Compositions and methods for preventing fish myocarditis

JP2025503468A5Pending Publication Date: 2025-12-08ZOETIS SERVICES LLC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024537383
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-12-20
Filing Date
2022-12-19
Publication Date
2025-12-08

AI Technical Summary

Technical Problem

The prior art is difficult to effectively control Cardinal syndrome (CMS) caused by fish myocarditis virus (PMCV), resulting in severe biological and economic losses, and the use of traditional antibiotics leads to bacterial resistance and human health risks.

Method used

A protein vaccine containing the PMCV ORF-1 antigen was developed to target the antigen to cell surface expression by fusion proteins with VHSV-G proteins, and enhance the immune response in combination with nucleic acid sequence encoding interferon and appropriate expression vectors.

Benefits of technology

It significantly reduced the symptoms of Cardinal syndrome, reduced viral load, and improved the protective effect on PMCV infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Antigens, vaccines, and methods for treating fish against infection with piscine myocarditis virus (PMCV) are disclosed.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention is generally in the field of aquaculture vaccines. [Background technology]

[0002] Aquaculture has experienced significant growth in terms of production, accounting for over 527% in the period 1990-2018. In 2018, aquaculture contributed approximately 46% of the world's total aquatic production (179 Mt) and 52% of seafood (fish, crustaceans, mollusks, and other aquatic animals excluding aquatic mammals, reptiles, seaweed, and other aquatic plants) for human consumption.

[0003] Commercial aquaculture is affected by infectious diseases caused primarily by bacteria, viruses, parasites, and to a lesser extent fungi. Bacterial diseases can inflict significant biological and therefore economic losses. Although they are usually controllable with antibiotics, the indiscriminate use of these medicines ultimately poses a threat to human health due to the development and transfer of resistance mechanisms among bacterial species, some of which are also human pathogens.

[0004] Cardiomyopathy syndrome (CMS) is an inflammatory heart disease that primarily affects farmed Atlantic salmon, Salmo salar L. The disease was first detected in Norway in 1985 and has since been diagnosed in both farmed and wild Atlantic salmon.

[0005] CMS is a disease most commonly diagnosed in farmed salmon during the post-marine period and causes considerable losses to the salmon industry. The clinical features of CMS vary from acute death without prior clinical signs to increased mortality with non-specific signs such as impaired or abnormal swimming behavior. The diagnosis of CMS is based on the detection of characteristic inflammation and degeneration of the cavernous myocardium in the atria and ventricles during histopathological examination.

[0006] The causative agent of CMS has been identified as Piscine Myocarditis Virus (PMCV) and the isolation and characterization of the virus is described in WO 2011 / 131600. Further understanding of the causative agent of CMS is provided by the isolation and culture of the CMS virus disclosed in NO 2008 2869. The host cells for the culture of the CMS virus disclosed in NO 2008 2869 have been shown to result in low yields of CMS virus.

[0007] Further knowledge is still needed to be able to develop efficient means to control the disease and to be able to develop efficient vaccines, such as recombinant vaccines. Summary of the Invention

[0008] In a first aspect, the present invention provides a protein comprising, from the N-terminus to the C-terminus: a. a sequence that is at least 90% identical, or at least 91% identical, or at least 92% identical, or at least 93% identical, or at least 94% identical, or at least 95% identical, or at least 96% identical, or at least 97% identical, or at least 98% identical, or at least 99% identical, or 100% identical to SEQ ID NO:34 or SEQ ID NO:35; b. an amino acid sequence that is at least 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 25-33; i) the PMCV ORF-1 antigen lacks SEQ ID NO:15, or a sequence at least 90% identical to SEQ ID NO:15; and / or ii) compared to SEQ ID NO:1, the protein comprises an internal deletion that is at least 4 consecutive amino acids in length.

[0009] In certain embodiments, the fish myocarditis virus (PMCV) ORF-1 antigen is at least 90% identical to SEQ ID NO:11, SEQ ID NO:12, or SEQ ID NO:46.

[0010] In certain embodiments, the protein is at least 95% identical to SEQ ID NO:25 and lacks SEQ ID NO:14, or a sequence that is at least 90% identical to SEQ ID NO:14. Preferably, the protein lacks one or more of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:15, or a sequence that is at least 90% identical thereto.

[0011] In certain other embodiments, the protein of the invention comprises a sequence that is at least 95% identical to SEQ ID NO:26 and lacks SEQ ID NO:14, or a sequence that is at least 90% identical to SEQ ID NO:14. The protein may comprise a sequence that is at least 95% identical to SEQ ID NO:26 and lacks SEQ ID NO:14, or a sequence that is at least 90% identical to SEQ ID NO:14, and further lacks one or more of SEQ ID NOs:5, 15, or 24, or a sequence that is at least 90% identical thereto.

[0012] In other embodiments, the protein comprises a sequence that is at least 95% identical to SEQ ID NO:27 and lacks SEQ ID NO:14, or a sequence that is at least 90% identical to SEQ ID NO:14. The protein may comprise a sequence that is at least 95% identical to SEQ ID NO:27 and lacks SEQ ID NO:14, or a sequence that is at least 90% identical to SEQ ID NO:14, and further lacks one or more of SEQ ID NOs:3, 15, or 24, or a sequence that is at least 90% identical thereto.

[0013] In other embodiments, the protein comprises a sequence at least 90% identical to SEQ ID NO: 28. Optionally, the protein lacks one or more of SEQ ID NOs: 3, 4, or 24, or a sequence at least 90% identical thereto.

[0014] In other embodiments, the protein comprises SEQ ID NO:29 or SEQ ID NO:30, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical to any one of these sequences. Preferably, the protein lacks at least one of SEQ ID NO:3 or SEQ ID NO:24, or an amino acid sequence at least 90% identical to SEQ ID NO:3 or SEQ ID NO:24.

[0015] In other embodiments, the protein comprises SEQ ID NO:32, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical thereto, and optionally lacks at least one of SEQ ID NO:14 or SEQ ID NO:15, or an amino acid sequence at least 90% identical to SEQ ID NO:14 or SEQ ID NO:15.

[0016] In other embodiments, the protein comprises SEQ ID NO:33, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical thereto, and optionally lacks SEQ ID NO:24, or an amino acid sequence that is at least 90% identical to SEQ ID NO:24.

[0017] In any of the above embodiments, the protein may optionally further lack at least one of SEQ ID NOs: 2 and 13, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 2 or 13.

[0018] In certain embodiments, the protein comprises SEQ ID NO:11 or 12, or a sequence that is at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical to SEQ ID NO:11 or SEQ ID NO:12.

[0019] In a second aspect, the present invention comprises a protein according to any of the embodiments of the first aspect of the invention, a) an N-terminal secretory signal sequence of a secreted protein or a first membrane-bound protein upstream of a protein according to any of the embodiments of the first aspect of the invention, b) a transmembrane domain of a second membrane-associated protein downstream of the protein according to any of the embodiments of the first aspect of the invention.

[0020] In certain embodiments, the first membrane-associated protein is identical to the second membrane-associated protein. In certain embodiments, the membrane-associated protein is viral hemorrhagic septicemia virus G-protein (VHSV-G). Preferably, the N-terminal secretory signal sequence is at least 90% identical to SEQ ID NO: 7. In some embodiments, the N-terminal secretory signal sequence is at least 90% identical to SEQ ID NO: 7, and at least half of the different amino acids in the N-terminal secretory signal are conservative substitutions.

[0021] In certain embodiments, the transmembrane domain is at least 90% identical to SEQ ID NO: 8. Preferably, the transmembrane domain is at least 90% identical to SEQ ID NO: 8, and at least half of the differing amino acids in the N-terminal secretion signal are conservative substitutions.

[0022] In a third aspect of the invention, a nucleic acid sequence is disclosed encoding a protein according to any embodiment of the first aspect, or a fusion protein according to the second aspect of the invention. In one particular embodiment, the nucleic acid sequence comprises SEQ ID NO: 16.

[0023] In a fourth aspect, the present invention provides a cassette comprising a nucleic acid sequence according to any one of the embodiments of the third aspect of the present invention. In certain embodiments, the nucleic acid sequence is under the operative control of a promoter. In certain aspects, the promoter is a CMV promoter.

[0024] In a fifth aspect of the invention there is provided a vector comprising a cassette according to any embodiment of the fourth aspect of the invention or a nucleic acid sequence according to any embodiment of the third aspect of the invention.

[0025] In certain embodiments, the vector also encodes a nucleic acid sequence encoding an immunomodulator. In certain embodiments, the immunomodulator is an interferon, such as Salmo salar IFNb type interferon comprising SEQ ID NO: 6, or IFNb1 type interferon comprising SEQ ID NO: 50, and the nucleic acid sequence encoding the interferon is at least 65% identical to SEQ ID NO: 18 or 19, e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical, and the codon frequency is conserved in the nucleic acid sequence. In certain embodiments, the nucleic acid sequence is 65-90% identical to SEQ ID NO: 18 or 19, and the codon frequency is conserved in the nucleic acid sequence. In certain embodiments, the nucleic acid sequence encoding an interferon comprises SEQ ID NO:17 or SEQ ID NO:20, or the nucleic acid sequence is at least 90% identical to SEQ ID NO:17 or SEQ ID NO:20, and the nucleic acid sequence encoding an interferon encodes SEQ ID NO:6 or SEQ ID NO:50, or an amino acid sequence that is 95% identical to SEQ ID NO:6 or SEQ ID NO:50.

[0026] In certain embodiments, the vector may be a plasmid vector or a viral vector.

[0027] In a sixth aspect, there is provided a host cell comprising a vector according to any embodiment of the fifth aspect.

[0028] In a seventh aspect, the present disclosure provides a vaccine comprising a protein according to any embodiment of the first aspect, a fusion protein according to any embodiment of the second aspect, or a vector according to the fifth aspect of the invention. In certain embodiments, the vaccine further comprises an adjuvant. In certain embodiments, the vaccine also provides a carrier. In one embodiment, the carrier is a lipid or liposomal carrier.

[0029] In certain embodiments, the vaccine is a multivalent vaccine and preferably comprises one or more additional antigens selected from the group consisting of SAV (Salmonid Alphaviruses, including SAV-1, SAV-2, SAV-3, SAV-4, SAV-5, and SAV-6), ISAV (Infectious Salmon Anemia Virus), IPNV (Infectious Pancreatic Necrosis Virus), ASPV (Atlantic Salmonpox Virus), IHNV (Infectious Hematopoietic Necrosis Virus), VHSV (Viral Hemorrhagic Septicemia Virus), PRV (Piscean Orthoreovirus), Aeromonas salmonicida subspecies Salmonicida, Vibrio (Listonella) anguillarum serotype O1, Vibrio (Listonella) anguillarum serotype O2a, Vibrio salmonicida, Moritella viscosa, and sea lice (including Lepeophtheirus salmonis and / or Caligus rogercresseyi) proteins.

