1A and another directed to TNF-α .

[0011] Another format for such bispecific antigen binding proteins is IgG-scFv molecules. In an IgG-scFv, each heavy chain of an antibody that specifically binds one target is linked to a single chain antibody (scFv) that specifically binds the other target. The scFv portion can be linked to the heavy chain of the IgG portion directly or through a peptide linker. In the IgG-scFv format, the IgG is directed to TL1A and the scFv portion to TNF-α or vice-versa. Bispecific antigen binding proteins in the IgG-scFv format have the advantage of being bivalent for both of their target antigens.

[0012] A further format for such bispecific antigen binding proteins is IgG-Fab molecules. In this format, the antigen binding protein has a structure such that a Fab molecule that binds to one target is fused to each heavy chain of an IgG molecule that binds to another target. One chain of a Fab portion can be linked directly or through a peptide linker to theC- terminus of a heavy chain of the IgGportion. The resultingmolecule has the advantage of being tetravalent and bispecific. All variations of the IgG-Fab format preferably comprise the CDR sequences of Tables 21.2A and 21.2B hereinafter. Preferred heavy and light chain sequences of IgG-Fab molecules appear in Table 21.1 hereinafter.

[0013] Other formats for bispecificantigenbindingproteinsarewithin thescopeof this invention.Onesuch format is IgG- Fab molecules. In this format, each heavy chain of an antibody that specifically binds to one target is linked to a Fab fragment that specifically binds to the other target. In the IgG-Fab format, the IgG is directed to TL1Aand theFabportion to TNF-α or vice-versa. Bispecific antigen binding proteins in the IgG-Fab format have the advantage of being bivalent for both of their target antigens. Other formats for bispecific antigen binding proteins within the scope of this invention are described infra.

[0014] The invention also relates to isolated nucleic acids encoding the TL1A-specific antigen binding proteins of the invention, as well as vectors comprising the nucleic acids, host cells comprising the vectors, and methods of making and using the TL1A-specific antigen binding proteins.

[0015] The invention also relates to isolated nucleic acids encoding the bispecific antigen binding proteins of the invention, as well as vectors comprising the nucleic acids, host cells comprising the vectors, and methods of making and using the bispecific antigen binding proteins.

[0016] In other embodiments, the present invention provides compositions comprising the TL1A-specific antigen binding proteins, the bispecific antigen binding proteins and kits comprising the anti-TL1A or bispecific antigen binding proteins, as well as articles of manufacture comprising the anti-TL1A or bispecific antigen binding proteins.

[0017] The TL1A-specific antigen binding proteins and the bispecific antigen binding proteins described herein can be used in the manufacture of pharmaceutical compositions or medicaments for the treatment of conditions associated with TL1A and / or, in the case of bispecific antigen binding proteins, conditions associated with TNF-α. Thus, the present invention also provides pharmaceutical compositions comprising a TL1A-specific antigen binding protein or a bispecific antigen binding protein and a pharmaceutically acceptable diluent, excipient or carrier.

[0018] The invention further relates to methods of treatment using the TL1A-specific antigen binding proteins. The TL1A-specific antigenbinding proteins of the present invention are useful for the inhibition of the proinflammatory cytokine TL1A. The antibodies can be used to reduce, limit, neutralize, or block the proinflammatory effects of TL1A. Thus, in some embodiments, the invention relates to the treatment of IBD and other autoimmune or inflammatory conditions using the TL1A-specific antigen binding proteins.

[0019] The invention further relates to methods of treatment using bispecific antigen binding proteins. The bispecific 3 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 antigen binding proteins of the present invention are useful for the inhibition of the proinflammatory cytokines, TL1A and TNF-α. The bispecific binding proteins can be used to reduce, limit, neutralize, or block the proinflammatory effects of TL1A. Likewise, the bispecific antigen binding proteins hereof can be used to reduce, limit, neutralize, or block the proinflammatory effects of TNF-α. Thus, in some embodiments, the invention relates to the treatment of IBD and other autoimmune or inflammatory conditions using TL1A-specific / TNF-specific antigen binding proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1showsaschematic representation of four bispecific hetero Ig formats used togenerateanti-TL1A / anti-TNF-α bispecific antigen binding proteins. As shown, a heavy chain directed to one antigen is disulfide-bonded to a heavy chain directed to a different antigen. A light chain for each antigen is disulfide-bonded to the heavy chain for the corresponding antigen. Figure 1 showsa preferred embodiment, inwhich the heavy and light chains comprise charge mutations to aid in correct association of the heavy and light chains. The Kabat-Eu numbering scheme is used to denote the positions of charge pair mutations within each of the chains and for all sequences throughout this specification. This IgG-like bispecific antigen binding protein format is a heterotetramer comprising two different light chains and two different heavy chains. HC1 and LC1 refer to the heavy chain and light chain, respectively, of one Fab binding arm and HC2 and LC2 refers to the heavy chain and light chain, respectively, of the second Fab binding arm. For example, in the schematic, HC1 and LC1 correspond to the anti-TL1A receptor binding arm and HC2 and LC2 correspond to the anti-TNF-α binding arm. However, the two binding arms can be switched such that HC1 and LC1 correspond to the anti-TNF-α binding arm and HC2 and LC2 correspond to the anti-TL1A receptor binding arm. Figure 2 shows a schematic representation of the IgG-scFv format used to generate anti-TL1A / anti-TNF-α bispecific antigen binding proteins. As shown, the structure incorporates a full tetrameric IgG directed to one antigen. A single- chain variable fragment (scFv), which comprises variable domains from a second antibody linked together by a glycine-serine linker, is fused to the carboxyl terminus of the heavy chain of a first antibody through a peptide linker to produce amodified heavy chain. Although theVH-VLorientation of the variable domainswithin the scFv is shown, the variable domainsmay also be organized in a VL-VHorientation. The completemolecule is amultimer comprising two heavy chains (but one unique heavy chain sequence) and two light chains (but one unique light chain sequence) from the first antibody. Figure 3 concerns MabSelect SuRe affinity chromatography of an anti-TL1A / anti-TNF-α, Hetero-Ig. It shows a representative FPLC protein A affinity capture chromatogram of an anti-TL1A / anti-TNF-α hetero-Ig. The protein was eluted with a step gradient of 100mMacetic acid (conductivity: black trace, dashed), pH 3.6 and pooled based on the A280 (black trace, solid). Figure 4 shows a representative FPLC SP high performance sepharose purification chromatogram of an anti- TL1A / anti-TNF-α hetero-Ig. Protein was eluted with an increasing salt gradient (conductivity : black trace, dashed) and was pooled based on the A280 elution profile (black trace, solid) and Caliper LabChip analysis of fractions. Figure 5 shows a representative FPLC SP high performance sepharose purification chromatogram of an anti- TL1A / anti-TNF-α hetero-Ig. Protein was eluted with decreasing ammonium sulfate gradient (conductivity : black trace, dashed) and pooled based on the A280 elution profile (black trace, solid) and Caliper LabChip analysis of fractions. Figure 6 concernsCaliper analysis of a TL1A / TNF-α hetero-Ig. It shows non-reduced and reducedCaliper analysis of an anti-TL1A / anti-TNF-α hetero-Ig. Figure 7 concerns SE-HPLC analysis of an anti-TL1A / anti-TNF-α hetero-Ig. It shows size exclusion chromatography on 30 µg of the final anti-TL1A / anti-TNF-α hetero-Ig product injected onto a Sepax Zenix-C SEC‑300 column (7.8 x 300 mm) in 50 mM NaH2PO4, 250 mM NaCl, pH 6.9 at 1 ml / min, observing the absorbance at 280 nm (black trace). Figure 8 concerns LC-MS of Non-Reduced Hetero-Ig (Theoretical mass: 145495 Da). Figure 8 showsmass analysis of 20 µg non-reduced anti-TL1A / anti-TNF-α hetero-Ig eluted from a reverse-phase HPLC gradient using an Agilent Zorbax 300SB-C8 column (2.1 x 50 mm 3.5 µm) and mobile phases of 0.1% TFA and 90% n-Propanol / 0.1% TFA (mobile phases A and B, respectively), equipped with an Agilent 6230 ESI-TOF Mass Spectrometer. Figure 9 shows mass analysis of 20 µg TL1A / TNF-α hetero-lg after limited Lysyl Endoproteinase C digestion for 30 minutes in 100mMTRIS, pH8.Reverse-phaseHPLCwas conductedusing anAgilent Zorbax300SB-C8column (2.1 x50mm3.5µm)andmobilephasesof0.1%TFAand90%n-propanol / 0.1%TFA(mobilephasesAandBrespectively) and mass detection on an Agilent 6230 ESI-TOF Mass Spectrometer. Theoretical masses for TL1A Fab, TNF Fab, and Fc are 47350 Da, 48002 Da, and 50175 Da, respectively. Figure 10 concerns MabSelect SuRe affinity chromatography of a anti-TL1A / anti-TNF-α IgG-scFv. It shows a representative FPLC protein A affinity capture chromatogram of an anti-TL1A / anti-TNF-α IgG-scFv. The protein was eluted with a step gradient of 100 mM acetic acid, pH 3.6 and pooled based on the A280 (black trace). 4 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 Figure11concernsSPSepharoseHighPerformancechromatographyof ananti-TL1A / anti-TNF-α IgG-scFv. It shows a representative FPLC Superdex 200 purification chromatogram of an anti-TL1A / anti-TNF-α IgG-scFv. Protein was eluted with isocratic gradient of buffer and pooled based on the A280 elution profile (black trace) and SE-HPLC analysis of fractions. Figure 12 shows non-reduced and reduced Caliper analysis of an anti-TL1A / anti-TNF-α IgG-scFv. Figure13concernsSE-HPLCanalysis of ananti-TL1A / anti-TNF-α IgG-scFv. It showssizeexclusionchromatography on 30 µg of the final anti-TL1A / anti-TNF-α IgG-scFv product injected onto a Sepax Zenix-C SEC‑300 column (7.8 x 300 mm) in 50 mM NaH2PO4, 250 mM NaCl, pH 6.9 at 1 ml / min, observing the absorbance at 280 nm. Figure 14 concerns IdeS Protease digested Ig-scFv. It shows mass analysis of 20 µg Ig-scFv using reverse-phase HPLCseparationonanAgilentZorbax300SBcolumn (2.1 x50mm,3.5µm)withmobilephasesof 0.1%TFAand90% n-propanol / 0.1% TFA (mobile phases A and B, respectively), and detection on an Agilent 6230 ESI-TOF Mass Spectrometer. Figure 15 shows genotyping of TL1A SNPs. To evaluate potential TL1A genotype association with expression, genomic DNA (gDNA) was isolated from healthy PBMC donors using Gentra Puregene Tissue kit from Qiagen. Genomic DNA were genotyped using TaqMan SNP genotyping assays for rs7848647, rs6478109, rs6478108, and rs3810936 assays from LifeTech and standard protocols on the Bio-Rad droplet digital PCR platform. Donors were considered homozygous risk haplotype if only risk alleles were present at all 4 genotyped SNPs (rs7848647, rs6478109, rs6478108, and rs3810936). Donors were considered homozygous non-risk haplotype if only non-risk alleles were present at all 4 genotyped SNPs. Donors were considered heterozygous haplotype if both risk and non- risk alleles were present at all 4 genotyped SNPs. Donors that were considered "recombinant" had only homozygous risk alleles at rs7848647, rs6478109, and rs6478108, but were heterozygous (risk and non-risk alleles present) at rs3810936. Figures 16A and 16B show higher fold induction of TL1A risk allele than non-risk allele in a heterozygous PBMC AEI Study. Frequency of risk vs. non-risk allele usage in heterozygous PBMC at basal level or after immune complex stimulation at various time points was examined by droplet digit PCR (ddPCR) using synonymous SNP (rs3810936) allelic specific fluorescent probes. Theallelic expression ratiowas calculatedbydividing thecopies / ml of the riskallele by the copies / ml of the non-risk allele. Total copy number of each allele was normalized by the input amount of cDNA (copies / ng), and the fold-induction for each allele at each time point was calculated by dividing the copies / ng at the time point of interest by the copies / ng at baseline (0 hr). Figure 17 shows that TL1A SNPs in promoter and intron contribute to allelic expression imbalance regulation. The inventor(s) identified a small number of donors homozygous for risk alleles at rs7848647, rs6478109, and rs6478108, but heterozygous at rs3810936, likely due to recombination between rs6478109 and synonymous SNP rs3810936. Frequencyof riskvs.non-riskalleleusage inheterozygousor recombinantdonorPBMCwasexaminedbydroplet digit PCR (ddPCR) using synonymous SNP (rs3810936) allelic specific fluorescent probes. Compared to heterozygous donors, no allelic expression imbalance was detected in these recombinant individuals before or after immune complex stimulation. Figures 18A and 18B show that TL1A risk SNPs are associated with expression quantitative trait loci (eQTL), PBMC donors with homozygous TL1A risk allele, homozygous non-risk alleles or heterozygous alleles were treated with immune complex. Total expression of TL1A (TNFSF15) in each donor was determined by digital PCR. In brief, cDNA from each sample was mixed with ddPCRTM Supermix for Probes (Bio-Rad) and PrimeTime® qPCR assay ID Hs.PT.56a.41003970. Dropletswere generated for each reaction using theQX100™droplet generator (Bio-Rad) and subjected to thermal cycling on a C1000 Touch™ thermal cycler (Bio-Rad). Following amplification, droplet fluores- cence was read on a QX100™ droplet reader (Bio-Rad). Data were analyzed using QuantaSoft software (Bio-Rad) and copies / µl of TL1A was determined and normalized for the amount of input cDNA (copies / ng). P values for differences in TL1A expression levels between different TNFSF15 haplotypes were determined using the student t test. At basal level, PBMCs from donors homozygous for TL1A risk SNPs have lower TL1AmRNA compared to non- risk homozygous donors. However, after immune complex stimulation, PBMCs from donors homozygous for TL1A risk SNPs have higher TL1A expression compared to non-risk homozygous donors. Figures 19A and 19B show cell-type specific regulation of TL1A synonymous SNP allelic expression imbalance. HUVEC cells from various donors were genotyped as described previously. Genotyped HUVEC cells from various donors were treated with IL‑1 at various time points. Total copy number of each allele was measured as described previously. Theallelic expression ratiowas calculatedbydividing the copies / ml of the risk allele by the copies / ml of the non-risk allele. No allelic expression imbalance was observed in HUVEC cells with or without IL‑1 treatment. Figures 20A and 20B show that prophylactivc treatment with anti-TL1A monoclonal antibody inhibited spontaneous colitis development in mdr1a‑ / - mice. Mice (n=10, 6‑7 weeks age) were randomized to different groups and treated intra-peritoneally once a week with 500 µg of anti-mouse TL1A antibody, anti-IL23p19 antibody, anti-mouse IL17RA antibody, ormouse isotype control or no treatment once perweek for 8weeks. Clinical disease activity wasmonitored by evaluating anal inflammation and stool consistency. Sections of the intestinewere subjected to histopath analysis. 5 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 Statistical analysis was performed using one-way ANOVA with Dunett’s compared to mIgG1 group. Figures21Aand21Bshow thatTL1Aexacerbatedcolitis inmdr1a+mice.Mdr1a‑ / -miceorwild-typecontrolmiceat 6‑8 weeks of age were treated intra-peritoneally once a week with 150 µg of recombinant mFc-TL1A fusion protein or isotype control three times each week for 4 weeks. Clinical disease activity was monitored by evaluating anal inflammation and stool consistency as described previously. After 4 weeks of treatment, mice were sacrificed, sections of the intestine were were subjected to histopath analysis. Statistical analysis was performed using oneway ANOVA with Dunett’s compared to mIgG1 group. Figures 22A to 22F shows increased inflammatory cells in lamina propria from Fc-TL1A challenged mdr1a‑ / - mice. Mdr1a‑ / - mice or wild-type control mice at 6‑8weeks of agewere treated intra-peritoneally once aweekwith 150µg of recombinant mFc-TL1A fusion protein or isotype control three times each week for 4 weeks. Lamina propria lymphocytes were isolated and stained for surface antigens and analyzed by FACS. TL1A challenge in mdr1a‑ / - mice resulted in increased inflammatory cells in lamina propria. Figures 23A to 23E showdistinct cytokine induction byTL1AandTNF challenge inmice. To evaluate if TL1A andTNF challenge result in similar or different pharmacodynamics effects, C57Bl / 6 mice (8 week, female) were first intraperitonially injected with 500 µg / mice of anti mouse TL1A, anti mouse TNF-α or PBS. After 4 hours, the mice were then challenged with 100 µg / mice of TL1A or 10 µg / mice of TNF-α or without challenging. The sera were collected after 24 hours. The cytokines were measured by MSD (IL‑22 was measured by ELISA). Figures 24A to 24F shows distinct cytokine induction by TL1A and TNF treatment in human PBMC. PBMC freshly isolated from human blood were cultured in media (RPMI1640 supplemented with 10% FBS, 2 mM glutamine, 1 mM sodium pyruvate, 5 X 10‑5 M 2-ME, and antibiotics) in the presence of 100 ng / ml of human TL1A or TNF-α. Supernatant was collected after 72 hours. The cytokines in the supernatant were measured by MSD (IL‑22 was measured by ELISA). Figure 25 depicts a schematic representation of a bispecific IgG-Fab format for an anti-TL1A anti-TNF-α bispecific antigen binding protein within the present invention. In this format, one polypeptide chain of a Fab fragment from a second antibody (e.g. the heavy chain (VH2-CH1) is fused to the carboxyl terminus of each heavy chain of a first antibody through a peptide linker to produce a modified heavy chain. The complete molecule is a homohexamer comprising twomodified heavy chains, two light chains from the first antibody, and two polypeptide chains containing the other half of the Fab fragment from the second antibody (e.g. the light chain (VL2-CL)). Charge pair mutations (representedby the circles) canbe introduced into theFab regions of the first antibody (Fab1) and / or secondantibody (Fab 2) to promote correct heavy chain-light chain pairing. Figure 26 depicts a schematic representation of a bispecific IgG-Fab format for an anti-TL1A anti-TNF-α bispecific antigen binding protein within the present invention using immunoglobulin domain crossover. In this variation of the IgG-Fab format, one polypeptide chain of a Fab fragment from a second antibody (e.g. the heavy chain (VH2-CH1) is fused to thecarboxyl terminusof theheavychain comprisingaCL insteadof aCH1domainof a first antibody througha peptide linker to produce a modified heavy chain. In this way, the CH1 and the CL domains of Fab 1 are "swapped." This swap is referred to as a Fab1 swap or an N-terminal swap herein. The complete molecule is a homohexamer comprising twomodified heavy chains, two light chains from the first antibody comprising a CH1 domain instead of a CL domain, and two polypeptide chains containing the other half of the Fab fragment from the second antibody (e.g. the light chain (VL2-CL)). Charge pairmutations (represented by the circles) can be introduced into the Fab regions of the first antibody (Fab 1) and / or second antibody (Fab 2) to promote correct heavy chain-light chain pairs. Not shown but also within the scope of this invention are IgG-Fab molecules in which (i) the CH1 and CL domains of Fab 2 are swapped insteadof thoseofFab1 (referred toherein asaFab2swaporaC-terminal swap) or (ii) both theCH1andCL domainsof Fab1areswappedand theCH1andCLdomains ofFab2are swapped (referred to hereinasadual swap). Figure 27 compares the expression titer of IgG-Fabs based on domain swapping format. Figure 28 compares the expression titer of IgG-Fabs based on type of charge pair mutation(s). Figure 29 compares the purity of IgG-Fabs based on domain swapping format. Figure 30 compares the anti-TL1A potency of IgG-Fabs based on domain swapping format. Figure 31 compares the anti-TNF-α potency of IgG-Fabs based on domain swapping format. Figure 32 compares the anti-TL1A potency of IgG-Fabs based on type of charge pair mutation(s). Figure 33 compares the anti‑ TNF-α potency of IgG-Fabs based on type of charge pair mutation(s). DETAILED DESCRIPTION OF THE INVENTION Definition of terms

[0021] In the description that follows, a number of terms are used extensively. The following definitions are provided to facilitate understanding of the invention.

[0022] Unless otherwise specified, "a", "an", "the", and "at least one" are used interchangeably and mean one or more 6 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 than one.

[0023] A "bindingentity" as usedhereinmeansanymonomeric ormultimeric protein or protein fragment that specifically bindsa specified target antigen. The term "bindingentity" includesbut is not limited to antibodiesandbindingparts thereof, such as immunologically functional fragments. Peptibodies and peptides are other examples of binding entities. The term "immunologically functional fragment" (or simply "fragment") of an antibody or immunoglobulin chain (heavy or light chain) binding entity, as used herein, is a species of binding entity comprising a portion (regardless of how that portion is obtained or synthesized) of an antibody that lacks at least some of the amino acids present in a full-length chain but which is still capable of specifically binding to an antigen. Such fragments are biologically active in that they bind to the target antigen and can compete with other binding entities, including intact antibodies, for binding to a given epitope. In some embodiments, the fragments are neutralizing fragments. In some embodiments, the fragments can block or reduce the likelihood of the interaction between the target antigen (TL1A or TNF-α. ) and its receptor. In one aspect, such a fragmentwill retain at least oneCDRpresent in the full-length light or heavy chain, and in someembodimentswill comprise a single heavy chain and / or light chain or portion thereof. These biologically active fragments can be produced by recombinant DNA techniques, or can be produced by enzymatic or chemical cleavage of binding entities, including intact antibodies. Immunologically functional immunoglobulin fragments include, but are not limited to, Fab, a diabody (heavy chain variable domainon the samepolypeptide asa light chain variable domain, connected via a short peptide linker that is too short to permit pairing between the two domains on the same chain), Fab’, F(ab’)2, Fv, domain antibodies and single- chain antibodies, and can be derived fromanymammalian source, including but not limited to human,mouse, rat, camelid or rabbit. It is further contemplated that a functional portion of the binding entities disclosed herein, for example, one or moreCDRs, couldbecovalently bound toasecondproteinor toasmallmolecule to createa therapeuticagentdirected toa particular target in the body, possessing bifunctional therapeutic properties, or having a prolonged serum half-life. As will be appreciated by one of skill in the art, a binding entity can include non-protein components. In some sections of the present disclosure, examples of binding entities are named herein in terms of "number / letter / number" (e.g., 23B3), with some binding entities further identified by additional letter / number combinations (e.g., VH4). In these cases, the exact name denotes a specific antibody. That is, a binding entity named 23B3may have some degree of sequence identity with but is not the same as an antibody named 23B3 VH4 (unless they are explicitly taught to be the same in the specification).

[0024] A "TL1A binding entity" is a binding entity that specifically binds to human TL1A; i.e., a binding entity for which human TL1A is the target antigen.

[0025] A "TNF-α binding entity" is a binding entity that specifically binds to human TNF-α ; i.e., a binding entity for which human TNF-α is the target antigen.

[0026] "Antigen binding protein" refers to a protein or polypeptide that comprises an antigen-binding region or antigen- binding portion that has a strong affinity for another molecule to which it binds (antigen). Antigen-binding proteins encompass antibodies, peptibodies, antibody fragments, antibody derivatives, antibody analogs, fusion proteins, and antigen receptors including chimeric antigen receptors (CARs).

[0027] "Antibodies" (Abs) and "immunoglobulins" (Igs) are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-likemolecules that lackantigenspecificity.Polypeptidesof the latter kindare, for example, producedat low levels by the lymph system and at increased levels by myelomas. Thus, as used herein, the term "antibody" or "antibody peptide(s)" refers to an intact antibody, an antibody that competes for specific binding with an antibody disclosed in this specification, or an antigen-binding fragment thereof that competes with the intact antibody for specific binding and includes chimeric, humanized, fully human, and bispecific antibodies. In certain embodiments, antigen-binding fragments are produced, for example, by recombinant DNA techniques. In additional embodiments, antigen-binding fragments are producedbyenzymaticor chemical cleavageof intact antibodies.Antigen-binding fragments include, butarenot limited to, Fab, Fab’, F(ab)2, F(ab’)2, Fv, and single-chain antibodies.

[0028] The term "isolated antibody" as used herein refers to an antibody that has been identified and separated and / or recovered fromacomponent of its natural environment.Contaminant components of its natural environment arematerials whichwould interferewith diagnostic or therapeutic uses for theantibody, andmay includeenzymes, hormones, andother proteinaceous or nonproteinaceous solutes. In preferred embodiments, the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody’s natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.

[0029] The term "agonist" refers to any compound including a protein, polypeptide, peptide, antibody, antibody fragment, large molecule, or small molecule (less than 10 kD), that increases the activity, activation or function of another molecule.

[0030] The term "antagonist" refers to any compound including a protein, polypeptide, peptide, antibody, antibody 7 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 fragment, largemolecule, or small molecule (less than 10 kD), that decreases the activity, activation or function of another molecule.

[0031] The term "bind(ing)" of an antigen or other polypeptide includes, but is not limited to, the binding of a ligand polypeptide of the present invention to a receptor; the binding of a receptor polypeptide of the present invention to a ligand; the binding of an antibody of the present invention to an antigen or epitope; the binding of an antigen or epitope of the present invention to an antibody; the binding of an antibody of the present invention to an anti-idiotypic antibody; the binding of an anti-idiotypic antibody of the present invention to a ligand; the binding of an anti-idiotypic antibody of the present invention to a receptor; the bindingof ananti-anti-idiotypic antibodyof the present invention to a ligand, receptor or antibody, etc.

[0032] A "bispecific" antigen binding protein is a molecule with binding entities derived from both a first antigen binding protein (e.g., antibody) that specifically binds a first target molecule of interest and a second antigen binding protein (e.g., antibody) that specifically binds a second targetmolecule of interest. Bispecific antigen binding proteinsmay be produced byavariety ofmethods including, but not limited to, fusionof hybridomasor linkingof Fab’ fragments.See, e.g., Songsivilai et al., Clin.Exp. Immunol., 79:315‑321 (1990);Kostelnyet al., J. Immunol., 148:1547‑1553 (1992), hereby incorporatedby reference. Molecules in the formats depicted in Figures 1 and 2 are bispecific antigen binding proteins in accordance with this definition. Various additional formats of bispecific antigen binding proteins within this definition are disclosed in WO 2014 / 159725;WO2013 / 041687;USPat.No. 8,945,553;USPat.No. 8,945,553;USPat.No. 8,258,268;USPat. App.No. 2012 / 0195900; International patent applicationWO2012 / 088302; US Prov. App. 62 / 218,977; Fischer and Leger (2007), Pathobiology 74:3‑14;_van Spriel et al. (2000), Immunology Today 21(8): 391‑7; Kufer et al. (2004), Trends in Biotech- nology 22(5): 238‑44; Byrne et al. (2013), Trends in Biotechnology 31(11): 621‑31; Muller and Kontermann (2010), Biodrugs 24(2): 89‑98; Chames and Baty (2009), http: / / dx.doi.org / 10.4161 / mabs.1.6.10015; Kontermann (2012), http: / / dx.doi.org / 10.4161 / mabs.4.2.19000; Holliger et al. (1993), Proc. Natl. Acad. Sci. USA 90: 6444‑8; Speiss et al., Mol. Immunol. (2015), 67: 95‑106, http: / / dx.doi.org / 10.1016 / j.molimm.2015.01.003; Holliger et al. (1993), Proc. Natl. Acad. Sci. USA90: 6444‑8; Speiss et al., Mol. Immunol. (2015), http: / / dx.doi.org / 10.1016 / j.molimm.2015.01.003; Ridgway et al, (1996), Protein Eng. 9: 617; Gunasekaran et al (2010), J. Biol. Chem. 285:19637; Davis (2010), Protein Eng. Des. & Sel. 23:195; DiGiammarino et al. (2012), Methods Mol. Biol. 899:145, 2012); Lindhofer et al. (1995), J. Immunol. 155: 219: Schaefer et al. (2011), Proc. Natl. Acad. Sci. USA, 108: 11187; Regula et al, US Patent Application No: 2010 / 0322934; Bostrom et al. (2009), Science 323:1610; US Pat. App. 2011 / 0076722; Rossi et al. (2008), Cancer Res. 68:8384; each of which is hereby incorporated by reference.

[0033] The term "epitope" refers to the portion of an antigen to which an antibody specifically binds. Thus, the term "epitope" includes any protein determinant capable of specific binding to an immunoglobulin or T-cell receptor. Epitopic determinantsusually consist of chemically active surfacegroupingsofmolecules suchasaminoacidsor sugar sidechains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. More specifically, the term "IL‑17 epitope", "TNF-αepitope" and / or "TNF-α / p19 epitope" as used herein refers to a portion of the corresponding polypeptide having antigenic or immunogenic activity in an animal, preferably in a mammal, and most preferably in amouseor a human.Anepitope having immunogenic activity is a portion of, for example, an IL‑17Aor IL‑17F orTNF-α / p19polypeptide thatelicits anantibody response inananimal.Anepitopehavingantigenicactivity isaportionof, for example, an IL‑17Aor IL‑17F or TNF-α / p19 polypeptide towhich an antibody immunospecifically binds as determined by any method well known in the art, for example, by immunoassays, protease digest, crystallography or HID-Exchange. Antigenic epitopes need not necessarily be immunogenic. Such epitopes can be linear in nature or can be adiscontinuous epitope. Thus, as used herein, the term "conformational epitope" refers to a discontinuous epitope formed by a spatial relationship between amino acids of an antigen other than an unbroken series of amino acids.

[0034] The term "immunoglobulin" refers to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes. One form of immunoglobulin constitutes the basic structural unit of an antibody. This form is a tetramer and consists of two identical pairs of immunoglobulin chains, each pair having one light and one heavy chain. In each pair, the light and heavy chain variable regions are together responsible for binding to an antigen, and the constant regions are responsible for the antibody effector functions.

[0035] Full-length immunoglobulin "light chains" (about 25 Kd or about 214 amino acids) are encoded by a variable region gene at the NH2-terminus (about 110 amino acids) and a kappa or lambda constant region gene at the COOH- terminus. Full-length immunoglobulin "heavy chains" (about 50 Kd or about 446 amino acids), are similarly encoded by a variable region gene (about 116 amino acids) and one of the other aforementioned constant region genes (about 330 aminoacids). Heavy chains are classified asgamma,mu, alpha, delta, or epsilon, anddefine the antibody’s isotype as IgG (such as IgG1, IgG2, IgG3 and IgG4), IgM, IgA, IgD and IgE, respectively. Within light and heavy chains, the variable and constant regionsare joinedbya "J" regionof about 12ormoreaminoacids,with theheavychain also includinga "D" region of about 10 more amino acids. (See generally, Fundamental Immunology (Paul, W., ed., 2nd Edition, Raven Press, NY (1989)), Chapter 7 (incorporated by reference in its entirety for all purposes).

[0036] An immunoglobulin light or heavy chain variable region consists of a "framework" region interrupted by three hypervariable regions. Thus, the term "hypervariable region" refers to the amino acid residues of an antibody which are 8 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 responsible for antigen binding. The hypervariable region comprises amino acid residues from a "Complementarity Determining Region" or "CDR" (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Edition, Public Health Service,National InstitutesofHealth,Bethesda,Md. (1991)) and / or those residues froma "hypervariable loop" (Chothia et al., J. Mol. Biol. 196: 901‑917 (1987)) (both of which are incorporated herein by reference). "Framework Region" or "FR" residues are those variable domain residues other than the hypervariable region residues as herein defined. The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. Thus, a "human framework region" is a framework region that is substantially identical (about 85% or more, usually 90‑95% or more) to the framework regionofanaturally occurringhuman immunoglobulin.The framework regionofanantibody, that is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDR’s. The CDR’sareprimarily responsible forbinding toanepitopeofanantigen.Accordingly, the term"humanized" immunoglobulin refers to an immunoglobulin comprising a human framework region and one or more CDR’s from a non-human (usually a mouse or rat) immunoglobulin. The non-human immunoglobulin providing the CDR’s is called the "donor" and the human immunoglobulin providing the framework is called the "acceptor". Constant regions need not be present, but if they are, they must be substantially identical to human immunoglobulin constant regions, i.e., at least about 85‑90%, preferably about 95% or more identical. Hence, all parts of a humanized immunoglobulin, except possibly the CDR’s, are substantially identical to correspondingparts of natural human immunoglobulin sequences. Further, one ormore residues in the human framework region may be back mutated to the parental sequence to retain optimal antigen-binding affinity and specificity. In thisway, certain framework residues from the non-humanparent antibody are retained in thehumanized antibody in order to retain the binding properties of the parent antibody while minimizing its immunogenicity. The term "human framework region" as used herein includes regions with such back mutations. A "humanized antibody" is an antibody comprising a humanized light chain and a humanized heavy chain immunoglobulin. For example, a humanized antibody would not encompass a typical chimeric antibody as defined above, e.g., because the entire variable region of a chimeric antibody is non-human.

[0037] As used herein, the term "modified heavy chain" refers to a fusion protein comprising an immunoglobulin heavy chain, particularly a human IgG1 or human IgG2 heavy chain, and a functional antibody fragment (e.g., a Fab or scFv) or portion thereof (e.g. immunoglobulin light chain or Fd fragment), wherein the fragment or portion thereof is fused at its N- terminus, optionally through a peptide linker, to the C-terminus of the heavy chain.

[0038] The term "humanized" immunoglobulin refers to an immunoglobulin comprising a human framework region and one or more CDR’s from a non-human, e.g., mouse, rat or rabbit, immunoglobulin. The non-human immunoglobulin providing theCDR’s is called the "donor" and the human immunoglobulin providing the framework is called the "acceptor". Constant regions need not be present, but if they are, they must be substantially identical to human immunoglobulin constant regions, i.e., at least about 85‑90%, preferably about 95% or more identical. Hence, all parts of a humanized immunoglobulin, except possibly theCDR’sandpossibly a fewback-mutatedaminoacid residues in the framework region (e.g., 1‑15 residues), are substantially identical to corresponding parts of natural human immunoglobulin sequences. A "humanized antibody" is an antibody comprising a humanized light chain and a humanized heavy chain immunoglobulin. For example, a humanizedantibodywould not encompass a typical chimeric antibodyasdefinedabove, e.g., because the entire variable region of a chimeric antibody is non-human.

[0039] The terms "human antibody" and "fully human antibody" each refer to an antibody that has an amino acid sequenceofahuman immunoglobulin, includingantibodies isolated fromhuman immunoglobulin librariesor fromanimals transgenic for one or more human immunoglobulins and that do not express endogenous immunoglobulins; for example, Xenomouse antibodies and antibodies as described by Kucherlapati et al. in U.S. Pat. No. 5,939,598.

[0040] The term "genetically altered antibodies" means antibodies wherein the amino acid sequence has been varied from that of a native antibody. Because of the relevance of recombinant DNA techniques in the generation of antibodies, one need not be confined to the sequences of amino acids found in natural antibodies; antibodies can be redesigned to obtain desired characteristics. The possible variations aremany and range from changing just one or a few amino acids to complete redesign of, for example, the variable and / or constant region. Changes in the constant regionwill, in general, be made in order to improve or alter characteristics, such as complement fixation, interaction with membranes and other effector functions. Changes in the variable region will be made in order to improve the antigen binding characteristics.

[0041] A "Fab fragment" is comprised of one light chain and theCH1 and variable regions of one heavy chain. The heavy chain of a Fab molecule cannot form a disulfide bond with another heavy chain molecule.

[0042] A "Fab’ fragment" contains one light chain and one heavy chain that contains more of the constant region, between theCH1andCH2domains, such that an interchaindisulfidebondcanbe formedbetween twoheavychains to form a F(ab’)2 molecule.

[0043] A "F(ab’)2 fragment" contains two light chains and two heavy chains containing a portion of the constant region between the CH1 and CH2 domains, such that an interchain disulfide bond is formed between two heavy chains.

[0044] The term "nativeFc" refers tomolecule or sequence comprising the sequenceof a non-antigen-binding fragment resulting from digestion of whole antibody, whether inmonomeric or multimeric form. The original immunoglobulin source of the native Fc is preferably of human origin and may be any of the immunoglobulins, although IgG1, IgG2 and IgG4 are 9 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 preferred. Native Fc’s are made up of monomeric polypeptides that may be linked into dimeric or multimeric forms by covalent (i.e., disulfide bonds) and non-covalent association. The number of intermolecular disulfide bonds between monomeric subunits of native Fc molecules ranges from 1 to 4 depending on class (e.g., IgG, IgA, IgE) or subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, IgGA2). One example of a native Fc is a disulfide-bonded dimer resulting from papain digestionof an IgG (seeEllisonet al. (1982),NucleicAcidsRes. 10: 4071‑9). The term "nativeFc" asusedherein is generic to the monomeric, dimeric, and multimeric forms.