[0030] In an eighth aspect, the present invention provides a method of protecting salmonid fish from PMCV infection, the method comprising administering to a salmonid fish in need thereof a vaccine according to any embodiment of the seventh aspect of the invention. In certain embodiments, the salmonid fish weighs between 15 and 200 grams. In certain embodiments, the salmonid fish is Atlantic salmon (Salmo salar), rainbow trout (Oncorhynchus mykiss), Coho salmon (Oncorhynchus kisutch), or Chinook salmon (Oncorhynchus tshawytscha). [Brief description of the drawings]

[0031] [Figure 1] Figure 1A shows the general virion structure of Totiviridae. Figure 1B shows the genome structure of PMCV. The genome contains three large ORFs. [Diagram 2] Figure 2A is a diagram of a strategy for routing vaccine antigens for expression on the cell surface, and Figure 2B is a diagram of a strategy for promoting secreted antigens. [Diagram 3] Figure 3A is a photograph showing detection of PMCV ORF1 in non-permeabilized cells, and Figure 3B shows the results obtained with different expression cassettes used to route full-length PMCV ORF-1 to the cell surface. [Figure 4-1] FIG. 4A is an assessment of the fluorescence intensity of cleaved capsid variants by IF staining of transfected CHH-1 cells. [Figure 4-2] Figure 4B shows protein expression by Western blotting detection from membrane fractions by immunoprecipitation (IP-Western). The two blots are representative of two different experiments. [Figure 4-3] Figure 4B continued. [Diagram 5] Evaluation of protein expression in five different plasmid backbones by immunoprecipitation and Western blotting from whole cell lysates of transfected CHH-1 cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032]

[0036] In order to better explain the present invention, the following definitions are provided.

[0033]

[0037] The term "about" applied to a reference figure refers to the reference figure plus or minus ten percent of that value.

[0034]

[0038] The term "codon frequency is conserved in the nucleic acid sequence" describes a nucleic acid sequence in which the frequency of at least 50% of the codons in the nucleic acid sequence of the present invention does not deviate by more than 40% from the frequency of the same codon in the genome of the host. For example, when the frequency of a given codon in the host genome is, for example, 20%, if the frequency of the same codon in the nucleic acid sequence according to the present invention is 12% (40% less than 20%) to 28% (40% more than 20%), this codon is counted among at least 50% of the codons whose frequency does not deviate by more than 40% from the frequency of the same codon in the genome of the host.

[0035]

[0039] For example, the codon frequencies in the genome of Atlantic salmon (Salmo salar) are provided in Table 1. [Table 1-1] [Table 1-2]

[0036]

[0040] The codon CGC codes for arginine with a frequency of 20.08%, i.e. 20.08% of the arginine residues in the genome of Salmo salar are coded for by CGC. If between 12.048% and 28.112% of the arginine residues in the nucleic acid sequence are coded for by CGC, then the codon CGC counts among at least 50% of the codons whose frequency does not deviate by more than 40% from the frequency of the same codon in the genome of Salmo salar.

[0037]

[0041] "Therapeutically effective amount" refers to an amount of an antigen or vaccine that will induce an immune response in a subject receiving the antigen or vaccine that is sufficient to prevent or reduce the signs or symptoms of disease, including adverse health effects or complications caused by infection with a pathogen such as a virus, ectoparasite, or bacterium. Humoral or cell-mediated immunity, or both humoral and cell-mediated immunity, may be induced. The immunogenic response of an animal to a vaccine may be assessed indirectly, for example, through measurement of antibody titers, lymphocyte proliferation assays, or directly, through monitoring of signs and symptoms after challenge with a wild-type strain. Protective immunity conferred by a vaccine may be assessed, for example, by measuring reduction in clinical signs, such as mortality, morbidity, body temperature, overall physical condition, and overall health and performance of the subject. Protective immunity may also be assessed by scoring histopathological lesions in tissues and by quantifying viral load, for example, by qPCR. The amount of a vaccine that is therapeutically effective may vary depending on the particular adjuvant used, the particular antigen used, or the condition of the subject, and may be determined by one of skill in the art.

[0038]

[0042] "Treating" refers to preventing the disorder, condition, or disease to which such term applies, or preventing or alleviating one or more symptoms of such disorder, condition, or disease.

[0039]

[0043] The present inventors have discovered that the N-terminal portion of SEQ ID NO:1 ((ORF-1 protein) of Piscid Myocarditis Virus (PMCV), i.e., amino acids 1 to about 399 of SEQ ID NO:1, or more preferably amino acids 1 to 425, or more preferably amino acids 1 to 450, or more preferably amino acids 1 to 475, or most preferably amino acids 1 to 499 of SEQ ID NO:1, is necessary and sufficient to target the antigen to the cell surface.

[0040]

[0044] At the same time, the inventors have surprisingly discovered that antigens according to the invention induce a better immune response, as measured by viral load and / or histology score, if: a) SEQ ID NO: 27, SEQ ID NO: 28, or SEQ ID NO: 31 are retained, while SEQ ID NO: 25 is deleted; or b) SEQ ID NO:25 is retained while SEQ ID NO:27, SEQ ID NO:28 or SEQ ID NO:31 is deleted; or c) SEQ ID NO: 32 is retained while SEQ ID NO: 14 is deleted; or d) one or more of SEQ ID NOs: 13, 27, 28, 29, 31 are retained, while SEQ ID NO: 2 is deleted.

[0041]

[0045] It has also been discovered that when SEQ ID NO:32 was absent, the presence of SEQ ID NO:15 was not sufficient to confer an appropriate immune response.

[0042]

[0046] Thus, in a first aspect, the present invention provides a protein comprising, from N-terminus to C-terminus: a) a sequence that is at least 90% identical, or at least 91% identical, or at least 92% identical, or at least 93% identical, or at least 94% identical, or at least 95% identical, or at least 96% identical, or at least 97% identical, or at least 98% identical, or at least 99% identical, or 100% identical to SEQ ID NO: 34 or SEQ ID NO: 35; b) providing a protein comprising an amino acid sequence that is at least 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 25 to 33; i) the protein lacks SEQ ID NO: 15 or a sequence at least 90% identical to SEQ ID NO: 15; and / or ii) compared to SEQ ID NO:1, the protein comprises an internal deletion that is at least 4 consecutive amino acids in length, and optionally, the protein comprises a linker in place of the internal deletion.

[0043]

[0047] In all of the embodiments, the differences from the reference sequence (SEQ ID NO: 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35) can be deletions, insertions, or substitutions. Preferably, at least some of the substitutions are conservative substitutions. In certain embodiments, at least 50% (i.e., at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or at least 99%, or 100%) of the substituted amino acids are conservative substitutions.

[0044]

[0048] In embodiments in which the PMCV ORF-1 antigen lacks SEQ ID NO: 15, it should be understood that larger deletions, e.g., C-terminal truncations, can also be made in the antigen. In certain embodiments, such larger C-terminal truncations comprise or consist of SEQ ID NO: 13.

[0045]

[0049] In certain embodiments, the protein comprises SEQ ID NO:25, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical to SEQ ID NO:25, and the PMCV ORF-1 antigen lacks SEQ ID NO:4, or SEQ ID NO:5, or SEQ ID NO:14, or SEQ ID NO:15, or a sequence at least 90% identical to SEQ ID NO:4, or SEQ ID NO:5, or SEQ ID NO:14, or SEQ ID NO:15.

[0046]

[0050] In other embodiments, the above protein comprises a sequence that is at least 95% identical to SEQ ID NO:29, or a sequence that is at least 95%, or 96%, or 97%, or 98%, or 99% identical to SEQ ID NO:29, and the PMCV ORF-1 antigen lacks SEQ ID NO:5, or SEQ ID NO:14, or SEQ ID NO:15, or a sequence that is at least 90% identical to SEQ ID NO:5, or SEQ ID NO:14, or SEQ ID NO:15.

[0047]

[0051] In other embodiments, the above protein comprises a sequence that is at least 95% identical to SEQ ID NO:32, or a sequence that is at least 95%, or 96%, or 97%, or 98%, or 99% identical to SEQ ID NO:32, and the PMCV ORF-1 antigen lacks SEQ ID NO:14 or SEQ ID NO:15, or a sequence that is at least 90% identical to SEQ ID NO:14 or SEQ ID NO:15.

[0048]

[0052] In other embodiments, the protein comprises SEQ ID NO:26, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical to SEQ ID NO:26, and lacks SEQ ID NO:5, or SEQ ID NO:14, or SEQ ID NO:15, or SEQ ID NO:24, or a sequence at least 90% identical to SEQ ID NO:5, or SEQ ID NO:14, or SEQ ID NO:15, or SEQ ID NO:24.

[0049]

[0053] In other embodiments, the protein comprises SEQ ID NO:30, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical to SEQ ID NO:30, and lacks SEQ ID NO:14, or SEQ ID NO:15, or SEQ ID NO:24, or a sequence at least 90% identical to SEQ ID NO:14, or SEQ ID NO:15, or SEQ ID NO:24.

[0050]

[0054] In other embodiments, the protein comprises SEQ ID NO:33, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical to SEQ ID NO:33, and lacks SEQ ID NO:24, or a sequence at least 90% identical to SEQ ID NO:24.

[0051]

[0055] In other embodiments, the protein comprises SEQ ID NO:27, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical to SEQ ID NO:27, and lacks SEQ ID NO:3, or SEQ ID NO:14, or SEQ ID NO:15, or SEQ ID NO:24, or a sequence at least 90% identical to SEQ ID NO:3, or SEQ ID NO:14, or SEQ ID NO:15, or SEQ ID NO:24.

[0052]

[0056] In other embodiments, the protein comprises SEQ ID NO:31, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical to SEQ ID NO:31, and lacks SEQ ID NO:3 or SEQ ID NO:24, or a sequence at least 90% identical to SEQ ID NO:3 or SEQ ID NO:24.

[0053]

[0057] In other embodiments, the protein comprises SEQ ID NO:28, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical to SEQ ID NO:28, and lacks SEQ ID NO:3, or SEQ ID NO:4, or SEQ ID NO:14, or a sequence at least 90% identical to SEQ ID NO:3, or SEQ ID NO:4, or SEQ ID NO:14.

[0054]

[0058] In other embodiments, the protein comprises SEQ ID NO: 15, or a sequence at least 90% identical thereto, and any one of SEQ ID NOs: 4, 5, 25, 26, 27, 29, 30, 32 (or an amino acid sequence that is at least 90% identical to SEQ ID NOs: 4, 5, 25, 26, 27, 29, 30, or 32), and compared to SEQ ID NO: 1, the protein comprises an internal deletion that is at least four consecutive amino acids in length, and optionally the protein comprises a linker in place of the internal deletion.

[0055]

[0059] In yet other embodiments, the protein lacks SEQ ID NO:13, or a sequence that is at least 90% identical to SEQ ID NO:13, and contains SEQ ID NO:25, or a sequence that is at least 95%, or 96%, or 97%, or 98%, or 99% identical to SEQ ID NO:25.