[0045] The term "Fc variant" refers to a molecule or sequence that is modified from a native Fc but still comprises a binding site for the salvage receptor, FcRn. International applicationsWO 97 / 34631 (published 25 September 1997) and WO 96 / 32478 describe exemplary Fc variants, as well as interaction with the salvage receptor, and are hereby incorporated by reference. Thus, the term "Fc variant" comprises a molecule or sequence that is humanized from a non-human native Fc. Furthermore, a native Fc comprises sites that may be removed because they provide structural features or biological activity that are not required for the fusion molecules of the present invention. Thus, the term "Fc variant" comprises amolecule or sequence that lacks one or more native Fc sites or residues that affect or are involved in (1) disulfide bond formation, (2) incompatibility with a selected host cell (3) N-terminal heterogeneity upon expression in a selected host cell, (4) glycosylation, (5) interaction with complement, (6) binding to an Fc receptor other than a salvage receptor, or (7) antibody-dependent cellular cytotoxicity (ADCC). Fc variants are described in further detail hereinafter.

[0046] The term "Fc domain" encompasses native Fc and Fc variant molecules and sequences as defined above. As with Fc variants and native Fc’s, the term "Fc domain" includes molecules in monomeric or multimeric form, whether digested from whole antibody or produced by other means.

[0047] The term "multimer" as applied to Fc domains or molecules comprising Fc domains refers to molecules having two or more polypeptide chains associated covalently, noncovalently, or by both covalent and non-covalent interactions. IgG molecules typically form dimers; IgM, pentamers; IgD, dimers; and IgA, monomers, dimers, trimers, or tetramers. Multimersmaybe formedbyexploiting thesequenceand resultingactivity of thenative Igsourceof theFcorbyderivatizing (as defined below) such a native Fc.

[0048] The term "dimer" as applied to Fc domains or molecules comprising Fc domains refers to molecules having two polypeptide chains associated covalently or non-covalently. Thus, exemplary dimerswithin the scope of this invention are as shown in Figure 2.

[0049] The terms "Fv fragment" and "single chain antibody" refer to polypeptides containing antibody variable regions from both heavy and light chains but lacking constant regions. Like a whole antibody, it is able to bind selectively to a specific antigen. With a molecular weight of only about 25 kDa, Fv fragments are much smaller than common antibodies (150‑160 kD)which are composed of two heavy protein chains and two light chains, and even smaller than Fab fragments (about 50 kDa, one light chain and half a heavy chain).

[0050] A "single domain antibody" is an antibody fragment consisting of a single domain Fv unit, e.g., VH or VL. Like a whole antibody, it is able to bind selectively to a specific antigen.With amolecular weight of only 12‑15 kDa, single-domain antibodiesaremuchsmaller thancommonantibodies (150‑160kDa)whicharecomposedof twoheavyprotein chainsand two light chains, and even smaller than Fab fragments (.about.50 kDa, one light chain and half a heavy chain) and single- chain variable fragments (.about.25 kDa, two variable domains, one from a light and one from a heavy chain). The first single-domain antibodies were engineered from heavy-chain antibodies found in camelids. Although most research into single-domain antibodies is currently based on heavy chain variable domains, light chain variable domains and nanobodies derived from light chains have also been shown to bind specifically to target epitopes.

[0051] The term "monoclonal antibody" as used herein is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.

[0052] In some embodiments, the anti-TL1A antigen binding protein, bispecific antigen binding protein or functional fragment of either thereof from which the anti-TL1A binding domain is derived selectively inhibits human TL1A relative to TNF superfamily ligands. An antibody or functional fragment thereof "selectively inhibits" a specific receptor or ligand relative to other receptors or ligands when the IC50 of the antibody in an inhibition assay of the specific receptor is at least 50-fold lower than the IC50 in an inhibition assay of another "reference" ligand or receptor. An "IC50" is the dose / concen- tration required to achieve 50% inhibition of a biological or biochemical function. With radioactive ligands, IC50 is the concentration of a competing ligand that displaces 50% of the specific binding of the radioactive ligand. The IC50 of any particular substance or antagonist can be determined by constructing a dose-response curve and examining the effect of different concentrations of the drug or antagonist on reversing agonist activity in a particular functional assay. IC50 values can be calculated for a given antagonist or drug by determining the concentration needed to inhibit half of the maximum biological response of the agonist. Thus, the IC50 value for any anti-TL1A antibody or functional fragment thereof can be calculated by determining the concentration of the antibody or fragment needed to inhibit half of the maximum biological response of TL1A in activating the human TL1A receptor in any functional assay, such as the assay described in Example 14 hereinafter. An antibody or functional fragment thereof that selectively inhibits a specific ligand or receptor is understood to be a neutralizing antibody or neutralizing fragment with respect to that ligand or receptor. Thus, in some 10 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 embodiments, the anti-TL1A antibody or functional fragment thereof from which the anti-TL1A binding domain of the bispecific antigen binding proteins of the invention is derived is a neutralizing antibody or fragment of human TL1A.

[0053] The variable regions or CDR regions of any anti-TL1A antibody or functional fragment thereof can be used to construct the anti-TL1A binding entity of any of the bispecific antigen binding proteins described herein. Likewise, the variable regionsorCDRsequencesof anyanti-TNF-αantibodyor functional fragment thereof canbeused to construct the anti-TNF-α binding entity of any of the bispecific antigen binding proteins described herein. For instance, the anti-TL1A binding domain of the bispecific antigen binding proteins of the invention may comprise VH and / or VL regions or one or moreCDRs fromanyof theanti-humanTL1Aantibodiesdescribed inUSPat.No. 7,820,798;USPat. App. 2008 / 0003221; US Pat. No. 8,263,743; US Pat. App. 2011 / 0217310; US Pat. App. 2012 / 0263718; US Pat. App. 2014 / 0308271; WO 2012 / 161856; WO 2013 / 044298; WO 2005 / 018571; US Pat. App. 2014 / 0120109; US Pat. No. 6,521,422; US Pat. App. 2014 / 0255302; andUSPat. App. 2015 / 0132311; each of which is hereby incorporated by reference in its entirety. In some embodiments, the anti-TL1A antibody from which the anti-TL1A binding entity is derived cross-blocks one or more of the human anti-TL1A antibodies described in one of the references just mentioned or one or more of the human anti-TL1A antibodies described below. The terms "cross-block," "cross-blocked," and "cross-blocking" are used interchangeably herein tomean theabilityof anantibody to interferewith thebindingofotherantibodiesorbinding fragments toa target (e.g. humanTL1A). Theextent towhich anantibodyor binding fragment is able to interferewith the bindingof another to a target (e.g., human TL1A) and therefore whether it can be said to cross-block, can be determined using competition binding assays. In some embodiments, a cross-blocking antibody or binding fragment thereof reduces human TL1A binding of a reference antibody between about 40% and 100%, such as about 60% and about 100%, specifically preferably between about 70%and 100%, andmore specifically preferably between about 80%and 100%. A particularly suitable quantitative assay for detecting cross-blocking uses a Biacore machine which measures the extent of interactions using surface plasmon resonance technology. Another suitable quantitative cross-blocking assay uses a FACS-based approach to measure competition between antibodies in terms of their binding to human TL1A. An exemplary assay regarding such cross-blocking appears in US Pat. App. 2015 / 0132311, example 2, paragraphs

[0922]

[0924] , hereby incorporated by reference.

[0054] The term "nucleic acid" or "nucleic acidmolecule" refers to polynucleotides, suchasdeoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, fragments generatedby thepolymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action. Nucleic acid molecules can be composed of monomers that are naturally-occurring nucleotides (such as DNA and RNA), or analogs of naturally- occurring nucleotides (e.g., .alpha.‑enantiomeric forms of naturally-occurring nucleotides), or a combination of both. Modified nucleotides can have alterations in sugar moieties and / or in pyrimidine or purine base moieties. Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters. Moreover, the entire sugar moiety can be replaced with sterically and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs. Examples of modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well- known heterocyclic substitutes. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like. The term "nucleic acidmolecule" also includesso-called "peptidenucleic acids",which comprisenaturally-occurringormodifiednucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single stranded or double stranded.

[0055] The term "complement of a nucleic acid molecule" refers to a nucleic acid molecule having a complementary nucleotide sequence and reverse orientation as compared to a reference nucleotide sequence.

[0056] The term "degenerate nucleotide sequence" denotes a sequence of nucleotides that includes one or more degenerate codons as compared to a reference nucleic acid molecule that encodes a polypeptide. Degenerate codons contain different triplets of nucleotides, but encode the same amino acid residue (i.e., GAUandGAC triplets each encode Asp).

[0057] An "isolated nucleic acid molecule" is a nucleic acid molecule that is not integrated in the genomic DNA of an organism. For example, aDNAmolecule that encodes agrowth factor that has been separated from thegenomicDNAof a cell is an isolatedDNAmolecule.Another exampleof an isolatednucleic acidmolecule is achemically-synthesizednucleic acid molecule that is not integrated in the genome of an organism. A nucleic acid molecule that has been isolated from a particular species is smaller than the complete DNA molecule of a chromosome from that species

[0058] A "nucleic acid molecule construct" is a nucleic acid molecule, either single‑ or double-stranded, that has been modified throughhuman intervention to contain segments of nucleic acid combinedand juxtaposed in anarrangement not existing in nature

[0059] "ComplementaryDNA (cDNA)" is a single-strandedDNAmolecule that is formed fromanmRNA template by the enzyme reverse transcriptase. Typically, a primer complementary to portions of mRNA is employed for the initiation of reverse transcription. Those skilled in the art also use the term "cDNA" to refer to a double-stranded DNA molecule consisting of such a single-stranded DNAmolecule and its complementary DNA strand. The term "cDNA" also refers to a 11 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 clone of a cDNA molecule synthesized from an RNA template.

[0060] A "promoter" is a nucleotide sequence that directs the transcription of a structural gene. Typically, a promoter is located in the 5’ non-coding region of a gene, proximal to the transcriptional start site of a structural gene. Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. These promoter elements include RNA polymerase binding sites, TATA sequences, CAAT sequences, differentiation-specific elements (DSEs; McGehee et al., Mol. Endocrinol., 7:551 (1993)), cyclic AMP response elements (CREs), serum response elements (SREs; Treisman, Seminars in Cancer Biol., 1:47 (1990)), glucocorticoid response elements (GREs), and binding sites for other transcription factors, such as CRE / ATF (O’Reilly et al., J. Biol. Chem., 267:19938 (1992)), AP2 (Ye et al., J. Biol. Chem., 269:25728 (1994)), SP1, cAMP response element binding protein (CREB; Loeken,GeneExpr., 3:253 (1993)) and octamer factors (see, in general,Watson et al., eds., Molecular Biology of theGene, 4thEdition,TheBenjamin / CummingsPublishingCompany, Inc. (1987), andLemaigreet al., Biochem.J., 303: 1 (1994)). If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter. Repressible promoters are also known.

[0061] A "regulatory element" is a nucleotide sequence that modulates the activity of a core promoter. For example, a regulatory elementmay contain a nucleotide sequence that bindswith cellular factors enabling transcription exclusively or preferentially in particular cells, tissues, or organelles. These types of regulatory elements are normally associated with genes that are expressed in a "cell-specific", "tissue-specific", or "organelle-specific" manner.

[0062] An "enhancer" is a type of regulatory element that can increase the efficiency of transcription, regardless of the distance or orientation of the enhancer relative to the start site of transcription.

[0063] "Heterologous DNA" refers to a DNA molecule, or a population of DNA molecules, that does not exist naturally within a given host cell. DNAmolecules heterologous to a particular host cell may contain DNA derived from the host cell species (i.e., endogenous DNA) so long as that host DNA is combined with non-host DNA (i.e., exogenous DNA). For example, a DNA molecule containing a non-host DNA segment encoding a polypeptide operably linked to a host DNA segment comprising a transcription promoter is considered to be a heterologous DNA molecule. Conversely, a hetero- logous DNA molecule can comprise an endogenous gene operably linked with an exogenous promoter. As another illustration, a DNAmolecule comprising a gene derived from a wild-type cell is considered to be heterologous DNA if that DNA molecule is introduced into a mutant cell that lacks the wild-type gene.

[0064] An "expression vector" is a nucleic acid molecule encoding a gene that is expressed in a host cell. Typically, an expression vector comprises a transcription promoter, a gene, and a transcription terminator. Gene expression is usually placed under the control of a promoter, and such a gene is said to be "operably linked to" the promoter. Similarly, a regulatory element and a core promoter are operably linked if the regulatory element modulates the activity of the core promoter.

[0065] A "recombinant host" is a cell that contains a heterologous nucleic acid molecule, such as a cloning vector or expression vector. In the present context, an example of a recombinant host is a cell that produces an antagonist of the present invention from an expression vector. In contrast, such an antagonist can be produced by a cell that is a "natural source" of said antagonist, and that lacks an expression vector.

[0066] The terms "amino-terminal" and "carboxyl-terminal" are used herein to denote positions within polypeptides. Where the context allows, these terms are used with reference to a particular sequence or portion of a polypeptide to denote proximity or relative position. For example, a certain sequence positioned carboxyl-terminal to a reference sequence within a polypeptide is located proximal to the carboxyl terminus of the reference sequence, but is not necessarily at the carboxyl terminus of the complete polypeptide.

[0067] A "fusion protein" is a hybrid protein expressedby anucleic acidmolecule comprising nucleotide sequences of at least twogenes. For example, a fusionprotein cancomprise at least part of a IL‑17RApolypeptide fusedwithapolypeptide that binds an affinity matrix. Such a fusion protein provides a means to isolate large quantities of IL‑17A using affinity chromatography.

[0068] The term "receptor" denotes a cell-associated protein that binds to a bioactive molecule termed a "ligand." This interaction mediates the effect of the ligand on the cell. Receptors can be membrane bound, cytosolic or nuclear; monomeric (e.g., thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric (e.g., PDGF receptor, growth hormone receptor, IL‑3 receptor, GM-CSF receptor, G-CSF receptor, erythropoietin receptor and IL‑6 receptor). Membrane-bound receptors are characterized by a multi-domain structure comprising an extracellular ligand-binding domain and an intracellular effector domain that is typically involved in signal transduction. In certain membrane-bound receptors, the extracellular ligand-binding domain and the intracellular effector domain are located in separate polypep- tides that comprise thecomplete functional receptor. In general, thebindingof ligand to receptor results inaconformational change in the receptor that causes an interaction between the effector domain and other molecule(s) in the cell, which in turn leads toanalteration in themetabolismof thecell.Metabolicevents thatareoften linked to receptor-ligand interactions include gene transcription, phosphorylation, dephosphorylation, increases in cyclic AMP production, mobilization of cellular calcium, mobilization of membrane lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of phospho- 12 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 lipids.

[0069] The term "expression" refers to the biosynthesis of a gene product. For example, in the case of a structural gene, expression involves transcription of the structural gene into mRNA and the translation of mRNA into one or more polypeptides.

[0070] The term "complement / anti-complement pair" denotes non-identical moieties that form a non-covalently associated, stable pair under appropriate conditions. For instance, biotin and avidin (or streptavidin) are prototypical members of a complement / anti-complement pair. Other exemplary complement / anti-complement pairs include recep- tor / ligand pairs, antibody / antigen (or hapten or epitope) pairs, sense / antisense polynucleotide pairs, and the like. Where subsequent dissociation of the complement / anti-complement pair is desirable, the complement / anti-complement pair preferably has a binding affinity of less than 109 M‑1.

[0071] A "detectable label" is amolecule or atomwhich can be conjugated to an antibodymoiety to produce amolecule useful for diagnosis. Examples of detectable labels include chelators, photoactive agents, radioisotopes, fluorescent agents, paramagnetic ions, or other marker moieties.

[0072] The term "affinity tag" is used herein to denote a polypeptide segment that can be attached to a second polypeptide to provide for purification or detection of the second polypeptide or provide sites for attachment of the second polypeptide to a substrate. In principal, any peptide or protein for which an antibody or other specific binding agent is available can be used as an affinity tag. Affinity tags include a polyhistidine tract, protein A (Nilsson et al., EMBOJ., 4:1075 (1985); Nilsson et al., MethodsEnzymol., 198:3 (1991)), glutathioneS transferase (Smith et al., Gene, 67:31 (1988)), Glu- Glu affinity tag (Grussenmeyer et al., Proc. Natl. Acad. Sci. USA, 82:7952 (1985)), substance P, FLAG® peptide (Hopp et al., Biotechnology, 6:1204 (1988)), streptavidin binding peptide, or other antigenic epitope or binding domain. See, in general, Ford et al., Protein Expression and Purification, 2:95 (1991). DNAmolecules encoding affinity tags are available from commercial suppliers (e.g., Pharmacia Biotech, Piscataway, N.J.).

[0073] The term "acidic residue" refers to amino acid residues having sidechains comprising acidic groups. Exemplary acidic residues include D and E.

[0074] The term "amide residue" refers to aminoacidshaving sidechains comprisingamidederivativesof acidic groups. Exemplary residues include N and Q.

[0075] The term "aromatic residue" refers to amino acid residues having sidechains comprising aromatic groups. Exemplary aromatic residues include F, Y, and W.

[0076] The term "basic residue" refers to amino acid residues having sidechains comprising basic groups. Exemplary basic residues include H, K, and R.

[0077] The term "hydrophilic residue" refers to amino acid residues having sidechains comprising polar groups. Exemplary hydrophilic residues include C, S, T, N, and Q.

[0078] The term "non-functional residue" refers to amino acid residues having sidechains that lack acidic, basic, or aromatic groups. Exemplary non-functional amino acid residues include M, G, A, V, I, L and norleucine (Nle).

[0079] Both the EU index as in Kabat et al. (1991), Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD and AHo numbering schemes (Honegger and Plückthun (2001), J Mol Biol. 8;309(3): 657‑70) can be used in the present invention. Amino acid positions and CDRs and FRs of a given antibody may be identified using either system. For example, EU heavy chain positions 39, 44, 183, 356, 357, 370, 392, 399, and 409are equivalent toAHoheavy chain positions 46, 51, 230, 484, 485, 501, 528, 535, and 551, respectively. Similarly, EU light chain positions 38, 100, and 176 are equivalent to AHO light chain positions 46 141, and 230, respectively. Tables (i), (ii) and (iii) below demonstrate the equivalence between numbering positions for v1, v2, and v3 versions of charge positions to aid correct assembly of, for example, IgG-Fab bispecific antigen binding proteins. 13 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 Bispecific antigen binding protein formats of the invention

[0080] One aspect of the invention concerns novel TL1A-specific antigen binding proteins and antibodies. Such antibodies are useful to treat conditions known in the art and described hereinafter that are amenable to treatment by inhibition of TL1A biological activity.

[0081] Another aspect of the invention concerns bispecific antigen binding proteins inwhich one light chain-heavy chain pair specifically binds TL1A and another light chain-heavy chain pair binds TNF-α . Such bispecific antigen binding proteins canbewholeantibodies (seeFigure1)orF(ab’)2 fragments. In thisaspect of the invention, theTL1Abindingentity is monovalent for TL1A and the TNF-α binding entity is monovalent for TNF-α .

[0082] In another bispecific antigen binding protein embodiment, the TL1A binding entity and the TNF-α binding entity are arranged in an overall structure referred to herein as IgG-scFv. In this embodiment, a first binding entity has the structure of an antibody-‑ i.e., two pairs of immunoglobulin chains, eachpair having one light chain andoneheavy chain. A secondbindingentity comprises thestructureof apair ofFvunits-‑ i.e., eachmemberof thepair hasavariable domain from a heavy chain and a variable domain from a light chain linked in tandem as a single chain. In the IgG-scFv configuration, each Fv unit is covalently bound to the C-terminus of a heavy chain constant domain (Fc) of the first binding entity (see Figure 2). Each Fv unit can be linked to the Fc domain of the first binding entity directly or through a linker. In this embodiment of the invention, each binding entity is bivalent for its target antigen. In a preferred embodiment, the TL1A binding entity has the structure of an antibody and the TNF-α binding entity has the structure of a pair of Fv units.

[0083] The invention further concerns bispecific antibodies with mutations to aid correct heavy-heavy and heavy-light chain pairing. Such mutations are described in US 8,592,562; WO 2009 / 089004; WO 2006 / 106905; WO 2014 / 4082179; WO 2014 / 081955; Speiss et al., Mol. Immunol. (2015), http: / / dx.doi.org / 10.1016 / j.molimm.2015.01.003; each of which is hereby incorporated by reference.

[0084] The invention further concerns a TL1A binding entity and a TNF-α binding entity arranged in other bispecific antigen binding protein formats known in the art. Specifically, the invention concerns the TL1A and TNF-α binding entities in the formats described in:WO2014 / 159 725;WO2013 / 041687; USPat. No. 8,945,553; USPat. No. 8,945,553; USPat. No. 8,258,268; US Pat. App. No. 2012 / 0195900; International patent application WO 2012 / 088 302; US Prov. App. 62 / 218,977, Fischer and Leger (2007), Pathobiology 74:3‑14;_van Spriel et al. (2000), Immunology Today 21(8): 391‑7; Kufer et al. (2004), Trends in Biotechnology 22(5): 238‑44; Byrne et al. (2013), Trends in Biotechnology 31(11): 621‑31; 14 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 Muller and Kontermann (2010), Biodrugs 24(2): 89‑98; Chames and Baty (2009), http: / / dx.doi.org / 10.4161 / mabs.1.6.10015; Kontermann (2012), http: / / dx.doi.org / 10.4161 / mabs.4.2.19000; Holliger et al. (1993), Proc. Natl. Acad. Sci. USA 90: 6444‑8; Speiss et al., Mol. Immunol. (2015), http: / / dx.doi.org / 10.1016 / j.molimm.2015.01.003; WO 2009 / 089004, published 16 July 2009; Holliger et al. (1993), Proc. Natl. Acad. Sci. USA 90: 6444‑8; Speiss et al., Mol. Immunol. (2015), http: / / dx.doi.org / 10.1016 / j.molimm.2015.01.003; Fidgway et al, (1996), Protein Eng. 9: 617; Gunasekaran et al (2010), J. Biol. Chem. 285:19637; Davis (2010), Protein Eng. Des. & Sel. 23:195; DiGiammarino et al. (2012),MethodsMol. Biol. 899:145, 2012); Lindhofer et al. (1995), J. Immunol. 155: 219:Schaefer et al. (2011), Proc. Natl. Acad. Sci. USA, 108: 11187; Regula et al, US Patent Application No: 2010 / 0322934; Bostrom et al. (2009), Science 323:1610;USPat. App. 2011 / 0076722;Rossi et al. (2008), CancerRes. 68:8384; each ofwhich is hereby incorporated by reference. Preferred embodiments

[0085] The amino acid sequences of the antigen binding proteins and binding entities are preferably based upon the sequences of human and / or humanized monoclonal antibodies against TL1A and TNF-α . The invention also comprises sequences having at least 90%, at least 95%, or at least 99% sequence identity to the preferred sequences set forth hereinafter. The amino acid sequences shown in the following tables are preferred for the antigen binding proteins of this invention, including bispecific antigen binding proteins in any format. TL1A-specific antigen Binding Proteins

[0086] TL1A-specific antigen binding proteins and antigen binding entities preferably comprise the complementarity determining region (CDR) sequences derived from preferred TL1A antibodies disclosed herein. Table A shows the preferred CDR sequences, alongside the preferred antibodies from which they were derived. Throughout, LCDR1, LCDR2, and LCDR3 refer to the light chain CDRs; HCDR1, HCDR2, and HCDR3 to the heavy chain CDRs, Throughout, the sequence identification number (SEQ ID NO) for each sequence appears in parentheses after the sequence in the table. Table A: Preferred TL1A-binding CDR sequences Source Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3(SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 3C6 DASSLQS (100) SYGMH (164) 2G11 ATSSLQS (106) SYFWS (170) 9C8 AASSLQS (112) SYFWS (170) 23B3 WASTRES (118) TNSVAWN (182) 23B3 VH4 WASTRES (118) TNSVAWN (182) 15 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Source Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3(SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 23B3 VH3 WASTRES (118) TNSVAWN (182) 3B3 GASSRAT (124) QQYGSSPT (126) GYYWN (188) 5G4 GASSRAT (124) QQYGSSPT (126) GYYWN (188) 17E9 AASSLQS (112) SYGMH (164) 53D3 LGSSRAS (685) TYYMS (777) 54E5 WASTRES (118) TYGMH (783) 56E1 WASTRES (118) SYGMH (164) 57A8 GNNNRPS (699) SYVMS (792) 58G5 GNSHRPS (705) NYAMS (798) 60G11 GNSHRPS (705) NYAMN (804) 73C2 AASSLQS (112) SSSATWN (809) 76A4 TASSLQS (721) SNSATWN (815) 77D12 SNNKRPS (725) GFYMH (819) 16 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Source Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3(SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 87H11 VASSLQS (731) GYYWS (265) 88H9 AASGLQG (737) SYGMH (164) 89H9 AASSLQS (112) SYAMS (836) 91D7 TASSLQS (749) GYYWS (265) 91F10_LC1 KVSNWDS (755) AYYMH (847) 91F10_LC2 AASRLQS (761) AYYMH (847) 91G8 AASSLQS (112) QQSFSTIT (767) SYAMS (836) EVAGAFDI (855) 92D3 GASRLQS (769) GYYMH (857) 92E5 AASSLQS (112) QQSFSSIT (775) SYAMS (836) EVAGAFDI (855)

[0087] Each of the foregoing sequences is encoded by the nucleic acid sequence immediately preceding it in the Sequence Listing. Throughout, the sequences from antibodies 9C8 and 3B3 are preferred.

[0088] In the antigen binding proteins of this invention, it is preferable to avoid isomerization sites. The two-amino acid sequences DG, DH, DS, and DT are known isomerization sites. The present invention relates also to antigen binding proteins in which the source antibody sequences, including the sequences of CDRs, are modified to eliminate isomeriza- tion sites. With that consideration, the invention relates to antigen binding proteins wherein HCDR2 is a modified form of theHCDR2 fromsourceantibody3C6having the sequenceVISYDXNNKLYTDXVKG(SEQ IDNO:204)whereineachX is independently a residue other than G, H, S, or T (i.e., A, C, D, E, F, I, K, L, M, N, P, Q, R, V, W, or Y), with A preferred. The invention further relates toantigenbindingproteinswhereinHCDR2 isamodified formof theHCDR2 fromsourceantibody 3C6 in which the acidic residue D is replaced with E so as to remove the isomerization sites, resulting in the sequence VISYEGNNKLYTESVKG (SEQ IDNO: 678). The invention further relates to antigen binding proteinswhereinHCDR3 is a modified form of HCDR3 from source antibody 23B3 having the sequence EDGDXYYRYGMDV (SEQ ID NO: 676). The invention further relates to antigenbindingproteinswherein the isomerization site ofHCDR3 fromsource antibody23B3 is removed by replacing the acidic residue D with E, resulting in the sequence EEGESYYRYGMDV (SEQ ID NO: 657).

[0089] In the antigen binding proteins of this invention, it is preferable to avoid deamidation sites. The two-amino acid sequences NG, NH, NS, and NT are known deamidation sites. The present invention relates also to antigen binding proteins inwhich thesourceantibodysequences, including thesequencesofCDRs, aremodified toeliminatedeamidation 17 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 sites. Oneway to eliminate the deamidation sites is to replace the second amino acid residue in the sites NG,NH, NS, and NTwith a residue other than G, H, S, or T (i.e., A, C, D, E, F, I, K, L, M, N, P, Q, R, V, W, or Y). A preferred way to eliminate deamidation sites is to replace theN inNG,NH,NSandNTwithQ.With that consideration, the invention relates to antigen binding proteins having the following sequences in addition to those listed in Table A: LCDR3 may have the sequence LQHQSYPPT (SEQ ID NO: 631) based on modification of the sequence from the source antibody 3C6; HCDR1 may have the sequences TQSVAWN (SEQ ID NO: 632) based on modification of the sequence from the source antibody 23B3 VH4; HCDR2mayhave thesequencesYIYYSGQTKYNPSLKS(SEQIDNO:633)orEIQHAGQTNYNPSLKS(SEQIDNO: 677) based on modification of the sequences from the source antibodies 9C8 and 3B3, respectively.

[0090] Antigen binding proteins of this invention may further result from substitution of an acidic residue for another acidic residue, anamide residue for another amide residue, and likewise for aromatic residues, basic residues, hydrophilic residues, non-functional residues, neutral polar residues, and polar hydrophobic residues. Such substitutions of non- functional residues of the source antibodyCDRs results in the sequences of the invention shown in Table B, wherein each X is independently M, G, A, V, I, or L. Table B: TL1A-binding CDR sequences with substitutions Source Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 3C6 DXSSLQS (636) SYXXH (639) 2G11 XTSSXQS (643) SYFWS (170) 9C8 XXSSXQS (647) SYFWS (170) 18 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Source Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 23B3 WXSTRES (652) TQSXXWN (654), TNXXXWN (655), TQSVAWN (632) 23B3 VH4 WXSTRES (652) TQSXXWN (654), TNXXXWN (655), TQSVAWN (632) 23B3 VH3 WXSTRES (652) TQSXXWN (654), TNXXXWN (655), TQSVAWN (632) 19 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Source Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 3B3 XXSSRXT (662) QQYXSSPT (663) XYYWN (664) 5G4 XXSSRXT (662) QQYXSSPT (663) XYYWN (664) 17E9 XXSSXQS (647) SYXXH (639) 20 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Source Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 53D3 XXSSRXS (789) TYYXS (955) 54E5 WXSTRES (652) TYXXH (979) 56E1 WXSTRES (652) SYXXH (639) 21 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Source Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 57A8 XNNNRPS (988) SYXXS (994) 58G5 XNXHRPS (1002), GQSHRPS (1003), XQSHRPS (1004) NYXXS (1010) 60G11 XNSHRPS (1002), GQSHRPS (1003), XQSHRPS (1004) NYXXN (1017) 73C2 XXSSXQS (647) [none] SSSXTWN (1022) 76A4 TXSSXQS (1026) [none] SNSXTWN (1027), SQSATWN (1028) SQSXTWN (1029) 22 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Source Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 77D12 [none] XFYXH (1037) 87H11 XXSSXQS (647) [none] XYYWS (1045) 88H9 XXSXXQX (1054) SYXXH (639) 23 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Source Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 89H9 XXSSXQS (647) QQSYSSXT (1065) SYXXS (994) EXXXXFDX (1071) 91D7 TXSSXQS (1073) [none] XYYWS (1045) 91F10_LC1 KVSNWDX (1081),KVS NWES (1082), KXSNWDS (1083), KXSNWDX (1084), KXSNWES (1085) XQXTHWP (1086) XYYXH (1087) 91F10_LC2 XXSRXQS (1092) XYYXH (1087) 91G8 XXSSXQS (647) QQSFSTXT (1094) SYXXS (994) EXXXXFDX (1071) 24 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Source Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 92D3 XXSRXQS (1098) XYYXH (1087) 92E5 XXSSXQS (647) QQSFSSXT (1107) SYXXS (994) EXXXXFDX (1071)

[0091] Also preferred are antigen binding proteins comprising the CDR germline sequences related to the antibodies shown in Table A. Such sequences are shown in Table C. Table C: Related germline CDR sequences of anti-TL1A antibodies Antibody designation related to germline LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 3C6 AASSLQS (112) SYAMH (253) TTVTYYYY YGMD (255) 2G11 AASSLQS (112) SYYWS (256) SYYYFD (258) 9C8 AASSLQS (112) SYYWS (259) LTGYFD (261) 23B3 WASTRES (118) SNSAAWN (262) 25 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Antibody designation related to germline LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 23B3 VH4 AASTLQS (242) SGSYYWS (268) 23B3 VH3 AASTLQS (242) SNYMS (271) 3B3 GASSRAT (124) GYYWS (265) 5G4 GASSRAT (124) GYYWS (265) 17E9 AASSLQS (112) SYAMH (253) 53D3 LGSNRAS (935) SYSMN (950) 54E5 WASTRES (118) SYGMH (164) 56E1 WASTRES (118) SYGMH (164) 57A8 GNSNRPS (148) SYAMS (836) 58G5 GNSNRPS (148) SYAMS (836) 60G11 GNSNRPS (148) SYAMS (836) 73C2 AASSLQS (112) SNSAAWN (262) 26 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Antibody designation related to germline LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 76A4 AASSLQS (112) SNSAAWN (262) 77D12 SNNQRPS (948) GYYMH (857) 87H11 AASSLQS (112) GYYWS (265) 88H9 AASSLQS (112) SYGMH (164) 89H9 AASSLQS (112) SYAMS (836) 91D7 AASSLQS (112) GYYWS (265) 91F10_LC1 KVSNRDS (943) GYYMH (857) 91F10_LC2 AASSLQS (112) GYYMH (857) 91G8 AASSLQS (112) SYAMS (836) 92D3 AASSLQS (112) GYYMH (857) 92E5 AASSLQS (112) SYAMS (836) 88H9 AASSLQS (112) SYGMH (164) 54E5 WASTRES (118) SYGMH (164) 27 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Antibody designation related to germline LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 56E1 WASTRES (118) SYGMH (164) 53D3 LGSNRAS (935) SYSMN (950) 89H9 AASSLQS (112) SYAMS (836) 91G8 AASSLQS (112) SYAMS (836) 92E5 AASSLQS (112) SYAMS (836) 92D3 AASSLQS (112) GYYMH (857) 91F10_LC2 AASSLQS (112) GYYMH (857) 91D7 AASSLQS (112) GYYWS (265) 76A4 AASSLQS (112) SNSAAWN (262) 87H11 AASSLQS (112) GYYWS (265) 73C2 AASSLQS (112) SNSAAWN (262) 91F10_LC1 KVSNRDS (943) GYYMH (857) 60G11 GNSNRPS (148) SYAMS (836) 28 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Antibody designation related to germline LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) 58G5 GNSNRPS (148) SYAMS (836) 57A8 GNSNRPS (148) SYAMS (836) 77D12 SNNQRPS (948) GYYMH (857)

[0092] Further preferred are antigen binding proteins comprising the variable domain sequences of the preferred anti- TL1A antibodies, as shown in Table D. Throughout, "VH" as shown in Table D refers to the variable domain of the heavy chain, "VL" to that of the light chain.Moleculeswithin this inventionmay incorporatemodifications to the sequences shown in Table D, including truncations or substitutions for stability or other functionality or removal of hotspots (chemical or physical modification of amino acids). Also included within the invention are molecules having at least 90% sequence identity with the sequences shown in Table D. Table D: Variable domain sequences of preferred anti-TL1A antibodies Antibody designation Amino acid sequence (SEQ ID NO) 3C6 VL 3C6 VH 2G11 VL 2G11 VH 9C8 VL 9C8 VH 23B3 VL 29 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Antibody designation Amino acid sequence (SEQ ID NO) 23B3 VH 3B3 VL 3B3 VH 23B3 VH4 VL 23B3 VH4 VH 23B3 VH3 VL 23B3 VH3 VH 5G4 VL 5G4 VH 17E9 VL 17E9 VH 53D3 VL 53D3 VH 30 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Antibody designation Amino acid sequence (SEQ ID NO) 54E5 VL 54E5 VH 56E1 VL 56E1 VH 57A8VL 57A8VH 58G5VL 58G5VH 60G11VL 60G11VH 73C2VL 73C2VH 76A4VL 31 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Antibody designation Amino acid sequence (SEQ ID NO) 76A4VH 77D12VL 77D12VH 87H11VL 87H11VH 88H9VL 88H9VH 89H9VL 89H9VH 91D7VL 91D7VH 91F10_LC1V L 91F10_LC1V H 91F10_LC2V L 32 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Antibody designation Amino acid sequence (SEQ ID NO) 91F10_LC2V H 91G8VL 91G8VH 92D3VL 92D3VH 92E5VL 92E5VH

[0093] Each of the foregoing polypeptides is encoded by a nucleic acid having the nucleotide sequence immediately preceding the polypeptide sequence in theSequence Listing. The sequences fromantibodies 9C8and 3B3are preferred.