[0056]

[0060] Relative to SEQ ID NO:1, the PMCV ORF-1 antigen may comprise an internal deletion that is at least 4 consecutive amino acids long. In general, the internal deletion may be up to 250 amino acids long. Preferably, the internal deletion is about 10 amino acids long, or 10-250 amino acids long, or 25-250 amino acids long, or 50-250 amino acids long, or 100-250 amino acids long, or 150-250 amino acids long, or 10-200 amino acids long, or 25-200 amino acids long, or 50-200 amino acids long, or 100-200 amino acids long, or 150-200 amino acids long, or about 200 amino acids long, or about 50 amino acids long, or 50-150 amino acids long, or 50-100 amino acids long, or about 100 amino acids long. In certain embodiments, the internal deletion comprises or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:14.

[0057]

[0061] In certain embodiments, a linker may be present in place of the internal deletion. The length of the internal deletion and the linker need not be the same. For example, the linker may be 3-50 amino acids long, or 3-40 amino acids long, or 3-30 amino acids long, or 3-20 amino acids long, or 3-10 amino acids long, or about 5 amino acids long, or about 10 amino acids long, or about 20 amino acids long. The exact sequence of the linker is not critical. In general, preferred amino acids are polar uncharged or charged residues, which make up about 50% of the naturally encoded amino acids. More specifically, threonine, serine, and glycine may provide good flexibility due to their small size and may also help maintain the stability of the linker structure in aqueous solvents through the formation of hydrogen bonds with water. In certain embodiments, the linker is rich in glycine and / or serine. In certain embodiments, the linker may be 5 amino acids long and include SEQ ID NO:36. SEQ ID NO:36 may be encoded by SEQ ID NO:37.

[0058]

[0062] Advantageously, the protein according to any embodiment of the first aspect of the present invention can be engineered into the target cell surface. Thus, such engineered antigens will be exposed on the cell surface where they can be recognized by the host's immune system, and thus a protective immune response will be generated. Thus, in a second aspect, the present disclosure provides a fusion protein comprising, from the N-terminus to the C-terminus: a) the N-terminal secretory signal sequence of the secreted protein or the first membrane-bound protein, b) a protein according to any of the embodiments of the first aspect above, c) a transmembrane domain of a second membrane-associated protein.

[0059]

[0063] In certain embodiments, the first protein may be selected from the group consisting of interferon a, interferon b, interferon c, interferon d, interferon gamma, interleukin-2, interleukin-4, and interleukin-12. The first and second proteins may be identical to each other or different. In some embodiments, the first and / or second protein may be a fusion protein of Atlantic salmon paramyxovirus, the signaling sequence and transmembrane domain sequences of which are SEQ ID NOs: 38 and 39, respectively. In some embodiments, the first and second protein may be a hemagglutinin (HE) protein of infectious salmon anemia virus (ISAV), the secretory signaling sequence and transmembrane domain sequences of which are SEQ ID NOs: 40 and 41, respectively.

[0060]

[0064] In some embodiments, the first membrane protein is identical to the second membrane protein and is the viral hemorrhagic septicemia virus G-protein (VHSV-G), whose secretory signaling peptide sequence and transmembrane domain sequence are SEQ ID NOs: 7 and 8, respectively.

[0061]

[0065] Thus, in some embodiments the N-terminal secretory signal sequence is at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical to SEQ ID NO:7.

[0062]

[0066] As mentioned above, preferably the mutations that lead to differences from SEQ ID NO: 7 are substitutions. In certain advantageous embodiments, at least half (or at least 60%, or at least 70%, or at least 80%, or at least 90%) of the different amino acids in the N-terminal secretion signal are conservative substitutions.

[0063]

[0067] In embodiments, when the VHSV-G protein is the source of both the N-terminal secretory signal and the transmembrane domain, the transmembrane domain is at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical to SEQ ID NO:8.

[0064]

[0068] As mentioned above, preferably the mutations that lead to differences from SEQ ID NOs: 7 and 8 are substitutions. In certain advantageous embodiments, at least half (or at least 60%, or at least 70%, or at least 80%, or at least 90%) of the different amino acids in the transmembrane domains are conservative substitutions.

[0065]

[0069] Additional fragments of the first and / or second proteins may also be included. Thus, in certain embodiments, SEQ ID NO:7, or a protein at least 90% identical to SEQ ID NO:7, may be contained within SEQ ID NO:48, or an amino acid sequence at least 90% identical to SEQ ID NO:48, or a fragment thereof. It is understood that the fragment will comprise SEQ ID NO:7, or a sequence at least 90% identical to SEQ ID NO:7.

[0066]

[0070] Independently, SEQ ID NO:8, or a protein at least 90% identical to SEQ ID NO:8, may be contained within SEQ ID NO:49, or an amino acid sequence at least 90% identical to SEQ ID NO:49, or a fragment thereof. It is understood that the fragment will include SEQ ID NO:8, or a sequence at least 90% identical to SEQ ID NO:8.

[0067]

[0071] As with SEQ ID NOs: 7 and 8, the mutations that lead to differences from SEQ ID NOs: 48 and 49 are substitutions. In certain advantageous embodiments, at least half (or at least 60%, or at least 70%, or at least 80%, or at least 90%) of the different amino acids in the N-terminal secretory signaling sequence and / or transmembrane domain are conservative substitutions.

[0068]

[0072] In other embodiments, the protein may comprise SEQ ID NO:11 or SEQ ID NO:12 or SEQ ID NO:46, or an amino acid sequence that is at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical to SEQ ID NO:11 or SEQ ID NO:12 or SEQ ID NO:46. Preferably, the differences are substitutions, and more preferably, at least 50% (or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or at least 99%) of the substituted amino acids are conservative substitutions.

[0069]

[0073] In certain embodiments, the fusion protein sequence comprises or consists of SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:47, or an amino acid sequence that is at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical to SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:47. Preferably, the differences are substitutions, and more preferably, at least 50% (or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or at least 99%) of the substituted amino acids are conservative substitutions.

[0070]

[0074] In a third aspect, the disclosure provides a nucleic acid sequence encoding a protein according to any of the embodiments of the first aspect of the invention, or a fusion protein according to any of the embodiments of the second aspect of the invention. The nucleic acid sequence according to the third aspect of the invention may in some embodiments comprise SEQ ID NO: 16, or is at least 90% (at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%) identical thereto.

[0071]

[0075] In a fourth aspect, the present invention provides an expression cassette comprising a nucleic acid sequence according to any embodiment of the third aspect of the invention. Preferably, the nucleic acid sequence according to any embodiment of the third aspect of the invention is under the operable control of a first promoter. The first promoter may be selected from exemplary promoters such as Simian Virus 40 early promoter (SV40), Cytomegalovirus immediate early promoter (CMV), human ubiquitin C promoter (UBC), human elongation factor 1 alpha promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), and chicken β-actin promoter associated with the CMV early enhancer (CAGG). Generally, the expression cassette of the present invention also comprises a polyadenylation signal that terminates transcription of the nucleic acid sequence encoding the antigen.

[0072]

[0076] Optionally, the cassette may also include a nucleic acid sequence encoding a molecular immunomodulator under operable control of a second promoter. Generally, the second promoter should be capable of initiating transcription in the host organism. In embodiments where the host is a salmonid fish, such as Salmo salar, suitable promoters include, but are not limited to, Simian Virus 40 early promoter (SV40), Cytomegalovirus immediate early promoter (CMV), human ubiquitin C promoter (UBC), human elongation factor 1 alpha promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), and chicken β-actin promoter (CAGG) associated with the CMV early enhancer. Generally, the expression cassette of the present invention also includes a polyadenylation signal that terminates transcription of the nucleic acid sequence of the present invention.

[0073]

[0077] In a fifth aspect, the present application discloses a vector comprising any of the cassettes according to the fourth aspect of the present invention. Different vectors suitable for the present invention are known in the art, including both plasmid and viral vectors. Suitable plasmids include, but are not limited to, pUC-based vectors, pVAX vectors, pcDNA vectors, NTC vectors. In a preferred set of embodiments, the vector is NTC9385R (Nature Technology Corporation) or a variant thereof, as described in the examples.

[0074]

[0078] In other embodiments, the relatively new "Doggybone" or dbDNA™ plasmids can be used as vectors. dbDNA™ plasmids and processes for making these plasmids are described at least in WO2018033730, WO2016034849, WO2019193361, WO2012017210, and WO2021161051. The advantage of this approach is that the vectors can be synthesized in a cell-free process, thus improving manufacturing efficiency. The cell-free process preferably involves amplification of the template via strand-displacement replication. This synthesis releases single-stranded DNA, which can then be copied into double-stranded DNA using a polymerase. Alternatively, strand displacement can be achieved by providing a DNA polymerase and a separate helicase. The replicative helicase can open the double-stranded DNA and facilitate the advancement of the leading strand polymerase. The resulting double-stranded DNA concatemers are enzymatically cleaved and ligated, thus forming a doggybone-like shaped DNA construct.

[0075]

[0079] Suitable viral vectors include but are not limited to alphaviruses such as SAV, rhabdoviruses such as VHSV and IHNV, paramyxoviruses such as ASPV, adenoviruses, poxviruses such as salmonella poxviruses, etc. These viruses can be genetically modified to remove the part of viral genome that is involved in replication.Therefore, the resulting virus will be suitable for infecting fish cells and producing antigens, but will not be pathogenic.

[0076]

[0080] In embodiments where the cassette does not contain a nucleic acid sequence encoding a molecular immunomodulator, such a nucleic acid sequence may still be present in the vector.

[0077]

[0081] In certain embodiments suitable for both the vector of this aspect and the cassette of the fourth aspect, the molecular immunomodulator is an interferon, preferably such as IFNb, and is encoded by SEQ ID NO: 6 (IFN-b protein) or SEQ ID NO: 50 (IFNb1 protein), or a sequence that is at least 95% (e.g., at least 96%, or at least 97%, or at least 98%, or at least 99%) identical to SEQ ID NO: 6 or 50, wherein the nucleic acid sequence is 65-90% identical to SEQ ID NO: 18, or 65-90% identical to SEQ ID NO: 19, and wherein the codon frequency is conserved in the nucleic acid sequence.

[0078]

[0082] An interferon-encoding nucleic acid sequence identical to SEQ ID NO: 18 or SEQ ID NO: 19, with the proviso that the codon frequency is conserved in said interferon-encoding nucleic acid sequence. In certain embodiments, the interferon-encoding nucleic acid sequence is 70-79% or 73-77% identical to SEQ ID NO: 18 or SEQ ID NO: 19, with the proviso that the codon frequency is conserved in said interferon-encoding nucleic acid sequence.

[0079]

[0083] As disclosed above, the frequency of at least 50% of the codons in the nucleic acid sequence encoding an interferon does not deviate by more than 40% from the frequency of the same codon in the genome of the host. In certain embodiments, the frequency of at least 40% of the codons in the nucleic acid sequence encoding an interferon does not deviate by more than 30% from the frequency of the same codon in the genome of the host, and / or the frequency of at least 30% of the codons in the nucleic acid sequence encoding an interferon does not deviate by more than 25% from the frequency of the same codon in the genome of the host, and / or the frequency of at least 25% of the codons in the nucleic acid sequence encoding an interferon does not deviate by more than 20% from the frequency of the same codon in the genome of the host. When the host is Salmo salar, the codon frequencies in Salmo salar are provided in Table 1.