[0094] The full anti-TL1A antibody sequences shown in Table E are preferred for the anti-TL1A antibodies. LC refers to the antibody light chain, HC to the heavy chain. Also encompassedwithin the invention aremolecules having at least 90% sequence identity with either or both of the light chain and heavy chain sequences in Table E. Table E: Preferred anti-TL1A Antibodies Antibody designation Light chain SEQ ID NO Heavy chain SEQ ID NO iPS (molecule designation) 3C6 50 52 284112 2G11 54 56 285396 9C8 58 60 285412 23B3 62 64 290043 3B3 66 68 308844 23B3 HC4 70 72 325246 23B3 HC3 74 76 325336 5G4 455 457 284510 17E9 459 461 284078 88H9 1116 1118 427485 54E5 1120 1122 427576 33 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Antibody designation Light chain SEQ ID NO Heavy chain SEQ ID NO iPS (molecule designation) 60G11 1124 1126 427493 53D3 1128 1130 427504 89H9 1132 1134 427509 91D7 1136 1138 427514 57A8 1140 1142 427519 91G8 1144 1146 427524 76A4 1148 1150 427529 87H11 1152 1154 427534 58G5 1156 1158 427539 57A8 1160 1162 427519 73C2 1164 1166 427544 77D12 1168 1170 427549 56E1 1172 1174 427554 92E5 1176 1178 427559 92D3 1180 1182 427564 91F10_LC1 1184 1186 427580 91F10_LC2 1188 1190 427572

[0095] Eachof theaminoacid sequences inTableE is encodedby thenucleic acid sequence immediately preceding it in the Sequence Listing. The sequences from antibodies 9C8 and 3B3 are preferred.

[0096] The foregoing anti-TL1A antibody sequences can be used in bispecific antigen proteins in any of the formats described herein. Preferably, such sequences are used in hetero Ig antigen binding proteins and IgG-scFv bispecific antigen binding proteins as described in this specification. Hetero Ig bispecific antigen binding proteins

[0097] The invention further relates to hetero Ig bispecific antigen binding proteins as shown in Figure 1 that comprise TL1A-specific binding entities. Structurally, hetero Ig bispecific antigen binding proteins comprise: (a) a TL1A binding entity light chain variable domain comprised in a light chain separate from a TL1A binding entity heavy chain variable domain, a heavy chain variable domain directed to a different antigen (e.g., TNF-α), and a binding entity light chain variable domain directed to the different antigen; (b) a TL1A binding entity heavy chain variable domain comprised in a heavy chain separate from the TL1A binding entity light chain variable domain, the heavy chain variable domain directed to a different antigen, and the light chain variable domain directed to a different antigen; (c) the heavy chain variable domain directed to a different antigen comprised in a heavy chain separate from the light chain domain directed to said different antigen, the TL1A binding entity heavy chain variable domain, and the TL1A binding entity light chain variable domain; (d) theheavychain comprising theTL1Abindingentity heavychain variabledomain covalently bound to the light chain comprising the TL1A binding entity light chain variable domain; (e) the heavy chain comprising the heavy chain variable domain directed to said different antigen covalently bound to the light chain comprising light chain variable domain directed to the different antigen; and (f) the heavy chain comprising the TL1A binding entity heavy chain variable domain covalently bound to the heavy chain comprising the heavy chain variable domain directed to the different antigen.

[0098] For suchhetero Ig bispecific antibodies, theTL1A-specific binding entities are preferred to comprise one ormore of the CDRs listed in Table A. The variable region domains in Table D may be employed but it is preferred that the TL1A binding entity comprise charged amino acids that aid in correct assembly of the hetero Ig bispecific antigen binding protein 34 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (see Figure 1). Variable region sequences preferred for the hetero Ig bispecific antibodies are shown in Table F. As before, VL in Table F refers to the light chain variable region, VH to the heavy chain variable region. The SEQ ID NO from the Sequence Listing appears after each sequence in Table F. Table F: Hetero Ig TL1A-specific variable regions Antibody designation Amino acid sequence (SEQ ID NO) 3B3 variant VL 3B3 variant VH 2G11 variant VL 2G11 variant VH 23B3 VH4 VL 23B3 VH4 VH 23B3 VH3 VL 23B3 VH3 VH 3C6 variant VL 3C6 variant VH 3C6 VL 3C6 VH 35 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55

[0099] Each of the polypeptides in Table F is encoded by a nucleic acid having the sequence immediately preceding the polypeptide sequence in the Sequence Listing.

[0100] Within the scopeof this inventionarehetero IgGmoleculeswith aTNF-specificbindingentity, preferably together with a TL1A-specific binding entity. TheTNF-specific binding entity preferably comprises oneormore sequences ofCDRs or variable domains of antibodies 3.2 (described hereinafter), 234 (described hereinafter), certolizumab, adalimumab, infliximab, golimumab, and the antibodies disclosed in USPat. No. 7,285,269, which is hereby incorporated by reference. Throughout this specification, "certolizumab" refers to an antibody having variable region sequences derived from certolizumab pegol. Preferred sequences based on such CDRs are shown in Table G. Table G: Preferred CDR sequences from anti-TNF-α antibodies Antibody designation LCDR1 (SEQ ID NO) LCDR2 (SEQ ID NO) LCDR3 (SEQ ID NO) HCDR1 (SEQ ID NO) HCDR2 (SEQ ID NO) HCDR3 (SEQ ID NO) adalimumab AASTLQS (242) DYAMH (158) certolizumab SASFLYS (154) DYGMN (218) C234 AASSLQS( 112) SYDMH (206) 3.2 GNSNRPS (148) SYWIG (212) SNWGLDY (216)

[0101] Eachof the polypeptides in TableG is encodedby a nucleic acid having the sequence immediately preceding the sequence of the polypeptide in the Sequence Listing. The sequences in Table G may be used in any bispecific antigen binding protein format, preferably a hetero Ig or IgG-scFv format and preferably together with a TL1A antigen binding entity.

[0102] TheTNFbindingentitiesof thebispecificantigenbindingproteinsmorepreferably comprise thesequencesof the variable regionof selectedanti-TNFantibodies.Thesequencesof such variable regionsare set forth inTableH.Asbefore, VL refers to the variable region of the light chain and VH refers to the variable region of the heavy chain. The invention further encompassesmolecules having sequences at least about 90% identical to any of the sequences shown in TableH. Table H: Variable domain sequences of preferred anti-TNF-α antibodies Source Antibody designation Amino acid sequence (SEQ ID NO) adalimumab VL adalimumab VH certolizumab VL 36 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Source Antibody designation Amino acid sequence (SEQ ID NO) certolizumab VH certolizumab var- iant VL certolizumab var- iant VH 3.2 VL 3.2 VH C234 VL C234 VH

[0103] Each of the foregoing polypeptides is encoded by a nucleic acid having the nucleotide sequence immediately preceding the polypeptide sequence in the Sequence Listing.

[0104] Preferred anti-TL1A / anti-TNF hetero IgG bispecific antibodies are shown in Table I. The hetero Ig molecule designation is based on the foregoing designations for the parental antibodies used to construct the hetero Ig molecule. The molecule designated "certolizumab / 3B3 variant," for example, employs polypeptides having the sequences from antibodies designated certolizumab and 3B3 variant herein. As before, VL refers to the variable region of the light chain, VH to the variable region of the heavy chain. Suchmoleculesmay include a "C clamp," cysteinemolecules substituted into the sequences to provide an additional disulfide bond for stabilization. Such cysteine substitutions are preferably introduced at the VL-VH interface, at positions 44 in the VH and 100 in the VL in the Kabat numbering scheme. Additional substitutionsmay bemade for stability or to introduce other functionality. Embodiments of the invention includemolecules with at least 90% sequence identity to any of the sequences shown in Table I. Table I: Variable region sequences of anti-TL1A / anti-TNF-α hetero IgG molecules Hetero Ig molecule designation Anti-TNF-α binding entity Anti-TL1A binding entity VL SEQ ID NO VH SEQ ID NO VL SEQ ID NO VH SEQ ID NO Certolizumab / 3B3 variant 42 286 288 290 Certolizumab / 2G11 variant 42 44 292 294 Certolizumab / 23B3 VH4 42 44 296 298 Certolizumab / 23B3 VH3 42 44 300 302 Certolizumab / 3C6 variant 42 44 304 306 37 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Hetero Ig molecule designation Anti-TNF-α binding entity Anti-TL1A binding entity VL SEQ ID NO VH SEQ ID NO VL SEQ ID NO VH SEQ ID NO Certolizumab / 3C6 42 44 308 310 3.2 / 3B3 variant 312 314 288 290 3.2 / 2G11 variant 312 314 292 294 3.2 / 23B3 VH4 312 314 296 298 3.2 / 23B3 VH3 312 314 300 302 3.2 / 3C6 variant 312 314 304 306 3.2 / 3C6 312 314 308 310 Certolizumab variant / 3B3 variant 42 318 288 290 Certolizumab variant / 2G11 variant 42 318 292 294 Certolizumab variant / 23B3 VH4 42 318 296 298 Certolizumab variant / 3C6 variant 42 318 304 306 Certolizumab variant / 3C6 42 318 308 310 C234 / 3B3 variant 320 322 288 290 C234 / 2G11 variant 320 322 292 294 C234 / 23B3 VH4 320 322 31 298 C234 / 23B3 VH3 320 322 300 302 C234 / 3C6 variant 320 322 304 306 C234 / 3C6 320 322 308 310

[0105] Each of the foregoing polypeptides is encoded by a nucleic acid having the nucleotide sequence immediately preceding the amino acid sequence of the polypeptide in the Sequence Listing.

[0106] Table J lists the full light chain and heavy chain sequences of preferred hetero Ig bispecific antigen binding proteins in accordancewith this invention. The listed sequences are preferred for all hetero Igmolecules, whether or not in the listed combination. The listed combinations are further preferred. "Var" in the molecule designation refers to variant. Suchmoleculesmay include charge variants to aid in assembly, as described for example inWO2009 / 089004, published 16 July 2009, hereby incorporated by reference. Table J: Full sequences of anti-TL1A / anti-TNF-α hetero IgG molecules Hetero Ig molecule designation Anti-TNF-α binding entity Anti-TL1A binding entity Molecule designation (iPS no.) Light chain SEQ ID NO Heavy chain SEQ ID NO Light chain SEQ ID NO Heavy chain SEQ ID NO certolizumab / 3B3 var 132 136 134 130 340593 certolizumab / 2G11 var 132 136 239 138 340595 certolizumab / 23B3 VH4 132 136 253 323 340596 certolizumab / 23B3 VH3 132 136 327 325 340597 certolizumab / 3C6 var 132 136 331 329 340598 certolizumab / 3C6 132 136 335 329 340599 3.2 / 3B3 var 337 339 134 130 340601 3.2 / 2G11 var 337 339 239 138 340602 3.2 / 23B3 VH4 337 339 323 253 340603 3.2 / 23B3 VH3 337 339 327 325 340604 38 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Hetero Ig molecule designation Anti-TNF-α binding entity Anti-TL1A binding entity Molecule designation (iPS no.) Light chain SEQ ID NO Heavy chain SEQ ID NO Light chain SEQ ID NO Heavy chain SEQ ID NO 3.2 / 3C6 var 337 339 331 329 340605 3.2 / 3C6 337 339 335 329 340606 certolizumab var / 3B3 var 132 316 134 130 340607 certolizumab var / 2G11 var 132 316 239 138 340608 certolizumab var / 23B3 VH4 132 316 323 253 340609 certolizumab var / 3C6 var 132 316 335 329 340611 certolizumab var / 3C6 132 316 331 329 340610 certolizumab var / 3B3 var 333 316 134 130 340612 certolizumab var / 2G11 var 333 316 239 138 340613 certolizumab var / 23B3 VH4 333 316 323 253 340614 certolizumab var / 3C6 var 333 316 331 329 340615 certolizumab var / 3C6 333 316 335 329 340616 certolizumab var / 3B3 var 333 463 134 130 340617 Certolizumab var / 2G11 var 333 463 239 138 340618 Certolizumab var / 23B3 VH4 333 463 323 253 340619 certolizumab var / 3C6 var 333 463 331 329 340620 certolizumab var / 3C6 333 463 335 329 340621 C234 / 3B3 var 341 343 134 130 349421 C234 / 2G11 var 341 343 239 138 349425 C234 / 23B3 VH4 341 343 323 253 349428 C234 / 23B3 VH3 341 343 327 325 349431 C234 / 3C6 var 341 343 331 329 349433 C234 / 3C6 341 343 335 329 349435 certolizumab / 3B3 var 510 514 512 555 349437 certolizumab / 2G11 var 510 514 541 558 349439 certolizumab / 23B3 VH4 510 514 539 562 349441 certolizumab / 23B3 VH3 510 514 543 565 349443 Certolizumab / 3C6 var 510 514 543 568 349445 Certolizumab / 3C6 510 514 544 568 349448 3.2 / 3B3 var 542 571 512 555 349451 3.2 / 2G11 var 542 571 541 558 349453 3.2 / 23B3 VH4 542 571 539 562 349455 3.2 / 23B3 VH3 542 571 543 565 349456 3.2 / 3C6 var 542 571 543 568 349457 3.2 / 3C6 542 571 544 568 349458 Certolizumab var / 3B3 var 510 573 512 555 349460 Certolizumab var / 2G11 var 510 573 541 558 349461 Certolizumab var / 23B3 VH4 510 573 539 562 349463 39 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Hetero Ig molecule designation Anti-TNF-α binding entity Anti-TL1A binding entity Molecule designation (iPS no.) Light chain SEQ ID NO Heavy chain SEQ ID NO Light chain SEQ ID NO Heavy chain SEQ ID NO Certolizumab var / 3C6 var 510 573 543 568 349465 Certolizumab var / 3C6 510 573 544 568 349467 Certolizumab var / 3B3 var 540 573 512 555 349468 Certolizumab var / 2G11 var 540 573 541 558 349470 Certolizumab var / 23B3 VH4 540 573 539 562 349471 Certolizumab var / 3C6 var 540 573 543 568 349473 Certolizumab var / 3C6 540 573 544 568 349474 Certolizumab var / 3B3 var 540 487 512 555 349476 Certolizumab var / 2G11 var 540 487 541 558 349479 Certolizumab var / 23B3 VH4 540 487 539 562 349480 Certolizumab var / 3C6 var 540 487 543 568 349482 Certolizumab var / 3C6 540 487 544 568 349484 C234 / 3B3 var 518 522 512 555 349485 C234 / 2G11 var 518 522 541 558 349486 C234 / 23B3 VH4 518 522 539 562 349487 C234 / 23B3 VH3 518 522 543 565 349488 C234 / 3C6 var 518 522 543 568 349489 C234 / 3C6 518 522 544 568 349490 Certolizumab / 3B3 var 545 578 546 579 349491 Certolizumab / 2G11 var 545 578 548 582 349492 Certolizumab / 23B3 VH4 545 578 549 585 349493 Certolizumab / 23B3 VH3 545 578 550 588 349495 Certolizumab / 3C6 var 545 578 551 591 349496 Certolizumab / 3C6 545 578 552 591 349498 C234 / 3B3 var 547 595 546 579 349499 C234 / 2G11 var 547 595 548 582 349501 C234 / 23B3 VH4 547 595 549 585 349502 C234 / 23B3 VH3 547 595 550 588 349503 C234 / 3C6 var 547 595 551 591 349504 C234 / 3C6 547 595 552 591 349505 Certolizumab / 3B3 var 132 599 134 598 349506 Certolizumb / 2G11 var 132 599 239 601 349507 Certolizumab / 23B3 VH4 132 599 323 603 349508 Certolizumab / 23B3 VH3 132 599 327 605 349509 Certolizumab / 3C6 var 132 599 331 607 349510 Certolizumab / 3C6 132 599 335 607 349511 3.2 / 3B3 var 337 609 134 598 349512 3.2 / 2G11 var 337 609 239 601 349513 40 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Hetero Ig molecule designation Anti-TNF-α binding entity Anti-TL1A binding entity Molecule designation (iPS no.) Light chain SEQ ID NO Heavy chain SEQ ID NO Light chain SEQ ID NO Heavy chain SEQ ID NO 3.2 / 23B3 VH4 337 609 323 603 349514 3.2 / 23B3 VH3 337 609 327 605 349515 3.2 / 3C6 variant 337 609 331 607 349516 3.2 / 3C6 337 609 335 607 349517 Certolizumab var / 3B3 var 132 611 134 598 349518 Certolizumab var / 2G11 var 132 611 239 601 349519 Certolizumab var / 23B3 VH4 132 611 323 603 349520 Certolizumab var / 3C6 var 132 611 331 607 349521 Certolizumab var / 3C6 132 611 335 607 349522 Certolizumab var / 3B3 var 333 611 134 598 349523 Certolizumab var / 2G11 var 333 611 239 601 349524 Certolizumab var / 23B3 VH4 333 611 323 603 349525 Certolizumab var / 3C6 var 333 611 331 607 349526 Certolizumab var / 3C6 333 611 335 607 349527 Certolizumab var / 3B3 var 333 613 134 598 349528 Certolizumab var / 2G11 var 333 613 239 601 349529 Certolizumab var / 23B3 VH4 333 613 323 603 349530 Certolizumab var / 3C6 var 333 613 335 607 349531 Certolizumab var / 3C6 341 615 134 598 349532 C234 / 2G11 var 341 615 239 601 349533 C234 / 23B3 VH4 341 615 323 603 349534 C234 / 23B3 VH3 341 615 327 605 349535 C234 / 3C6 var 341 615 331 607 349536 C234 / 3C6 341 615 335 607 349537 Certolizumab var / 3C6 var 333 613 331 607 349539 Certolizumab var / 2G11 var 132 463 239 138 361830 Certolizumab var / 3C6 var 132 463 331 329 361831 Certolizumab var / 3C6 132 463 335 320 361832 Certolizumab var / 3B3 var 510 487 512 555 361833 Certolizumab var / 2G11 var 510 487 541 558 361834 Certolizumab var / 23B3 VH4 510 487 539 562 361835 Certolizumab var / 3C6 var 510 487 543 568 361836 Certolizumab var / 3C6 510 487 544 568 361837 Certolizumab var / 3B3 var 132 613 134 598 361838 Certolizumab var / 23B3 VH4 132 613 323 603 361839 Certolizumab var / 3C6 var 132 613 331 607 361840 Certolizumab var / 3C6 132 613 335 607 361841 Certolizumab var / 3B3 var 132 463 134 130 361842 41 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Hetero Ig molecule designation Anti-TNF-α binding entity Anti-TL1A binding entity Molecule designation (iPS no.) Light chain SEQ ID NO Heavy chain SEQ ID NO Light chain SEQ ID NO Heavy chain SEQ ID NO Certolizumab var / 3B3 var 540 616 512 508 381084 Certolizumab var / 3B3 var 540 620 512 508 381089 Certolizumab var / 2G11 var 540 616 541 558 381094 Certolizumab var / 2G11 var 540 620 541 558 381096 Certolizumab var / 23B3 VH4 540 616 539 562 381098 Certolizumab var / 23B3 VH4 540 620 539 562 381100 C234 var / 3B3 var 538 623 512 502 381102 C234 var / 3B3 var 537 626 512 508 381109 Certolizumab var / 3B3 var 546 514 194 535 381208 Certolizumab var / 3B3 var 536 616 194 535 381216 Certolizumab / 3B3 var 536 620 194 535 381220 Certolizumab var / 3B3 var 546 487 194 535 381222 Certolizumab / 3B3 var 471 136 473 198 381292 Certolizumab var / 3B3 var 479 477 473 198 381300 Certolizumab / 3B3 var 176 136 520 198 381306 Certolizumab var / 3B3 var 475 477 520 198 381312 Certolizumab var / 3B3 var 471 463 473 198 381316 Certolizumab var / 3B3 var 176 463 570 198 381318 Certolizumab var / 3B3 var 471 465 473 198 381320 Certolizumab var / 3B3 var 176 465 520 198 381325 certolizumab / 3B3 variant 510 514 512 508 376541 C234 / 3B3 variant 518 522 512 508 376542 certolizumab / 3B3 variant 510 516 512 508 376543

[0107] Each of the foregoing polypeptides is encoded by a nucleic acid having the nucleotide sequence immediately preceding the amino acid sequence of the polypeptide in the Sequence Listing, except as noted in Table J‑1. Table J‑1: Nucleic Acids Encoding Polypeptides of Table J Polypeptide SEQ ID NO: Encoding Nucleic Acid SEQ ID NO: 176 526 194 627 198 529 239 236 253 250 320 332 323 257 333 464 465 528 471 531 42 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Polypeptide SEQ ID NO: Encoding Nucleic Acid SEQ ID NO: 473 530 475 534 477 532 479 533 487 515 508 618 520 527 535 629 536 630 537 625 538 622 539 559 540 560 541 556 542 570 543 563 544 569 545 576 546 574, 628 547 593 548 580 549 583 550 587 551 590 552 592 570 527 571 553 579 575 588 586 591 589 598 596 599 597 616 617 623 621 626 624 IgG-scFv Bispecific Antigen Binding Proteins

[0108] IgG-scFvantigenbindingproteins have the structure shown inFigure 2.Suchmolecules comprise theheavyand light chains of an antibody (the IgG portion of themolecule), which comprises a first antigen binding entity of the IgG-scFv molecule. Suchmolecules further comprise an scFv--a fusion protein having in one chain the heavy chain variable domain 43 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 and light chain variable domain of a second antibody. This scFv portion of the molecule comprises a second antigen binding entity of the IgG-scFv molecule. An scFv portion is fused to each heavy chain of the IgG portion of the molecule.

[0109] An IgG-scFv antigen binding protein herein comprises an anti-TL1A binding entity, particularly the amino acid sequencesof anti-TL1Abindingentities asdescribed hereinabove.Preferred IgG-scFvantigenbindingproteins comprise the sequences of anti-TL1ACDRsas described in Tables A, B andC,with those of TableAmost preferred.More preferred IgG-scFv antigen binding proteins comprise the anti-TL1A variable domain sequences of Table D. Also preferred are IgG- scFv antigen binding proteins having the full antibody sequences of Table E.

[0110] This specification further relates to IgG-scFv molecules comprising an anti-TNF-α antigen binding entity, preferably comprising CDR sequences as described in Table G. Further preferred are IgG-scFv molecules comprising the sequences of anti-TNF-α variable domains as described in Table H. Further preferred are IgG-scFv molecules comprising the full amino acid sequences of anti-TNF-α antibodies as described in Table K. Table K: Preferred anti-TNF-α Antibodies Antibody designation Light chain SEQ ID NO Heavy chain SEQ ID NO iPS no. Adalimumab 46 48 104628 C234 78 80 330194 3.2 84 86 330237 certolizumab 88 90 333788

[0111] Eachof the aminoacid sequences inTableK is encodedby thenucleic acid sequence immediately preceding it in the Sequence Listing.

[0112] In certain embodiments, the heavy chain of the IgG portion is fused to the scFv portion via a peptide linker. In certain embodiments, the peptide linker comprises a sequence selected from the group consisting of (Gly3Ser)2, (Gly4Ser)2, (Gly3Ser)3, (Gly4Ser)3, (Gly3Ser)4, (Gly4Ser)4, (Gly3Ser)5, (Gly4Ser)5, (Gly3Ser)6, and (Gly4Ser)6.

[0113] Further preferredare IgG-scFvantigenbindingproteinshaving theheavyand light chain sequencesasdisclosed in Tables L and M. The heavy chain sequences in Tables L and M include the ScFv portion of the molecule fused to the heavy chain of the IgG portion of the molecule. In the molecule designation in the left column of these tables, the first antibody name identifies the IgG portion of the molecule, such that the IgG-scFv molecule comprises the full heavy and light chain sequences of the noted antibody. The second antibody name identifies the scFv portion of the molecule, such that the heavy chain sequence comprises the heavy chain variable domain and the light chain variable domain sequences as disclosed previously herein. Thus, "adalimumab IgG‑9C8 scFv" includes the light chain of adalimumab and the heavy chain of adalimumab fused to heavy chain variable domain and light chain variable domain of antibody 9C8. "CC" in the molecule designations in Tables L and M refers to a cysteine clamp; molecules that include CC in their designation have been modified to have an additional cysteine disulfide bond. Such cysteine substitutions are preferably introduced at the VL-VH interface,at positions44 in theVHand100 in theVL in theKabatnumberingscheme. "Var" inTableLmeansvariant. Table L: Preferred TL1A binding entity IgG- TNF binding entity scFv antigen binding proteins Molecule designation heavy chain SEQ ID NO light chain SEQ ID NO iPS 9C8 IgG-adalimumab scFv 355 447 370012 9C8 IgG‑3.2 scFv 357 447 370013 9C8 IgG-C234 scFv 359 318 370014 9C8 IgG-adalimumab scFv+CC 361 447 370015 9C8 IgG‑3.2 scFv+CC 363 447 370016 9C8 IgG-C234 scFv+CC 365 58 370017 23B3 VH4 IgG-adalimumab scFv 367 70 370018 23B3 VH4 IgG‑3.2 scFv 369 70 370019 23B3 VH4 IgG-C234 scFv 371 70 370020 23B3 VH4 IgG-adalimumab scFV+CC 373 70 370021 23B3 VH4 IgG‑3.2 scFv+CC 375 70 370022 23B3 VH4 IgG-C234 scFv+CC 377 70 370023 44 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Molecule designation heavy chain SEQ ID NO light chain SEQ ID NO iPS 3B3 var 2 IgG-adalimumab scFv 391 523 371218 3B3v2 IgG‑3.2 scFv 393 523 371219 3B3v2 IgG-C234 scFv 395 523 371220 3B3v2 IgG-adalimumab scFv+CC 397 523 371221 3B3v2 IgG‑3.2 scFv+CC 399 523 371222 3B3v2 IgG-C234 scFv+CC 401 523 371223 3B3 var IgG‑3.2 var scFv 403 523 381031 3B3 var IgG‑3.2 var scFv 405 523 381035 9C8 var IgG‑3.2 var scFv 407 447 381040 9C8 var IgG‑3.2 var scFv 409 447 381044 3B3 var IgG‑3.2 var scFv+CC 411 523 381048 3B3 var IgG‑3.2 var scFv+CC 413 523 381053 3B3 var IgG-C234 var scFv 415 523 381058 3B3 var IgG-C234 var scFv 417 523 381062 23B3 VH4 var IgG-adalimumab var scFv 419 70 381066 23B3 VH4 var IgG-adalimumab var scFv 421 70 381070 23B3 VH4 var IgG-adalimumab var scFv+CC 423 70 381074 23B3 VH4 var IgG-adalimumab var scFv+CC 425 70 381079

[0114] Each of the polypeptides in Table L is encoded by a nucleic acid having the nucleotide sequence immediately preceding the polypeptide sequence in the Sequence Listing. Table M: Preferred TNF-α binding entity IgG- TL1A binding entity scFv antigen binding proteins Molecule designation heavy chain SEQ ID NO light chain SEQ ID NO iPS Adalimumab IgG‑9C8 scFv 82 46 369989 Adalimumab IgG‑23B3 VH4 scFv 284 46 369990 Adalimumab IgG‑9C8 scFv+CC 286 46 369992 Adalimumab IgG‑9C8 var scFv+CC 441 453 381505 Adalimumab IgG‑23B3 VH4 scFv+CC 312 46 369993 3.2 IgG‑9C8 scFv 314 84 369995 3.2 IgG‑23B3 VH4 scFv 320 84 369996 3.2 IgG‑9C8 scFv+CC 322 84 369998 3.2 IgG‑23B3 VH4 scFv+CC 345 84 369999 C234 IgG‑9C8 scFv 347 78 370001 C234 IgG‑23B3 VH4 scFv 349 78 370002 C234 IgG‑9C8 scFv+CC 351 78 370004 C234 IgG 23B3 VH4 scFv+CC 353 78 370005 Adalimumab IgG‑3B3v2 scFv 379 46 371212 Adalimumab IgG‑3Bv2 scFv+CC 381 46 371213 3.2 IgG‑3B3v2 scFv 383 84 371214 45 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Molecule designation heavy chain SEQ ID NO light chain SEQ ID NO iPS 3.2 IgG‑3B3v2 scFv+CC 385 84 371215 C234 IgG‑3B3v2 scFv 387 78 371216 C234 IgG‑3B3v2 scFv+CC 389 78 371217 3.2 var IgG‑9C8 var scFv 427 449 381327 3.2 var IgG‑9C8 var scFv 429 449 381331 C234 var IgG‑9C8 var scFv 431 451 381485 C234 var IgG‑9C8 var scFv+CC 433 451 381489 C234 var IgG‑3B3 var scFv 435 451 381493 C234 var IgG‑3B3 var scFv+CC 437 451 381497 Adalimumab var IgG‑9C8 var scFv 439 453 381501 Adalimumab var IgG‑9C8 var scFv+CC 441 453 381505 Adalimumab var IgG‑3B3 var scFv 443 453 381509 Adalimumab var IgG‑3B3 var scFv+CC 445 453 381513

[0115] Each of the polypeptides in Table M is encoded by a nucleic acid having the nucleotide sequence immediately preceding the polypeptide sequence in the Sequence Listing. IgG-Fab bispecific antigen binding proteins

[0116] In the IgG-Fab format, the bispecific, multivalent antigen binding protein comprises (i) a first polypeptide comprising a first heavy chain (VH2-CH1-CH2-CH3) from a first antibody, wherein the first heavy chain is fused at its carboxyl terminus (optionally through a peptide linker) to a polypeptide comprising VH2-CH1 domains of a second antibody to form amodified heavy chain, (ii) a second polypeptide comprising a light chain from a first antibody (VL1-CL) and (iii) a third polypeptide comprising VL2-CL domains of the second antibody. The CL and CH1 domains of the first antibody may be switched ("swapped") in some embodiments between the first and second polypeptide. In such embodiments, the second polypeptide comprises VL1-CH1, while the first polypeptide comprises VH1-CL-CH2-CH3- VH2-CH1 with VH1-CL-CH2-CH3 fused at its C-terminus to VH2-CH1 optionally through a peptide linker. The third polypeptide comprises VL2-CL. Alternatively, the CL and CH1 domains of the second antibody may be switched in some embodiments between the first and third polypeptides. In such embodiments, the third polypeptide comprises VL2-CH1, while the first polypeptide comprisesVH1-CH1-CH2-CH3-VH2-CLwhereinVH1-CH1-CH2-CH1 is fusedat itsC-terminus toVH2-CLoptionally throughapeptide linker. The secondpolypeptide comprisesVL1-CL. In yet another embodiment, the CL and CH1 domains of both antibodies are switched between the first, second and third polypeptides. In such embodiments, the first polypeptide comprises VH1-CL-CH2-CH3-VH2-CL, with VH1-CL-CH2-CH3 optionally fused at its C-terminus to VH2-CL, the second polypeptide comprises VLl-CH1, and the third polypeptide comprises VL2-CH1. Within the scope of this invention are such IgG-Fabmolecules in which the first antibody comprises a TL1A binding entity and the second antibody comprises a TNF-α binding entity. Likewise, also within the scope of this invention are such IgG- Fab molecules in which the first antibody comprises a TNF-α binding entity and the second antibody comprises a TL1A bindingentity. Anexpressionhaving the samemeaningas the last twosentences is that the first antibody comprisesoneof a TL1A binding entity or a TNF-α binding entity and the second antibody comprises the other.

[0117] In one aspect of the IgG-Fab format within this invention, the bispecific, tetravalent antigen binding protein comprises a) a first heavy chain of a first antibody (VH1), wherein the first antibody specifically binds to a first antigen, and wherein thefirst heavychain is fused through itsC-terminus to theN-terminusofamoiety comprisingasecondheavychain of a second antibody (VH2), wherein the second antibody specifically binds to a second antigen; b) two light chains of the first antibody of a); and c) two light chains of the second antibody of a). Within this invention, the first antibody may specifically bind TL1A and the second may specifically bind TNF-α or vice-versa.

[0118] In another aspect of the IgG-Fab formatwithin this invention, the bispecific antigenbindingprotein comprises (i) a first binding domain that specifically binds to a first antigen comprising a first light chain immunoglobulin variable region (VL1)andafirst heavychain immunoglobulin variable region (VH1); (ii) a secondbindingdomain that specifically binds toa second antigen comprising a second light chain immunoglobulin variable region (VL2) and a second heavy chain immunoglobulin variable region (VH2); and (iii) a human immunoglobulin Fc region, wherein one of the binding domains 46 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 is positioned at the amino terminus of the Fc region and the other binding domain is positioned at the carboxyl terminus of the Fc region, wherein the carboxyl-terminal binding domain is a Fab and is fused through a peptide linker to the carboxyl terminus of the Fc region, andwherein the Fab is fused to the Fc region through the amino terminus of the VH region of the Fab. Within this invention, the first antigen may be TL1A and the second TNF-α or vice-versa.

[0119] In another aspect of the IgG-Fab format, the bispecific, tetravalent antigen binding protein comprises: a) a first polypeptide comprising a first heavy chain of a first antibody comprising a first heavy chain variable region (VH1) andafirstCH1domain,wherein the first antibody specifically binds to a first antigen, andwherein the first heavy chain is fused through its C-terminus to the N-terminus of a polypeptide comprising a second heavy chain variable regionof a secondantibody (VH2),wherein theVH2 is fused through itsC-terminus to theN-terminusof a secondCH1 domain, and wherein the second antibody specifically binds to a second antigen; wherein i) the VH1 or first CH1 domain comprises at least one amino acid substitution to introduce a charged (e.g., positively charged) amino acid at a residue selected from the group consisting of positions 39, 44, and 183 using EU numbering; and ii) the VH2 or second CH1 domain comprises at least one amino acid substitution to introduce a charged (preferably oppositely charged from that of i) above) amino acid at a residue selected from the group consisting of a residue that corresponds topositions39, 44, and183usingEUnumbering,wherein thecharge is theopposite of the substituted residue of the VH1 or first CH1 of the first heavy chain; and b) a second polypeptide comprising a first light chain of the first antibody of a), wherein the first light chain comprises a first light chain variable region (VL1) and a first CL region; and wherein the VL1 or first CL domain comprises at least one amino acid substitution to introduce a charged amino acid at a residue selected from the group consisting of positions 38, 100, and 176 using EU numbering, wherein the charge at position 38 is the opposite of the substituted residue of the VH1 or first CH1 of the first heavy chain at position 39; the charge at position 100 is the opposite of the substituted residue of the VH1 or first CH1 of the first heavy chain at position 44; the charge at position 176 is the opposite of the substituted residue of the VH1 or first CH1 of the first heavy chain at position 183; and c) a third polypeptide comprising a second light chain of the second antibody of a), wherein the second light chain comprises a second light chain variable region (VL2) and a second CL region; and wherein the VL2 or second CL domain comprises at least one amino acid substitution to introduce a charged amino acid at a residue selected from the group consisting of positions 38, 100, and 176 using EU numbering, wherein the charge at position 38 is the opposite of the substituted residue of the VH2 or second CH1 of the second heavy chain at position 39; the charge at position 100 is the opposite of the substituted residue of theVH2 or secondCH1of the second heavy chain at position 44; the charge at position 176 is the opposite of the substituted residue of theVH2or secondCH1of the secondheavy chain at position 183.

[0120] Within this invention, the first antigen in subparagraph a) abovemay be one of TL1A and TNF-α and the second antigen may be the other. Another way of stating this same binding specificity is to say that the first antibody in subparagraph a) comprises one of a TL1A binding entity or a TNF-α binding entity and the second antibody comprises the other.

[0121] In some embodiments of the bispecific antigen binding proteins of the invention in which the carboxyl-terminal binding domain is a Fab fragment, the binding domain positioned at the amino terminus of the Fc region (i.e., the amino- terminal binding domain) is also a Fab fragment. The amino-terminal Fab fragment can be fused to the amino terminus of the Fc region through a peptide linker or an immunoglobulin hinge region described herein. In some embodiments, the amino-terminal Fab fragment is joined to the amino terminus of the Fc region through a human IgG1 hinge region. In other embodiments, the amino-terminal Fab fragment is joined to the amino terminus of the Fc region through a human IgG2 hinge region. In oneembodiment, the amino-terminal Fab fragment is fused to theFc region through the carboxyl terminus of the CH1 region of the Fab.