[0080]

[0084] In certain embodiments, the nucleic acid sequence comprises SEQ ID NO:17 or SEQ ID NO:20 or is at least 90% identical (i.e., more than 91% identical, more than 92% identical, more than 93% identical, more than 94% identical, more than 95% identical, more than 96% identical, more than 97% identical, more than 98% identical, or more than 99% identical) to one of SEQ ID NO:17 or SEQ ID NO:20, and the nucleic acid sequence encodes SEQ ID NO:6, or an amino acid sequence at least 95% identical thereto, as described above.

[0081]

[0085] In certain embodiments, the vector may contain the expression cassette described above and an additional antigen, such as a salmonid fish alphavirus antigen. It is also possible for the vector to contain additional nucleic acid sequences encoding different molecular immunomodulators.

[0082]

[0086] The vector according to any embodiment of this fifth aspect of the invention and / or the cassette of the fourth aspect may optionally comprise an amino acid sequence encoding additional antigen(s). In general, these additional antigens may be of viral, bacterial, protozoan or parasitic origin. Suitable viruses include PMCV, SAV, ISA, IPNV, ASPV (Atlantic salmonpox virus), IHNV (infectious hematopoietic necrosis virus), VHSV (viral hemorrhagic septicemia virus) and PRV. Antigens from enveloped and non-enveloped viruses may be included. In certain embodiments, the antigen is a viral structural or capsid protein, or an outer surface protein. Fragments of these proteins capable of eliciting a protective immune response are also suitable.

[0083]

[0087] Suitable bacteria include, but are not limited to, Aeromonas salmonicida subspecies Salmonicida, Vibrio (Listonella) anguillarum, Vibrio salmonicida, Moritella viscosa, and Yersinia ruckeri. Again, proteins present on the outer surface of the bacteria and those proteins capable of eliciting a protective immune response are preferred.

[0084]

[0088] Suitable parasites include sea lice (family Caligidae, preferably genus Lepeophtheirus or Caligus). Proteins derived from sea lice and capable of eliciting a protective immune response have been described, including gut peptides or fragments thereof, including but not limited to SEQ ID NO: 21, or a sequence at least 90% identical thereto.

[0085]

[0089] The skilled artisan will understand that the differences between the described amino acid sequence and the reference amino acid sequence (whether in the context of a protein according to any embodiment of the first aspect of the invention, or a fusion protein according to any embodiment of the second aspect, or a suitable molecular immunomodulator in certain embodiments of the fourth or fifth aspects) may be in the form of insertions, deletions, or substitutions. Preferably, the mutations are substitutions, and more preferably, at least some of these substitutions are conservative substitutions.

[0086]

[0090] Those skilled in the art will further recognize that changes in a nucleic acid sequence that result in a modification of the amino acid sequence of the encoded protein may have little, if any, effect on the resulting three-dimensional structure of the protein. For example, the codon for the amino acid alanine, a hydrophobic amino acid, may be replaced by a codon that codes for another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes that result in the substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, may also be expected to produce a protein with substantially the same functional activity.

[0087]

[0091] The following six groups each contain amino acids that are typical conservative substitutions for one another: [1] alanine (A), serine (S), threonine (T), [2] aspartic acid (D), glutamic acid (E), [3] asparagine (N), glutamine (Q), [4] arginine (R), lysine (K), histidine (H), [5] isoleucine (I), leucine (L), methionine (M), valine (V), and [6] phenylalanine (F), tyrosine (Y), tryptophan (W) (see, e.g., U.S. Patent Publication No. 20100291549).

[0088]

[0092] In certain embodiments, at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or all 100% of the amino acids that differ from the reference sequence are conservative substitutions.

[0089]

[0093] Protein and / or nucleic acid sequence identity according to any of the above embodiments can be evaluated using any of a variety of sequence comparison algorithms and programs known in the art. For sequence comparison, typically one sequence serves as a reference sequence (e.g., a sequence disclosed herein) to which test sequences are compared. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence relative to the reference sequence based on the program parameters.

[0090]

[0094] The percent identity of two amino acid or two nucleic acid sequences can be determined, for example, by comparing sequence information using the computer program GAP, i.e., the Genetics Computer Group (GCG, Madison, WI) Wisconsin Package version 10.0 program, GAP (Devereux et al. (1984), Nucleic Acids Res. 12:387-95). In calculating percent identity, the sequences being compared are typically aligned in a manner that gives the maximum correspondence between the sequences. Preferred default parameters for the GAP program include: (1) a GCG implementation of a unary comparison matrix for nucleotides (containing a value of 1 for identity and 0 for non-identity) and the weighted amino acid comparison matrix of Gribskov and Burgess ((1986) Nucleic Acids Res. 14:6745) as described in Atlas of Polypeptide Sequence and Structure, Schwartz and Dayhoff, eds., National Biomedical Research Foundation, pp. 353-358 (1979), or other equivalent comparison matrices; (2) for amino acid sequences, a penalty of 8 for each gap and an additional penalty of 2 for each symbol in each gap, or for nucleic acid sequences, a penalty of 50 for each gap and an additional penalty of 3 for each symbol in each gap; (3) no penalty for final gaps; and (4) no maximum penalty for long gaps.

[0091]

[0095] Sequence identity and / or similarity can also be determined using the local sequence identity algorithm of Smith and Waterman, 1981, Adv. Appl. Math. 2:482, the sequence identity alignment algorithm of Needleman and Wunsch, 1970, J. Mol. Biol. 48:443, the similarity search method of Pearson and Lipman, 1988, Proc. Nat. Acad. Sci. USA 85:2444, computerized implementations of these algorithms (BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.).

[0092]

[0096] Another example of a useful algorithm is PILEUP. PILEUP creates multiple sequence alignments from a group of related sequences using progressive pairwise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, 1987, J. Mol. Evol. 35:351-360, which is similar to the method described by Higgins and Sharp, 1989, CABIOS 5:151-153. Useful PILEUP parameters include a default gap weight of 3.00, a default gap length weight of 0.10, and weighted end gaps.

[0093]

[0097] Another example of a useful algorithm is the BLAST algorithm described in Altschul et al., 1990, J. Mol. Biol. 215:403-410; Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402; and Karin et al., 1993, Proc. Natl. Acad. Sci. USA 90:5873-5787. A particularly useful BLAST program is the WU-BLAST-2 program from Altschul et al., 1996, Methods in Enzymology 266:460-480. WU-BLAST-2 uses several search parameters, most of which are set to default values. Adjustable parameters are set with the following values: overlap span=1, overlap fraction=0.125, word threshold (T)=II. The HSP S and HSP S2 parameters are dynamic values ​​and are established by the program itself depending on the composition of the particular sequence and the composition of the particular database in which the sequence of interest is being searched, but these values ​​can be adjusted to increase sensitivity.

[0094]

[0098] An additional useful algorithm is Gapped BLAST as reported by Altschul et al., 1993, Nucl. Acids Res. 25:3389-3402. Gapped BLAST uses the BLOSUM-62 substitution scores, the threshold T parameter is set to 9, and the two-hit method that results in ungapped extensions imposes a cost of 10+k for gap lengths of k, and u is set to 16, X g is set to 40 in the database search step and to 67 in the output step of the algorithm. Gapped alignments result in a score corresponding to approximately 22 bits.

[0095]

[0099] Those skilled in the art will understand that there are multiple ways to generate the amino acid sequences according to the first or second aspect of the invention, the nucleic acids according to the third aspect of the invention, the expression cassettes according to the fourth aspect of the invention, and the vectors according to the fifth aspect of the invention. For example, nucleic acid sequences can be designed using software tools, such as CLC Main Workbench, artificially synthesized, or generated using targeted mutagenesis. These sequences can be subcloned into expression cassettes and vectors using genetic engineering techniques that are widely available to those skilled in the art. See, for example, Molecular cloning: a laboratory manual (Sambrook & Russell: 2000, Cold Spring Harbor Laboratory Press; ISBN: 0879695773) and Current protocols in molecular biology (Ausubel et al., 1988+updates, Greene Publishing Assoc., New York; ISBN: 0471625949).

[0096]

[0100] In a sixth aspect, there is provided a host cell comprising a vector according to any embodiment of the fifth aspect.

[0097]

[0101] In a seventh aspect, the present application discloses a vaccine. The vaccine may comprise a vector according to any of the embodiments of the fifth aspect of the invention. The vaccine may be monovalent or multivalent. Generally, one dose of a monovalent vaccine may contain at least 1 μg of a vector according to any of the embodiments of the fifth aspect. In certain embodiments, one dose of a vaccine may contain 1 μg to about 25 μg of a vector. In other embodiments, one dose of a vaccine may contain 1 to about 20 μg of a vector, or about 5 to about 20 μg of a vector, or about 5 to about 15 μg of a vector, or about 10 to about 20 μg of a vector, or about 5 to about 10 μg of a vector.

[0098]

[0102] A number of antigens suitable for the vaccine according to the invention are described above. These antigens may be administered in the form of DNA vaccines comprising the vectors and expression cassettes described above in the fourth and fifth aspects of the invention. In other embodiments, these antigens may be administered in the form of subunits (i.e. purified or partially purified proteins). In yet other embodiments, the antigens may comprise inactivated or attenuated organisms.

[0099]

[0103] In addition to an antigen, the vaccine of the present invention may further comprise an adjuvant, ie, a substance that enhances or modulates the immune response, in addition to a molecular immunomodulator comprising SEQ ID NO:6, or an amino acid sequence that is 95% identical thereto.

[0100]

[0104] Such adjuvants are well known in the art. Suitable non-limiting adjuvants include saponin (e.g., Quil A), alum, CpG oligonucleotides, poly I:C, oligoribonucleotides, cytokines, glycolipids such as BAY® 1005, and quaternary amines such as dimethyldioctadecylammonium bromide (hereinafter, "DDA"). Complexes containing saponin, sterol (e.g., cholesterol), and optionally, phospholipids have been described in the art. Combinations of CpG oligonucleotides and saponin, CpG and cholesterol, and CpG and alum have been reported to induce synergistic effects.

[0101]

[0105] In addition to the antigen and optional additional adjuvants, the vaccine may also include a suitable pharmaceutical carrier. Suitable carriers will be apparent to those skilled in the art and will depend in large part on the route of administration. Additional components that may be present in the present invention are adjuvants, preservatives, surfactants, chemical stabilizers, suspending agents or dispersing agents. Typically, stabilizers, adjuvants, and preservatives are optimized to determine the best formulation for efficacy in the target subject.

[0102]

[0106] In certain embodiments, the vaccine may include a liposomal adjuvant and / or carrier to facilitate the transport of the vector across the cell membrane, thus resulting in increased expression of the antigen and / or molecular immunomodulator. Suitable non-limiting examples of such liposomal adjuvant / carrier systems are described, for example, in U.S. Patent No. 10,456,459.

[0103]

[0107] In an eighth aspect, the present application discloses a method of protecting salmonid fish from infection, the method comprising administering to a salmonid fish in need thereof a vaccine according to any of the embodiments of the seventh aspect of the invention. Thus, the present disclosure also provides a vaccine according to any of the embodiments of the seventh aspect for use in protecting salmonid fish from infection.

[0104]

[0108] It should be clear to one skilled in the art that the infection against which the antigen(s) are present in the vaccine dictates the invention against which the vaccine will protect. Thus, for example and without limitation, if the vaccine comprises a nucleic acid sequence encoding a PMCV antigen, the vaccine will be used against an infection caused by PMCV.

[0105]

[0109] The vaccine according to the invention may be administered to salmonids by a variety of routes, including but not limited to intramuscularly. Preferably, the vaccine is administered in microdoses, such that the volume of a dose is less than 500 μl, or less than 400 μl, or less than 300 μl, or less than 200 μl, or about 100 μl, or less than 100 μl, or about 50 μl, or about 25 μl.

[0106]

[0110] The vaccines disclosed herein may be used to protect multiple salmonid species from infection. Suitable salmonid fish include, but are not limited to, Atlantic salmon (Salmo salar), Coho salmon (Oncorhynchus kisutch), Rainbow trout (Oncorhynchus mykiss), Sockeye salmon (Oncorhynchus nerka), Chinook salmon (Oncorhynchus tshawytscha), and other species.

[0107]

[0111] Salmonid fish of different ages (or weights) can be vaccinated according to the present invention. In certain embodiments, the salmonid fish weighs about 15 to about 200 grams at the time of vaccination. Thus, the weight of the salmonid fish at the time of vaccination can be about 25 to about 150 grams, or about 40 to about 110 grams, or about 50 to about 100 grams. EXAMPLES

[0108] Example 1. Preparation of a surface-targeted expression system

[0112] All successful DNA vaccines for Atlantic salmon have been derived from enveloped viruses and are based on membrane-associated antigens, therefore exposure of antigens on the surface of cells may be important for efficacy.

[0109]

[0113] PMCV is a naked virus containing a 6.7 kb dsRNA genome with three predicted open reading frames (Figure 1). The capsid protein (CP) is translated from ORF1, while ORF2 encodes the RNA-dependent RNA polymerase (RdRp). The function of the ORF3 protein is still unknown, but it encodes a protein that has a cytotoxic effect when overexpressed in cell culture and is not required for the assembly of viral particles.

[0110]

[0114] DNA vaccines expressing PMCV ORF1 (capsid protein) and PMCV ORF3 (protein of unknown function) had previously been tested without providing protection (data not shown). Because PMCV is a naked virus without the predicted membrane-spanning domain for the PMCV ORF1 protein, and because it has been demonstrated that the PMCV ORF1 protein is expressed only intracellularly (data not shown), it was hypothesized that a response could be elicited if the expressed ORF1 capsid protein is targeted to the cell membrane.

[0111]

[0115] The aim of this experiment was to construct a DNA vaccine expressing PMCV capsid protein (or a part thereof) as a cell surface expressed antigen. The strategy was to fuse the N-terminal secretory signal peptide of the viral hemorrhagic septicemia virus G-protein (VHSV-G) according to SEQ ID NO: 7 upstream of the PMCV ORF1 antigen N-terminus. Additionally, as shown in Figure 2A, the C-terminal transmembrane domain of VHSV-G according to SEQ ID NO: 8 was fused downstream of the antigen C-terminus to incorporate the antigen at the cell surface (von Gersdorff Jorgensen et al., 2012). A secretory version of the vaccine antigen was also prepared using only the N-terminal secretory signal peptide and omitting the use of the C-terminal transmembrane domain (Figure 2B).

[0112]

[0116] Additional constructs were prepared similar to the construct shown in FIG. 2A, except that the signal peptide and transmembrane domain sequences of the Atlantic salmon paramyxovirus fusion protein (SEQ ID NOs: 38 and 39, respectively), or the infectious salmon anemia virus (ISAV) hemagglutinin (HE) protein (SEQ ID NOs: 40 and 41, respectively) were used instead.

[0113]

[0117] The routing of antigen expression was studied by immunofluorescence (IF) staining 6 days after transfection of CHH-1 cells with various DNA vaccine constructs. Transfection was performed using the LIPOFECTAMIN® 3000 kit (Thermo Fisher) in 12-well plates. In this experiment, the pVAX1 expression vector (Invitrogen) was utilized to construct the DNA vaccine, and 1 μg of plasmid DNA was used for transfection. Cells were fixed with 3.7% formaldehyde only for surface antigen expression, or fixed with 3.7% formaldehyde, followed by permeabilization of cells using 0.1% Triton X-100 for staining of intracellularly expressed proteins. Vaccine antigens were detected using both monoclonal and polyclonal antibodies against PMCV ORF1. Appropriate fluorescently labeled secondary antibodies (rabbit anti-mouse FITC (DAKO F0261) or polyclonal goat anti-rabbit Alexa Fluor Plus 488 (Invitrogen A32731) were used for detection. Staining of permeabilized cells to detect intracellularly expressed antigens was routinely included as a positive control in the protocol.

[0114]

[0118] The use of the VHSV G-protein can be used to route expression of the PMCV ORF-1 antigen to the cell surface, as shown in Figure 3. Use of the signal protein and transmembrane domain from the hemagglutinin (HE) protein of infectious salmon anemia virus also resulted in membrane staining of the PMCV ORF1 protein, but use of the region from the fusion protein of Atlantic salmon paramyxovirus was unsuccessful.

[0115]

[0119] In the next experiment, in vivo testing in Atlantic salmon (Salmo salar) was performed. Two variants of the antigen were tested: the full-length capsid protein (G-ORF1) and a truncated capsid protein (G-ORF1-deltaD) expressing the first half of the capsid protein (PMCV ORF1 positions 1-1293 of SEQ ID NO: 16). Both antigens were expressed in a standard expression vector (pcDNA3.1) and as an alphavirus replicon vaccine based on Salmonid Fish Alphavirus 3 (SAV-3). PBS and pcDNA-eGFP were included as negative vaccine controls.

[0116]

[0120] For all vaccines in this study, antigen-encoding genes were inserted downstream of the CMV promoter in the eukaryotic expression vector pcDNA3.1(+) (Invitrogen). All plasmids were diluted in sterile phosphate-buffered saline (PBS) to 10 μg per 50 μl injection volume. All fish received one intramuscular injection on each side of the fish and a total dose of 20 μg. Two non-immunized control groups were included, one group received 20 μg of the control vaccine (eGFP in pcDNA3.1) and one group received 2×50 μl of PBS. [Table 2]

[0117]

[0121] Fish (n=45 per group) were kept in freshwater and had a mean weight of 48 grams. Prior to vaccination, fish were anesthetized using Tricain (PHARMAQ), tagged by shortening of the adipose fin and / or upper jaw, assigned to groups, and injected intramuscularly with 0.05 ml of the test vaccine twice under the same anesthesia period (one injection on each side of the fish). After immunity was allowed to develop for 49 days at 12°C (light:dark 12:12), fish were anesthetized again using Tricain (PHARMAQ) and challenged with infectious PMCV by intraperitoneal injection of 0.1 ml of homogenized spleen (isolate ID AL V1223 spleen) from an outbreak in the Norwegian region of CMS. Fish were then sampled at three time points (n=15 per group per sampling time point), 10, 20, and 50 days after challenge. The ventricles and kidneys were harvested on RNALATER® from all sampled fish for subsequent RNA extraction. Hearts (ventricles and atria) were also fixed in formalin from all fish at the last sampling time point (day 50) for histopathological analysis. RNA was extracted from all samples stored on RNALATER® and analyzed by real-time RT-PCR for the presence of PMCV RNA using a commercial service from PHARMAQ Analytiq (Bergen, Norway). Hearts stored on formalin were sectioned and histopathology was scored from 0 to 3 according to severity, with 0 indicating no pathological findings and 3 indicating the presence of severe pathology (service provided by PHARMAQ Analytiq, Bergen, Norway).

[0118]

[0122] Vaccines expressing the full-length ORF1 of PMCV routed to the cell surface showed significant protection against challenge compared to the control group (one-way ANOVA with Dunnett's post-hoc test for histology in the atria, p<0.0001). This was shown both as an increase in Ct values ​​in the kidney and heart early after infection (results not shown) and as a reduction in histopathology scores 50 days after infection (Table 3). Antigens based on the first half of the capsid protein (G-ORF1-deltaD, PMCV ORF1 positions 1-1293) failed to provide protection and no further increase in protection was provided using salmon alphavirus replicons in contrast to standard expression vectors. [Table 3]

[0119]

[0123] A DNA vaccine candidate targeting the full-length antigen to the cell surface resulted in an approximately 50% reduction in histopathological scores, accompanied by a reduction in viral load (qPCR) in the kidney and heart.

[0120]

[0124] A follow-up in vivo study compared the efficacy of a DNA vaccine expressing the PMCV ORF1 full-length protein as a cell surface-expressed antigen, a secreted antigen, or an intracellularly expressed antigen, in addition to including a codon-optimized version of the full-length capsid protein encoded by SEQ ID NO: 45. The study contained two parallel immunization tanks, each with five groups of Atlantic salmon (n=30 per group per tank).

[0121]

[0125] For all vaccines in this study, antigen-encoding genes were inserted downstream of the CMV promoter in the eukaryotic expression vector NTC9385R (Nature Technology Corporation). All plasmids were diluted in sterile phosphate-buffered saline (PBS) to 10 μg per 50 μl injection volume. All fish received one intramuscular injection on each side of the fish and a total dose of 20 μg. A non-immunized control group was included and received 2×50 μl PBS, as summarized in Table 4. [Table 4]

[0122]

[0126] Fish were kept in fresh water and had an average weight of 26 grams at the time of vaccination. During administration of the test vaccine, fish were anesthetized using Tricain (PHARMAQ), tagged by shortening of the adipose fin and / or upper jaw, assigned to groups, and injected intramuscularly with 0.05 ml of the test vaccine twice under the same anesthesia period (one injection on each side of the fish). After immunity was allowed to develop for 39 days at 12°C (light:dark 12:12), fish were anesthetized again using Tricain (PHARMAQ) and challenged with infectious PMCV by intraperitoneal injection of 0.1 ml of homogenized heart (isolate ID AL V1273 heart) derived from an outbreak in the Norwegian region of CMS. Fish (n=15 per group per time point) were then sampled 21 and 56 days after challenge. Ventricles and kidneys were harvested on RNALATER® from all sampled fish for subsequent RNA extraction. Hearts (ventricles and atria) were also fixed in formalin from all fish at the last sampling time point (day 56) for histopathological analysis. RNA was extracted from all samples stored on RNALATER® and analyzed by real-time RT-PCR for the presence of PMCV RNA using a commercial service from PHARMAQ Analytiq (Norway). Hearts stored on formalin were sectioned and histopathology was scored from 0 to 3 according to severity, with 0 indicating no pathological findings and 3 indicating the presence of severe pathology (service provided by PHARMAQ Analytiq, Norway).