[0122] In some embodiments, the bispecific antigen binding protein of the invention comprises a first antibody that specifically binds to a first target where one polypeptide chain (e.g. the heavy chain (VH2-CH1)) of a Fab fragment from a second antibody that specifically binds to a second target is fused to the carboxyl terminus of the heavy chain of the first antibody. The bispecific antigen binding protein in such embodiments also comprises a polypeptide chain containing the other half of the Fab fragment from the second antibody (e.g., the light chain (VL2-CL)). This format is referred to herein as the "IgG-Fab" format, and one embodiment of this type of molecule is shown schematically in Figure 25. Thus, in certain embodiments, the present invention includes a bispecific, multivalent antigen binding protein comprising: (i) a light chain from a first antibody, (ii) a heavy chain from the first antibody, wherein the heavy chain is fused at its carboxyl terminus through a peptide linker to a first polypeptide comprising VH-CH1 domains of a second antibody to form amodified heavy chain, and (iii) a second polypeptide comprising VL-CL domains of the second antibody. When dimerized, the bispecific 47 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 antigen binding protein is a homohexamer comprising twomodified heavy chains, two light chains from the first antibody, and two polypeptide chains containing the other half of the Fab fragment from the second antibody (the Fd fragment). In one embodiment, the first polypeptide, which is fused to the carboxyl terminus of the heavy chain, comprises VHandCH1 domains from the second antibody, and the second polypeptide comprises VL andCL domains from the second antibody.

[0123] In certain embodiments, the antigen binding proteins of the invention comprise (i) a first binding domain that specifically binds a first target antigen, (ii) a second binding domain that specifically binds to a second target antigen, and (iii) a human immunoglobulin Fc region, wherein one of the binding domains is positioned at the amino terminus of the Fc region and the other binding domain is positioned at the carboxyl terminus of the Fc region. In some such embodiments, each of the first and second binding domains comprises immunoglobulin variable regions. For instance, in certain embodiments, the first binding domain comprises a first light chain variable region (VL1) and a first heavy chain variable region (VH1) from an anti-first target antigen antibody and the second binding domain comprises a second light chain variable region (VL2) and a second heavy chain variable region (VH2) from an anti-second target antigen antibody.

[0124] In certain embodiments of the bispecific antigen binding proteins of the invention, the binding domain positioned at the amino terminus of the Fc region (i.e. the amino-terminal binding domain) is a Fab fragment fused to the amino terminus of the Fc region through a peptide linker described herein or through an immunoglobulin hinge region. An "immunoglobulin hinge region" refers to the amino acid sequence connecting the CH1 domain and the CH2 domain of an immunoglobulin heavychain. Thehinge regionof human IgG1 isgenerally definedas theaminoacid sequence fromabout Glu216 or about Cys226, to about Pro230. Hinge regions of other IgG isotypesmay be alignedwith the IgG1 sequence by placing the first and last cysteine residues forming inter-heavy chain disulfide bonds in the same positions and are determinable to those of skill in the art. In some embodiments, the amino-terminal binding domain is joined to the amino terminusof theFc region throughahuman IgG1hinge region. In otherembodiments, theamino-terminal bindingdomain is joined to the amino terminus of the Fc region through a human IgG2 hinge region. In one embodiment, the amino-terminal binding domain (e.g. Fab fragment) is fused to the Fc region through the carboxyl terminus of the CH1 region of the Fab.

[0125] In some embodiments of the antigen binding proteins of the invention, the binding domain positioned at the carboxyl terminus of theFc region (i.e. the carboxyl-terminal binding domain) is a Fab fragment. In suchembodiments, the Fab is fused or otherwise connected to the carboxyl terminus of the Fc region (e.g. the carboxyl terminus of the CH3 domain) through a peptide linker through the amino terminus of the VH region of the Fab fragment. Thus, in one embodiment, theFab is fused toanFc region through theamino terminusof theVH regionof theFabsuch that the resulting fusion protein comprises, fromN-terminus toC-terminus, aCH2domain, aCH3domain, a peptide linker, aVH region, and a CH1 region.

[0126] In certain embodiments, the first heavy chain of an antigen binding protein of the present invention is fused to the VH2 via a peptide linker. In certain embodiments, the peptide linker comprises a sequence selected from the group consisting of (Gly3Ser)2, (Gly4Ser)2, (Gly3Ser)3, (Gly4Ser)3, (Gly3Ser)4, (Gly4Ser)4, (Gly3Ser)5, (Gly4Ser)5, (Gly3Ser)6, and (Gly4Ser)6 These sequences can also be written as: GGGSGGGS (SEQ ID NO: 673), GGGGSGGGGS (SEQ ID NO: 695), GGGSGGGSGGGS (SEQ ID NO: 703), GGGGSGGGGSGGGGS (SEQ ID NO: 729), GGGSGGGSGGGSGGGS (SEQ ID NO: 735), GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 825), GGGSGGGSGGGSGGGSGGGS (SEQ ID NO: 937), GGGGSGGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 939), GGGSGGGSGGGSGGGSGGGSGGGS (SEQ ID NO: 941), and GGGGSGGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 945).

[0127] The peptide linker joining the Fc region to the carboxyl-terminal Fab can be any of the peptide linkers described herein. Inparticular embodiments, thepeptide linker joining theFc region to thecarboxyl-terminal Fab fragment is at least 5 amino acids in length. In other embodiments, the peptide linker joining theFc region to the carboxyl-terminal Fab fragment is at least 8 amino acids in length. Particularly suitable peptide linkers for joining the Fc region to the carboxyl-terminal Fab fragment are glycine-serine linkers, such as (GlyxSer)n wherein x=3 or 4 and n= 2, 3, 4, 5 or 6. In one embodiment, the peptide linker connecting the Fc region to the carboxyl-terminal Fab fragment is a L10 (G4S)2 linker. In another embodiment, the peptide linker connecting the Fc region to the carboxyl-terminal Fab fragment is a L9 or G3SG4S linker (GGGSGGGGS, SEQ ID NO: 946). Chain mutations

[0128] In particular embodiments, the bispecific antigen binding proteins described herein comprise a Fc region from a 48 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 human IgG1 antibody modified to remove effector functions. Such modified IgG1 Fc regions comprise substitutions R292C and V302C. In such embodiments, the Fc region may also comprise substitution N297G (known as a SEFL2 scaffold),

[0129] Preferred embodiments further include mutations in the heavy and light chains to aid in correct assembly of a hetero IgG bispecific antigen binding protein. An approach for promoting heterodimer formation to the exclusion of homodimer formation entails utilizing an electrostatic steeringmechanism (seeGunasekaran et al. (2010), J. Biol. Chem., Vol. 285: 19637‑19646, which is hereby incorporated by reference in its entirety). This approach involves introducing or exploiting charged residues in the CH3 domain in each heavy chain so that the two different heavy chains associate through opposite charges that cause electrostatic attraction. Homodimerization of the identical heavy chains are disfavored because the identical heavy chains have the same charge and therefore are repelled. This same electrostatic steering technique can be used to prevent mispairing of light chains with the non-cognate heavy chains by introducing residues having opposite charges in the correct light chain - heavy chain pair at the binding interface. The electrostatic steering technique and suitable charge pair mutations for promoting heterodimers and correct light chain-heavy chain pairing is described inWO2009 / 089004andWO2014 / 081955, both ofwhich are hereby incorporated by reference in their entireties.

[0130] In embodiments in which the bispecific antigen binding proteins of the invention are heterodimeric antibodies comprising a first light chain (LC1) and first heavy chain (HC1) from a first antibody that specifically binds to a first target antigen and a second light chain (LC2) and second heavy chain (HC2) from a second antibody that specifically binds to a second target,HC1orHC2maycomprise oneormoreaminoacid substitutions to replaceapositively-chargedaminoacid with a negatively-charged amino acid. For instance, in one embodiment, the CH3 domain of HC1 or the CH3 domain of HC2 comprises an amino acid sequence differing from a wild-type IgG amino acid sequence such that one or more positively-charged amino acids (e.g., lysine, histidine and arginine) in the wild-type human IgG amino acid sequence are replaced with one or more negatively-charged amino acids (e.g., aspartic acid and glutamic acid) at the corresponding position(s) in theCH3domain. In theseandotherembodiments, aminoacids (e.g. lysine) at oneormorepositionsselected from370, 392 and 409 (EUnumbering system) are replacedwith a negatively-charged amino acid (e.g., aspartic acid and glutamic acid). An amino acid substitution in an amino acid sequence is typically designated herein with a one-letter abbreviation for the amino acid residue in a particular position, followed by the numerical amino acid position relative to an original sequence of interest, which is then followed by the one-letter symbol for the amino acid residue substituted in. For example, "T30D" symbolizes a substitution of a threonine residue by an aspartate residue at amino acid position 30, relative to the original sequence of interest. Another example, "S218G" symbolizes a substitution of a serine residue by a glycine residue at amino acid position 218, relative to the original amino acid sequence of interest.

[0131] In certain embodiments, HC1 or HC2 of the heterodimeric antibodies may comprise one or more amino acid substitutions to replace a negatively-charged amino acid with a positively-charged amino acid. For instance, in one embodiment, the CH3 domain of HC1 or the CH3 domain of HC2 comprises an amino acid sequence differing from wild- type IgG amino acid sequence such that one or more negatively-charged amino acids in the wild-type human IgG amino acid sequence are replaced with one or more positively-charged amino acids at the corresponding position(s) in the CH3 domain. In these and other embodiments, amino acids (e.g., aspartic acid or glutamic acid) at one or more positions selected from356, 357, and 399 (EUnumbering system) of theCH3domain are replacedwith a positively-charged amino acid (e.g., lysine, histidine and arginine).

[0132] In particular embodiments, the heterodimeric antibody comprises a first heavy chain comprising negatively- charged amino acids at positions 392 and 409 (e.g., K392D and K409D substitutions), and a second heavy chain comprising positively-charged amino acids at positions 356 and 399 (e.g., E356K and D399K substitutions). In other particular embodiments, the heterodimeric antibody comprises a first heavy chain comprising negatively-charged amino acids at positions 392, 409, and 370 (e.g., K392D, K409D, and K370D substitutions), and a second heavy chain comprisingpositively-chargedaminoacidsat positions356, 399, and357 (e.g., E356K,D399K,andE357Ksubstitutions). In related embodiments, the first heavy chain is from an anti-first target antigen antibody and the second heavy chain is from an anti-second target antigen antibody.

[0133] To facilitate theassociation of a particular heavy chainwith its cognate light chain, both theheavy and light chains maycontain complementaryaminoacidsubstitutions.Asusedherein, "complementaryaminoacidsubstitutions" refer toa substitution to a positively-chargedaminoacid in one chain pairedwith a negatively-chargedaminoacid substitution in the other chain. For example, in some embodiments, the heavy chain comprises at least one amino acid substitution to introduce a charged amino acid and the corresponding light chain comprises at least one amino acid substitution to introduce a charged amino acid, wherein the charged amino acid introduced into the heavy chain has the opposite charge of the amino acid introduced into the light chain. In certain embodiments, one or more positively-charged residues (e.g., lysine, histidine or arginine) can be introduced into a first light chain (LC1) and one or more negatively-charged residues (e.g., aspartic acid or glutamic acid) can be introduced into the companion heavy chain (HC1) at the binding interface of LC1 / HC1,whereas oneormorenegatively-charged residues (e.g., aspartic acid or glutamic acid) can be introduced into a second light chain (LC2) andoneormorepositively-charged residues (e.g., lysine, histidine or arginine) can be introduced 49 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 into thecompanionheavychain (HC2)at thebinding interfaceofLC2 / HC2.Theelectrostatic interactionswill direct theLC1 to pair with HC1 and LC2 to pair with HC2, as the opposite charged residues (polarity) at the interface attract. The heavy / light chain pairs having the samecharged residues (polarity) at an interface (e.g. LC1 / HC2andLC2 / HC1)will repel, resulting in suppression of the unwanted HC / LC pairings.

[0134] In these and other embodiments, the CH1 domain of the heavy chain or the CL domain of the light chain comprises an amino acid sequence differing from a wild-type IgG amino acid sequence such that one or more positively- chargedaminoacids inawild-type IgGaminoacidsequence is replacedwithoneormorenegatively-chargedaminoacids. Alternatively, the CH1 domain of the heavy chain or the CL domain of the light chain comprises an amino acid sequence differing from a wild-type IgG amino acid sequence such that one or more negatively-charged amino acids in a wild-type IgG amino acid sequence is replaced with one or more positively-charged amino acids. In some embodiments, one or more aminoacids in theCH1domain of the first and / or secondheavy chain in theheterodimeric antibody at anEUposition selected fromF126,P127,L128,A141, L145,K147,D148,H168,F170,P171,V173,Q175,S176,S183,V185andK213 is replaced with a charged amino acid. In certain embodiments, a heavy chain residue for substitution with a negatively‑ or positively-charged amino acid is S183 (EU numbering system). In some embodiments, S183 is substituted with a positively-charged amino acid. In alternative embodiments, S183 is substitutedwith a negatively-chargedamino acid. For instance, in one embodiment, S183 is substituted with a negatively-charged amino acid (e.g. S183E) in the first heavy chain, and S183 is substituted with a positively-charged amino acid (e.g. S183K) in the second heavy chain.

[0135] Inembodiments inwhich the light chain isakappa light chain, oneormoreaminoacids in theCLdomainof thefirst and / or second light chain in the heterodimeric antibody at a position (EU numbering in a kappa light chain) selected from F116,F118,S121,D122,E123,Q124,S131,V133, L135,N137,N138,Q160,S162,T164,S174andS176 is replacedwith a charged amino acid. In embodiments in which the light chain is a lambda light chain, one or more amino acids in the CL domain of the first and / or second light chain in the heterodimeric antibody at a position (EU numbering in a lambda chain) selected from T116, F118, S121, E123, E124, K129, T131, V133, L135, S137, E160, T162, S165, Q167, A174, S176 and Y178 is replaced with a charged amino acid. In some embodiments, a residue for substitution with a negatively- or positively- chargedamino acid is S176 (EUnumbering system) of theCLdomain of either a kappa or lambda light chain. In certain embodiments, S176 of the CL domain is replaced with a positively-charged amino acid. In alternative embodi- ments, S176 of the CL domain is replaced with a negatively-charged amino acid. In one embodiment, S176 is substituted with a positively-charged amino acid (e.g. S176K) in the first light chain, andS176 is substitutedwith a negatively-charged amino acid (e.g. S176E) in the second light chain.

[0136] In addition to or as an alternative to the complementary amino acid substitutions in theCH1 andCL domains, the variable regions of the light and heavy chains in the heterodimeric antibody may contain one or more complementary amino acid substitutions to introduce charged amino acids. For instance, in some embodiments, the VH region of the heavychainor theVL regionof the light chainofaheterodimeric antibodycomprisesanaminoacidsequencediffering from wild-type IgG amino acid sequence such that one or more positively-charged amino acids in wild-type IgG amino acid sequence is replacedwith one ormore negatively-charged amino acids. Alternatively, the VH region of the heavy chain or theVL regionof the light chaincomprisesanaminoacidsequencediffering fromawild-type IgGaminoacidsequencesuch that one or more negatively-charged amino acids in a wild-type IgG amino acid sequence is replaced with one or more positively-charged amino acids.

[0137] Vregion interface residues (i.e., amino acid residues thatmediate assembly of the VHandVL regions) within the VH region include EU positions 1, 3, 35, 37, 39, 43, 44, 45, 46, 47, 50, 59, 89, 91, and 93. One or more of these interface residues in the VH region can be substituted with a charged (positively‑ or negatively-charged) amino acid. In certain embodiments, the amino acid at EU position 39 in the VH region of the first and / or second heavy chain is substituted for a positively-chargedaminoacid, e.g., lysine. Inalternativeembodiments, theaminoacidatEUposition39 in theVHregionof the first and / or second heavy chain is substituted for a negatively-charged amino acid, e.g., glutamic acid. In some embodiments, the amino acid at EU position 39 in the VH region of the first heavy chain is substituted for a negatively- charged amino acid (e.g., G39E), and the amino acid at EU position 39 in the VH region of the second heavy chain is substituted for a positively-chargedaminoacid (e.g.,G39K). In someembodiments, theaminoacid atEUposition44 in the VH region of the first and / or second heavy chain is substituted for a positively-charged amino acid; for example, lysine. In alternative embodiments, the amino acid at EU position 44 in the VH region of the first and / or second heavy chain is substituted for a negatively-chargedamino acid; for example, glutamic acid. In certain embodiments, the aminoacid at EU position 44 in theVH region of the first heavy chain is substituted for a negatively-chargedaminoacid (e.g.,G44E), and the amino acid at EU position 44 in the VH region of the second heavy chain is substituted for a positively-charged amino acid (e.g., G44K).

[0138] Vregion interface residues (i.e., amino acid residues thatmediate assembly of the VHandVL regions) within the VL region includeEUpositions 32, 34, 35, 36, 38, 41, 42, 43, 44, 45, 46, 48, 49, 50, 51, 53, 54, 55, 56, 57, 58, 85, 87, 89, 90, 91, and 100. One or more interface residues in the VL region can be substituted with a charged amino acid, preferably an amino acid that has an opposite charge to those introduced into the VH region of the cognate heavy chain. In some embodiments, the amino acid at EU position 100 in the VL region of the first and / or second light chain is substituted for a 50 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 positively-chargedaminoacid; for example, lysine. Inalternativeembodiments, theaminoacidatEUposition100 in theVL regionof thefirst and / or second light chain is substituted for anegative-chargedaminoacid; for example,sglutamicacid. In certain embodiments, the aminoacid atEUposition 100 in theVL regionof the first light chain is substituted for a positively- charged amino acid (e.g. G100K), and the amino acid at EU position 100 in the VL region of the second light chain is substituted for a negatively-charged amino acid (e.g. G100E).

[0139] In certain embodiments, a heterodimeric antibody of the invention comprises a first heavy chain and a second heavy chain and a first light chain and a second light chain, wherein the first heavy chain comprises amino acid substitutions at positions 44 (EU), 183 (EU), 392 (EU) and 409 (EU), wherein the second heavy chain comprises amino acid substitutions at positions 44 (EU), 183 (EU), 356 (EU) and 399 (EU), wherein the first and second light chains comprise an amino acid substitution at positions 100 (EU) and 176 (EU), and wherein the amino acid substitutions introduce a charged amino acid at the positions. In related embodiments, the glycine at position 44 (EU) of the first heavy chain is replaced with glutamic acid, the glycine at position 44 (EU) of the second heavy chain is replaced with lysine, the glycine at position 100 (EU) of the first light chain is replacedwith lysine, the glycine at position 100 (EU) of the second light chain is replacedwith glutamic acid, the serine at position 176 (EU) of the first light chain is replacedwith lysine, the serine at position176 (EU)of the second light chain is replacedwithglutamicacid, the serineat position183 (EU)of the first heavy chain is replacedwithglutamicacid, the lysineat position392 (EU)of thefirst heavychain is replacedwithaspartic acid, the lysine at position 409 (EU) of the first heavy chain is replaced with aspartic acid, the serine at position 183 (EU) of the second heavy chain is replaced with lysine, the glutamic acid at position 356 (EU) of the second heavy chain is replaced with lysine, and / or the aspartic acid at position 399 (EU) of the second heavy chain is replaced with lysine.

[0140] In other embodiments, a heterodimeric antibody of the invention comprises a first heavy chain and a second heavy chain and a first light chain and a second light chain, wherein the first heavy chain comprises amino acid substitutions at positions 183 (EU), 392 (EU) and 409 (EU), wherein the second heavy chain comprises amino acid substitutions at positions 183 (EU), 356 (EU) and 399 (EU), wherein the first and second light chains comprise an amino acid substitution at position 176 (EU), and wherein the amino acid substitutions introduce a charged amino acid at the positions. In relatedembodiments, the serineat position 176 (EU)of the first light chain is replacedwith lysine, the serineat position 176 (EU) of the second light chain is replaced with glutamic acid, the serine at position 183 (EU) of the first heavy chain is replacedwithglutamicacid, the lysineat position392 (EU)of thefirst heavychain is replacedwithaspartic acid, the lysine at position 409 (EU) of the first heavy chain is replaced with aspartic acid, the serine at position 183 (EU) of the second heavy chain is replaced with lysine, the glutamic acid at position 356 (EU) of the second heavy chain is replaced with lysine, and / or the aspartic acid at position 399 (EU) of the second heavy chain is replaced with lysine.

[0141] In still other embodiments, a heterodimeric antibody of the invention comprises a first heavy chain and a second heavy chain and a first light chain and a second light chain, wherein the first heavy chain comprises amino acid substitutions at positions 183 (EU), 392 (EU), 409 (EU), and 370 (EU), wherein the second heavy chain comprises aminoacid substitutions at positions 183 (EU), 356 (EU), 399 (EU), and 357 (EU), wherein the first and second light chains comprise an amino acid substitution at position 176 (EU), and wherein the amino acid substitutions introduce a charged amino acid at the positions. In related embodiments, the serine at position 176 (EU) of the first light chain is replaced with lysine, the serine at position 176 (EU) of the second light chain is replaced with glutamic acid, the serine at position 183 (EU)of the first heavy chain is replacedwithglutamicacid, the lysineat position392 (EU)of the first heavychain is replaced with aspartic acid, the lysine at position 409 (EU) of the first heavy chain is replacedwith aspartic acid, the lysine at position 370 (EU) of the first heavy chain is replacedwith aspartic acid, the serine at position 183 (EU) of the second heavy chain is replaced with lysine, the glutamic acid at position 356 (EU) of the second heavy chain is replaced with lysine, the aspartic acid at position 399 (EU) of the second heavy chain is replacedwith lysine, and / or the glutamic acid at position 357 (EU) of the second heavy chain is replaced with lysine.

[0142] Anyof theconstant domainscanbemodified to containoneormoreof thechargepairmutationsdescribedabove to facilitate correct assembly of a heterodimeric antibody.

[0143] The inventive heterodimeric antibodies also encompass antibodies comprising the heavy chain(s) and / or light chain(s), where one, two, three, four or five amino acid residues are lacking from the N-terminus or C-terminus, or both, in relation to any one of the heavy and light chains, e.g., due to post-translationalmodifications resulting from the type of host cell in which the antibodies are expressed. For instance, Chinese Hamster Ovary (CHO) cells frequently cleave off a C- terminal lysine from antibody heavy chains.

[0144] Chargepairmutationsor complementary aminoacid substitutionsasdescribedherein canbe introduced into the Fab regions of the first antibody (Fab 1) or second antibody (Fab 2) to promote correct heavy chain-light chain pairing. For instance, in some embodiments, the amino acid at EU position 38 of the VL domain in Fab 1 is replaced with a negatively- charged amino acid (e.g. glutamic acid) and the amino acid at EU position 39 of the VH domain in Fab 1 is replaced with a positively-chargedaminoacid (e.g. lysine). Inotherembodiments, theaminoacidatEUposition38of theVLdomain inFab 1 is replaced with a positively-charged amino acid (e.g. lysine) and the amino acid at EU position 39 of the VH domain in Fab 1 is replacedwith a negatively-charged amino acid (e.g. glutamic acid). In certain embodiments, the amino acid at EU position 38 of the VL domain in Fab 2 is replaced with a negatively-charged amino acid (e.g. glutamic acid) and the amino 51 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 acid at EU position 39 of the VH domain in Fab 2 is replaced with a positively-charged amino acid (e.g. lysine). In other embodiments, the amino acid at EUposition 38 of theVL domain in Fab 2 is replacedwith a positively-charged amino acid (e.g. lysine) and the amino acid at EU position 39 of the VH domain in Fab 2 is replaced with a negatively-charged amino acid (e.g. glutamic acid).

[0145] In embodiments in which the VH-CH1 region (i.e. Fd fragment) from the second antibody is fused to the heavy chain of the first antibody, the heavy chain from the first antibody comprises a S183E mutation (EU numbering), the light chain from the first antibody comprises a S176K mutation (EU numbering), the light chain from the second antibody comprises a S176E mutation (EU numbering), and the Fd region from the second antibody (which is fused to the C- terminus of the heavy chain from the first antibody) comprises a S183Kmutation (EU numbering). In other embodiments, the heavy chain from the first antibody comprises a G44E mutation (EU) and S183E mutation (EU numbering), the light chain from the first antibody comprises aG100Kmutation (EU) and S176Kmutation (EU numbering), the light chain from the second antibody comprises aG100Emutation (EU) and S176Emutation (EU numbering), and the Fd region from the second antibody (which is fused to the C-terminus of the heavy chain from the first antibody) comprises a G44Kmutation (EU) andS183Kmutation (EUnumbering). The charges in the foregoing examplesmaybe reversed so long as the charge on the corresponding light or heavy chain is also reversed so that the correct heavy / light chain pairs have opposite charges.

[0146] In one embodiment, the present invention is directed to a bispecific, tetravalent antigen binding protein, comprising: a) a first polypeptide comprising a first heavy chain of a first antibody comprising a first heavy chain variable region (VH1) andafirstCH1domain,wherein the first antibody specifically binds to a first antigen, andwherein the first heavy chain is fused through its C-terminus to the N-terminus of a polypeptide comprising a second heavy chain variable regionof a secondantibody (VH2),wherein theVH2 is fused through itsC-terminus to theN-terminusof a secondCH1 domain, and wherein the second antibody specifically binds to a second antigen; wherein i) the VH1 or first CH1 domain comprises at least one amino acid substitution to introduce a charged (e.g., positively charged) amino acid at a residue selected from the group consisting of positions 39, 44, and 183 using EU numbering; and ii) the VH2 or second CH1 domain comprises at least one amino acid substitution to introduce an oppositely charged (e.g., negatively charged) amino acid at a residue selected from the group consisting of a residue that corresponds to positions 39, 44, and 183 using EU numbering; and b) a second polypeptide comprising a first light chain of the first antibody of a), wherein the first light chain comprises a first light chain variable region (VL1) and a first CL region; and wherein the VL1 or first CL domain comprises at least one amino acid substitution to introduce a negatively charged amino acid at a residue selected from the group consisting of positions 38, 100, and 176 using EU numbering; and c) a third polypeptide comprising a second light chain of the second antibody of a), wherein the second light chain comprises a second light chain variable region (VL2) and a secondCL region;. andwherein theVL1or first CLdomain comprises at least one amino acid substitution to introduce a positively charged amino acid at a residue selected from the group consisting of positions 38, 100, and 176 using EU numbering.

[0147] Within this invention, the first antigen in subparagraph a) abovemay be one of TL1A and TNF-α and the second antigen may be the other. Another way of stating this same binding specificity is to say that the first antibody in subparagraph a) comprises one of a TL1A binding entity or a TNF-α binding entity and the second antibody comprises the other.

[0148] "Corresponds to" as it pertains to the VH2 and second CH1 domain means that the amino acid residues of the VH2 and second CH1 domain are counted from the C-terminus of the first heavy chain if there is no linker. If there is a peptide linker, the aminoacid residuesof theVH2andsecondCH1domain are counted from theC-terminus of the peptide linker. In neither caseare theamino acid residues counted from theN-terminus of the first heavy chain. Rather, for theVH2 and second CH1 domain, counting begins at the first amino acid residue of the VH2 domain. The counting of amino acid residues is performed using the EU or AHo convention.

[0149] In certain embodiments: a) theVH1or first CH1domain comprises amutation selected from the group consisting of Q39K, G44K, and S183K using EU numbering; b) the VH2 or second CH1 domain comprises amutation selected from the group consisting of Q39E,G44E, andS183E using EUnumbering; c) the VL1 or first CL domain comprises amutation selected from thegroupconsistingofQ38E,G100E,andS176EusingEUnumbering; andd) theVL2or secondCLdomain comprises a mutation selected from the group consisting of Q38K, G100K, and S176K using EU numbering.

[0150] In certain embodiments: a) the VH1 comprises a Q39K mutation and the first CH1 domain comprises a S183K mutation using EU numbering; b) the VH2 comprises a Q39E mutation and the second CH1 domain comprises a S183E 52 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 mutationusingEUnumbering; c) theVL1comprisesaQ38Emutationand thefirstCLdomaincomprisesaS176Emutation usingEUnumbering; and d) theVL2 comprises aQ38Kmutation and the secondCLdomain comprises aS176Kmutation using EU numbering.

[0151] In certain embodiments: a) the first CH1 domain comprisesG44K andS183Kmutations using EUnumbering; b) the second CH1 domain comprises G44E and S183E mutations using EU numbering; c) the first CL domain comprises G100EandS176EmutationsusingEUnumbering; andd) the secondCLdomain comprisesG100KandS176Kmutations using EU numbering.

[0152] In one embodiment the present invention is directed to a bispecific, tetravalent antigen binding protein, comprising: a) a first polypeptide comprising a first heavy chain of a first antibody comprising a first heavy chain variable region (VH1) andafirstCH1domain,wherein the first antibody specifically binds to a first antigen, andwherein the first heavy chain is fused through its C-terminus to the N-terminus of a polypeptide comprising a second heavy chain variable regionof a secondantibody (VH2),wherein theVH2 is fused through itsC-terminus to theN-terminusof a secondCH1 domain, and wherein the second antibody specifically binds to a second antigen; wherein i) the VH1 or first CH1 domain comprises at least one amino acid substitution to introduce a negatively charged amino acid at a residue selected from the group consisting of positions 39, 44, and 183 using EU numbering; and ii) theVH2or secondCH1domain comprisesat least oneaminoacid substitution to introduceapositively charged amino acid at a residue selected from the group consisting of a residue that corresponds to positions 39, 44, and 183 using EU numbering; and b) a second polypeptide comprising a first light chain of the first antibody of a), wherein the first light chain comprises a first light chain variable region (VL1) and a first CL region; and wherein the VL1 or first CL domain comprises at least one amino acid substitution to introduce a positively charged amino acid at a residue selected from the group consisting of positions 38, 100, and 176 using EU numbering; and c) a third polypeptide comprising a second light chain of the second antibody of a), wherein the second light chain comprises a second light chain variable region (VL2) and a secondCL region;. andwherein theVL1or first CLdomain comprisesat least oneaminoacid substitution to introduceanegatively chargedaminoacidat a residueselected from the group consisting of positions 38, 100, and 176 using EU numbering.

[0153] Within this invention, the first antigen in subparagraph a) abovemay be one of TL1A and TNF-α and the second antigen may be the other. Another way of stating this same binding specificity is to say that the first antibody in subparagraph a) comprises one of a TL1A binding entity or a TNF-α binding entity and the second antibody comprises the other.

[0154] In certain embodiments: a) theVH1or first CH1domain comprises amutation selected from the group consisting of Q39E, G44E, and S183E using EU numbering; b) the VH2 or second CH1 domain comprises amutation selected from the group consisting of Q39K,G44K, andS183K using EUnumbering; c) the VL1 or first CL domain comprises amutation selected from thegroupconsistingofQ38K,G100K,andS176KusingEUnumbering; andd) theVL2or secondCLdomain comprises a mutation selected from the group consisting of Q38E, G100E, and S176E using EU numbering.

[0155] In certainembodiments: a) thefirstCH1domaincomprisesaS183EmutationusingEUnumbering; b) thesecond CH1 domain comprises a S183Kmutation using EUnumbering; c) the first CL domain comprises a S176Kmutation using EU numbering; and d) the second CL domain comprises a S176E mutation using EU numbering.

[0156] In certain embodiments: a) the VH1 comprises a Q39E mutation and the first CH1 domain comprises a S183E mutation using EU numbering; b) the VH2 comprises a Q39K mutation and the second CH1 domain comprises a S183K mutationusingEUnumbering; c) theVL1comprisesaQ38Kmutationand thefirstCLdomaincomprisesaS176Kmutation usingEUnumbering; and d) theVL2 comprises aQ38Emutation and the secondCLdomain comprises aS176Emutation using EU numbering.

[0157] In certain embodiments: a) the first CH1 domain comprisesG44E andS183Emutations using EUnumbering; b) the second CH1 domain comprises G44K and S183K mutations using EU numbering; c) the first CL domain comprises G100KandS176KmutationsusingEUnumbering; andd) the secondCLdomain comprisesG100EandS176Emutations using EU numbering.

[0158] In one embodiment the present invention is directed to a bispecific, tetravalent antigen binding protein, comprising: a) a first polypeptide comprising a first heavy chain of a first antibody comprising a first heavy chain variable region (VH1) andafirstCH1domain,wherein the first antibody specifically binds to a first antigen, andwherein the first heavy chain is fused through its C-terminus to the N-terminus of a polypeptide comprising a second heavy chain variable 53 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 regionof a secondantibody (VH2),wherein theVH2 is fused through itsC-terminus to theN-terminusof a secondCH1 domain, and wherein the second antibody specifically binds to a second antigen; wherein i) theVH1or firstCH1domain comprises at least one aminoacid substitution to introduce a chargedaminoacid at a residue selected from the group consisting of positions 39, 44, and 183 using EU numbering; and ii) the VH2 or second CH1 domain comprises at least one amino acid substitution to introduce a charged amino acid at a residue selected from the group consisting of a residue that corresponds to positions 39, 44, and 183 using EU numbering, wherein the charge is the opposite of the substituted residue of the VH1 or first CH1 of the first heavy chain; and b) a second polypeptide comprising a first light chain of the first antibody of a), wherein the first light chain comprises a first light chain variable region (VL1) and a first CL region; and wherein the VL1 or first CL domain comprises at least one amino acid substitution to introduce a charged amino acid at a residue selected from the group consisting of positions 38, 100, and 176 using EU numbering, wherein the charge at position 38 is the opposite of the substituted residue of the VH1 or first CH1 of the first heavy chain at position39; the chargeat position100 is theopposite of the substituted residueof theVH1or firstCH1of thefirst heavy chain at position 44; the charge at position 176 is the opposite of the substituted residue of the VH1 or first CH1 of the first heavy chain at position 183; and c) a third polypeptide comprising a second light chain of the second antibody of a), wherein the second light chain comprises a second light chain variable region (VL2) and a second CL region; and wherein the VL2 or second CL domain comprises at least one amino acid substitution to introduce a charged amino acid at a residue selected from the group consisting of positions 38, 100, and 176 using EU numbering, wherein thechargeat position38 is theoppositeof thesubstituted residueof theVH2or secondCH1of thesecondheavychain at position 39; the charge at position 100 is the opposite of the substituted residue of the VH2 or second CH1 of the second heavy chain at position 44; the charge at position 176 is the opposite of the substituted residue of the VH2 or second CH1 of the second heavy chain at position 183.

[0159] Within this invention, the first antigen in subparagraph a) abovemay be one of TL1A and TNF-α and the second antigen may be the other. Another way of stating this same binding specificity is to say that the first antibody in subparagraph a) comprises one of a TL1A binding entity or a TNF-α binding entity and the second antibody comprises the other.

[0160] In certain embodiments: a) the VH1 comprises a Q39E mutation and the first CH1 domain comprises a S183K mutation using EU numbering; b) the VH2 comprises a Q39K mutation and the second CH1 domain comprises a S183E mutationusingEUnumbering; c) theVL1comprisesaQ38Kmutationand thefirstCLdomaincomprisesaS176Emutation usingEUnumbering; and d) theVL2 comprises aQ38Emutation and the secondCLdomain comprises aS176Kmutation using EU numbering.

[0161] In certain embodiments: a) the first CH1 domain comprisesG44E andS183Kmutations using EUnumbering; b) the second CH1 domain comprises G44K and S183E mutations using EU numbering; c) the first CL domain comprises G100KandS176EmutationsusingEUnumbering; andd) the secondCLdomaincomprisesG100EandS176Kmutations using EU numbering.

[0162] In certain embodiments: a) the VH1 comprises a Q39K mutation and the first CH1 domain comprises a S183E mutation using EU numbering; b) the VH2 comprises a Q39E mutation and the second CH1 domain comprises a S183K mutationusingEUnumbering; c) theVL1comprisesaQ38Emutationand thefirstCLdomaincomprisesaS176Kmutation usingEUnumbering; and d) theVL2 comprises aQ38Kmutation and the secondCLdomain comprises aS176Emutation using EU numbering.

[0163] In certain embodiments: a) the first CH1 domain comprisesG44K andS183Emutations using EUnumbering; b) the second CH1 domain comprises G44E and S183K mutations using EU numbering; c) the first CL domain comprises G100EandS176KmutationsusingEUnumbering; andd) the secondCLdomain comprisesG100KandS176Emutations using EU numbering.