[0123]

[0127] Results showed that significant protection against PMCV infection was achieved with vaccines expressing full-length ORF1 of PMCV routed to the cell surface (G-ORF1 and G-ORF1 codon-optimized). Expression of PMCV ORF1 in its native form (intracellular protein) did not provide detectable protection. Secreted expression provided some protection (no differences were detected in the kidney at day 20; see Tables 5, 6). [Table 5] [Table 6]

[0124] Example 2: Preparation of CMS antigen and determination of antigen activity

[0128] Expression of PMCV ORF1 full-length protein on the cell membrane provided partial protection in a challenge model. Despite this finding, in vitro, antigen expression levels were observed to be significantly lower than those of the control GFP construct. This project investigated whether expressing truncated versions of the capsid protein by deleting regions could increase the expression levels and immunogenicity of vaccine antigens.

[0125]

[0129] The expression system described in Example 1 (using the VHSV-G signal peptide and transmembrane domain sequences) was prepared with different constructs based on the PMCV ORF-1 antigen.

[0126]

[0130] Initial studies expressing membrane-associated PMCV capsid antigen from a VHSV-G expression cassette showed that inclusion of the first part of the PMCV ORF1 protein sequence was crucial for success: when the capsid protein was split into thirds, membrane-associated protein was only successfully achieved for constructs containing the first third (data not shown).

[0127]

[0131] After constructing PMCV ORF1 capsid deletion variants, they were tested by IF staining and Western blot of transfected cells. For all deletion constructs, the deleted PMCV ORF1 sequence was replaced with a GGGGS linker (SEQ ID NO: 36). The strategy for generating the various deletion variants was as follows. (1) In the first round, relatively large deletions were tested (IntDel1-7, 200 amino acids long, overlapping by 100 amino acids, except for IntDel7, which was 162 amino acids long). The first deletion (IntDel1) was made at nucleotide positions 298-897 within PMCV ORF1 (SEQ ID NO: 16), because inclusion of certain N-terminal sequences was found to be necessary for successful routing of expressed proteins to the cell membrane. (2) In the second round, smaller deletion variants were generated (IntDel11-18, contiguous non-overlapping 50 amino acids long starting within IntDel4), focusing on the region covered by IntDel4-7. The first of these deletions (IntDel11) was constructed at nucleotide positions 1384-1533 within PMCV ORF1 (SEQ ID NO:16). (3) In the third round, antigen variants with very small adjacent overlapping deletions were generated (IntDel21-42, 10 amino acids long overlapping by 2 amino acids). The first of these deletions (IntDel21) was constructed at nucleotide positions 1936-1965 within PMCV ORF1 (SEQ ID NO: 16).

[0128]

[0132] Expression of PMCV ORF1 capsid deletion variants in CHH-1 cells by IF staining and Western blot. The procedure for immunofluorescence staining of cells was as follows: CHH-1 cells were trypsinized and seeded in 12-well plates (150000 cells and 1 ml cell medium per well). Cells were incubated at 15°C ON in a CO2 incubator (5% CO2). Cells were transfected the day after seeding using 1 μg plasmid / well and LIPOFECTAMIN® 3000 (Thermo Fisher Scientific) according to the manufacturer's instructions. Before immunostaining of cells, cells were incubated at 15°C in a CO2 incubator (5% CO2) for 5 days. Cell medium was carefully removed from all wells and all wells were carefully washed with PBS. Cells were fixed by incubating with 3.7% formaldehyde (diluted in PBS) for 15 minutes at room temperature. The cells were then blocked with 5% non-fat dry milk in PBS for 1 hour. Mouse anti-HIS (6x-His Tag monoclonal antibody (4A12E4) Fisher scientific, Cat. No. 37-2900 at 1:1500 dilution, and mouse anti-PMCV ORF1 monoclonal antibody (mAb No. 10, 1:200 dilution) were both used as primary antibodies and incubated at room temperature for 1 hour. FITC-conjugated polyclonal rabbit anti-mouse immunoglobulin (DAKO F0261) was used as secondary antibody at 1:1000 dilution and incubated for another 1 hour. Cell staining was evaluated by fluorescence microscopy.

[0129]

[0133] Evaluation of expression levels of PMCV ORF1 deletion constructs by Western blotting was performed as follows: CHH-1 cells were trypsinized and seeded in 6-well plates (1 million cells and 3 ml cell medium per well). Cells were incubated at 15°C ON in a CO2 incubator (5% CO2). Cells were transfected the day after seeding using 2.5 μg plasmid / well and LIPOFECTAMIN® 3000 (Thermo Fisher Scientific) according to the manufacturer's instructions. Cells were placed back into a sealed bag and incubated at 15°C in a CO2 incubator (5% CO2) for 6 days before further analysis. Plates were then placed on ice and the medium was removed. Cells were first washed twice with ice-cold PBS. To prepare membrane lysates, cells were first harvested by adding 200 μl of 20 mM Tris-HCl, pH 7.5, containing protease inhibitors, the cells were carefully scraped off, and the cell suspension was transferred to a pre-chilled tube. The wells were then rinsed with another 100 μl, for a total of 300 μl of cell suspension per transfection. As this is a detergent-free buffer, cells were lysed by passing them through a syringe tip (25G, approximately 5 times) and centrifuged at 12000 rpm for 10 min at 4°C. The supernatant was discarded and the membrane pellet was lysed in 300 μl of RIPA lysis buffer (Abcam, no. 156034) with 1× protease inhibitor cocktail to release membrane-associated proteins. Samples were incubated at 4°C for 30 min, occasionally resuspending the pellet by tapping the tube. The tubes were centrifuged at 12000 rpm for 10 min at 4°C, and the membrane lysates were transferred to fresh tubes and kept on ice until immunoprecipitation. On ice, 1 μg of mouse IgG1 anti-6x-His monoclonal antibody 4E3D10H2 / E3 (Fisher Scientific no. 15442890, 1 mg / ml) was added to each sample and incubated overnight at 4°C on a rotator. Protein G-bound beads were prepared (25 μl / sample) by washing the immobilized beads 3-5 times with approximately 1 ml of cold PBST and resuspended in 25 μl of PBST containing protease inhibitors per aliquot.On ice, 25 μl of pre-equilibrated beads were added to each sample and the sample-bead mixture was incubated for 1 hour at room temperature with rotation. The beads were washed 3-5 times with 500 μl ice-cold PBST containing protease inhibitors, gently mixing the beads between each wash to remove non-specific binding. After the last wash, as much buffer as possible was removed from the beads and 40 μl of 1x Laemmli Sample Buffer (BioRad #161-0737) was added (prepared by mixing 20 μl of 2x Laemmli Sample Buffer with 2 μl of β-mercaptoethanol and 18 μl of dH2O). Samples were incubated at 70°C for 10 minutes, quickly centrifuged and magnetized, and the eluent was transferred to a new vial. All samples were denatured at 98°C for 5 minutes before loading onto 4-20% Criterion™ TGX Stain-Free™ Gels. Gels were run at 200V for approximately 45 minutes and blotted using the TRANS-BLOT® TURBO™ Transfer System (BioRad) and TRANS-BLOT® TURBO™ Midi PVDF Transfer Packs #170-4157. A 7 minute turbo program was used. Membranes were immediately placed in blocking buffer (5% nonfat milk in PBST). Blocking was performed for 1 hour at room temperature. Blots were incubated with primary antibody rabbit anti-delta PMCV ORF1 diluted 1:500 in 1% nonfat milk / PBST overnight at 4°C on a rotator. The next day, the blots were washed 2x15 min with PBST and incubated with secondary antibodies Polyclonal Swine Anti-Rabbit (DAKO #P0217) Immunoglobulin HRP diluted 1:1000 in 2% non-fat milk and PRECISION PROTEIN™ StrepTactin-HRP Conjugate 1:10000 (to visualize ladder) for 1 h at room temperature. Blots were washed 2x15 min with PBST before detection of signal with Clarity western ECL substrate (BioRad #170-5060).

[0130]

[0134] The results can be summarized as follows: After the first round (200 amino acid long deletion), expression at the cell membrane was only achieved with the antigen from construct IntDel4-7. Thus, the N-terminal part is necessary for routing the antigen to the cell membrane. Therefore, the constructs made in the second round (50 amino acid long deletion) focused on the region covered by IntDel4-7. All these constructs succeeded in expressing the antigen at the cell membrane, except for IntDel18 (construct lacking the amino acid sequence described in SEQ ID NO:15), for which cell surface expression was lower. The deletion constructs (IntDel15-17) led to an increase in membrane expression levels. IntDel6 (construct lacking amino acids 500-699 of SEQ ID NO:1) from the first round was also found to have a higher expression level. No further candidates were revealed in the third round, except for IntDel42 (construct lacking the amino acids described in SEQ ID NO:14), which was slightly better than the others. The results are shown in FIG.

[0131]

[0135] Based on the combined results from immunofluorescence staining and Western blotting evaluation, several deletion candidates have been selected based on the results from several vaccine trials in the project. For all vaccines in the first study, antigen-encoding genes were inserted downstream of the CMV promoter in the eukaryotic expression vector NTC9385R (Nature Technology Corporation). All plasmids were diluted in sterile phosphate-buffered saline (PBS) to 10 μg per 50 μl injection volume. All fish received one intramuscular injection on each side of the fish and a total dose of 20 μg. A non-immunized control group was included and received 2×50 μl PBS, as summarized in Table 7. [Table 7]

[0132]

[0136] Atlantic salmon (Salmo salar) (n=30 per group) kept in fresh water and with a mean weight of 20 grams were anesthetized using Tricain (PHARMAQ), tagged by shortening of the adipose fin and / or upper jaw, assigned to groups and injected intramuscularly twice with 0.05 ml of the test vaccine under the same anesthesia period (one injection on each side of the fish). After immunity was allowed to develop for 48 days at 12C (light:dark 12:12), the fish were anesthetized again using Tricain (PHARMAQ) and challenged with infectious PMCV by intraperitoneal injection of 0.1 ml of homogenized heart (isolate ID AL V1273 heart) derived from an outbreak in the Norwegian area of ​​CMS. Fish (n=15 per group per sampling time point) were then sampled at two time points, 19 and 49 days after challenge. The ventricles and kidneys were harvested on RNALATER® from all sampled fish for subsequent RNA extraction. Hearts (ventricles and atria) were also fixed in formalin from all fish at the last sampling time point (day 49) for histopathological analysis. RNA was extracted from all samples stored on RNALATER® and analyzed by real-time RT-PCR for the presence of PMCV RNA using a commercial service from PHARMAQ Analytiq (Norway). Hearts stored on formalin were sectioned and histopathology was scored from 0 to 3 according to severity, with 0 indicating no pathological findings and 3 indicating the presence of severe pathology (service provided by PHARMAQ Analytiq, Norway).