[0164] In one embodiment the present invention is directed to a method for preparing a bispecific, tetravalent antigen binding protein, comprising: 1) co-expressing in a host cell; a) a first polynucleotidewherein the first polynucleotide encodes a first polypeptide comprising a first heavy chain of a first antibody comprising a first heavy chain variable region (VH1) and a first CH1 domain, wherein the first antibodyspecificallybinds toafirst antigen, andwherein thefirst heavychain is fused through itsC-terminus to the N-terminus of a polypeptide comprising a second heavy chain variable region of a second antibody (VH2), 54 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 wherein the VH2 is fused through its C-terminus to the N-terminus of a second CH1 domain, and wherein the second antibody specifically binds to a second antigen; wherein i) theVH1or firstCH1domaincomprisesat least oneaminoacid substitution to introduceapositively charged amino acid at a residue selected from the group consisting of positions 39, 44, and 183 using EU numbering; and ii) the VH2 or second CH1 domain comprises at least one amino acid substitution to introduce a negatively chargedaminoacid at a residue selected from thegroup consisting of a residue that corresponds to positions 39, 44, and 183 using EU numbering; and b) a second polynucleotide wherein the second polynucleotide encodes a second polypeptide comprising a light chain of the first antibody of a), wherein the light chain comprises a first light chain variable region (VL1) and a first CL region; and wherein the VL1 or first CL domain comprises at least one amino acid substitution to introduce a negatively chargedaminoacid at a residue selected from thegroup consisting of positions 38, 100, and176using EU numbering; c) a third polynucleotide wherein the third polycucleotide encodes a third polypeptide comprising a light chain of the second antibody of a), wherein the light chain comprises a second light chain variable region (VL2) and a second CL region;. and wherein the VL1 or first CL domain comprises at least one amino acid substitution to introduceapositively chargedaminoacidat a residueselected from thegroupconsistingof positions38, 100, and 176 using EU numbering; 2) cultivating the host cell under conditions such that the polypeptides are produced; and 3) recovering from the host cell the antigen binding protein.

[0165] Within this invention, the first antigen in subparagraph a) abovemay be one of TL1A and TNF-α and the second antigen may be the other. Another way of stating this same binding specificity is to say that the first antibody in subparagraph a) comprises one of a TL1A binding entity or a TNF-α binding entity and the second antibody comprises the other.

[0166] In one embodiment the present invention is directed to a method for preparing a bispecific, tetravalent antigen binding protein, comprising: 1) co-expressing in a host cell: a) a first polynucleotidewherein the first polynucleotide encodes a first polypeptide comprising a first heavy chain of a first antibody comprising a first heavy chain variable region (VH1) and a first CH1 domain, wherein the first antibodyspecificallybinds toafirst antigen, andwherein thefirst heavychain is fused through itsC-terminus to the N-terminus of a polypeptide comprising a second heavy chain variable region of a second antibody (VH2), wherein the VH2 is fused through its C-terminus to the N-terminus of a second CH1 domain, and wherein the second antibody specifically binds to a second antigen; wherein i) the VH1 or first CH1 domain comprises at least one amino acid substitution to introduce a negatively charged amino acid at a residue selected from the group consisting of positions 39, 44, and 183 using EU numbering; and ii) the VH2 or second CH1 domain comprises at least one amino acid substitution to introduce a positively chargedaminoacid at a residue selected from thegroup consisting of a residue that corresponds to positions 39, 44, and 183 using EU numbering; and b) a second polynucleotide wherein the second polynucleotide encodes a second polypeptide comprising a first light chain of the first antibody of a), wherein the first light chain comprises a first light chain variable region (VL1) and a first CL region; and wherein the VL1 or first CL domain comprises at least one amino acid substitution to introduceapositively chargedaminoacidat a residueselected from thegroupconsistingof positions38, 100, and 176 using EU numbering; and c) a third polynucleotide wherein the third polynucleotide encodes a third polypeptide comprising a second light chain of the second antibody of a), wherein the second light chain comprises a second light chain variable region (VL2) and a second CL region;. and wherein the VL1 or first CL domain comprises at least one amino acid substitution to introduce a negatively charged amino acid at a residue selected from the group consisting of positions 38, 100, and 176 using EU numbering; 55 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 2) cultivating the host cell under conditions such that the polypeptides are produced; and 3) recovering from the host cell the antigen binding protein.

[0167] Within this invention, the first antigen in subparagraph a) abovemay be one of TL1A and TNF-α and the second antigen may be the other. Another way of stating this same binding specificity is to say that the first antibody in subparagraph a) comprises one of a TL1A binding entity or a TNF-α binding entity and the second antibody comprises the other.

[0168] In one embodiment the present invention is directed to a method for preparing a bispecific, tetravalent antigen binding protein, comprising: 1) co-expressing in a host cell: a) a first polynucleotidewherein the first polynucleotide encodes a first polypeptide comprising a first heavy chain of a first antibody comprising a first heavy chain variable region (VH1) and a first CH1 domain, wherein the first antibodyspecificallybinds toafirst antigen, andwherein thefirst heavychain is fused through itsC-terminus to the N-terminus of a polypeptide comprising a second heavy chain variable region of a second antibody (VH2), wherein the VH2 is fused through its C-terminus to the N-terminus of a second CH1 domain, and wherein the second antibody specifically binds to a second antigen; wherein i) the VH1 or first CH1 domain comprises at least one amino acid substitution to introduce a charged amino acid at a residue selected from the group consisting of positions 39, 44, and 183 using EU numbering; and ii) the VH2 or second CH1 domain comprises at least one amino acid substitution to introduce a charged amino acid at a residue selected from the group consisting of a residue that corresponds to positions 39, 44, and 183 using EUnumbering, wherein the charge is the opposite of the substituted residue of the VH1or first CH1 of the first heavy chain; and b) a second polynucleotide wherein the second polynucleotide encodes a second polypeptide comprising a light chain of the first antibody of a), wherein the light chain comprises a first light chain variable region (VL1) and a first CL region; and wherein the VL1 or first CL domain comprises at least one amino acid substitution to introduce a charged amino acid at a residue selected from the group consisting of positions 38, 100, and 176 using EU numbering, wherein the chargeat position 38 is the opposite of the substituted residueof theVH1or firstCH1of the first heavy chain at position 39; the charge at position 100 is the opposite of the substituted residue of the VH1 or first CH1 of the first heavy chain at position 44; the charge at position 176 is the opposite of the substituted residue of the VH1 or first CH1 of the first heavy chain at position 183; and c) a third polynucleotide wherein the third polynucleotide encodes a third polypeptide comprising a light chain of the second antibody of a), wherein the light chain comprises a second light chain variable region (VL2) and a second CL region; and wherein the VL1 or first CL domain comprises at least one amino acid substitution to introduceapositively chargedaminoacidat a residueselected from thegroupconsistingof positions38, 100, and 176 using EU numbering, wherein the charge at position 38 is the opposite of the substituted residue of theVH2 or secondCH1of the second heavy chain at position 39; the chargeat position 100 is theopposite of the substituted residueof theVH2or secondCH1 of the secondheavychainat position44; the chargeat position176 is theopposite of the substituted residueof the VH2 or second CH1 of the second heavy chain at position 183; 2) cultivating the host cell under conditions such that the polypeptides are produced; and 3) recovering from the host cell the antigen binding protein.

[0169] Within this invention, the first antigen in subparagraph a) abovemay be one of TL1A and TNF-α and the second antigen may be the other. Another way of stating this same binding specificity is to say that the first antibody in subparagraph a) comprises one of a TL1A binding entity or a TNF-α binding entity and the second antibody comprises the other.

[0170] Additionally or alternatively, correct heavy-light chain pairing may be facilitated by swapping the CH1 and CL domains in the carboxyl-terminal Fab binding domain. By way of example, the first polypeptide, which is fused to the carboxyl terminus of the heavy chain, may comprise a VL domain and CH1 domain from the second antibody, and the secondpolypeptidemaycompriseaVHdomainandCLdomain from thesecondantibody. Inanother embodiment, thefirst polypeptide, which is fused to the carboxyl terminus of the heavy chain,may comprise aVHdomain and aCLdomain from the second antibody, and the second polypeptidemay comprise a VL domain andCH1 domain from the second antibody. 56 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55

[0171] The heavy chain constant regions or the Fc regions of the bispecific antigen binding proteins described herein may comprise one or more amino acid substitutions that affect the glycosylation and / or effector function of the antigen binding protein.One of the functions of theFc region of an immunoglobulin is to communicate to the immune systemwhen the immunoglobulin binds its target. This is commonly referred to as "effector function." Communication leads to antibody- dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), and / or complement depen- dent cytotoxicity (CDC).ADCCandADCParemediated through thebindingof theFc region toFc receptors on the surface of cells of the immunesystem.CDC ismediated through thebindingof theFcwithproteinsof the complement system,e.g., C1q. In some embodiments, the bispecific antigen binding proteins of the invention comprise one or more amino acid substitutions in the constant region to enhance effector function, including ADCC activity, CDC activity, ADCP activity, and / or the clearance or half-life of the antigen binding protein. Exemplary amino acid substitutions (EU numbering) that can enhance effector function include, but are not limited to, E233L, L234I, L234Y, L235S,G236A, S239D, F243L, F243V, P2471, D280H, K290S, K290E, K290N, K290Y, R292P, E294L, Y296W, S298A, S298D, S298V, S298G, S298T, T299A, Y300L, V3051, Q311M, K326A, K326E, K326W, A330S, A330L, A330M, A330F, I332E, D333A, E333S, E333A, K334A, K334V, A339D, A339Q, P396L, or combinations of any of the foregoing.

[0172] In other embodiments, the bispecific antigen binding proteins of the invention comprise one or more amino acid substitutions in the constant region to reduce effector function. Exemplary amino acid substitutions (EU numbering) that can reduce effector function include, but are not limited to, C220S, C226S, C229S, E233P, L234A, L234V, V234A, L234F, L235A, L235E, G237A, P238S, S267E, H268Q, N297A, N297G, V309L, E318A, L328F, A330S, A331S, P331S or combinations of any of the foregoing.

[0173] Exemplary substitutions to aid in correct assembly of hetero Ig molecules are shown in Figure 1. Preferred substitutions for the hetero Ig format are shown in (v2) in Figure 1 and Table N. All positions in TableN are according to EU numbering. Table N: Mutations in the hetero-Ig Molecules Chain Domain Mutation EU # Light chain 1 Variable E 38 Constant E 176 Light chain 2 Variable K 38 Constant K 176 Heavy chain 1 Variable K 39 CH1 K 183 CH3 D 392 CH3 D 409 Heavy chain 2 Variable E 39 CH1 E 183 CH3 K 356 CH3 K 399

[0174] Preferred charged amino acids for the IgG-Fab format, as well as CH / CL domain swaps as described herein for Figure 26, are shown in Table O. "Fab 1" and "Fab 2" in Table O are as depicted in Figures 25 and 26. Fab 1 is at the N- terminusof the IgG-Fabmolecule andFab2 is at itsC-terminus. The identity andposition of the chargedaminoacids in the Fab appear to the right of the domain listed in Table O. All positions are according to EU numbering. Table O: Mutations in the IgG-Fab Molecules Designation Domain Mutation EU # Domain Mutation EU # CPMv1 Fab 1 CL E 230 Fab 2 CL K 230 Fab 1 CH1 K 230 Fab 2 CH1 E 230 CPMv1 Fab 1 swap Fab 1 CL K 230 Fab 2 CL K 230 Fab 1 CH1 E 230 Fab 2 CH1 E 230 57 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Designation Domain Mutation EU # Domain Mutation EU # CPMv1 Fab 2 swap Fab 1 CL E 230 Fab 2 CL E 230 Fab 1 CH1 K 230 Fab 2 CH1 K 230 CPMv1 Fab 1&2 swap Fab 1 CL K 230 Fab 2 CL E 230 Fab 1 CH1 E 230 Fab 2 CH1 K 230 CPMv2 Fab 1 CL E 230 Fab 2 CL K 230 Fab 1 CH1 K 230 Fab 2 CH1 E 230 Fab 1 VL E 46 Fab 2 VL E 46 Fab 1 VH K 46 Fab 2 VH K 46 CPMv2 Fab 1 swap Fab 1 CL K 230 Fab 2 CL K 230 Fab 1 CH1 E 230 Fab 2 CH1 E 230 Fab 1 VL E 46 Fab 2 VL E 46 Fab 1 VH K 46 Fab 2 VH K 46 CPMv2 Fab 2 swap Fab 1 CL E 230 Fab 2 CL E 230 Fab 1 CH1 K 230 Fab 2 CH1 K 230 Fab 1 VL E 46 Fab 2 VL E 46 Fab 1 VH K 46 Fab 2 VH K 46 CPMv2 Fab 1 & 2 swap Fab 1 CL K 230 Fab 2 CL E 230 Fab 1 CH1 E 230 Fab 2 CH1 K 230 Fab 1 VL E 46 Fab 2 VL E 46 Fab 1 VH K 46 Fab 2 VH K 46 CPMv3 Fab 1 CL E 230 Fab 2 CL K 230 Fab 1 CH1 K 230 Fab 2 CH1 E 230 Fab 1 VL E 141 Fab 2 VL E 51 Fab 1 VH K 51 Fab 2 VH K 141 CPMv3 Fab 1 swap Fab 1 CL K 230 Fab 2 CL K 230 Fab 1 CH1 E 230 Fab 2 CH1 E 230 Fab 1 VL E 141 Fab 2 VL E 51 Fab 1 VH K 51 Fab 2 VH K 141 CPMv3 Fab 2 swap Fab 1 CL E 230 Fab 2 CL E 230 Fab 1 CH1 K 230 Fab 2 CH1 K 230 Fab 1 VL E 141 Fab 2 VL E 51 Fab 1 VH K 51 Fab 2 VH K 141 CPMv3 Fab 1 & 2 swap Fab 1 CL K 230 Fab 2 CL E 230 Fab 1 CH1 E 230 Fab 2 CH1 K 230 Fab 1 VL E 141 Fab 2 VL E 51 Fab 1 VH K 51 Fab 2 VH K 141 Binding affinity and biological activity

[0175] In another embodiment of the foregoing aspects of the invention, an anti-TL1A antibody (or an antigen-binding 58 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 fragment thereof) or theTL1Abindingentity of a hetero Ig bispecificantigenbindingprotein or an IgG-scFvantigenbinding proteinbindsTL1Awithabindingaffinity (KD1) of at least 1x10‑10M‑1, at least 5x10‑10M‑1, at least 1x10 ‑10M‑1, at least 5x 10‑10 M‑1, at least 8 x 10‑10 M‑1, or at least 1 x 10‑10 M‑1 wherein the binding affinity is measured by surface plasmon resonance, such as Biacore. More particularly, the invention relates to the following embodiments: an anti-TL1A antibody (or an antigen-binding fragment thereof) binds to human TL1A when the antibody is immobilized on an SCM5 sensor chip at a binding affinity of about 1 to about 5 KD pM or to cynomolgus TL1A when the antibody is immobilized on an SCM5 sensor chip at a binding affinity of about 1‑10 to about 7.5‑10 M‑1 KD; an anti-TNF-α binding entity of a hetero Ig bispecific antigen binding protein binds to human TNF-αwhen the antigen binding protein is immobilized on an SCM5 sensor chip at a binding affinity of about 1‑10 to about 5‑10 M‑1 KD pM, preferably about 10 to about 12 pM; an anti-TL1A binding entity of a hetero Ig bispecific antigen binding protein binds to human TL1A when the antigen binding protein is immobilized on an SCM5 sensor chip at a binding affinity of about 2‑10 to about 6.5‑10 M‑1 KD, preferably about 10 to about 11 pM; ananti-TNF-αbindingentity of an IgG-scFvbispecificantigenbindingproteinbinds tohumanTNF-αwhen theantigen binding protein is immobilized on an SCM5 sensor chip at a binding affinity of about 4.5‑10 to about 7.5‑10 M‑1 KD, preferably about 10 to about 20 pM; and aTL1Abindingentity of an IgG-scFvbispecific antigenbinding protein binds to humanTL1Awhen theantigenbinding protein is immobilized on an SCM5 sensor chip at a binding affinity of about 1.5 to about 160 pM KD.

[0176] Further details on TL1A and TNF-α binding appear in Examples 13 and 15 hereinafter.

[0177] In another embodiment of the foregoing aspects of the invention, a TNF-α binding entity of an IgG-Fab bispecific antigenbindingprotein bindsaTNF-α trimerwith abindingaffinity (KD1) of 1 x10‑10M‑1, at least 5 x10‑10M‑1, at least 1 x10 ‑10 M‑1, at least 5 x 10‑10 M‑1, at least 8 x 10‑10 M‑1, or at least 1 x 10‑10 M‑1 wherein the binding affinity is measured by surface plasmon resonance, such as Biacore.

[0178] In other embodiments of the foregoing aspects of the invention: an anti-TL1A antibody (or an antigen-binding fragment thereof) neutralizes or inhibits human TL1A in a TF‑1 NF-κB reporter cell line with an IC50 of about 0.08 to about 3 nM, cynomolgus TL1ATL1A in a TF‑1 NF-κB reporter cell line with an IC50 of about 0.375 to about 10 nM; a TNF-α binding entity of a hetero Ig bispecific antigen binding protein neutralizes or inhibits human TNF-α in a TF‑1 NF-κB reporter cell line with an IC50 of about 50 to 550 pM, with about 50 to about 110 pM preferred; a TL1Abinding entity of a hetero Ig bispecific antigen binding protein neutralizes or inhibits humanTL1A in a TF‑1NF- κB reporter cell line with an IC50 of about 45 to about 3500 pM, with about 45 to 190 pM preferred; aTNF-αbindingentity of an IgG-scFvbispecificantigenbindingproteinneutralizesor inhibits soluble humanTNF-α in a TF‑1 NF-κB reporter cell line with an IC50 of about 20 to about 75 pM; and a TL1A binding entity of an IgG-scFv bispecific antigen binding protein neutralizes or inhibits human TL1A in a TF‑1 NF-κB reporter cell line with an IC50 of about 19 to about 200 pM.

[0179] Further details on TL1A inhibition and TNF-α inhibition appears in Examples 14 and 16 hereinafter. Immunoconjugates, derivatives, variants

[0180] The antibodies and bispecific antibodies of the invention may be used alone or as immunoconjugates with a therapeutic agent (e.g., a cytotoxic agent). In some embodiments, the agent is a chemotherapeutic agent. In some embodiments, the agent is a radioisotope, including but not limited to Lead‑212, Bismuth‑212, Astatine‑211, Iodine‑131, Scandium‑47,Rhenium‑186,Rhenium‑188,Yttrium‑90, Iodine‑123, Iodine‑125,Bromine‑77, Indium‑111, andfissionable nuclides such as Boron‑10 or an Actinide. In other embodiments, the agent is a toxin or cytotoxic drug, including but not limited to ricin, abrin, modified Pseudomonas enterotoxin A, Pseudomonas exotoxin, calicheamicin, adriamycin, 5- fluorouracil, diphtheria toxin, and the like. Methods of conjugation of antibodies to such agents are known in the literature, and include direct and indirect conjugation.

[0181] Suitable detectablemoleculesmaybedirectly or indirectly attached to the antibodies andbispecific antibodies of the present invention. Suitable detectable molecules include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescentmarkers, chemiluminescentmarkers,magneticparticlesand the like.For indirect attachmentofadetectableor cytotoxic molecule, the detectable or cytotoxic molecule can be conjugated with a member of a complementary / anti- complementary pair, where theothermember is bound to the bindingpolypeptide or antibody portion. For thesepurposes, biotin / streptavidin is an exemplary complementary / anti-complementary pair.

[0182] The bispecific antibodies and antibodies of the invention also include derivatives that are modified, e.g., by the 59 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 covalent attachment of any type of molecule to the antibody such that covalent attachment does not prevent the antibody frombinding to its epitope.Examplesof suitablederivatives includebut arenot limited toantibodiesor bispecificantibodies that are fucosylated, glycosylated, acetylated, pegylated, phosphorylated, or amidated. The antibodies and bispecific antibodies and derivatives thereof of the invention may themselves by derivatized by known protecting / blocking groups, proteolytic cleavage, linkage to a cellular ligand or other proteins, and the like. In some embodiments of the invention, at least one heavy chain of the antibody or bispecific antigen binding protein is PEGylated. In some embodiments, the PEGylation is N-linked or is linked through the sidechain of an amino acid (e.g., lysine).

[0183] Glycosylation can contribute to the effector function of antibodies, particularly IgG1 antibodies. Thus, in some embodiments, the antigen binding proteins of the inventionmay comprise one ormore amino acid substitutions that affect the level or type of glycosylation of the binding proteins. Glycosylation of polypeptides is typically either N-linked or O- linked. N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue. The tri- peptide sequences asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline, are the recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain. Thus, the presence of either of these tri-peptide sequences in a polypeptide creates a potential glycosylation site. O-linked glycosylation refers to the attachment of one of the sugars N-acetylgalactosamine, galactose, or xylose, to a hydro- xyamino acid, most commonly serine or threonine, although 5-hydroxyproline or 5-hydroxylysine may also be used.

[0184] In certain embodiments, glycosylation of the antigen binding proteins described herein is increased by adding one or more glycosylation sites, e.g., to the Fc region of the binding protein. Addition of glycosylation sites to the antigen bindingprotein canbe conveniently accomplishedbyaltering theaminoacid sequencesuch that it contains oneormoreof the above-described tri-peptide sequences (for N-linked glycosylation sites). The alteration may also be made by the addition of, or substitution by, one ormore serine or threonine residues to the starting sequence (forO-linked glycosylation sites). For ease, the antigen binding protein amino acid sequence may be altered through changes at the DNA level, particularly by mutating the DNA encoding the target polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids.

[0185] The invention also encompasses production of antigen binding proteins with altered carbohydrate structure resulting in altered effector activity, including antigen binding proteins with absent or reduced fucosylation that exhibit improved ADCC activity. Various methods are known in the art to reduce or eliminate fucosylation. For example, ADCC effector activity is mediated by binding of the antibody molecule to the FcγRIII receptor, which has been shown to be dependent on the carbohydrate structure of the N-linked glycosylation at the N297 residue of the CH2 domain. Non- fucosylated antibodies bind this receptor with increased affinity and trigger FcγRIII-mediated effector functions more efficiently than native, fucosylated antibodies. For example, recombinant production of non-fucosylated antibody in CHO cells in which the alpha‑1,6-fucosyl transferase enzyme has been knocked out results in antibodywith 100-fold increased ADCC activity (see Yamane-Ohnuki et al., Biotechnol Bioeng. 87(5):614‑22, 2004). Similar effects can be accomplished through decreasing the activity of alpha‑1,6-fucosyl transferase enzyme or other enzymes in the fucosylation pathway, e.g., through siRNA or antisense RNA treatment, engineering cell lines to knockout the enzyme(s), or culturing with selective glycosylation inhibitors (see Rothman et al., Mol Immunol. 26(12): 1113‑23, 1989). Some host cell strains, e.g. Lec13 or rat hybridomaYB2 / 0 cell line naturally produce antibodieswith lower fucosylation levels (seeShields et al., J Biol Chem. 277(30):26733‑40, 2002 and Shinkawa et al., J Biol Chem. 278(5):3466‑73, 2003). An increase in the level of bisected carbohydrate, e.g. through recombinantly producing antibody in cells that overexpress GnTIII enzyme, has also been determined to increase ADCC activity (see Umana et al., Nat Biotechnol. 17(2):176‑80, 1999).

[0186] In other embodiments, glycosylation of the antigen binding proteins described herein is decreased or eliminated by removing one or more glycosylation sites, e.g., from the Fc region of the binding protein. Amino acid substitutions that eliminate or alter N-linkedglycosylation sites can reduce or eliminateN-linked glycosylation of the antigen binding protein. In certainembodiments, thebispecificantigenbindingproteinsdescribedherein compriseamutationat positionN297 (EU numbering), such as N297Q, N297A, or N297G. In one particular embodiment, the bispecific antigen binding proteins of the invention comprise a Fc region from a human IgGI antibody with a N297G mutation. To improve the stability of molecules comprising a N297mutation, the Fc region of the molecules may be further engineered. For instance, in some embodiments,oneormoreaminoacids in theFc regionaresubstitutedwith cysteine topromotedisulfidebond formation in the dimeric state.Residues corresponding toV259, A287,R292, V302, L306, V323, or I332 (EUnumbering) of an IgG1Fc region may thus be substituted with cysteine. In one embodiment, specific pairs of residues are substituted with cysteine such that they preferentially form a disulfide bondwith each other, thus limiting or preventing disulfide bond scrambling. In certain embodiments pairs include, but are not limited to, A287C and L306C, V259C and L306C, R292C and V302C, and V323C and I332C. In particular embodiments, the bispecific antigen binding proteins described herein comprise a Fc region from a human IgG1 antibody with mutations at R292C and V302C. In such embodiments, the Fc region may also comprise a N297G mutation.

[0187] Modifications of the antigen binding proteins of the invention to increase serum half-life also may desirable, for example, by incorporationoforadditionofasalvage receptorbindingepitope (e.g., bymutationof theappropriate regionor by incorporating the epitope into a peptide tag that is then fused to theantigen binding protein at either end or in themiddle, 60 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 e.g., by DNA or peptide synthesis; see, e.g., WO96 / 32478) or adding molecules such as PEG or other water soluble polymers, including polysaccharide polymers. The salvage receptor binding epitope preferably constitutes a region wherein any oneormore aminoacid residues fromoneor two loops of aFc region are transferred to ananalogous position in the antigen binding protein. In one embodiment, three or more residues from one or two loops of the Fc region are transferred. In one embodiment, the epitope is taken from the CH2 domain of the Fc region (e.g., an IgG Fc region) and transferred to the CH1, CH3, or VH region, or more than one such region, of the antigen binding protein. Alternatively, the epitope is taken from theCH2domain of the Fc region and transferred to theCL region or VL region, or both, of the antigen binding protein. See International applications WO 97 / 34631 andWO 96 / 32478 for a description of Fc variants and their interaction with the salvage receptor.

[0188] The bispecific antibodies and antibodies of the invention include variants having single or multiple amino acid substitutions, deletions, additions, or replacements that retain their biological properties (e.g., blocking thebindingofTL1A and / orTNF-α to their respective receptors, inhibiting thebiological activity of TL1AandTNF-α). Apersonof ordinary skill in the art can produce variants having single or multiple amino acid substitutions, deletions, additions or replacements. These variants may include, inter alia: (a) variants in which one or more amino acid residues are substituted with conservative or non-conservative amino acids, (b) variants in which one ormore amino acids are added to or deleted from the polypeptide, (c) variants in which one or more amino acids include a substituent group, and (d) variants in which the polypeptide is fused with another peptide or polypeptide such as a fusion partner, a protein tag or other chemical moiety, that may confer useful properties to the polypeptide, such as, for example, an epitope for an antibody, a polyhistidine sequence, a biotin moiety and the like. Antibodies and bispecific antibodies of the invention may include variants in which amino acid residues from one species are substituted for the corresponding residue in another species, either at the conserved or non-conserved positions. In another embodiment, amino acid residues at non-conserved positions are substitutedwith conservativeor non-conservative residues. The techniques for obtaining these variants, includinggenetic (suppressions, deletions, mutations, etc.), chemical, and enzymatic techniques, are known to the person having ordinary skill in the art. Nucleic acids, vectors, host cells

[0189] The invention also includes isolated nucleic acids encoding the bispecific antibodies of the invention, which includes, for instance, the light chain, light chain variable region, light chain constant region, heavy chain, heavy chain variable region, heavy chain constant region, linkers, and any and all components and combinations thereof of the bispecific antibodies disclosed herein. Nucleic acids of the invention include nucleic acids having at least 80%, more preferably at least about 90%, more preferably at least about 95%, and most preferably at least about 98% homology to nucleic acids of the invention. The terms "percent similarity", "percent identity" and "percent homology"when referring to a particular sequence are used as set forth in the University of Wisconsin GCG® software program. Nucleic acids of the invention also include complementary nucleic acids. In some instances, the sequences will be fully complementary (no mismatches) when aligned. In other instances, there may be up to about a 20% mismatch in the sequences. In some embodimentsof the inventionareprovidednucleicacidsencodingbothaheavychainanda light chainofanantibodyof the invention.

[0190] Nucleic acids of the invention can be cloned into a vector, such as a plasmid, cosmid, bacmid, phage, artificial chromosome (BAC, YAC) or virus, into which another genetic sequence or element (either DNA or RNA)may be inserted so as to bring about the replication of the attached sequence or element. In some embodiments, the expression vector contains a constitutively active promoter segment (such as but not limited to CMV, SV40, Elongation Factor or LTR sequences) or an inducible promoter sequence such as the steroid inducible pIND vector (Invitrogen), where the expression of the nucleic acid can be regulated. Expression vectors of the invention may further comprise regulatory sequences, for example, an internal ribosomal entry site. The expression vector can be introduced into a cell by transfection, for example.

[0191] For IgG-Fab bispecific antigen binding proteins, nucleic acids encoding each of the three components may be cloned into the same expression vector. In some embodiments, the nucleic acid encoding the light chain of the IgG-Fab molecule and the nucleic acid encoding the second polypeptide (which comprises the other half of the C-terminal Fab domain)arecloned intooneexpressionvector,whereas thenucleicacidencoding themodifiedheavychain (fusionprotein comprising a heavy chain and half of a Fab domain) is cloned into a second expression vector. In certain embodiments, all components of the bispecific antigen binding proteins described herein are expressed from the samehost cell population. For example, even if one or more components is cloned into a separate expression vector, the host cell is cotransfected with both expression vectors such that one cell produces all components of the bispecific antigen binding proteins.

[0192] In another embodiment, the present invention provides an expression vector comprising the following operably linked elements; a transcription promoter; a first nucleic acid molecule encoding the heavy chain of a bispecific antigen binding protein, antibody or antigen-binding fragment of the invention; a second nucleic acid molecule encoding the light chain of a bispecific antigen binding protein, antibody or antigen-binding fragment of the invention; and a transcription 61 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 terminator. In another embodiment, thepresent inventionprovidesanexpressionvector comprising the followingoperably linkedelements; a first transcriptionpromoter; a first nucleic acidmolecule encoding theheavychain of abispecificantigen binding protein, antibody or antigen-binding fragment of the invention; a first transcription terminator; a second transcrip- tion promoter a second nucleic acid molecule encoding the light chain of a bispecific antigen binding protein, antibody or antigen-binding fragment of the invention; and a second transcription terminator.

[0193] Asecretory signal peptidesequencecanalso, optionally, beencodedby theexpressionvector, operably linked to the coding sequence of interest, so that the expressed polypeptide can be secreted by the recombinant host cell, formore facile isolation of the polypeptide of interest from the cell, if desired. For instance, in some embodiments, signal peptide sequencesmaybeappended / fused to theamino terminusof anyof the polypeptide sequences listed in TablesE, J, K, and L. In certain embodiments, a signal peptide having the amino acid sequence ofMKHLWFFLLLVAAPRWVLS (SEQ IDNO: 499) is fused to the amino terminus of any of the polypeptide sequences in Tables D, I, J, and K. In other embodiments, a signal peptide having the amino acid sequence of METPAQLLFLLLLWLPDTTG (SEQ ID NO: 501) is fused to the amino terminus of any of the polypeptide sequences in Tables E, J, K, and L. In still other embodiments, a signal peptide having the amino acid sequence of MDMRVPAQLLGLLLLWLRGARC (SEQ IDNO: 503) is fused to the amino terminus of any of the polypeptide sequences in Tables E, J, K, and L. Each of the foregoing signal peptides is encoded by the nucleic acid having a sequence immediately preceding it in the Sequence Listing. Other suitable signal peptide sequences that can be fused to the amino terminus of the polypeptide sequences described herein include: MEAPAQLLFLLLLWLPDTTG (SEQ ID NO: 504), MEWTWRVLFLVAAATGAHS (SEQ ID NO: 505), and MEWSWVFLFFLSVTTGVHS (SEQ ID NO: 506). Other signal peptides are known to thoseof skill in the art andmaybe fused toanyof the polypeptide chains listed in Tables E, J, K and L, for example, to facilitate or optimize expression in particular host cells.

[0194] Recombinant host cells comprising such vectors and expressing the heavy and light chains are also provided.

[0195] Antibody-producing cells and bispecific antigen binding protein producing cells contain, depending on the bispecific antigen binding protein format, nucleic acids encoding the heavy chain, light chain, heavy chain-scFv construct, heavy chain-Fab heavy chain variable domain construct, and Fab light chain variable domain. Such nucleic acids can be used toproduce theantibodiesor bispecificantibodiesof the invention inaccordancewith techniques known in theart. The present invention, in one embodiment, provides a method of producing a bispecific antigen binding protein or antibody comprising culturing a recombinant host cell expressing the heavy and light chains or other constructs noted above and isolating the bispecific antigen binding protein or antibody produced by the cell.

[0196] The recombinant host cell may be a prokaryotic cell, for example anE. coli cell, or a eukaryotic cell, for example a mammalian cell or a yeast cell. Yeast cells includeSaccharomyces cerevisiae, Schizosaccharomyces pombe, andPichia pastoris cells.Mammalian cells includeVERO,HeLa,ChinesehamsterOvary (CHO),W138, baby hamster kidney (BHK), COS‑7, MDCK, human embryonic kidney line 293, normal dog kidney cell lines, normal cat kidney cell lines, monkey kidney cells, African greenmonkey kidney cells, COS cells, and non-tumorigenic mousemyoblast G8 cells, fibroblast cell lines,myelomacell lines,mouseNIH / 3T3cells, LMTK31cells,mousesertoli cells, humancervical carcinomacells, buffalo rat liver cells, human lung cells, human liver cells, mouse mammary tumor cells, TRI cells, MRC 5 cells, and FS4 cells. Antibody-producing and bispecific antigen binding proteinproducing cells of the invention also include any insect expression cell line known, such as for example, Spodoptera frugiperda cells. In a preferred embodiment, the cells are mammalian cells. In a most preferred embodiment, the mammalian cells are CHO cells.

[0197] The antibody-producing cells preferably are substantially free of TL1A and TNF-α binding competitors. In preferred embodiments, the antibody-producing cells comprise less than about 10%, preferably less than about 5%,more preferably less than about 1%, more preferably less than about 0.5%, more preferably less than about 0.1%, and most preferably 0% by weight TL1A or TNF-α binding competitors. In some embodiments, the antibodies and bispecific antibodies producedare substantially free of TL1AandTNF-α competitors. In preferred embodiments, the antibodies and bispecific antibodies produced comprise less than about 10%, preferably less than about 5%, more preferably less than about 1%,morepreferably less than about 0.5%,morepreferably less than about 0.1%, andmost preferably 0%byweight both TL1A and TNF-α binding competitors. Purification

[0198] Methods of antibody purification are known in the art and can be employedwith production of the antibodies and bispecific antibodies of the present invention. In some embodiments of the invention, methods for antibody purification include filtration, affinity column chromatography, cation exchange chromatography, anion exchange chromatography, and concentration. The filtration step preferably comprises ultrafiltration, and more preferably ultrafiltration and diafiltra- tion. Filtration is preferably performed at least about 5‑50 times, more preferably 10 to 30 times, andmost preferably 14 to 27 times. Affinity column chromatography, may be performed using, for example, PROSEP® Affinity Chromatography (Millipore,Billerica,Mass.). In apreferredembodiment, theaffinity chromatographystepcomprisesPROSEP®-vAcolumn chromatography. Eluate may be washed in a solvent detergent. Cation exchange chromatography may include, for example, SP-SepharoseCation ExchangeChromatography. Anion exchange chromatographymay include, for example 62 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 but not limited to, Q-Sepharose Fast Flow Anion Exchange. The anion exchange step is preferably non-binding, thereby allowing removal of contaminants including DNA and BSA. The antibody product is preferably nanofiltered, for example, usingaPallDV20Nanofilter. Theantibodyproductmaybeconcentrated, for example, usingultrafiltrationanddiafiltration. Themethodmay further comprise a step of size exclusion chromatography to remove aggregates. Further parameters of purification appear in the working examples hereinafter.

[0199] The bispecific antibodies, antibodies or antigen-binding fragments may also be produced by other methods known in the art, for example by chemical coupling of antibodies and antibody fragments. Uses of the monospecific and bispecific antibodies of the invention

[0200] The bispecific antibodies and monospecific antibodies of the present invention are useful, for example, for the inhibition of proinflammatory cytokines, such as TL1A and TNF-α . The bispecific antibodies andmonospecific antibodies of the invention can be used to treat inflammatory disorders and autoimmune diseases, such as inflammatory bowel disease (IBD), Crohn’s disease (CD), ulcerative colitis (UC), irritable bowel syndrome (IBS), bladder syndrome / intersticial cystitis, urinary bowel disfunction, sepsis, uveitis, encephalomyelitis, myasthenia gravis, Sjogren’s syndrome (SS), scleroderma, multiple sclerosis (MS), cystic fibrosis (CF), inflammation in chronic kidney disease (CKD), psoriasis (Pso), psoriatic arthritis (PsA), ankylosing spondylitis (AS), rheumatoid arthritis (RA), juvenile rheumatoid arthritis (JRA), osteoarthritis (OA), spondyloarthropathy, primary sclerosing cholangitis, primary biliary cirrhosis, atherosclerosis, sple- nomegaly, inflammation in chronic kidney disease (CKD), atopic dermatitis (AD), eczematous dermatitis, contact dermatitis systemic sclerosis, systemic lupus erythematosus (SLE), lupus nephritis (LN), cutaneous lupus erythemato- sus, autoimmune thyroiditis, IgA nephropathy, diabetic kidney disease, antineutrophil cytoplasmic antibodies (ANCA)‑as- sociated vasculitis (AAV), minimal change disease (lipoid nephrosis), focal segmental glomerulosclerosis (FSGS), nephrogenic systemic fibrosis (NSF), nephrogenic fibrosing dermopathy, fibrosing cholestatic hepatitis, eosinophilic fasciitis (Shulman’s syndrome), scleromyxedema (popular mucinosis), scleroderma, lichen sclerosusetatrophicus, inflammatory lung injury such as idiopathic pulmonary fibrosis, asthma, chronic obstructive pulmonary disease (COPD), airway hyper-responsiveness, chronic bronchitis, allergic asthma, eczema, Helicobacter pylori infection, intraabdominal adhesions and / or abscesses as results of peritoneal inflammation (e.g., from infection, injury, etc.), nephrotic syndrome, idiopathic demyelinating polyneuropathy,Guillain-Barre syndrome, transplant rejection, organ allograft rejection, graft vs. host disease (GVHD) (e.g., from a transplant, such as blood, bone marrow, kidney, pancreas, liver, orthotopic liver, lung, heart, intestine, small intestine, large intestine, thymus, allogeneic stem cell, reduced-intensity allogeneic, bone, tendon, cornea, skin, heart valves, veins, arteries, blood vessels, stomach and testis), IgA nephropathy, diabetic kidney disease, diabetesmellitus,minimal changedisease (lipoid nephrosis), nephrogenic systemic fibrosis (NSF), nephrogenic fibrosing dermopathy, fibrosing cholestatic hepatitis, eosinophilic fasciitis (Shulman’s syndrome), scleromyxedema (popular mucinosis), scleroderma, lichen sclerosusetatrophicus, Takatsuki disease (or PEP syndrome), nephrotic syndrome, POEMssyndrome,Crow-Fukasesyndrome,nephrotic syndrome, , antineutrophil cytoplasmicantibodies, vasculitis, giant cell arteritis and multiple-myeloma-induced lytic bone disease, streptococcal cell wall (SCW)‑induced arthritis, gingivi- tis / periodontitis, herpetic stromal keratitis, gluten-sensitive enteropathy restenosis, Kawasaki’s disease, and immune- mediated renaldiseases.Thebispecificantibodiesandmonospecificantibodiesdescribedhereincanalsobeused to treat cancer, including angiogenesis.

[0201] In one embodiment, the invention concernsmethodsof treating oneormore of the aforementioneddiseases and disorders in amammal in need of such treatment by administering a therapeutically effective amount of amonospecific or bispecific antigen binding protein of the present invention. In a preferred embodiment themammal is a human. In another preferred embodiment, the disease or disorder is IBD, CD, or UC.

[0202] The invention further concerns the use of the bispecific and monospecific antibodies of the present invention in the treatment of inflammatory diseases characterized by the presence of elevated levels of TL1A or / (in the case of the bispecific antibodies) TNF-α , and in the treatment of cancers characterized by the presence of elevated levels of TL1A and / or TNF-α.

[0203] Accordingly, in one embodiment, the present invention provides a method of inhibiting one or more of proin- flammatory cytokines, e.g., TL1A and TNF-α , in a mammal in need of such treatment comprising administering a therapeutically effective amount of a bispecific or monospecific antibody of the invention to a mammal in need of such treatment. In a preferred embodiment, themammal is a human. Themethodmay beused to treat a disorder characterized by elevated expression or activity of TL1A or TNF-α . The monospecific or bispecific antigen binding protein may be administered with another pharmaceutical agent, either in the same formulation or separately.

[0204] In another embodiment, the present invention provides a composition comprising a monospecific or bispecific antigen binding protein as described herein and a pharmaceutically acceptable carrier. A pharmaceutical composition comprising an antibody, e.g., a bispecific antigen binding protein, of the invention can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby the therapeutic antibodies are combined in amixture with a pharmaceutically acceptable carrier. A composition is said to comprise a "pharmaceutically acceptable carrier" if its 63 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 administration can be tolerated by a recipient patient. Sterile phosphate-buffered saline is one example of a pharma- ceutically acceptable carrier. Other suitable carriers are well-known to those in the art. See, for example, Getman), ed., Remington’s Pharmaceutical Sciences, 19th Edition, Mack Publishing Company (1995).

[0205] For pharmaceutical use, an antibody, e.g., a bispecific antigen binding protein, of the present invention is formulated for parenteral, particularly intravenous or subcutaneous, delivery according to conventional methods. Intravenous administration may be by bolus injection, controlled release, e.g., using mini-pumps or other appropriate technology, or by infusionover a typical period of one to several hours. In general, pharmaceutical formulationswill include an antibody, e.g., a bispecific antigen binding protein, of the invention in combination with a pharmaceutically acceptable carrier, such as saline, buffered saline, 5% dextrose in water or the like. Formulations may further include one or more excipients, preservatives, solubilizers, buffering agents, albumin to prevent protein loss on vial surfaces, etc. When utilizing such a combination therapy, the antibodies, which include bispecific antibodies, may be combined in a single formulation or may be administered in separate formulations. Methods of formulation are well known in the art and are disclosed, for example, inGennaro, ed., Remington’sPharmaceutical Sciences,MackPublishingCo., EastonPa. (1990), which is incorporated herein by reference. Therapeutic doses will generally be in the range of 0.1 to 100 mg / kg of patient weight per day, preferably 0.5‑20 mg / kg per day, with the exact dose determined by the clinician according to accepted standards, taking into account the nature and severity of the condition to be treated, patient traits, etc. Determination of dose iswithin the level of ordinaryskill in theart.Morecommonly, theantibodieswill beadministeredoveroneweekor less, often over a period of one to three days. Generally, the dosage of administered antibodies will vary depending upon such factors as the patient’s age, weight, height, sex, general medical condition and previous medical history. Typically, it is desirable to provide the recipient with a dosage of antibodies which is in the range of from about 1 pg / kg to 10 mg / kg (amount of agent / body weight of patient), although a lower or higher dosage also may be administered as circumstances dictate.

[0206] Administration of an antibody, e.g., bispecific antigen binding protein, of the invention to a subject can be intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, intrapleural, intrathecal, by perfusion through a regional catheter, or by direct intralesional injection. When administering therapeutic antibodies by injection, the administration may be by continuous infusion or by single or multiple boluses.

[0207] Additional routes of administration include oral, mucosal-membrane, pulmonary, and transcutaneous. Oral delivery is suitable for polyester microspheres, zein microspheres, proteinoid microspheres, polycyanoacrylate micro- spheres, and lipid-based systems (see, for example, DiBase et al., "Oral Delivery of Microencapsulated Proteins", in Sanders et al., eds., Protein Delivery: Physical Systems, pp. 255‑288, Plenum Press (1997)). The feasibility of an intranasal delivery is exemplified by such a mode of insulin administration (see, for example, Hinchcliffe et al., Adv. Drug Deliv. Rev., 35:199 (1999)). Dry or liquid particles comprising antibodies of the invention can be prepared and inhaledwith the aid of dry-powder dispersers, liquid aerosol generators, or nebulizers (e.g., Pettit et al., TIBTECH, 16:343 (1998); Patton et al., Adv. Drug Deliv. Rev., 35:235 (1999)). This approach is illustrated by the AERX® diabetes management system, which is a hand-held electronic inhaler that delivers aerosolized insulin into the lungs. Studies have shown that proteins as large as 48,000 kDa have been delivered across skin at therapeutic concentrations with the aid of low- frequency ultrasound, which illustrates the feasibility of transcutaneous administration (Mitragotri et al., Science, 269:850 (1995)). Transdermal delivery using electroporation provides another means to administer a molecule having IL‑17 and TNF-α / p19 binding activity (Potts et al., Pharm. Biotechnol., 10:213 (1997)).

[0208] For purposes of therapy, compositions comprising an antibody, e.g., a bispecific antigen binding protein, of the invention and a pharmaceutically acceptable carrier are administered to a patient in a therapeutically effective amount. A combination of an antibody, e.g., a bispecific antigen binding protein, of the present invention and a pharmaceutically acceptable carrier is said to be administered in a "therapeutically effective amount" if the amount administered is physiologically significant. An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient. For example, an agent used to treat inflammation is physiologically significant if its presence alleviates the inflammatory response. Effective treatment may be assessed in a variety of ways. In one embodiment, effective treatment is determined by reduced inflammation. In other embodiments, effective treatment is marked by inhibition of inflammation. In still other embodiments, effective therapy is measured by increasedwell-being of the patient including such signs as weight gain, regained strength, decreased pain, thriving, and subjective indications from the patient of better health.

[0209] Apharmaceutical composition comprising an antibody, e.g., a bispecific antigen binding protein, of the invention can be furnished in liquid form, in an aerosol, or in solid form. Liquid forms, are illustrated by injectable solutions and oral suspensions. Exemplary solid forms include capsules, tablets, and controlled-release forms. The latter form is illustrated by miniosmotic pumps and implants (Bremer et al., Pharm. Biotechnol., 10:239 (1997); Ranade, "Implants in Drug Delivery", in Ranade et al., eds., Drug Delivery Systems, pp. 95‑123, CRC Press (1995); Bremer et al., "Protein Delivery with Infusion Pumps", in Sanders et al., eds., Protein Delivery: Physical Systems, pp. 239‑254, Plenum Press (1997); Yewey et al., "Delivery of Proteins from aControlled Release Injectable Implant", in Sanders et al., eds., Protein Delivery: Physical Systems, pp. 93‑117, Plenum Press (1997). 64 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55

[0210] Liposomes provide one means to deliver therapeutic polypeptides to a subject intravenously, intraperitoneally, intrathecally, intramuscularly, subcutaneously, or via oral administration, inhalation, or intranasal administration. Lipo- somes are microscopic vesicles that consist of one or more lipid bilayers surrounding aqueous compartments (see, generally, Bakker-Woudenberg et al., Eur. J. Clin. Microbiol. Infect. Dis., 12(Suppl. 1):561 (1993), Kim, Drugs, 46:618 (1993), and Ranade, "Site-Specific Drug Delivery Using Liposomes as Carriers", in Ranade et al., eds., Drug Delivery Systems, pp. 3‑24, CRC Press (1995)). Liposomes are similar in composition to cellular membranes and as a result, liposomescanbeadministeredsafelyandarebiodegradable.Dependingon themethodofpreparation, liposomesmaybe unilamellar or multilamellar, and liposomes can vary in size with diameters ranging from 0.02 .mu.m to greater than 10 .mu.m. A variety of agents can be encapsulated in liposomes: hydrophobic agents partition in the bilayers and hydrophilic agents partition within the inner aqueous space(s) (see, for example, Machy et al., Liposomes in Cell Biology and Pharmacology, John Libbey (1987), and Ostro et al., American J. Hosp. Pharm., 46:1576 (1989)). Moreover, it is possible to control the therapeutic availability of the encapsulated agent by varying liposome size, the number of bilayers, lipid composition, as well as the charge and surface characteristics of the liposomes.

[0211] Liposomes can absorb to virtually any type of cell and then slowly release the encapsulated agent. Alternatively, an absorbed liposome may be endocytosed by cells that are phagocytic. Endocytosis is followed by intralysosomal degradation of liposomal lipids and release of the encapsulated agents (Scherphof et al., Ann. N.Y. Acad. Sci., 446:368 (1985)). After intravenous administration, small liposomes (0.1 to 1.0 .mu.m) are typically taken up by cells of the reticuloendothelial system, located principally in the liver and spleen, whereas liposomes larger than 3.0 .mu.m are deposited in the lung. This preferential uptake of smaller liposomes by the cells of the reticuloendothelial systemhas been used to deliver chemotherapeutic agents to macrophages and to tumors of the liver.

[0212] The reticuloendothelial systemcan be circumvented by severalmethods including saturationwith large doses of liposome particles, or selective macrophage inactivation by pharmacological means (Claassen et al., Biochim. Biophys. Acta, 802:428 (1984)). In addition, incorporation of glycolipid‑ or polyethelene glycol-derivatized phospholipids into liposomemembraneshasbeenshown to result in a significantly reduceduptakeby the reticuloendothelial system(Allenet al., Biochim. Biophys. Acta, 1068:133 (1991); Allen et al., Biochim. Biophys. Acta, 1150:9 (1993)).

[0213] Liposomes can also be prepared to target particular cells or organs by varying phospholipid composition or by inserting receptors or ligands into the liposomes. For example, liposomes, prepared with a high content of a nonionic surfactant, have been used to target the liver (Hayakawa et al., JapanesePatent No. 04‑244,018; Kato et al., Biol. Pharm. Bull., 16:960 (1993)). These formulations were prepared by mixing soybean phospatidylcholine, .alpha.‑tocopherol, and ethoxylated hydrogenated castor oil (HCO‑60) in methanol, concentrating the mixture under vacuum, and then recon- stituting themixturewithwater. A liposomal formulation of dipalmitoylphosphatidylcholine (DPPC)with a soybean-derived sterylglucosidemixture (SG)andcholesterol (Ch) hasalsobeenshown to target the liver (Shimizuet al., Biol. Pharm.Bull., 20:881 (1997)).

[0214] Alternatively, various targeting ligands can be bound to the surface of the liposome, such as antibodies, antibody fragments, carbohydrates, vitamins, and transport proteins. For example, liposomes can bemodified with branched type galactosyllipid derivatives to target asialoglycoprotein (galactose) receptors, which are exclusively expressed on the surface of liver cells (Kato et al., Crit. Rev. Ther. Drug Carrier Syst., 14:287 (1997); Murahashi et al., Biol. Pharm. Bull., 20:259 (1997)). Similarly,Wuet al.,Hepatology, 27:772 (1998), haveshown that labeling liposomeswithasialofetuin led to a shortened liposome plasma half-life and greatly enhanced uptake of asialofetuin-labeled liposome by hepatocytes. On the other hand, hepatic accumulation of liposomes comprising branched type galactosyllipid derivatives can be inhibited bypreinjectionof asialofetuin (Murahashi et al., Biol.Pharm.Bull., 20:259 (1997)).Polyaconitylatedhumanserumalbumin liposomes provide another approach for targeting liposomes to liver cells (Kamps et al., Proc. Nat’l Acad. Sci. USA, 94:11681 (1997)). Moreover, Geho et al. U.S. Pat. No. 4,603,044, describe a hepatocyte-directed liposome vesicle delivery system, which has specificity for hepatobiliary receptors associated with the specialized metabolic cells of the liver.

[0215] In amore general approach to tissue targeting, target cells are prelabeledwith biotinylated antibodies specific for a ligand expressed by the target cell (Harasymet al., Adv. DrugDeliv. Rev., 32: 99 (1998)). After plasmaelimination of free antibody, streptavidin-conjugated liposomes are administered. In another approach, targeting antibodies are directly attached to liposomes (Harasym et al., Adv. Drug Deliv. Rev., 32: 99 (1998)).

[0216] Antibodiescanbeencapsulatedwithin liposomesusingstandard techniquesofproteinmicroencapsulation (see, for example, Anderson et al., Infect. Immun., 31:1099 (1981), Andersonet al., CancerRes., 50:1853 (1990), andCohenet al., Biochim.Biophys.Acta, 1063:95 (1991), Alvinget al. "Preparation andUseof Liposomes in Immunological Studies", in Gregoriadis, ed., Liposome Technology, 2nd Edition, Vol. III, p. 317, CRC Press (1993), Wassef et al., Meth. Enzymol., 149:124 (1987)). As noted above, therapeutically useful liposomes may contain a variety of components. For example, liposomes may comprise lipid derivatives of poly(ethylene glycol) (Allen et al., Biochim. Biophys. Acta, 1150:9 (1993)).

[0217] Degradable polymermicrospheres have been designed tomaintain high systemic levels of therapeutic proteins. Microspheres are prepared from degradable polymers such as poly(lactide-co-glycolide) (PLG), polyanhydrides, poly (ortho esters), nonbiodegradable ethylvinyl acetate polymers, inwhich proteins are entrapped in the polymer (Gombotz et 65 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 al., BioconjugateChem., 6:332 (1995); Ranade, "Role of Polymers inDrugDelivery", in Ranade et al., eds., DrugDelivery Systems, pp. 51‑93, CRC Press (1995); Roskos et al., "Degradable Controlled Release Systems Useful for Protein Delivery", in Sanders et al., eds., Protein Delivery: Physical Systems, pp. 45‑92, Plenum Press (1997); Bartus et al., Science, 281:1161 (1998); Putney et al., Nature Biotechnology, 16:153 (1998); Putney, Curr. Opin. Chem. Biol., 2:548 (1998)). Polyethylene glycol (PEG)‑coated nanospheres can also provide carriers for intravenous administration of therapeutic proteins (see, for example, Gref et al., Pharm. Biotechnol., 10:167 (1996).

[0218] The formulation canalso containmore thanoneactive compoundasnecessary for theparticular indication being treated, preferably thosewith complementary activities that do not adversely affect eachother. Alternatively, or in addition, the composition can comprise an agent that enhances its function, such as, for example, a cytotoxic agent, cytokine, chemotherapeutic agent, or growth-inhibitory agent. Suchmolecules are suitably present in combination in amounts that are effective for the purpose intended.

[0219] In one embodiment, an antibody, e.g., a bispecific antigen binding protein, of the invention is administered in combination therapy, i.e., combined with other agents, e.g., therapeutic agents, that are useful for treating pathological conditions or disorders, such as autoimmune disorders and inflammatory diseases. The term "in combination" in this context means that the agents are given substantially contemporaneously, either simultaneously or sequentially. If given sequentially, at the onset of administration of the second compound, the first of the two compounds is preferably still detectable at effective concentrations at the site of treatment.

[0220] For example, the combination therapy can include one or more an antibodies, e.g., bispecific antibodies, of the invention coformulated with, and / or coadministered with, one or more additional therapeutic agents, e.g., one or more cytokine and growth factor inhibitors, immunosuppressants, anti-inflammatory agents, metabolic inhibitors, enzyme inhibitors, and / or cytotoxic or cytostatic agents, as described in more detail below. Furthermore, one or more antibodies, e.g., bispecific antibodies, described herein may be used in combination with two or more of the therapeutic agents described herein. Such combination therapiesmay advantageously utilize lower dosages of the administered therapeutic agents, thus avoiding possible toxicities or complications associated with the various monotherapies.

[0221] Preferred therapeutic agents used in combinationwith an antibody, e.g., bispecific antigen binding protein, of the invention are those agents that interfere at different stages in an inflammatory response. In one embodiment, one ormore antibodies, e.g., bispecific antibodies, described herein may be co-formulated with, and / or co-administered with, one or more additional agents such as other cytokine or growth factor antagonists (e.g., soluble receptors, peptide inhibitors, small molecules, ligand fusions); or antibodies or antigen binding fragments thereof that bind to other targets (e.g., antibodies that bind to other cytokines or growth factors, their receptors, or other cell surface molecules); and anti- inflammatory cytokines or agonists thereof. Non-limiting examples of the agents that can be used in combination with the antibodies described herein, include, but are not limited to, antagonists of one ormore interleukins (ILs) or their receptors, e.g., antagonists of IL‑1, IL‑2, IL‑6, IL‑7, IL‑8, IL‑12, IL‑13, IL‑15, IL‑16, IL17A-F, IL‑18, IL‑20, IL‑21, IL‑22, IL‑25 and IL‑31; antagonists of cytokinesor growth factorsor their receptors, suchas, LT,EMAP-II,GM-CSF,FGFandPDGF.Antibodies of the invention can also be combined with inhibitors of e.g., antibodies to, cell surface molecules such as CD2, CD3, CD4, CD8,CD20 (e.g., theCD20 inhibitor rituximab (RITUXAN®),CD25,CD28,CD30,CD40,CD45,CD69,CD80 (B7.1),CD86 (B7.2), CD90, or their ligands, including CD154 (gp39 or CD40L), or LFA‑1 / ICAM‑1 and VLA‑4 / VCAM‑1 (Yusuf- Makagiansar et al., Med. Res. Rev., 22:146‑167 (2002)). Preferred antagonists that can be used in combination with one ormore antibodies, e.g., bispecific antibodies, described herein include antagonists of IL‑1, IL‑6, IL‑12, TNF-α, IL‑15, IL‑18, IL‑20, IL‑22 and IL‑31.

[0222] Examples of those agents include IL‑12 antagonists, such as chimeric, humanized, human or in vitro-generated antibodies (or antigen binding fragments thereof) that bind to IL‑12 (preferably human IL‑12), e.g., the antibody disclosed in WO 00 / 56772; IL‑12 receptor inhibitors, e.g., antibodies to human IL‑12 receptor; and soluble fragments of the IL‑12 receptor, e.g., human IL‑12 receptor. Examples of IL‑15 antagonists include antibodies (or antigen binding fragments thereof) against IL‑15 or its receptor, e.g., chimeric, humanized, human or in vitro-generated antibodies to human IL‑15 or its receptor, soluble fragments of the IL‑15 receptor, and IL‑15-binding proteins. Examples of IL‑17 antagonists include brodalumab, secukinumab, and ixekizumab. Examples of IL‑18 antagonists include antibodies, e.g., chimeric, huma- nized, humanor in vitro-generatedantibodies (or antigenbinding fragments thereof), to human IL‑18, soluble fragments of the IL‑18 receptor, and IL‑18 binding proteins (IL‑18BP). Examples of IL‑1 antagonists include Interleukin‑1-converting enzyme (ICE) inhibitors, such as Vx740, IL‑1 antagonists, e.g., IL‑1 RA (anakinra, Kineret®), sIL1RII, and anti-IL‑1 receptor antibodies (or antigen binding fragments thereof).

[0223] In other embodiments, oneormoreantibodies, e.g., bispecificantibodies, describedhereinmaybeadministered in combinationwith oneormoreof the following: IL‑13antagonists, e.g., soluble IL‑13 receptors (sIL‑13) and / or antibodies against IL‑13; IL‑2antagonists, e.g., DAB486-IL‑2and / orDAB389-IL‑2 (IL‑2 fusionproteins, Seragen), and / or antibodies to IL‑2R, e.g., anti-Tac (humanized anti-IL‑2R, Protein Design Labs). Yet another combination includes one or more antibodies, e.g., bispecific antibodies, of the invention, antagonistic small molecules, and / or inhibitory antibodies in combinationwith nondepleting anti-CD4 inhibitors (DEC-CE9.1 / SB210396; non-depleting primatized anti-CD4antibody; IDEC / SmithKline). Yet other preferred combinations include antagonists of the costimulatory pathway CD80 (B7.1) or 66 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 CD86 (B7.2), including antibodies, soluble receptors or antagonistic ligands; as well as p-selectin glycoprotein ligand (PSGL), anti-inflammatory cytokines, e.g., IL‑4 (DNAX / Schering); IL‑10 (SCH 52000; recombinant IL‑10 DNAX / Scher- ing); IL‑13 and TGF-beta, and agonists thereof (e.g., agonist antibodies).

[0224] In other embodiments, one or more antibodies, e.g., bispecific antibodies, of the invention can be co-formulated with, and / or co-administeredwith, one ormore anti-inflammatory drugs, immunosuppressants, ormetabolic or enzymatic inhibitors. Non-limiting examples of the drugs or inhibitors that can be used in combination with the antibodies described herein, include, but are not limited to, one or more of: nonsteroidal anti-inflammatory drug(s) (NSAIDs), e.g., ibuprofen, tenidap, naproxen, meloxicam, piroxicam, diclofenac, and indomethacin; sulfasalazine; corticosteroids such. as pre- dnisolone; cytokine suppressive anti-inflammatory drug(s) (CSAIDs); inhibitors of nucleotide biosynthesis, e.g., inhibitors of purine biosynthesis, folate antagonists (e.g., methotrexate (N‑[4‑[[(2,4-diamino‑6-pteridinyl)methyl]methylamino]ben- zoyl]‑glutamic acid); and inhibitors of pyrimidine biosynthesis, e.g., dihydroorotate dehydrogenase (DHODH) inhibitors. Preferred therapeutic agents for use in combination with one or more antibodies, e.g., bispecific antibodies, of the invention include NSAIDs, CSAIDs, (DHODH) inhibitors (e.g., leflunomide), and folate antagonists (e.g., methotrexate).

[0225] Examples of additional inhibitors include one or more of: corticosteroids (oral, inhaled and local injection); immunosuppresants, e.g., cyclosporin, tacrolimus (FK‑506); and mTOR inhibitors, e.g., sirolimus (rapamycin--RAPA- MUNE® or rapamycin derivatives, e.g., soluble rapamycin derivatives (e.g., ester rapamycin derivatives, e.g., CCI‑779); agents which interfere with signaling by proinflammatory cytokines such as IL‑1 (e.g., IRAK, NIK, IKK, p38 orMAP kinase inhibitors); COX2 inhibitors, e.g., celecoxib, rofecoxib, and variants thereof; phosphodiesterase inhibitors, e.g., R973401 (phosphodiesterase Type IV inhibitor); phospholipase inhibitors, e.g., inhibitors of cytosolic phospholipase 2 (cPLA2) (e.g., trifluoromethyl ketone analogs); inhibitors of vascular endothelial cell growth factor or growth factor receptor, e.g., VEGF inhibitor and / or VEGF-R inhibitor; and inhibitors of angiogenesis. Preferred therapeutic agents for use in combination with the antibodies of the invention are immunosuppresants, e.g., cyclosporin, tacrolimus (FK‑506); mTOR inhibitors, e.g., sirolimus (rapamycin) or rapamycin derivatives, e.g., soluble rapamycin derivatives (e.g., ester rapamycin derivatives, e.g., CCI‑779); COX2 inhibitors, e.g., celecoxib and variants thereof; and phospholipase inhibitors, e.g., inhibitors of cytosolic phospholipase 2 (cPLA2), e.g., trifluoromethyl ketone analogs.

[0226] Additional examplesof therapeutic agents that canbecombinedwith anantibody, e.g., bispecificantigenbinding protein, of the invention include one or more of: 6-mercaptopurines (6-MP); azathioprine sulphasalazine; mesalazine; olsalazine; chloroquine / hydroxychloroquine (PLAQUENIL®); pencillamine; aurothiomalate (intramuscular and oral); azathioprine; coichicine; beta‑2 adrenoreceptor agonists (salbutamol, terbutaline, salmeteral); xanthines (theophylline, aminophylline); cromoglycate; nedocromil; ketotifen; ipratropium and oxitropium; mycophenolate mofetil; adenosine agonists; antithrombotic agents; complement inhibitors; and adrenergic agents.

[0227] Anti-TL1A antibodies of the invention may be combined with TNF-α antagonists for treatment of the same conditions as noted herein for anti-TL1A / anti-TNF-α bispecific antigen binding proteins. SuchTNF-α antagonists include, for example, etanercept, adalimumab, infliximab, golimumab, and certolizumab pegol.

[0228] Non-limiting examples of agents for treating or preventing arthritic disorders (e.g., rheumatoid arthritis, inflam- matory arthritis, rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis and psoriatic arthritis), with which an antibody, e.g., bispecific antigen binding protein, of the invention may be combined include one or more of the following: IL‑12 antagonists as described herein; NSAIDs; CSAIDs; nondepleting anti-CD4 antibodies as described herein; IL‑2 antagonists as described herein; anti-inflammatory cytokines, e.g., IL‑4, IL‑10, IL‑13 and TGF-α, or agonists thereof; IL‑1 or IL‑1 receptor antagonists as described herein; phosphodiesterase inhibitors as described herein; Cox‑2 inhibitors as described herein; iloprost: methotrexate; thalidomide and thalidomide-related drugs (e.g., Celgen); leflunomide; inhibitor of plasminogen activation, e.g., tranexamic acid; cytokine inhibitor, e.g., T‑614; prostaglandin E1; azathioprine; an inhibitor of interleukin‑1 converting enzyme (ICE); zap‑70 and / or 1 ck inhibitor (inhibitor of the tyrosine kinase zap‑70 or 1 ck); an inhibitor of vascular endothelial cell growth factor or vascular endothelial cell growth factor receptor as described herein; an inhibitor of angiogenesis as described herein; corticosteroid anti-inflammatory drugs (e.g., SB203580); TNF-α -convertase inhibitors; IL‑1; IL‑13; IL‑17 inhibitors; gold; penicillamine; chloroquine; hydroxychloroquine; chlorambucil; cyclophosphamide; cyclosporine; total lymphoid irradiation; antithymocyte globulin; CD5-toxins; orally administered peptides and collagen; lobenzarit disodium; cytokine regulating agents (CRAs) HP228 and HP466 (Houghten Pharma- ceuticals, Inc.); ICAM‑1 antisense phosphorothioate oligodeoxynucleotides (ISIS 2302; Isis Pharmaceuticals, Inc.); soluble complement receptor 1 (TP 10; T Cell Sciences, Inc.); prednisone; orgotein; glycosaminoglycan polysulphate; minocycline (MINOCIN®); anti-IL2R antibodies; marine and botanical lipids (fish and plant seed fatty acids); auranofin; phenylbutazone; meclofenamic acid; flufenamic acid; intravenous immune globulin; zileuton; mycophenolic acid (RS‑61443); tacrolimus (FK‑506); sirolimus (rapamycin); amiprilose (therafectin); cladribine (2-chlorodeoxyadenosine); and azaribine. Preferred combinations include one or more antibodies, e.g., bispecific antibodies, of the invention in combination with methotrexate or leflunomide, and in moderate or severe rheumatoid arthritis cases, cyclosporine.

[0229] Preferred examples of inhibitors to use in combination with one ormore antigen binding proteins, e.g., bispecific antigen binding proteins, of the invention to treat arthritic disorders include antagonists of IL‑12, IL‑15, IL‑18, IL‑22; Tcell and B cell-depleting agents (e.g., anti-CD4 or anti-CD22 antibodies); small molecule inhibitors, e.g., methotrexate and 67 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 leflunomide; sirolimus (rapamycin) and analogs thereof, e.g., CCI‑779; cox‑2 and cPLA2 inhibitors; NSAIDs; p38 inhibitors, TPL‑2,Mk‑2andNFκB inhibitors;RAGEor solubleRAGE;P-selectin orPSGL‑1 inhibitors (e.g., smallmolecule inhibitors, antibodies to PSGL‑1, antibodies to P-selectin); estrogen receptor beta (ERB) agonists or ERB-NFκB antagonists. Most preferred additional therapeutic agents that can be co-administered and / or co-formulated with one or more antibodies, e.g., bispecific antibodies, of the invention include one or more of: methotrexate, leflunomide, or a sirolimus (rapamycin) or an analog thereof, e.g., CCI‑779.

[0230] Non-limiting examples of agents for treating or preventing an inflammatory disease or disorder, (e.g., IBD, CD, UC, IBS) with which an antibody, e.g., bispecific antigen binding protein, of the invention can be combined include the following: budenoside; epidermal growth factor; corticosteroids; cyclosporine; sulfasalazine; aminosalicylates; 6-mer- captopurine; azathioprine; metronidazole; lipoxygenase inhibitors; mesalamine; olsalazine; balsalazide; antioxidants; thromboxane inhibitors; IL‑1 receptor antagonists; anti-IL‑1monoclonal antibodies; anti-IL‑6monoclonal antibodies (e.g., anti-IL‑6 receptorantibodiesandanti-IL‑6antibodies); growth factors; elastase inhibitors; pyridinyl-imidazole compounds; IL‑4, IL‑10, IL‑13 and / or TGF.beta. cytokines or agonists thereof (e.g., agonist antibodies); IL‑11; glucuronide- or dextran- conjugated prodrugs of prednisolone, dexamethasone or budesonide; ICAM‑1 antisense phosphorothioate oligodeox- ynucleotides (ISIS 2302; Isis Pharmaceuticals, Inc.); soluble complement receptor 1 (TP10; T Cell Sciences, Inc.); slow- release mesalazine; methotrexate; antagonists of platelet activating factor (PAF); ciprofloxacin; and lignocaine.

[0231] Non-limiting examples of agents for treating or preventing multiple sclerosis with one or more antibodies, e.g., bispecific antibodies, of the invention can be combined include the following: interferons, e.g., interferon-α (e.g., AVONEX®, Biogen) and interferon‑1b (BETASERON®, Chiron / Berlex); Copolymer 1 (Cop‑1; COPAXONE®, Teva Pharmaceutical Industries, Inc.); dimethyl fumarate (e.g., BG‑12; Biogen); hyperbaric oxygen; intravenous immunoglo- bulin; cladribine; corticosteroids; prednisolone; methylprednisolone; azathioprine; cyclophosphamide; cyclosporine; cyclosporine A, methotrexate; 4-aminopyridine; and tizanidine. Additional antagonists that can be used in combination with antibodies of the invention include antibodies to or antagonists of other human cytokines or growth factors, for example, LT, IL‑1, IL‑2, IL‑6, EL‑7, IL‑8, IL‑12 IL‑15, IL‑16, IL‑18, EMAP‑11, GM-CSF, FGF, and PDGF. Antibodies as described herein can be combinedwith antibodies to cell surfacemolecules such as CD2, CD3, CD4, CD8, CD25, CD28, CD30,CD40, CD45,CD69, CD80,CD86,CD90 or their ligands.One ormore antibodies, e.g., bispecific antibodies, of the invention may also be combined with agents, such as methotrexate, cyclosporine, FK506, rapamycin, mycophenolate mofetil, leflunomide, NSAIDs, for example, ibuprofen, corticosteroids such as prednisolone, phosphodiesterase inhibi- tors, adenosine agonists, antithrombotic agents, complement inhibitors, adrenergic agents, agents which interfere with signaling by proinflammatory cytokines as described herein, IL‑1b converting enzyme inhibitors (e.g., Vx740), anti-P7s, PSGL, TACE inhibitors, T-cell signaling inhibitors such as kinase inhibitors, metalloproteinase inhibitors, sulfasalazine, azathioprine, 6-mercaptopurines, angiotensin converting enzyme inhibitors, soluble cytokine receptors and derivatives thereof, as described herein, and anti-inflammatory cytokines (e.g., IL‑4, IL‑10, IL‑13 and TGF).

[0232] Preferred examples of therapeutic agents for multiple sclerosis with which the antibodies of the invention can be combined include dimethyl fumarate (e.g., BG‑12; Biogen), interferon-beta, for example, IFN-β‑1a and IFN-β‑1b; COPAXONE®, corticosteroids, IL‑1 inhibitors, antibodies to CD40 ligand and CD80, IL‑12 antagonists.

[0233] Non-limiting examples of agents for treating or preventing psoriasis with which an antibody, e.g., bispecific antigen binding protein, of the invention can be combined include the following: corticosteroids; vitamin. D3 and analogs thereof; retinoiods (e.g., soriatane); methotrexate; cyclosporine, 6-thioguanine; Accutane; hydrea; hydroxyurea; sulfa- salazine; mycophenolate mofetil; azathioprine; tacrolimus; fumaric acid esters; biologics such as AMEVIVE®, Raptiva ustekinumab, and XP‑828L; phototherapy; and photochemotherapy (e.g., psoralen and ultraviolet phototherapy com- bined).