[0133]

[0137] The results of viral load 3 weeks post-challenge and histoscore 7 weeks post-challenge are shown in Tables 8 and 9, respectively. The combined data of all results showed that IntDel variants 15, 16, and 17 (in which the antigen lacked the amino acid sequence set forth in SEQ ID NO: 3, 4, or 5, respectively) performed better than the full-length capsid protein (G-ORF1). [Table 8] [Table 9]

[0134]

[0138] Additional clinical trials were conducted to evaluate the three new antigen deletion candidates. For all vaccines in the first study, antigen-encoding genes were inserted downstream of the CMV promoter in the eukaryotic expression vector NTC9385R (Nature Technology Corporation). All plasmids were diluted in sterile phosphate-buffered saline (PBS) to 10 μg per 50 μl injection volume. All fish received one intramuscular injection on each side of the fish and a total dose of 20 μg. A non-immunized control group was included and received 2×50 μl PBS, as summarized in Table 10. [Table 10]

[0135]

[0139] Atlantic salmon (Salmo salar) (n=30 per group) kept in one tank of fresh water and with an average weight of 28 grams were anesthetized using Tricain (PHARMAQ), tagged by shortening of the adipose fin and / or upper jaw, assigned to groups and injected intramuscularly twice with 0.05 ml of the test vaccine under the same anesthesia period (one injection on each side of the fish). After allowing immunity to develop for 58 days at 12°C (light:dark 12:12), the fish were anesthetized again using Tricain (PHARMAQ) and challenged with infectious PMCV by intraperitoneal injection of 0.1 ml of homogenized heart (isolate ID AL V1289) originating from an outbreak in the Norwegian region of CMS. Fish (n=15 per group) were then sampled at two time points, 3 and 7 weeks after challenge. Ventricles and kidneys were harvested on RNALATER® from all sampled fish for subsequent RNA extraction. Hearts (ventricles and atria) were also fixed in formalin from all fish at the last sampling time point (week 7) for histopathological analysis. RNA was extracted from all samples stored on RNALATER® and analyzed by real-time RT-PCR for the presence of PMCV RNA using a commercial service from PHARMAQ Analytiq (Norway). Hearts stored on formalin were sectioned and histopathology was scored from 0 to 4 according to severity, with 0 indicating no pathological findings and 4 indicating the presence of severe pathology (service provided by PHARMAQ Analytiq, Norway).

[0136]

[0140] The results at 3 and 7 weeks are summarized in Tables 11 and 12, respectively. [Table 11] [Table 12]

[0137] Example 3: Vaccine backbone selection

[0141] To optimize vaccine efficacy, the characteristics of the plasmid backbone, such as vector size and functional elements, are also important. Three vector candidates were compared for in vitro antigen expression. The candidates included pcDNA3.1, pVAX1 (INVITROGEN™), NTC9385R (Nature Technology Corporation), and two variants of NTC9385R that co-express innate immune stimulatory elements: RIG-I agonist (NTC9385R-eRNA41H) and RIG-I agonist that function as type I interferon-inducing adjuvants, as well as Toll-like receptor 9-stimulating CpG motifs (NTC9385R-eRNA41H-CpG). NTC9385R NANOPLASMID™ is smaller in size than other conventional vectors, allows for improved uptake and persistence in transfected cells, and possesses a modified promoter that is claimed to enhance antigen expression. This includes an RNA-based sucrose-selectable antibiotic-free marker (RNA-OUT) that replaces the use of antibiotics in the manufacturing process, and a modified origin of replication that ensures that the plasmid can only replicate in the specific E. coli production strain, which is beneficial from a safety perspective. The smaller size may affect transfection efficiency, as well as the level and duration of expression. Additionally, some bacterial region protein marker genes, such as resistance marker genes, have been shown to dramatically reduce vector expression. It has been shown that bacterial regions larger than 1 kilobase silence transgene expression in quiescent tissues such as the liver, likely due to heterochromatin formation mediated by the untranscribed bacterial region that spreads to the eukaryotic region and inactivates the promoter (Suschak et al., 2017).

[0138]

[0142] The in vitro expression level of vaccine antigen G-ORF1 in five different plasmid backbones was evaluated by Western blotting as follows: CHH-1 cells were trypsinized and seeded in 6-well plates (1 million cells and 3 ml cell culture medium per well). The cells were incubated at 15°C ON in a CO2 incubator (5% CO2). The cells were transfected the day after seeding using 2.5 μg plasmid / well and LIPOFECTAMIN® 3000 (Thermo Fisher Scientific) according to the manufacturer's instructions. The cells were placed back into a sealed bag and incubated at 15°C in a CO2 incubator (5% CO2) for 5 days before further analysis. The plates were then placed on ice and the culture medium was removed. The cells were first washed twice with ice-cold PBS. Whole cell lysates were prepared by adding 150 μl of NP40 lysis buffer (Invitrogen, no. FNN021) containing 1× protease inhibitor cocktail (Roche, no. 1697498) directly to the wells. Lysates were transferred to pre-chilled Eppendorf tubes and incubated at 4° C. for 30 min with occasional tapping of the tubes to resuspend the cells, centrifuged at 12000 rpm for 10 min at 4° C., and the supernatants were transferred to fresh tubes and kept on ice until immunoprecipitation. On ice, 1 μg of mouse IgG1 anti-6x-His monoclonal antibody 4E3D10H2 / E3 (Fisher Scientific no. 15442890, 1 mg / ml) was added to each sample and incubated overnight at 4° C. on a rotator. Protein G-bound beads were prepared by washing the immobilized beads 3-5 times with approximately 1 ml of cold PBST and resuspended in 25 μl of PBST containing protease inhibitors per aliquot (25 μl / sample). On ice, 25 μl of pre-equilibrated beads were added to each sample and the sample-bead mixture was incubated for 1 h at room temperature with rotation. Non-specific binding was removed by washing the beads 3-5 times with 500 μl of ice-cold PBST containing protease inhibitors, gently mixing the beads between each wash.After the final wash, as much buffer as possible was removed from the beads and 40 μl of 1x Laemmli Sample Buffer (BioRad #161-0737) was added (prepared by mixing 20 μl of 2x Laemmli Sample Buffer with 2 μl of β-mercaptoethanol and 18 μl of dH2O). Samples were incubated at 70°C for 10 minutes, quickly centrifuged and magnetized, and the eluent was transferred to a new vial. All samples were denatured at 98°C for 5 minutes before loading onto a 4-20% CRITERION™ TGX STAIN-FREE™ Gel. Gels were run at 200V for approximately 45 minutes and blotted using the TRANS-BLOT® TURBO™ Transfer System (BioRad) and TRANS-BLOT® TURBO™ Midi PVDF Transfer Packs #170-4157. A 7 minute turbo program was used. The membrane was immediately placed in blocking buffer (5% non-fat milk in PBST). Blocking was performed for 1 h at room temperature. The blot was incubated with the primary antibody rabbit anti-delta PMCV ORF1 diluted 1:500 in 1% non-fat milk / PBST overnight at 4° C. on a rotator. The next day, the blot was washed 2×15 min with PBST and incubated with the secondary antibody polyclonal swine anti-rabbit (DAKO #P0217) immunoglobulin HRP diluted 1:1000 in 2% non-fat milk and PRECISION PROTEIN™ StrepTactin-HRP Conjugate 1:10000 (to visualize the ladder) for 1 h at room temperature. The blot was washed 2×15 min with PBST before detection of the signal with Clarity western ECL substrate (BioRad #170-5060).

[0139]

[0143] For all vaccines in this study, the full-length PMCV ORF1 capsid gene (G-ORF1), routed for expression at the cell membrane, was inserted downstream of the CMV promoter in different eukaryotic expression vectors according to the table below. All plasmids were diluted in sterile phosphate buffered saline (PBS) to 10 μg per 50 μl injection volume. All fish received one intramuscular injection on each side of the fish and a total dose of 20 μg. A non-immunized control group was included and received 2×50 μl PBS, as summarized in Table 13. [Table 13]

[0140]

[0144] Atlantic salmon (Salmo salar) (n=30 per group) kept in freshwater and with a mean weight of 29 grams were anesthetized using Tricain (PHARMAQ), tagged by shortening of the adipose fin and / or upper jaw, assigned to groups and injected intramuscularly twice with 0.05 ml of the test vaccine under the same anesthesia period (one injection on each side of the fish). After allowing immunity to develop for 59 days at 12°C (light:dark 12:12), the fish were anesthetized again using Tricain (PHARMAQ) and challenged with infectious PMCV by intraperitoneal injection of 0.1 ml of homogenized heart (isolate ID AL V1273 heart) originating from an outbreak in the Norwegian region of CMS. Fish (n=15 per group) were then sampled at two time points, 20 and 48 days after challenge. Ventricles and kidneys were harvested on RNALATER® from all sampled fish for subsequent RNA extraction. Hearts (ventricles and atria) were also fixed in formalin from all fish at the last sampling time point (day 48) for histopathological analysis. RNA was extracted from all samples stored on RNALATER® and analyzed by real-time RT-PCR for the presence of PMCV RNA using a commercial service from PHARMAQ Analytiq (Norway). Hearts stored on formalin were sectioned and histopathology was scored from 0 to 3 according to severity, with 0 indicating no pathological findings and 3 indicating the presence of severe pathology (service provided by PHARMAQ Analytiq, Norway).

[0141]

[0145] Western blot analysis of transfected CHH-1 cells showed that all three NTC9385R plasmid variants mediated superior antigen expression compared to the pcDNA3.1 and pVAX1 plasmid backbones (Figure 5). Clinical trials showed good protection for the NTC9385R-based vaccine, at least as good as the pcDNA3.1 / pVAX1-based vaccine (see Tables 14 and 15 for 3 and 7 weeks, respectively). The combined data set showed a trend toward superior protection with the NTC9385R-based vaccine backbone. The NTC9385R plasmid with immune stimulatory elements did not provide any additional benefit. [Table 14] [Table 15]

[0142] Example 4: Adjuvant Selection

[0146] Molecular adjuvants have shown considerable promise in both enhancing immunogenicity and extending the longevity of immune responses, and these molecular adjuvants expressing cytokines, chemokines, or costimulatory molecules can be co-administered with DNA vaccine plasmids encoding antigens. Cells transfected with molecular adjuvant plasmids secrete the adjuvant into the surrounding area and stimulate local antigen-presenting cells (Suschak et al., 2017). The adjuvant activity of fish type I interferons has already been shown in a viral DNA vaccination model of infectious salmon anemia virus (ISAV) in Atlantic salmon (Chang et al., 2015). In this paper, it was demonstrated that type I IFN enhanced antibody responses against ISAV-hemagglutinin protein and provided increased protection against viral challenge.

[0143]

[0147] The following molecular adjuvants: IFNa, IFNb, IFNc, IFNd, IFNγ, IL-2, IL-4, IL-12, and VHSV-G were tested in vivo with full-length PMCV ORF1 vaccine antigen (G-ORF1) for adjuvant activity using a high-throughput model for rapid efficacy screening of candidates.

[0144]

[0148] This model is based on the surprising discovery that differences in histopathological lesions 50 days after challenge can be predicted by viral RNA levels in the heart and kidney of the same groups 20 days after challenge. Therefore, for rapid screening of many groups, only one sampling time point, 3 weeks after challenge, needs to be used.