[0234] Non-limiting examples of agents for treating or preventing inflammatory airway / respiratory disease (e.g., chronic obstructive pulmonary disorder, asthma) with which an antibody, e.g., bispecific antigen binding protein, of the invention can be combined include the following: beta2-adrenoceptor agonists (e.g., salbutamol (albuterol), levalbuterol, terbuta- line, bitolterol); long-acting beta2-adrenoceptor agonists (e.g., salmeterol, formoterol, bambuterol); adrenergic agonists (e.g., inhaled epinephrine and ephedrine tablets); anticholinergic medications (e.g., ipratropium bromide); combinations of inhaled steroids and long-acting bronchodilators (e.g., fluticasone / salmeterol (ADVAIR® in the United States, and Seretide in the United Kingdom)) or. budesonide / formoterol (SYMBICORT®)); inhaled glucocorticoids (e.g., ciclesonide, beclomethasone, budesonide, flunisolide, fluticasone, mometasone, triamcinolone); leukotriene modifiers (e.g., mon- telukast, zafirlukast, pranlukast, and zileuton); mast cell stabilizers (e.g., cromoglicate (cromolyn), and nedocromil); antimuscarinics / anticholinergics (e.g., ipratropium, oxitropium, tiotropium); methylxanthines (e.g., theophylline, amino- phylline); antihistamines; IgE blockers (e.g., omalizumab); M3 muscarinic antagonists (anticholinergics) (e.g., ipratro- pium, tiotropium); cromones (e.g., chromoglicate, nedocromil); zanthines (e.g., theophylline); IL‑17 inhibitors (e.g., brodalumab, secukinumab, ixekizumab), IL‑4 inhibitors; and IL‑13 inhibitors.

[0235] In one embodiment, an antibody, e.g., bispecific antigen binding protein, of the invention can be used in combination with one or more antibodies directed at other targets involved in regulating immune responses, e.g., transplant rejection. 68 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55

[0236] Non-limiting examples of agents for treating or preventing immune responses with which an antibody, e.g., bispecific antigen binding protein, of the invention can be combined include the following: antibodies against other cell surface molecules, including but not limited to CD25 (interleukin‑2 receptor-α), CD11a (LFA‑1), CD54 (ICAM‑1), CD4, CD45, CD28 / CTLA4 (CD80 (B7.1), e.g., CTLA4 Ig (abatacept , ORENCIA®), ICOSL, ICOS and / or CD86 (B7.2). In yet another embodiment, an antibody of the invention is used in combination with one or more general immunosuppressive agents, such as cyclosporin A or FK506.

[0237] In other embodiments, antibodies are used as vaccine adjuvants against autoimmune disorders, inflammatory diseases, etc. The combination of adjuvants for treatment of these types of disorders are suitable for use in combination with a wide variety of antigens from targeted self-antigens, i.e., autoantigens, involved in autoimmunity, e.g., myelin basic protein; inflammatory self-antigens (e.g., amyloid peptide protein) or transplant antigens (e.g., alloantigens). The antigen may comprise peptides or polypeptides derived from proteins, as well as fragments of any of the following: saccharides, proteins, polynucleotides or oligonucleotides, autoantigens, amyloid peptide protein, transplant antigens, allergens, or other macromolecular components. In some instances, more than one antigen is included in the antigenic composition.

[0238] For example, desirable vaccines for moderating responses to allergens in a vertebrate host, which contain the adjuvant combinations of this invention, include those containing an allergen or fragment thereof. Examples of such allergens aredescribed inU.S.Pat. No. 5,830,877andPCTPublicationNo.WO99 / 51259,which are hereby incorporated by reference in their entireties, and include pollen, insect venoms, animal dander, fungal spores and drugs (such as penicillin). The vaccines interfere with the production of IgE antibodies, a known cause of allergic reactions. In another example, desirable vaccines for preventing or treating disease characterized by amyloid deposition in a vertebrate host, which contain the adjuvant combinations of this invention, include those containing portions of amyloid peptide protein (APP). This disease is referred to variously as Alzheimer’s disease, amyloidosis or amyloidogenic disease. Thus, the vaccines of this invention include the adjuvant combinations of this invention plus A.beta. peptide, as well as fragments of Aβ peptide and antibodies to Aβ peptide or fragments thereof.

[0239] In another embodiment, pharmaceutical compositions may be supplied as a kit comprising a container that comprises an antibody, bispecific antigen binding protein or antigen-binding fragment of the invention. Antibodies, e.g., bispecific antibodies, of the invention canbe provided in the formof an injectable solution for single ormultiple doses, or as a sterile powder that will be reconstituted before injection. Alternatively, such a kit can include a dry-powder disperser, liquid aerosol generator, or nebulizer for administration of the antigen binding protein (e.g., anti-TL1A / anti-TNF-α bispecific antigen binding protein). Such a kit may further comprise written information on indications and usage of the pharmaceutical composition. Moreover, such information may include a statement that the antibody composition is contraindicated in patients with known hypersensitivity to TL1A and TNF-α .

[0240] In a further embodiment, the inventionprovidesanarticle ofmanufacture, comprising: (a) a compositionofmatter comprisinganantibody, bispecific antigenbindingprotein or antigen-binding fragment as describedherein; (b) a container containingsaidcomposition;and (c)a label affixed tosaidcontainer, orapackage insert included insaidcontainer referring to the use of said antibody in the treatment of an immune related disease.

[0241] In another aspect, the composition comprises a further active ingredient, which may, for example, be a further antibody or an anti-inflammatory, cytotoxic or chemotherapeutic agent. Preferably, the composition is sterile.

[0242] The antibodies, e.g., bispecific antibodies, as described herein are also useful to prepare medicines and medicaments for the treatment of immune-related and inflammatory diseases, including for example, IBS, IBD, CD, UC. In a specific aspect, such medicines and medicaments comprise a therapeutically effective amount of a bispecific antigen binding protein, antibody or antigen-binding fragment of the invention with a pharmaceutically acceptable carrier. In an embodiment, the admixture is sterile.

[0243] The bispecific antigen binding proteins of the invention are useful for detecting TL1A and / or TNF-α in biological samples and identification of cells or tissues that express the TL1A receptorDR3and / or TNF-α receptor. For instance, the bispecific antigen binding proteins can be used in diagnostic assays, e.g., binding assays to detect and / or quantify TL1A and / or TNF-α binding and / or expression in a tissue or cell. In addition, the bispecific antigen binding proteins described herein can be used to inhibit TL1A from forming a complexwith its receptor DR3, therebymodulating the biological activity of TL1A or DR3 in a cell or tissue. Likewise, the bispecific antigen binding proteins described herein can be used to inhibit TNF-α from forming a complex with its receptor, therebymodulating the biological activity of TNF-α or its receptor in a cell or tissue. Exemplary activity that can bemodulated includes, but is not limited to, inhibiting and / or reducing inflammation.

[0244] Thebispecificantigenbindingproteinsdescribedherein canbeused fordiagnostic purposes todetect, diagnose, ormonitor diseases and / or conditions associatedwith TL1Aand / or TNF-α. Also provided aremethods for the detection of the presence of TL1A and / or TNF-α in a sample using classical immunohistological methods known to those of skill in the art. See, for example, Tijssen (1993), Practice and Theory of Enzyme Immunoassays, Vol 15 (Eds R.H. Burdon and P.H. vanKnippenberg,Elsevier,Amsterdam);Zola (1987),MonoclonalAntibodies:AManual ofTechniques, pp.147‑158 (CRC Press, Inc.); Jalkanen et al. (1985), J. Cell. Biol. 101:976‑985; Jalkanen et al. (1987), J. Cell Biol. 105:3087‑3096. The detection of either TL1A and / or TNF-α can be performed in vivo or in vitro.

[0245] Diagnostic applications provided herein include use of the antigen binding proteins to detect expression of TL1A 69 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 and / or TNF-α and binding of these ligands to their receptors. Examples ofmethods useful in the detection of the presence of the ligand include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmu- noassay (RIA).

[0246] For diagnostic applications, the antigen binding protein typically will be labeled with a detectable labeling group. Suitable labeling groups include, but are not limited to, the following: radioisotopes or radionuclides (e.g., 3H, 14C, 15N, 35S, 90Y, 99Tc, 111In, 125I, 131I), fluorescent groups (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic groups (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescent groups, biotinyl groups, or predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies,metal binding domains, epitope tags). In someembodiments, the labeling group is coupled to the antigen binding protein via spacer arms of various lengths to reduce potential steric hindrance. Variousmethods for labeling proteins are known in the art and may be used.

[0247] In another embodiment, the bispecific antigen binding protein described herein can be used to identify a cell or cells that express TL1A and / or TNF-α. In a specific embodiment, the antigen binding protein is labeled with a labeling group and the binding of the labeled antigen binding protein to TL1A and / or TNF-α is detected. In a further specific embodiment, the binding of the antigen binding protein to TL1A and / or TNF-α is detected in vivo. In a further specific embodiment, the bispecific antigen binding protein is isolated and measured using techniques known in the art. See, for example,HarlowandLane, 1988, Antibodies: A LaboratoryManual, NewYork: ColdSpringHarbor (ed. 1991andperiodic supplements); John E. Coligan, ed., 1993, Current Protocols In Immunology New York: John Wiley & Sons.

[0248] Anotheraspect of the inventionprovides fordetecting thepresenceofa testmolecule that competes forbinding to TL1A and / or TNF-α with the antigen binding proteins described herein. An example of one such assay would involve detecting the amount of free antigen binding protein in a solution containing an amount of TL1A and / or TNF-α in the presence or absence of the test molecule. An increase in the amount of free antigen binding protein (i.e., the antigen binding protein not bound to TL1A and / or TNF-α) would indicate that the test molecule is capable of competing for TL1A and / or TNF-αbindingwith thebispecific antigenbinding protein. In oneembodiment, the antigenbindingprotein is labeled with a labeling group. Alternatively, the test molecule is labeled and the amount of free test molecule is monitored in the presence and absence of the antigen binding protein. WORKING EXAMPLES

[0249] The invention is further illuminated by the followingworking examples, which exemplify but do not limit the scope of the invention EXAMPLE 1 Preparation of XenoMouse® anti-TL1A monoclonal antibodies Mouse strains

[0250] Fully human antibodies to human TL1A were generated by immunizing XENOMOUSE® transgenic mice. U.S. Pat. Nos. 6,114,598; 6,162,963;6,833,268; 7,049,426; 7,064,244, which are incorporated herein by reference in their entirety; Green et al. (1994), Nature Genetics 7:13‑21; Mendez et al. (1997), Nature Genetics 15:146‑156; Green and Jakobovitis (1998), J.Ex.Med,188:483‑495;KellermanandGreen (2002),CurrentOpinion inBiotechnology13, 593‑597; eachofwhich is incorporatedby reference in its entirety.Animals from theXMG1-KL,XMG2-K,XMG2-K / Balbc,XMG2-KL, XMG4-K and XMG4-KL XENOMOUSE® strains were used for all immunizations. Generation of TL1A Immunogen

[0251] TL1A polypeptides containing the N-terminal His tag (H6) of which the first 22 amino acids are the VK1 signal peptide) were generated by transiently transfecting 293HEK cells with the corresponding cDNAs. The commonly used polyHis tag was employed to facilitate detection and subsequent purification.

[0252] 293‑6Ecells at 9.48x105 cells / mlwere transfectedwith 0.5mg / LDNA (0.1mg / LHis-TL1A in pTT5vectorwith 0.4 mg / L empty pTT5 vector) (Durocher et al. (2002) NRCC, Nucleic Acids. Res. 30, e9) with 3 ml PEI / mg DNA in FreeStyle 293 media (Invitrogen). Tryptone N1 was added to cultures 1 hour after transfection. Cells were grown in suspension in FreeStyle293expressionmediumsupplementedwith0.1%PluronicF68and50µg / mlGeneticin for 7daysandharvested for purification. EXAMPLE 2 70 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 Generation of TL1A

[0253] TL1A polypeptides containing the N-terminal His tag (H6) of which the first 22 amino acids are the VK1 signal peptide) were generated by transiently transfecting 293HEK cells with the corresponding cDNAs. The commonly used polyHis tag was employed to facilitate detection and subsequent purification.

[0254] 293‑6E cells at 9.48x105 cells / ml were transfected with 0.5mg / L DNA (0.1mg / L His-TL1A in pTT5 vector with 0.4mg / L empty pTT5 vector) (Durocher et al. NRCC,NucleicAcids.Res. (2002) 30, e9)with 3mlPEI / mgDNA inFreeStyle 293 media (Invitrogen). Tryptone N1 was added to cultures 1 hour after transfection. Cells were grown in suspension in FreeStyle293expressionmediumsupplementedwith0.1%PluronicF68and50µg / mlGeneticin for 7daysandharvested for purification. Immunizations

[0255] Immunizations are conducted using one or more suitable forms of TL1A antigen, including recombinant human TL1A expressed on cells and recombinant human TL1A soluble protein or combinations thereof.

[0256] A suitable amount of immunogen (i.e., 10 µg of protein delivered by injection to the abdomen) is used for initial immunization inXenoMouse®.Following the initial immunization, subsequentboost immunizationsof immunogen (i.e., 2 x 10e6cellsor5µgofprotein) areadministeredonascheduleand for thedurationnecessary to induceasuitable titer ofanti- TL1A antibody in the mice. Titers are determined by any suitable method, for example, enzyme immunoassay or fluorescence activated cell sorting (FACS).

[0257] Multiple immunogens and routes of immunization were used to generate anti-human TL1A immune responses. For genetic immunizations, mice were immunized 12‑16 times over 6‑8 weeks using the Helios Gene Gun system according to themanufacturer’s instructions (BioRad,Hercules,California). Briefly, expression vectors encodingwild type humanor cynomolgusTL1Awere coated onto gold beads (BioRad,Hercules, California) and delivered to theepidermis of a shavedmouseabdomen. For cell-based immunizations,micewere immunizedwith a suspension-adaptedCHO-K1 cell line (Invitrogen, Carlsbad, California), stably transfected with an expression vector encoding human TL1A. Animals were immunized with cells mixed with Alum prepared from aluminum potassium sulfate (EMDChemicals Inc., Gibbstown, NJ) and CpG-ODN (Eurofins MWGOperon LLC, Huntsville, AL) 10‑12 times over 6‑8 weeks using a protocol that alternated between subcutaneous and intraperitoneal injections. The initial boost was comprised of 4x106 cells while subsequent boosts contained 2x106 cells. For soluble, recombinant protein immunizations, mice were immunized with a 6x His- tagged, trimeric form of the human and cynomolgus TL1A extracellular domain (amino acids 72‑251 of the TL1A sequences). Animals were immunized with recombinant protein mixed with Alum and CpG-ODN, 8‑12 times over 4‑8 weeks using sub-cutaneous injections. The initial boost was comprised of 10µgwhile subsequent boosts contained 5µg. Human TL1A-specific serum titers were monitored by live-cell FACS analysis on an Accuri or FacsCalibur (BD Biosciences) flow cytometer. Animals with the highest antigen-specific serum titers directed against human and cynomolgus TL1A were sacrificed and used for hybridoma generation (Kohler and Milstein, 1975). EXAMPLE 3 Preparation of Monoclonal Antibodies Hybridoma Generation

[0258] Animals exhibiting suitable titers are identified, and lymphocytes are obtained from draining lymph nodes and, if necessary, pooled for each cohort. Pooled lymphocytes (fromeach immunization cohort) were dissociated from lymphoid tissue by grinding in a suitable medium (for example, Dulbecco’s Modified Eagle Medium (DMEM); Invitrogen, Carlsbad, CA).. B cells may be selected and / or expanded using a suitable method, and fused with suitable fusion partner; for example, non-secretory myeloma P3X63Ag8.653 cells (American Type Culture Collection CRL 1580; Kearney et al, J. Immunol. 123, 1979, 1548‑1550), using techniques that are known in the art. B cellswere selected and / or expanded using standard methods, and fused with a suitable fusion partner using techniques that were known in the art.

[0259] In one suitable fusionmethod, lymphocytes aremixedwith fusion partner cells at a ratio of 1:4. The cellmixture is gently pelleted by centrifugation at 400 x g for 4 minutes, the supernatant decanted, and the cell mixture gently mixed (for example, by using a 1ml pipette). Fusion is induced with PEG / DMSO (polyethylene glycol / dimethyl sulfoxide; obtainable from Sigma-Aldrich, St. Louis MO; 1 ml per million lymphocytes). PEG / DMSO is slowly added with gentle agitation over one minute followed, by one minute of mixing. IDMEM (DMEM without glutamine; 2 ml per million B cells), is then added over 2minuteswith gentle agitation, followedbyadditional IDMEM(8ml permillionB-cells)which is addedover 3minutes.

[0260] The fused cells are gently pelleted (400 x g, 6minutes) and resuspended in 20ml Selectionmedia (for example, DMEM containing Azaserine and Hypoxanthine [HA] and other supplemental materials as necessary) per million B-cells. 71 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 Cellsare incubated for20‑30minutesat37Cand then resuspended in200mlSelectionmediaandcultured for three to four days in T175 flasks prior to 96-well plating.

[0261] Cells are distributed into 96-well plates using standard techniques tomaximize clonality of the resulting colonies. After several days of culture, supernatants are collected and subjected to screening assays as detailed in the examples below, including confirmation of binding to human TL1A, evaluation of cross-reactivity with other species’ TL1A (for example, cynomologous monkey TL1A), and ability to inhibit the activity of TL1A. Positive cells are further selected and subjected to standard cloning and subcloning techniques. Clonal linesmay be expanded in vitro, and the secreted human antibodies obtained for analysis.

[0262] In this manner, mice were immunized with recombinant human TL1A soluble protein for a total of 15 immuniza- tions over a period of approximately 2 months; several hybridoma cell lines secreting TL1A-specific antibodies were obtained, and the antibodies were further characterized. The sequences thereof are presented in the Sequence Listing and in Tables A, C and D and results of various tests using these antibodies are shown herein.

[0263] Tables A to E herein show the sequences of anti-TL1A antibodies prepared in accordance with this working example. EXAMPLE 4 Antigen Enrichment of Hybridoma Pools

[0264] Fused hybridoma pools from select immune tissue harvest were used as a source of material for FACS-based enrichments. To enrich for hybridomas expressing antibodies specific to native (full length, on-cell) human TL1A membranes were prepared from 293Tcells transiently expressing the TL1A cDNA construct. 24 hours after transfection using 293Fectin™ (ThermoFisher Scientific Inc.) cells were biotinylated with E-Z link NHS-LC-LC‑ Biotin according to the manufacturer’s recommendation (ThermoFisherScientific Inc.). After biotinylation, cellswerehomogenizedwith aneedle and syringe to formmembrane fragments and referred to as "membrane preps". The biotinylated membrane preps were then used to detect hybridomas expressing surface antibodies specific to the target of interest via standard biotin- streptavidin chemistry.

[0265] To enrich hybridoma pools for the antigen of interest, they were first incubated with the membrane prep probe. Unbound probewas thenwashed away and the antigen-specific hybridomaswere identified by simultaneous detection of surface IgG (with an Alexa 488 conjugated Gt anti-human Fc secondary antibody; Jackson ImmunoResearch) and the biotinylated membrane prep TL1A probe (Alexa Fluor 647 conjugated streptavidin; Jackson ImmunoResearch). Hybri- domas expressing surface IgG and binding antigen were detected by FACS analysis on an Accuri flow cytometer. Dual positive events were sorted as single cells into 384-well plates on a FACSAria cell sorter (BD Biosciences). After several days of culture, the hybridoma supernatants containing monoclonal antibodies were collected and used in the screening assays described in the examples below. EXAMPLE 5 Initial Selection of TL1A-Specific Binding Antibodies

[0266] Human TL1A was expressed on host Human Embryonic Kidney 293 cells by transfection using an expression vector expressing huTL1A cDNA, Gibco™ Opti-MEM® media (Gibco, Cat. No. 31985088) and 293Fectin™ reagent (Invitrogen, Cat. No. 12347019) following the protocol set out by the manufacturer. Hybridoma supernatants were screened for the presence of huTL1A-specificmonoclonal antibodies using the FMAT8200ScreeningSystem (Molecular Devices) and the CellInsight™High Content Imaging Platform (ThermoFisher Scientific). The number of huTL1A positive wells (i.e., those that havesignal over irrelevant hybridomasupernatant) is presented inTable5.1. ForCellInsight screens, 15 µl / well of hybridoma supernatant (and positive and negative controls) were added to black, 384-well, clear bottom plates (CorningCan.No. 3712) followedby theadditionof 30µl / well of amixture of TL1A / 293Tcells, nuclearHoescht stain (Pierce, Cat. No. 62249) and Alexa 488-goat anti-human IgG (H+L) (Jackson, Cat. No. 109‑545‑088). After 3 hours of incubation at room temperature, plateswerewashed 2 times on anAquaMax 4000 platewasher (fittedwith a 384-well cell wash head) and read on the CellInsight instrument according to the manufacturer’s recommendations. For FMAT-based screens, 20 µl / well of hybridoma supernatant (and positive and negative controls) were added to black, 384-well, clear bottom plates followed by addition of 40 µl / well of a mixture of TL1A / 293Tcells, 293T parental cells and Cy5-goat anti- human IgG (Fc) (Jackson, Cat. No. 109‑075). After 3 hours of incubation at room temperature, plates were read on the FMAT 8200 system according to the manufacturer’s recommendations. 72 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 Table 5.1: TL1A-specific antibodies selected Harvest # Platform Total # Positive 1 FMAT 8200 1488 2 FMAT 8200 900 5 Cellinsight 1830 6 FMAT 8200 438 7&8 Cellinsight 1541 EXAMPLE 6 Identification of TL 1A Receptor-Ligand Blocking Antibodies

[0267] Biotinylated huTL1Awas prepared by reacting 100µg / ml of NHS LC LC biotin (Pierce, Cat. No. 21338) and 100 µghuTL1A (prepared as described inExample 2) in 1ml of PBSpH8.5 for 1hr at room temperature.Un-reacted biotinwas removed by ultra-filtration using a 5 kDa Amicon Ultra spin column (Millipore, Cat. No. UFC8 005). Hybridoma super- natants containing huTL1A-binding antibodies were assayed for their ability to block huTL1A binding to human Death Receptor3 (huDR3) viaanELISA-based receptor-ligandassay.ELISAplates (CorningCat.No.3702)werecoatedwith40 µl / well of humanDR3-Fc chimera (1µg / ml) (R&DSystems,Cat. No. 943-D3) in coating buffer (1xPBS / 0.05%azide), then incubatedovernight at 4°C.Plateswere thenwashedwithwater3 timesandblockedwith90µl diluent (1xPBS / 1%milk) for 30 min at room temperature. 15 µl of anti-TL1A hybridoma supernatant was preincubated with 45 µl of biotinylated TL1A (30 ng / ml final) in 96-well storage plates (Sigma, Cat. No. P6866) in assay diluent for 2 hr at room temperature prior to adding to the pre-blocked DR3 ELISA plates. Assay plates were then incubated for 1 hr at room temperature. Sample plates were subsequently washed 3 times followed by the addition of 40 µl / well of streptavidin-HRP (Pierce, Cat. No. 21126) and another 1 hr incubation at room temperature. Plates were washed an additional three times and 40 µl TMB (Neogen, Cat. No. 308177) was added. The TMB reaction was incubated for 30 min at room temperature and then quenchedwith40µl / well of 1Nhydrochloric acid.Finally, plateswere readonanELISAplate readerat awavelengthof450 nm. Cutoffs were set at < 38% of signal of negative control, irrelevant ESNs (exhausted supernatants). The numbers of samples able to block the huTL1A-DR3 interaction (as defined by this cutoff) are indicated in Table 6.1. Table 6.1: Selected TL1A / DR3 blockers Harvest # Total # TL1A / DR3 blockers 1 208 2 39 EXAMPLE 7 TL1A functional blocking assays

[0268] In order to screen for hybridomascapableof blockingTL1A functional activity, IFNγ release fromprimaryTcells or aNF-κB reporter assay in TF1 cells were employed. For the IFNγ release assay, purified primary humanTcells (Biological Speciality Corp.,Cat. # 215‑01‑10) were stimulated with soluble human TL1A in the presence or absence of hybridoma supernatants specific toTL1A. 2 x105primary humanTcellswere stimulatedwith 8 - 16ng / mLhumanTL1A (Amgen), 1 - 2 ng / mL IL‑12 (Peprotech) and 0.5 - 1 ng / mL IL‑18 (R&D Systems) in the presence of hybridoma supernatants containing anti-TL1A antibodies in 96-well round bottom plate at 37 °C for 72 hours. Culture supernatants were then tested for IFNγ level by ELISA according to the manufacturer’s instructions (R&D Systems). For theTL1A responsive reporter assay, a TF‑1NF-κB reporter cell line (Amgen)was stimulatedwith soluble or membrane-bound human TL1A or soluble cynomolgus monkey TL1A. 0.2 ‑3 nM or 2 - 20 nM of soluble human or cynomolgusmonkeyTL1A (respectively)was incubatedwith 104 - 105TF‑1NF-κB reporter cells in thepresenceof serially diluted hybridoma supernatants (or controls) in 96 or 384-well plates at 37 °C overnight. For testing samples against membrane-bound TL1A, activity assays were performed by co-culturing the TF‑1 NF-κB reporter cell line with human TL1A-expressing AM1D cells. 105 TF‑1 NF-xB reporter cells and 103 AM1D cells were co-cultured in the presence of 5 ug / mLof anti-TL1Aantibody (or controls) in a384-well plate at 37 °Covernight.Reporter signal in eachwellwasdetermine using the Steady-Glo Luciferase Assay System according to the manufacturer’s recommendation (Promega). 73 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 EXAMPLE 8 Molecular Rescue and Sequencing of TL1A Receptor-Ligand Blocking Antibodies

[0269] RNA (total or mRNA) was purified from wells containing the TL1A-neutralizing antibody-producing hybridoma cells using aQiagenRNeasymini or the InvitrogenmRNA catcher plus kit. Purified RNAwas used to amplify the antibody heavy and light chain variable region (V) genes using cDNA synthesis via reverse transcription, followed by a polymerase chain reaction (RT-PCR). The fully human antibody gamma heavy chain was obtained using the Qiagen One Step Reverse Transcriptase PCR kit (Qiagen). Thismethodwas used to generate the first strand cDNA from theRNA template and then to amplify the variable region of the gamma heavy chain using multiplex PCR (see Table 8.1 for the complete primer list, SEQ IDNOS:1191 to1252, respectively). The5’ gammachain-specificprimer annealed to thesignal sequence of the antibody heavy chain, while the 3’ primer annealed to a region of the gamma constant domain. The fully human kappa light chain was obtained using the Qiagen One Step Reverse Transcriptase PCR kit (Qiagen). This method was used to generate the first strand cDNA from the RNA template and then to amplify the variable region of the kappa light chain using multiplex PCR. The 5’ kappa light chain-specific primer annealed to the signal sequence of the antibody light chain while the 3’ primer annealed to a region of the kappa constant domain. The fully human lambda light chain was obtained using theQiagenOneStepReverse Transcriptase PCRkit (Qiagen). Thismethodwas used to generate the first strand cDNA from theRNA template and then to amplify the variable region of the lambda light chain usingmultiplex PCR. The 5’ lambda light chain-specific primer annealed to the signal sequence of light chain while the 3’ primer annealed to a region of the lambda constant domain.

[0270] The amplified cDNA was purified enzymatically using exonuclease I and alkaline phosphatase and the purified PCR product was sequenced directly. Amino acid sequences were deduced from the corresponding nucleic acid sequences bioinformatically. Two additional, independent RT-PCR amplification and sequencing cycles were completed for each hybridoma sample in order to confirm that any mutations observed were not a consequence of the PCR. The derived amino acid sequences were then analyzed to determine the germline sequence origin of the antibodies and to identify deviations from the germline sequence. The amino acid sequences corresponding to CDRs of the sequenced antibodies were aligned and these alignments were used to group the clones by similarity. Table 8.1: Multiplex primers used to amplify antibody V genes. Heavy chain Sequence 5’ to 3’ SEQ ID NO. C ACC ATG GAC TGG ACC TGG AGG ATC 1191 C ACC ATG GAC TGG ACC TGG AGC ATC 1192 C ACC ATG GAC TGC ACC TGG AGG ATC 1193 C ACC ATG GAC TGG ACC TGG AGA ATC 1194 C ACC ATG GAC TGG ACC TGG AGG G 1195 C ACC ATG GAC TGG ATT TGG AGG ATC C 1196 C ACC ATG GAC ACA CTT TGC TCC ACG 1197 C ACC ATG GAC ACA CTT TGC TAC ACA CTC C 1198 C ACC ATG GAG TTT GGG CTG AGC TG 1199 5’ primer C ACC ATG GAA TTG GGG CTG AGC TG 1200 C ACC ATG GAG TTG GGG CTG AGC TG 1201 C ACC ATG GAA CTG GGG CTC CGC 1202 C ACC ATG GAA TTT GGG CTG AGC TGG 1203 C ACC ATG GAG TTG GGG CTG TGC TG 1204 C ACC ATG GAG TTT GGG CTT AGC TGG 1205 C ACC ATG GAG TTT TGG CTG AGC TGG 1206 C ACC ATG AAA CAC CTG TGG TTC TTC CTC 1207 C ACC ATG AAG CAC CTG TGG TTC TTC C 1208 C ACC ATG AAA CAT CTG TGG TTC TTC CTT CTC 1209 74 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Heavy chain Sequence 5’ to 3’ SEQ ID NO. C ACC ATG GGG TCA ACC GCC ATC C 1210 C ACC ATG TCT GTC TCC TTC CTC ATC TTC 1211 3’ primer GCTGAGGGAGTAGAGTCCTGAGGACTGT 1212 Kappa chain Sequence 5’ to 3’ SEQ ID NO. C ACC ATG GAC ATG AGG GTC CCC G 1213 C ACC ATG GAC ATG AGG GTC CCT GC 1214 C ACC ATG GAC ATG AGG GTC CTC GC 1215 C ACC ATG AGG CTC CCT GCT CAG C 1216 C ACC ATG AGG CTC CTT GCT CAG CTT C 1217 C ACC ATG GAA ACC CCA GCG CAG C 1218 5’ primer C ACC ATG GAA GCC CCA GCG CAG 1219 C ACC ATG GAA GCC CCA GCT CAG 1220 C ACC ATG GAA CCA TGG AAG CCC CAG 1221 C ACC ATG GTG TTG CAG ACC CAG GTC 1222 C ACC ATG GGG TCC CAG GTT CAC C 1223 C ACC ATG TTG CCA TCA CAA CTC ATT GGG 1224 C ACC ATG GTG TCC CCG TTG CAA TTC 1225 3’ primer ACCCGATTGGAGGGCGTTATCCACC 1226 Lambda chain Sequence 5’ to 3’ SEQ ID NO. C ACC ATG GCC TGG TCC CCT CTC 1227 C ACC ATG GCC TGG TCT CCT CTC C 1228 C ACC ATG GCC AGC TTC CCT C TC C 1229 C ACC ATG GCC GGC TTC CCT CTC 1230 C ACC ATG ACC TGC TCC CCT CTC C 1231 C ACC ATG GCC TGG GCT CTG CTC 1232 C ACC ATG GCC TGG GCT CTG CTG 1233 C ACC ATG GCA TGG ATC CCT CTC TTC 1234 C ACC ATG GCC TGG ACC GCT CTC 1235 C ACC ATG GCC TGG ACC CCT CTC 1236 C ACC ATG GCC TGG ATC CCT CTC C 1237 C ACC ATG GCC TGG ACC GTT CTC C 1238 C ACC ATG GCA TGG GCC ACA CTC C 1239 5’ primer C ACC ATG GCC TGG ATC CCT CTA C 1240 C ACC ATG GCC TGG GTC TCC TTC TAC 1241 C ACC ATG GCC TGG ACC CAA CTC C 1242 C ACC ATG GCT TGG ACC CCA CTC C 1243 C ACC ATG GCC TGG ACT CCT CTC C 1244 C ACC ATG GCC TGG ACT CCT CTT CTT C 1245 C ACC ATG GCC TGG ACT CTT CTC CTT C 1246 75 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) Lambda chain Sequence 5’ to 3’ SEQ ID NO. C ACC ATG GCC TGG GCT CCA CTA C 1247 C ACC ATG GCC TGG ACT CCT CTC TTT C 1248 C ACC ATG GCC TGG ATG ATG CTT CTC C 1249 C ACC ATG GCC TGG GCT CCT CTG 1250 C ACC ATG CCC TGG GCT CTG CTC 1251 3’ primer GGA GGG TKT GGT GGT CTC CAC TCC C 1252 (where K = G + T) EXAMPLE 9 Preparation of hetero Ig constructs

[0271] Generation of a bispecific antibody through co-expression of two different antibodies leads to contaminants primarily consisting of mispaired heavy and light chains. The preferred bispecific, heterotetramer molecule with two different heavy chains associated with correctly paired light chains is only a minority of the total amount of combinations that can assemble. The contaminants occur mainly due to two different reasons. The first reason is that the heavy chain that comes together at the Fc region of the antibody can homodimerize, leading to conventionalmonospecific antibody, or heterodimerize, leading toapotential bispecificantibody.Thesecond reason is that light chain is promiscuousandcanpair with either of the heavy chains, leading to mispaired light-heavy chain Fab assembly that may not retain binding to the desired target. For these reasons, the bispecific engineering is a two-step process. The first goal is to prevent the homodimerization of the heavy chains and encourage heterodimerization. This can be achieved through engineering the Fc region of the antibodies, using, for example, the knobs-into-holes or charge pairmutations strategies. The second goal is toengineer the light-heavychain interface in suchaway that the light chain is specifically associatedonlywith its cognate heavy chain.

[0272] The "Hetero-Ig" platform technology (see, e.g.,WO2009089004 andWO2014081955, both of which are hereby incorporated by reference in their entireties) takes advantage of the electrostatic steering mechanism to overcome the pairing problems mentioned above. Specifically, charged residues are introduced or exploited to drive heavy chain heterodimerization and correct light-heavy chain association. The charge pairmutations (CPMs) in theCH3domain of the Fc region drive the heterodimerization of the two different heavy chains through opposite charges that cause electrostatic attraction (see, e.g., WO2009089004 and U.S. Patent No. 8,592,562); the two identical heavy chain combinations have identical juxtaposed charges and are therefore repelled.

[0273] The correct heavy chain-light chain pairing is facilitated by CPMs at the HC / LC binding interface or the HCl / HC2 binding interface (see Figure 1). The correct heavy chain-light chain combinations will have opposite charges and therefore be attracted to each other, whereas the incorrect heavy chain-light chain combinations will have the same charges juxtaposed, resulting in repulsion. In Figure 1, correctly assembled hetero-Ig molecules have two or three HC1 / HC2 CPMs and two to four HC / LC CPMs that drive the assembly of the preferred heterotetramer comprising two different heavy chainsand twodifferent light chains so that theheterotetramerwill be themajority component generatedby the expression system. TheDNAs encoding anti-TL1A / anti-TNF-α hetero Ig-s contain fragments coding for anti-TL1A (or anti-TNF-α) heavy chain andanti-TNF-α (or anti-TL1A) Fab.TheDNAswere cloned into pTT5.1 vector. Theseexpression vectors were then used to transfect and express anti-TL1A / anti-TNF-α bi-specifics in human 293 6E cells.

[0274] Anti-TNF-α antibodies 3.2, 234 and certolizumab were used with anti-TL1A antibodies 3B3, 2G11, 23B3 VH3, 23B3VH4, and3C6 toengineer hetero Igmoleculesasdescribed inTable Jusinghigh throughput cloning, expressionand purification.Eachof thebispecifichetero Igmoleculeshadoneof the four formatsshown inFigure1using the IgG1effector functionless scaffold or an IgG2 scaffold. Preferred IgG molecules incorporate the charge mutations shown in Figure 1 (v2), which are shown in TableM. The IgG1 effector functionless scaffold comprises substitutions R292C and V302C and may also comprise substitution N297G (also known as the SEFL2 scaffold). EXAMPLE 10 Method for Expression and Purification of anti-TL1A / anti-TNFα Hetero-Ig Molecules

[0275] Hetero-Ig expression was performed via transient transfection of 293‑6E cells. One day prior to transfection N‑1 76 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 culturewasset up ina20LWavebag,at 36 °C‑37 °C, 5%CO2, 0.2LPMoverlaywitha total volumeof 9Lof cultureat 8.5E5 vc / mL in Freestyle F‑17 media (Thermo Fisher). The transfection complex was then prepared by mixing FreeStyle F‑17 media, pre-warmed with 0.5 mg / L transfection DNA, with a 1:1:1:1 plasmid DNA chain ratio. Transfection complex (media+DNA+PEI reagent) volume was 10% of final culture volume. Four hours post-transfection , a feed of yeastolate and glucose was added. Culture was harvested on day six at 2.11 E6 cells / mL and 78.2% viability. Expression titer was measured using the ForteBio Octet Q System at 84.0 mg / L. The conditioned media was harvested by centrifugation and filtered using 0.2 µm cellulose acetate filter using a peristaltic pump.

[0276] For purification, the hetero-Ig molecules were affinity captured by MabSelect SuRe chromatography (GE Life Sciences, Piscataway, NJ), using Dulbecco’s PBS without divalent cations (Invitrogen, Carlsbad, CA) as the wash buffer and 100 mM acetic acid, pH 3.6 as the elution buffer (Figure 3). All separations were carried out at ambient temperature. Theelution peakwaspooledbasedon the chromatogram, neutralized to pH7.0using2M tris base, dilutedwith 5-volumes water, and filtered through a 0.22µmcellulose acetate filter. To remove half antibody species, the samplewas then loaded on to anSP-HPsepharose column (GELifeSciences, Piscataway,NJ) andwashedwith 8 column volumesof SP-BufferA (20 mM sodium phosphate, pH 7.0) followed by elution using a 20 column volume gradient to 60% SP-Buffer B (20 mM sodium phosphate, 1 M NaCl, pH 7.0) (Figure 4). A pool was made based on the chromatogram and Caliper LabChip (Perkin Elmer, Waltham, MA) analysis of fractions. The pool was conditioned with an equal volume of 2X HIC Buffer (200 mMsodiumphosphate, 1.5Mammoniumsulfate, pH7.0) and filtered througha0.22µmcelluloseacetate filter. To remove mispaired species, the sample was loaded on to a Butyl-HP sepharose column (GE Life Sciences, Piscataway, NJ) and washed with 8 column volumes of Butyl-Buffer A (50 mM sodium phosphate, 0.75 M ammonium sulfate, pH 7.0) followed byelution using a20 columnvolumegradient to 100%Butyl-BufferB (50mMsodiumphosphate, pH7.0) (Figure 5). A pool wasmadebasedon the chromatogramandCaliper LabChip (PerkinElmer,Waltham,MA)analysis of fractions under non- reducing and reducing conditions. The pool was diafiltered against approximately 30 volumes of 10 mM sodium acetate, 9% sucrose, pH 5.2 using Slide-A-Lyzer dialysis cassettes with a 10 kDa cutoff membrane (Pierce, Rockford, IL) and further concentrated using a Vivaspin‑20 centrifugal concentrator with a 10 kDa cutoff membrane (Sartorius Stedim Biotech, Goettingen, Germany). The concentrated material was then filtered through a 0.8 / 0.2 µm cellulose acetate filter and the concentration was determined by the absorbance at 280 nm using an extinction coefficient of approximately 212,000. Sample purity was determined by Caliper LabChip analysis under reducing (with 2% 2-mercaptoethanol) and non-reducing (with25mM iodoacetamide) conditions (Figure 6). Analytical SECwascarriedout usingaZenix-CSEC‑300 column (Sepax Technologies, Newark, DE) with an isocratic elution in 50 mM sodium phosphate, 250 mM NaCl, pH 6.9 over 18’ (Figure 7).

[0277] In order to assess both hetero-Ig integrity and confirm heavy chain-light chain pairing, LC-MSwas performed on non-reduced hetero-Ig, as well as hetero-Ig after limited lysyl endoproteinase C (Wako, Richmond, VA) digestion to produce the hetero-Ig Fab’s (fragment antigen binding) regions of the hetero-Ig. Analysis of non-reduced hetero-Ig was performed by simple dilution of 30µg native hetero-Ig sample, 1:1 in 0.1%TFA, and injecting 20µg. Analysis of Fab’swas achieved by incubation of hetero-Ig in the presence of lysyl endoproteinase C using a 1:400 enzyme / substrate ratio in the presence of 100 mMTris, adjusted to pH8, for 30 minutes at 37 °C. The reaction was then stopped by dilution in an equal volume of 0.1% TFA. Initial cleavage of antibody by Lysyl Endoproteinase C is just above the hinge disulfides after the lysine in the sequence motif SCDK / THTCPPC yielding Fab and Fc fragments.

[0278] Mass analysis was performed using an Agilent 6230 ESI-TOFMass Spectrometer and 1260 quaternary HPLC system equipped with a Zorbax 300SB-C8, 2.1 x 50 mm 3.5 µm column (Agilent, Santa Clara, CA). Mobile phase A consisted of 0.1% TFA, and mobile phase B consisted of 90% n-propanol, 0.1% TFA in water. Chromatographic gradient conditions for analysis of non-reduced hetero-Ig were as follows: 20% mobile phase B for 1 minute; 1‑9 min, 20‑70% B; 9‑10 min, 70‑100% B; 10‑11 min, 100% B. Column temperature was kept at 75 °C and post column equilibration at 20% mobile phase B was performed for 7 minutes prior to injection of the next sample. The ESI-TOF settings were as follows: capillary voltage, 5900V; gas temperature, 340 °C; dry gas, 13 L / min; nebulizer pressure, 25 psig; fragmentor voltage 460 V and skimmer voltage, 95 V (figure 8).

[0279] Analysis of hetero-Ig digested with lysl endoproteinase C was conducted by injecting 20µg onto the reverse- phaseHPLC column and eluting using the following LC gradient: 2%mobile phase held for 2minutes; 2‑12min, 2‑45%B; 12‑16 min, 45‑90% B; 16‑17 min 90% B. Column temperature was kept at 75 °C and post column equilibration at 20% mobile phase B was performed for 7 minutes prior to injection of the next sample (figure 9). EXAMPLE 11 Preparation of IgG-ScFv constructs

[0280] Each anti-TL1A / anti-TNF-α IgG-scFv antigen binding protein consists of two antigen binding domains, one directed against TL1A and the other against TNF-α. The DNAs encoding anti-TL1A / anti-TNF-α IgG-scFv contain fragments coding for anti-TL1A (or ant-TNF-α) heavy chain (HC) in which the C-terminus is fused to anti-TNF-a (or anti- 77 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 TL1A) antibody single chain Fv (scFv) (see Figure 2) with or without cysteine clamp for the purpose of improving biophysical properties. In order to introduce the cysteine clamp, positions 44 (Kabat numbering) VH and 100 (Kabat numbering) in VL were mutated to cysteine. The DNAs were cloned into pTT5.1 vector. These expression vectors were then used to transfect and express anti-TL1A / anti-TNF-α bi-specifics in human 293‑6E cells. Full sequences for anti- TL1A / anti-TNF-α IgG-scFv antigen binding proteins produced are shown in Tables L and M. EXAMPLE 12 Method for Purifying anti-TL1A / anti-TNFα IgG-scFv Molecules

[0281] IgG-ScFv expression was performed via transient 293 productions. One day prior to transfection, cultures were set up in eight 5 LThompson Ultra Yield flasks, with a total volume of 2.250 L of culture at 8.5E5 vc / mL each in Freestyle F‑17media (ThermoFisher). The cultureswere kept at 36 °C‑37 °C, 5%CO2 at and shaking at 120RPM. The transfection complexwaspreparedbymixingFreeStyleF‑17mediawith 0.5mg / LDNA, usinga20%of codingplasmidand80%empty pTT5 vector andPEI at 10%final culture volumeFour hours later a yeast lysate and glucose feedwas added to each flask. Six days post transfection the cells were harvested through centrifugation, pooled and filtered. Average titer was measured by Forte Bio Octet at 25 mg / L.

[0282] The IgG-scFv molecules were affinity captured by MabSelect SuRe chromatography (GE Life Sciences, Piscataway, NJ), using Dulbecco’s PBS without divalent cations (Invitrogen, Carlsbad, CA) as the wash buffer and 100mMacetic acid, pH 3.6 as the elution buffer (Figure 10). Affinity separations were carried out at ambient temperature. The elution peak was pooled based on the chromatogram, neutralized to pH 7.0 using 2 M tris base, diluted with one volume 10 mM citrate, 75 mM lysine, 4% trehalose, pH 7.0, and concentrated to approximately 20 mg / mL using a Vivacell‑100 centrifugal concentrator with a 30 kDa cutoff membrane (Sartorius Stedim Biotech, Goettingen, Germany). To remove high molecular weight aggregates, the sample was filtered through a 0.8 / 0.2-µm cellulose acetate filter then loaded on to a Superdex 200 Prep Grade column (GE Life Sciences, Piscataway, NJ) equilibrated with 10 mM citrate, 75 mM lysine, 4% trehalose, pH 7.0 and eluted with an isocratic gradient with the same buffer (Figure 11). Gel filtration separations were carried out at approximately 7 °C. A pool was made based on the chromatogram and analytical SEC of the fractions using a Zenix-C SEC‑300 column (Sepax Technologies, Newark, DE). The pool was further concentrated using a Vivaspin‑20 centrifugal concentrator with a 30 kDa cutoff membrane (Sartorius Stedim Biotech, Goettingen, Germany) and filtered through a 0.8 / 0.2-µmcellulose acetate filter. The concentrationwas determined by the absorbance at 280 nm using an extinction coefficient of approximately 341,000. Sample purity was determined by Caliper LabChip analysis under reducing (with 2% 2-mercaptoethanol) and non-reducing (with 25 mM iodoacetamide) conditions (Figure 12). Analytical SECwascarried out using aZenix-CSEC‑300column (SepaxTechnologies,Newark,DE)with an isocratic elution in 50 mM sodium phosphate, 250 mM NaCl, pH 6.9 over 18’ (Figure 13).

[0283] Due to the large size of the Ig-scFvs, 200 kDa or greater, accurate mass was not achievable by ESI-TOF mass analysis. In order to verify mass and assess the quality, Ig-scFv’s were analyzed after digestion with IdeS protease (Promega, Madison WI), which cleaves just below the IgG hinge disulfides, between glycines in the sequence motif, CPPCPAPELLG / GP yielding (Fab)2 andFcwithC-terminally fused scFv. The Ig-scFv’swere incubated in the presence of IdeSproteaseusinga1:10enzymesubstrate ratio for 1hourat 37 °C.Thesamplewas thendiluted1:1 in0.1%TFA,and20 µg was injected onto LC-MS.

[0284] Mass analysis was performed using an Agilent 6230 ESI-TOFMass Spectrometer and 1260 quaternary HPLC system equipped with a Zorbax 300SB-C8, 2.1 x 50 mm 3.5 µm column (Santa Clara, CA). Mobile phase A consisted of 0.1% TFA, and mobile phase B consisted of 90% n-propanol, 0.1% TFA in water. Analysis of Ig-scFv digested with IdeS Protease was conducted by injecting 20 µg and eluting using the following LC gradient: 2% mobile phase held for 2 minutes; 2‑12 min, 2‑45% B; 12‑16 min, 45‑90% B; 16‑17 min 90% B. Column temperature was kept at 75 °C and post column equilibration at 20%mobile phase B was performed for 7 minutes prior to injection of the next sample (figure 14). EXAMPLE 13 TL1A binding assay

[0285] Goat anti-human Fc (Jackson Lab, Cat#109‑005‑098) was first immobilized on an SCM5 sensor chip using amine coupling. Anti-TL1A monoclonal antibodies, Fab fragment (using anti-huFab antibody, GE Healthcare cat # 28‑9583‑25) or anti-TL1A / anti-TNF-α bispecific molecules were injected to the chip at 10 µl / min for 1 minute. Various concentrations of human or cynomolgus TL1A protein from 0.78 to 25 nM in sample buffer (PBS, 0.005%P20, 0.1 mg / ml BSA) were injected at flow rate of 50 µl / min for 3 min association, 10 min dissociation. On rate, off rate and equilibrium dissociation constant were calculated using 1:1 binding model on BIAevaluation software.

[0286] Tables 13.1‑13.3 showanti-TL1A binding data for anti-TL1A antibodies, hetero Ig bispecific antibodies, and IgG- 78 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 scFv bispecific antibodies. Table 13.1: TL1A binding of anti-TL1A antibodies Anti-TL1A mAb Protein ID SEQ ID NOS: human TL1A cyno TL1A ka (1 / Ms) kd (1 / s) KD (M) ka(1 / Ms) kd (1 / s) KD (M) 3C6 PL‑39112 50, 52 NA <5.0E‑05 <1.0E‑10 5.7E+05 1.4E‑03 2.4E‑09 3B3 parental PL‑39114 66, 68 4.0E+05 9.5E‑05 2.4E‑10 2.5E+05 1.4E‑04 5.7E‑10 5G4 PL‑39115 455, 457 5.0E+05 1.8E‑04 3.6E‑10 2.9E+05 1.9E‑04 6.6E‑10 17E9 PL‑39113 459, 461 2.5E+05 5.3E‑05 2.2E‑10 7.3E+05 2.0E‑03 2.8E‑09 9C8 PL‑39116 58, 60 1.6E+05 5.3E‑05 3.4E‑10 9.4E+04 6.9E‑05 7.3E‑10 23B3 PL‑36543 62, 64 4.7E+05 4.2E‑04 8.9E‑10 2.3E+05 3.2E‑04 1.4E‑09 2G11 PL‑36544 54, 56 1.7E+05 1.8E‑04 1.1E‑09 6.6E+04 4.9E‑05 7.3E‑10 3B3 variant PL‑36552 130, 134 4.3E+05 2.2E‑04 5.0E‑10 2.8E+05 1.4E‑04 5.0E‑10 Table 13.2: TL1A binding of anti-TL1A Fab fragment Anti-TL1A Fab Protein ID human TL1A cyno TL1A ka (1 / Ms) kd (1 / s) KD (M) ka (1 / Ms) kd (1 / s) KD (M) 3C6 PL‑39193 NA <5.0E‑05 <1.0E‑10 NB up to 100 3B3 parental : PL‑39195 4.1E+05 1.6E‑04 4.0E‑10 3.5E+05 1.8E‑04 5.1E‑10 5G4 PL‑39196 4.7E+05 3.3E‑04 7.0E‑10 4.4E+05 1.6E‑04 3.7E‑10 17E9 PL‑39194 NA <5.0E‑05 <1.0E‑10 NB up to 100 nM 9C8 PL‑39197 NA <5.0E‑05 <1.0E‑10 NA <5.0E‑05 <1.0E‑10 23B3 PL‑38024 7.6E+05 6.4E‑04 8.5E‑10 5.3E+05 1.6E‑04 3.1E‑10 2G11 PL‑38025 NA <5.0E‑05 <3.0E‑10 NA <5.0E‑05 <1.0E‑10 3B3 variant PL‑38026 3.8E+05 4.1E‑04 1.1E‑09 4.5E+05 5.6E‑05 1.3E‑10 Table 13.3: TL1A binding of hetero Ig bispecific antibodies iPS anti-TNF anti-TL1A ka (1 / Ms) kd (1 / s) KD (M) 376541 Certolizumab parent 3B3 variant (322520) 7.1E+05 2.1E‑04 3.0E‑10 376542 C234 3B3 variant (322520) 7.1E+05 2.1E‑04 3.0E‑10 376543 Certolizumab variant 3B3 variant (322520) 7.2E+05 2.3 E‑04 3.2E‑10 349461 Certolizumab Variant 2G11 Variant 5.4E+05 1.3E‑04 2.5E‑10 349463 Certolizumab Variant 23B3 VH4 6.3E+05 4.0E‑04 6.4E‑10 371222 3.2 / CC 3B3 variant (322520) 6.6E+05 1.4E‑04 2.1E‑10 EXAMPLE 14 TL1A activity assay

[0287] TL1A activity assay was performed using TF‑1 NF-κB reporter cell line. In brief, 30 ng / ml (EC90) of human or cynomolgusmonkey TL1Awas incubated with 104 TF‑1 NF-κB reporter cells in the presence of serially diluted anti-TL1A antibodies or anti-TL1A / anti-TNF-α bispecificmolecules in 96-well plate at 37 °C overnight. Each well was supplemented with 50 µl of Steady-glo Luciferase testing solution (Promega). Plate was covered and incubated while shaking for 10 minutes. Luciferase activity was analyzed by microbeta reader.

[0288] Tables 14.1‑14.3 show anti-TL1A quality control (QC) and activity data for anti-TL1A antibodies, hetero Ig 79 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 bispecific antibodies, IgG-scFv bispecific antibodies, and Fab’s with both human and cynomolgus monkey TL1A. Table 14.1: anti-TL1A activity of anti-TL1A antibodies and Fab fragments mAb mAb / Fab huTL1A (0.2 nM) NF-kB IC50 nM cyno TL1A (2 nM) NF-kB IC50 nM 3C6 mAb 0.153 >100 Fab 0.162 >100 17E9 mAb 0.168 >100 Fab 70.83 >100 3B3S65A mAb 0.083 0.595 Fab 0.178 0.434 3B3 / 7B3 mAb 0.037 0.390 Fab 0.112 0.647 5G4 mAb 0.058 0.622 Fab 2.838 10.06 2G11 mAb 0.223 0.938 Fab 0.551 1.637 9C8 mAb 0.131 0.721 Fab 2.434 2.748 23B3 mAb 0.089 0.619 Fab 2.992 2.629 80 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 Ta bl e 14 .2 :Q C an d ac tiv ity of he te ro Ig bi sp ec ifi c an tib od ie s SE -H PL C C al ip er A ct iv ity iP S N o. TL 1A TN F- α Fi na lC on e. Fi na lY ie ld H M W M ai n N R 1 N R 2 H C 1 H 2 LC 1 LC 2 TL 1A (p M ) TN F- α (p M ) 37 65 41 C er to liz um ab (p ar en t) 3B 3 (v ar ia nt ) 12 .0 5 29 5 0. 7 99 .3 72 28 42 58 51 49 18 7 51 34 94 61 C er to liz um ab (v ar ia nt ) 2G 11 (v ar ia nt ) 10 .4 9 18 8 0. 7 99 .3 45 55 10 0 0 51 49 12 84 60 34 94 63 C er to liz um ab (v ar ia nt ) 23 B3 (V H 4) 10 .6 1 45 0 0. 6 99 .4 63 37 50 50 33 67 34 64 64 37 65 42 C 23 4 3B 3 (v ar ia nt ) 9. 76 17 4 0. 0 10 0. 0 71 29 44 56 50 50 14 7 54 4 37 65 43 C er to liz um ab (v ar ia nt ) 3B 3 (v ar ia nt ) 13 .6 0 32 0 0. 4 99 .6 75 25 43 57 51 49 15 8 10 7 81 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 Ta bl e 14 .3 :Q C an d ac tiv ity of Ig G -s cF v bi sp ec ifi c an tib od ie s SE -H PL C C al ip er A ct iv ity iP S Ig G sc Fv Fi na l C on e. Fi na l Yi el d H M W M ai n Sh ou ld er N R 1 N R 2 H C 1 LC 1 TL 1A (p M ) TN F- α (p M ) 37 12 13 TN F- α (a da lim um ab ) TL 1A (3 B3 Va r2 ) 12 .4 0 31 0 .0 5 98 .3 1. 4 11 89 81 19 61 64 37 12 17 TN F- α (C 23 4) TL 1A (3 B3 Va r2 / C C ) 13 .0 6 29 0 0. 4 98 .5 1. 2 39 61 81 18 69 40 36 99 89 TN F- α (a da lim um ab ) TL 1A (9 C 8) 13 .8 3 19 9 0. 3 98 .1 1. 1 27 73 76 18 14 0 59 36 99 95 TN F- α (3 .2 ) TL 1A (9 C 8) 15 .8 1 21 7 1. 0 97 .9 1. 6 10 0 80 17 19 9 53 37 00 01 TN F- α (C 23 4) TL 1A (9 C 8) 12 .4 1 28 9 0. 2 98 .2 1. 1 42 58 84 16 11 9 52 36 99 92 TN F- α (a da lim um ab ) TL 1A (9 C 8 / C C ) 11 .4 8 16 9 0. 3 98 .2 1. 6 16 84 84 16 15 1 72 37 00 04 TN F- α (C 23 4) TL 1A (9 C 8 / C C ) 11 .3 4 11 1 0. 3 98 .2 1. 5 45 55 84 16 16 3 70 37 00 13 TL 1A (9 C 8) TN F- α (3 .2 ) 16 .5 3 46 4 0. 3 98 .3 1. 5 41 59 79 18 17 1 25 37 12 19 TL 1A (3 B3 Va r2 ) TN F- α (3 .2 ) 10 .9 19 7 0. 4 98 .1 1. 4 10 0 70 20 53 22 37 12 22 TL 1A (3 B3 Va r2 ) TN F- α (3 .2 / C C ) 20 .0 7 15 7 0. 2 98 .3 1. 5 10 0 78 18 86 26 37 00 18 TL 1A (2 3B 3) TN F- α (a da lim um ab ) 11 .5 9 11 2 2. 2 96 .5 1. 5 10 0 86 14 15 7 25 37 00 21 TL 1A (2 3B 3) TN F- α (a da lim um ab / C C ) 15 .2 9 32 1 0. 0 10 0. 0 1. 3 7 93 86 14 13 9 24 82 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 EXAMPLE 15 TNF-α binding assay

[0289] Goat anti-human Fc was first immobilized on SCM5 sensor chip using amine coupling. Anti-TNF monoclonal antibodies, Fab fragment or TL1A / TNFbispecificswere injected to the chip at 10µl / min for 1min. Various concentration of humanor cynomologusTNFprotein from0.78 to25nM in sample buffer (PBS, 0.005%P20, 0.1mg / mlBSA)were injected at flow rate of 50 µl / min for 3 min association, 10 min dissociation. On rate, off rate and equilibrium dissociation constant were calculated using 1:1 binding model on BIAevaluation software.

[0290] Tables15.1‑15.3showTNF-αbindingactivitydata foranti-TNF-αantibodies,hetero Igbispecificantibodies, IgG- scFv bispecific antibodies, and IgG-Fab bispecific antibodies. Table 15.1: TNF-α binding activity of anti-TNF-α antibodies and Fab fragment Human TNF-α Cyno TNF-α ka (1 / Ms) kd (1 / s) KD (M) ka (1 / Ms) kd (1 / s) KD(M) 3.2 mAb 1.5E+06 7.3E‑05 4.8E‑11 9.0E+05 9.9E‑05 1.1E‑10 Fab <5.0E‑5 <5.0E‑5 4.14 mAb 5.3E+05 6.1E‑05 1.2E‑10 3.5E+05 1.0E‑04 2.9E‑10 Fab <5.0E‑5 <5.0E‑5 234 mAb 1.5E+06 7.9E‑05 5.2E‑11 1.2E+06 1.0E‑04 8.7E‑11 Fab <5.0E‑5 <5.0E‑5 Adalimumab mAb 7.1E+05 6.1E‑05 8.6E‑11 6.4E+05 5.5E‑05 8.7E‑11 Fab 4.5E+05 1.4E‑04 3.2E‑10 3.6E+05 8.1E‑05 2.3E‑10 Certolizumab pegol Peg-Fab 3.9E+06 6.2E‑05 1.6E‑11 6.4E+06 2.2E‑03 3.5E‑10 Table 15.2: TNF-α binding activity of hetero Ig bispecific antibodies iPS Lot anti-TNF-α anti-TL1A ka (1 / Ms) kd (1 / s) KD (M) 376541 PL‑42786 Certolizumab parent 3B3 variant (322520) 3.2E+06 4.4E‑05* 1.4E‑11 376542 PL‑42789 C234 3B3 variant (322520) 2.3E+06 1.1E‑04 4.8E‑11 376543 PL‑42790 Certolizumab variant 3B3 variant (322520) 3.6E+06 5.5E‑05 1.6E‑11 349461 PL‑42787 Certolizumab variant 2G11 Variant 3.4E+06 6.4E‑05 1.9E‑11 349463 PL‑42788 Certolizumab variant 23B3 VH4 3.4E+06 5.5E‑05 1.6E‑11 Table 15.3: TNF-α binding activity of 1gG-scFv bispecific antibodies iPS Lot IgG scFV ka (1 / Ms) kd (1 / s) KD (M) 369989 PL‑42765 TNF-α (Adalimumab) TL1A (9C8) 1.2E+06 7.6E‑05 6.6E‑11 369992 PL‑42770 TNF-α (Adalimumab) TL1A (9C8 / CC) 1.2E+06 8.4E‑05 7.3E‑11 369995 PL‑42779 TNF-α (3.2) TL1A (9C8) 1.7E+06 7.7E‑05 4.4E‑11 370001 PL‑42767 TNF-α (C234) TL1A (9C8) 1.7E+06 9.9E‑05 5.9E‑11 370004 PL‑42785 TNF-α (C234) TL1A (9C8 / CC) 1.7E+06 1.0E‑04 5.9E‑11 370013 PL‑42781 TL1A (9C8) TNF-α (3.2) 1.3E+06 8.8E‑05 6.5E‑11 370018 PL‑42763 TL1A (23B3) TNF-α (Adalimumab) 1.1E+06 5.3E‑05 5.0E‑11 370021 PL‑42778 TL1A (23B3) TNF-α (Adalimumab / CC) 1.1E+06 4.9E‑05* 4.5E‑11 371213 PL‑42771 TNF-α (Adalimumab) TL1A (3B3.322520 / CC) 1.3E+06 8.2E‑05 6.5E‑11 371217 PL‑42782 TNF-α (C234) TL1A (3B3.322520 / CC) 1.9E+06 8.8E‑05 4.8E‑11 83 EP 4 640 705 A2 5 10 15 20 25 30 35 40 45 50 55 (continued) iPS Lot IgG scFV ka (1 / Ms) kd (1 / s) KD (M) 371219 PL‑42774 TL1A (3B3.322520) TNF-α (3.2) 1.3E+06 5.5E‑05 4.2E‑11 371222 PL‑42783 TL1A (3B3.322520) TNF-α (3.2 / CC) 1.3E+06 6.3E‑05 4.7E‑11 EXAMPLE 16 TNF-α activity assays

[0291] TNF-α activity assay was performed using TF‑1 NF-kB reporter cell line. In brief, 1 ng / ml (EC90) of human or cynomolgus monkey TNF-α was incubated with 104 TF‑1 NF-κB reporter cells in the presence of a serially diluted anti- TNF-α antibodies or TL1A / TNF-α bispecific molecules in 96-well plate at 37 °C overnight. 50 µl of Steady-glo Luciferase testing solution (Promega) was added to each well. Plate was covered and incubated while shaking for 10 minutes. Luciferase activity was analyzed by microbeta reader.

[0292] Table 16.1 shows anti-TNF-αQCand activity data for anti-TNF antibodies. Tables 14.2 and 14.3 show anti-TNF- α binding activity for hetero Ig bispecific antigen binding proteins, and IgG-scFv bispecific antigen binding proteins, respectively. Table 16.1: Anti-TNF-α activity of TNF-α antibodies and Fab fragments Antibody designation Modality Human TNF (20 pM) IC50 (pM) NFkB Cyno TNF (20 pM) IC50 (pM) NFkB 3.2 mAb 75 334 Fab 367 2950 4.14 mAb 127 739 Fab 526 3105 234 mAb 74 138 Fab 825 2027 adalimumab mAb 119 180 Fab 670 1800 certolizumab pegol Peg-Fab 91 1.38 µM EXAMPLE 17 Bispecific molecule activity

[0293] The human and cynomolgus monkey TL1A and TNF-α binding activities of bispecifi...

Claims

1. An antigen binding protein comprising a TL1A binding entity and a TNF-α binding entity, wherein: a. the TL1A binding entity has one or two TL1A binding heavy chain variable domains comprising anti-TL1A HCDR1, anti-TL1A HCDR2, and anti-TL1A HCDR3, wherein: i. anti-TL1A HCDR1 comprises a sequence of SEQ ID NO: 188; ii. anti-TL1A HCDR2 comprises a sequence of SEQ ID NO: 190; iii. anti-TL1A HCDR3 comprises a sequence of SEQ ID NO: 192; b. the TL1A binding entity has one or two TL1A binding light chain variable domains comprising anti-TL1A LCDR1, anti-TL1A LCDR2, and anti-TL1A LCDR3, wherein: i. anti-TL1A LCDR1 comprises a sequence of SEQ ID NO: 122; ii. anti-TL1A LCDR2 comprises a sequence of SEQ ID NO: 124; iii. anti-TL1A LCDR3 comprises a sequence selected from SEQ ID NO: 126; c. the TNF-α binding entity comprises one or two TNF-α binding heavy chain variable domains comprising anti-TNF HCDR1, anti-TNF HCDR2, and anti-TNF HCDR3, wherein: i. anti-TNF HCDR1 comprises a sequence selected from SEQ ID NOS: 158, 218, 206, and 212; ii. anti-TNF HCDR2 comprises a sequence selected from SEQ ID NOS: 160, 220, 208, and 214; iii. anti-TNF HCDR3 comprises a sequence selected from SEQ ID NOS: 162, 222, 210, and 216; and d. the TNF-α binding entity comprises one or two TNF-α binding light chain variable domains comprising an anti-TNF LCDR1, anti-TNF LCDR2, and anti-TNF LCDR3, wherein; i. anti-TNF LCDR1 comprises a sequence selected from SEQ ID NOS:92, 152, 140, and 146, ii. anti-TNF LCDR2 comprises a sequence selected from SEQ ID NOS: 94, 154, 112, and 148, and iii. anti-TNF LCDR3 comprises a sequence selected from SEQ ID NOS: 96, 156, 144, and 150.

2. The antigen binding protein of claim 1 wherein the TL1A binding heavy chain variable domain comprises a sequence at least about 90% identical to SEQ ID NO: 24.

3. The antigen binding protein of claim 1, wherein the TL1A binding light chain variable domain comprises a sequence at least about 90% identical to SEQ ID NO: 22.

4. The antigen binding protein of claim 1, wherein the TL1A binding entity comprises a heavy chain that comprises a sequence at least about 90% identical to SEQ ID NO: 68.

5. The antigen binding protein of claim 1, wherein the TL1A binding entity comprises a light chain that comprises a sequence at least about 90% identical to SEQ ID NO: 66.

6. The antigen binding protein of claim 1 comprising light and heavy chain sequences of SEQ ID NOS: 66 and 68.

7. The antigen binding protein of claim 1 wherein: a. the TNF-α binding entity comprises one or two TNF-α binding heavy chain variable domains comprising anti-TNF HCDR1, anti-TNF HCDR2, and anti-TNF HCDR3, wherein: i. anti-TNF HCDR1 comprises a sequence of SEQ ID NO: 218, ii. anti-TNF HCDR2 comprises a sequence of SEQ ID NO: 220, and iii. anti-TNF HCDR3 comprises a sequence of SEQ ID NO: 222; and b. the TNF-α binding entity comprises one or two TNF-α binding light chain variable domains comprising an anti-TNF LCDR1, anti-TNF LCDR2, and anti-TNF LCDR3, wherein: i. anti-TNF LCDR1 comprises a sequence of SEQ ID NO: 152, ii. anti-TNF LCDR2 comprises a sequence of SEQ ID NO: 154, and iii. anti-TNF LCDR3 comprises a sequence of SEQ ID NO: 156.

8. The antigen binding protein of claim 1, wherein the TNF-α binding heavy chain variable domain comprises a sequence at least about 90% identical to a sequence selected from SEQ ID NOS: 4, 44, 286, 318, 40, and 36.

9. The antigen binding protein of claim 1, wherein the TNF-α binding heavy chain variable domain comprises a sequence at least about 90% identical to a sequence selected from SEQ ID NOS: 44, 286, and 318.

10. The antigen binding protein of claim 1, wherein the TNF-α binding light chain variable domain comprises a sequence at least about 90% identical to a sequence selected from SEQ ID NOS: 2, 42, 38, and 34.

11. The antigen binding protein of claim 1, wherein the TNF-α binding light chain variable domain comprises a sequence at least about 90% identical to a sequence of SEQ ID NO: 42.

12. The antigen binding protein of claim 1 comprising a set of variable domain sequences selected from SEQ ID NOS: a. 42, 286, 288, and 290; b. 312, 314, 288, and 290; c. 42, 318, 288, and 290; and d. 320, 322, 288, and 290.

13. The antigen binding protein of claim 1 comprising a set of variable domain sequences selected from SEQ ID NOS: a. 42, 286, 288, and 290; and b. 42, 318, 288, and 290.

14. The antigen binding protein of claim 1, wherein the heavy and light chains are human IgG1, IgG2, or IgG4 and wherein: a. the TL1A binding entity comprises two TL1A binding heavy chains and two TL1A binding light chains, wherein: i. each TL1A binding heavy chain comprises a TL1A binding heavy chain variable domain; and ii. each TL1A binding light chain comprises a TL1A binding light chain variable domain; and b. the TNF-α entity comprises two TNF-α binding heavy chains and two TNF-α binding light chains, wherein: i. each TNF-α binding heavy chain comprises a TL1A binding heavy chain variable domain; and ii. each TNF-α binding light chain comprises a TL1A binding light chain variable domain.

15. The antigen binding protein of claim 14 comprising a set of sequences selected from SEQ ID NOS: 132, 136, 134, and 130; 132, 316, 134, and 130; 333, 316, 134, and 130; 333, 463, 134, and 130; 341, 343, 134, and 130; 510, 514, 512, and 555; 510, 514, 541, and 558; 510, 573, 512, and 555; 542, 571, 512, and 555; 540, 573, 512, and 555; 540, 487, 512, and 555; 518, 522, 512, and 555; 545, 578, 546, and 579; 547, 595, 546, and 579; 132, 599, 134, and 598; 337, 609, 134, and 598; 132, 611, 134, and 598; 333, 611, 134, and 598; 333, 613, 134, and 598; 510, 487, 512, and 555; 132, 613, 134, and 598; 132, 463, 134, and 130; 540, 616, 512, and 508; 540, 620, 512, and 508; 538, 623, 512, and 502; 537, 626, 512, and 508; 546, 514, 194, and 535; 536, 616, 194, and 535; 536, 620, 194, and 535; 546, 487, 194, and 535; 471, 136, 473, and 198; 479, 477, 473, and 198; 176, 136, 520, and 198; 475, 477, 520, and 198; 471, 463, 473, and 198; 176, 463, 473, and 198; 471, 465, 473, and 198; 176, 463, 570, and 198; 471, 465, 473, and 198; 176, 465, 520, and 198; 510, 514, 512, and 508; 518, 522, 512, and 508; and 540, 616, 512, and 508.

16. The antigen binding protein of claim 14 comprising a set of sequences selected from SEQ ID NOS: 132, 136, 134, and 130; 132, 316, 134, and 130; 333, 316, 134, and 130; 333, 463, 134, and 130; 510, 514, 512, and 555; 510, 514, 541, and 558; 510, 573, 512, and 555; 540, 573, 512, and 555; 540, 487, 512, and 555; 545, 578, 546, and 579; 132, 599, 134, and 598; 132, 611, 134, and 598; 333, 611, 134, and 598; 333, 613, 134, and 598; 510, 487, 512, and 555; 132, 613, 134, and 598; 132, 463, 134, and 130; 540, 616, 512, and 508; 540, 620, 512, and 508; 546, 514, 194, and 535; 536, 616, 194, and 535; 536, 620, 194, and 535; 546, 487, 194, and 535; 471, 136, 473, and 198; 479, 477, 473, and 198; 176, 136, 520, and 198; 475, 477, 520, and 198; 471, 463, 473, and 198; 176, 463, 473, and 198; 471, 465, 473, and 198; 176, 463, 570, and 198; 471, 465, 473, and 198; 176, 465, 520, and 198; and 510, 514, 512, and 508.

17. The antigen binding protein of claim 14 comprising the sequences of iPS No. 376543 (SEQ ID NOS: 510, 516, 512, and 508).

18. The antigen binding protein of claim 14, wherein: a. one heavy chain comprises substitutions K392D and K409D and the other heavy chain comprises substitutions E356K and D399K using EU numbering; or b. one heavy chain comprises substitutions K392D, K409D and K370D and the other heavy chain comprises substitutions E356K, D399K and E357K using EU numbering.

19. The antigen binding protein of claim 14, wherein: a. one heavy chain comprises substitution S183K, the other heavy chain comprises substitution S183E, one light chain comprises substitution S176E, and the other light chain comprises substitution S176K using EU numbering; or b. one heavy chain comprises substitutions Q39K and S183K, the other heavy chain comprises substitutions Q39E and S183E, one light chain comprises substitutions Q38E and S176E, and the other light chain comprises substitutions Q38K and S176K using EU numbering; or c. one heavy chain comprises substitutions G44K and S183K, the other heavy chain comprises substitutions G44E and S183E, one light chain comprises substitutions G100E and S176E, and the other light chain comprises substitutions G100K and S176K using EU numbering; or d. one heavy chain comprises substitution S183K, the other heavy chain comprises substitution 5183E, one light chain comprises substitution S176E, and the other light chain comprises substitution S176K using EU numbering.

20. The antigen binding protein of claim 14, wherein the antigen binding protein comprises two IgG1 heavy chains comprising substitutions R292C, V302C and N297G using EU numbering.