[0145]

[0149] For all groups in the in vivo screening study of adjuvants, the vaccine antigen and the plasmid-encoded adjuvant were administered on separate plasmids. The gene encoding the antigen (G-ORF1) and the various plasmid-encoded adjuvant genes were all inserted downstream of the CMV promoter in the eukaryotic expression vector pcDNA3.1(+) (Invitrogen). The plasmids were diluted in sterile phosphate-buffered saline (PBS) to 10 μg per 50 μl injection volume according to the table below. All fish received one intramuscular injection on each side of the fish and a total dose of 20 μg of plasmid (20 μg of each plasmid if antigen + adjuvant was given). As summarized in Table 16, two non-immunized control groups were included, one group received 20 μg of control vaccine (eGFP in pcDNA3.1) and one group received 2×50 μl of PBS. [Table 16-1] [Table 16-2]

[0146]

[0150] Atlantic salmon (Salmo salar) (n=15 per group) kept in freshwater and with an average weight of 31 grams were anesthetized using Tricain (PHARMAQ), tagged by shortening of the adipose fin and / or upper jaw, assigned to groups and injected intramuscularly twice with 0.05 ml of the test vaccine under the same anesthesia period (one injection on each side of the fish). After allowing immunity to develop for 50 days at 12°C (light:dark 12:12), the fish were anesthetized again using Tricain (PHARMAQ) and challenged with infectious PMCV by intraperitoneal injection of 0.1 ml of homogenized heart (isolate ID ALV1223 heart) originating from an outbreak in the Norwegian area of ​​CMS. Fish (n=15 per group) were then sampled 21 days after challenge. Ventricles and kidneys were harvested on RNALATER® from all sampled fish for subsequent RNA extraction. RNA was extracted from all samples stored on the RNALATER® and analyzed for the presence of PMCV RNA by real-time RT-PCR using a commercial service from PHARMAQ Analytiq (Norway).

[0147]

[0151] After 7 weeks of immunization and 3 weeks of challenge, the model found that while most of the adjuvant strategies failed to improve efficacy, one adjuvant, IFNb, significantly enhanced the level of efficacy. The results are listed in Table 17.

[0148]

[0152] IFNb and IFNc were selected for follow-up fish testing. For all groups in this study, the vaccine antigen and plasmid-encoded adjuvant were administered on separate plasmids. The antigen-encoding gene (G-ORF1) and the plasmid-encoded adjuvant gene (IFNb or IFNc) were all inserted downstream of the CMV promoter in the eukaryotic expression vector pcDNA3.1(+) (Invitrogen). Plasmids were diluted in sterile phosphate-buffered saline (PBS) to 10 μg per 50 μl injection volume according to the table below. All fish received one intramuscular injection on each side of the fish and a total dose of 20 μg of plasmid (20 μg of each plasmid if antigen + adjuvant was given). A non-immunized control group was included and received 2×50 μl of PBS, as summarized in Table 18. [Table 17] [Table 18]

[0149]

[0153] Atlantic salmon (Salmo salar) (n=30 per group) kept in fresh water and with a mean weight of 29 grams were anesthetized using Tricain (PHARMAQ), tagged by shortening of the adipose fin and / or upper jaw, assigned to groups and injected intramuscularly twice with 0.05 ml of the test vaccine under the same anesthesia period (one injection on each side of the fish). After allowing immunity to develop for 59 days at 12°C (light:dark 12:12), the fish were anesthetized again using Tricain (PHARMAQ) and challenged with infectious PMCV by intraperitoneal injection of 0.1 ml of homogenized heart (isolate ID ALV1273 heart) originating from an outbreak in the Norwegian region of CMS. Fish (n=15 per group) were then sampled at two time points, 20 and 48 days after challenge. Ventricles and kidneys were harvested on RNALATER® from all sampled fish for subsequent RNA extraction. Hearts (ventricles and atria) were also fixed in formalin from all fish at the last sampling time point (day 48) for histopathological analysis. RNA was extracted from all samples stored on RNALATER® and analyzed by real-time RT-PCR for the presence of PMCV RNA using a commercial service from PHARMAQ Analytiq (Norway). Hearts stored on formalin were sectioned and histopathology was scored from 0 to 3 according to severity, with 0 indicating no pathological findings and 3 indicating the presence of severe pathology (service provided by PHARMAQ Analytiq, Norway).

[0150]

[0154] The results showed that IFNb was superior to IFNc (Table 19). The difference between the two adjuvants was most pronounced at the sampling time point 7 weeks after challenge (data from earlier time points not shown). The group receiving the adjuvant only was also partially protected, reflecting that IFN is a key effector of both innate and adaptive immune responses. [Table 19]

[0151] Example 5 - Adjuvant Delivery

[0155] The goal of this experiment was to determine the best method of delivering the antigen and molecular adjuvant.

[0152]

[0156] The plasmid-encoded adjuvant may be delivered on a separate plasmid or may be included on the same plasmid as that encoding the antigen. If expressed from the same plasmid as the antigen, this may be done, for example, in the following manner. 1. From a separate but same promoter as the vaccine antigen. 2. From a similar (but not identical) promoter that is separate from the vaccine antigen. 3. As a fusion protein with the antigen separated by a P2A peptide sequence to facilitate self-cleavage.

[0153]

[0157] In this example, different delivery options of the adjuvant were tested. Cell surface expressed PMCV ORF1 antigen (G-ORF1) was given to all groups. The adjuvant was provided in the following way: 1. On a separate plasmid (G-ORF1+IFNb) 2. Expressed together with the antigen, downstream of the same CMV promoter and separated from the antigen by the self-cleaving 2A peptide (G-ORF1-P2A-IFNb) 3. Expressed on the same plasmid as the antigen, but downstream of a second CMV promoter (G-ORF1-CMV-IFNb) 4. One group received only antigen (G-ORF1) and no adjuvant. 5. A non-vaccinated control group receiving PBS was also included.

[0154]

[0158] For all vaccines in this study, genes were inserted downstream of the CMV promoter in the eukaryotic expression vector pVAX1 (Invitrogen). The antigen used was G-ORF1 (G-PMCV_ORF1_full_1-2583). All vaccines were diluted in sterile phosphate-buffered saline (PBS) to 10 μg per 50 μl injection volume. All fish received one intramuscular injection on each side of the fish and a total dose of 20 μg. For fish receiving antigens and plasmid-encoded adjuvants on separate plasmids, the dose of each plasmid was 20 μg. A non-immunized control group was included and received 2×50 μl PBS. In addition, one group received a codon-altered version of the plasmid-encoded adjuvant, as summarized in Table 20. [Table 20]

[0155]

[0159] Atlantic salmon (Salmo salar) (n=30 per group) kept in fresh water and with an average weight of 25 grams were anesthetized using Tricain (PHARMAQ), tagged by shortening of the adipose fin and / or upper jaw, assigned to groups and injected intramuscularly twice with 0.05 ml of the test vaccine under the same anesthesia period (one injection on each side of the fish). After immunity was allowed to develop for 49 days at 12°C (light:dark 12:12), the fish were anesthetized again using Tricain (PHARMAQ) and challenged with infectious PMCV by intraperitoneal injection of 0.1 ml of homogenized heart (isolate ID ALV1273 heart) originating from an outbreak in the Norwegian area of ​​CMS. Fish (n=15 per group) were then sampled at two time points, 19 and 47 days after challenge. Ventricles and kidneys were harvested on RNALATER® from all sampled fish for subsequent RNA extraction. Hearts (ventricles and atria) were also fixed in formalin from all fish at the last sampling time point (day 47) for histopathological analysis. RNA was extracted from all samples stored on RNALATER® and analyzed by real-time RT-PCR for the presence of PMCV RNA using a commercial service from PHARMAQ Analytiq (Norway). Hearts stored on formalin were sectioned and histopathology was scored from 0 to 3 according to severity, with 0 indicating no pathological findings and 3 indicating the presence of severe pathology (service provided by PHARMAQ Analytiq, Norway).

[0156]

[0160] Results from the clinical trial are illustrated by histoscore data from the heart 7 weeks after challenge (Table 21).

[0157]

[0161] Antigen expression levels and adjuvant activity for the different constructs have also been evaluated in vitro (results not shown). The combined results suggest that the preferred approach is to provide the adjuvant on the same plasmid as the antigen, under the same but separate promoter as the antigen, although delivery on a different plasmid may also be effective. [Table 21]

[0158] Example 6 - Duration of Vaccine Effectiveness

[0162] Initial studies showed that fish receiving only the adjuvant were partially protected, reflecting that IFNs are important effectors of both the innate and adaptive immune responses. A long-term follow-up vaccine trial was performed to study the duration of protection afforded by including a molecular adjuvant in the DNA construct.

[0159]

[0163] For all vaccines in this study, genes were inserted downstream of the CMV promoter in eukaryotic expression vectors from Nature Technology Corporation (NTC). The backbones were either NTC9385R or NTC9385R-eRNA41H-CpG. For groups receiving both antigen and plasmid-encoded adjuvant, these were provided either as separate plasmids (20 μg of each plasmid) or the same plasmid (20 μg). All fish received one intramuscular injection (0.05 ml) on each side of the fish. A non-immunized control group was included and received 2×50 μl of PBS. See Table 22 below for details of the vaccine groups. [Table 22]

[0160]

[0164] Atlantic salmon (Salmo salar) (n=60 per group) held in freshwater and with an average weight of 17 grams were anesthetized using Tricain (PHARMAQ), tagged by shortening of the adipose fin and / or upper jaw, assigned to groups, and injected intramuscularly with two 0.05 ml doses of the test vaccine under the same anesthesia period (one injection on each side of the fish). The fish were then held in holding tanks where immunity was allowed to develop for 78, 120, or 183 days at 12°C (12:12 light:dark). At each of these time points, cohorts of fish (n=15 per group at 78 and 183 dpv, and n=30 per group at 120 dpv) were transferred to challenge tanks. Fish were reanaesthetized using Tricain (PHARMAQ) and challenged with infectious PMCV by intraperitoneal injection of 0.1 ml homogenized heart (isolate ID ALV1273 heart) from an outbreak in the Norwegian region of CMS. Fish (n=15 per group) were then sampled 3 weeks after challenge. Ventricles and kidneys were harvested on RNALATER® from all sampled fish for subsequent RNA extraction. An additional sampling was performed 7 weeks after challenge for the cohort challenged 120 days after vaccination. In addition to hearts and kidneys for RNALATER®, hearts (ventricles and atria) were also fixed in formalin from all fish at this last sampling time point (week 7) for histopathological analysis. RNA was extracted from all samples stored on RNALATER® and analyzed for the presence of PMCV RNA by real-time RT-PCR using a commercial service from PHARMAQ Analytiq (Norway). Hearts preserved on formalin were sectioned and histopathology was scored from 0 to 3 according to severity, with 0 indicating no pathological findings and 3 indicating the presence of severe pathology (services provided by PHARMAQ Analytiq, Norway).

[0161]

[0165] Vaccine efficacy was assessed by challenge up to 26 weeks after immunization (challenge at 12, 18, and 26 weeks after immunization). The 18 week challenge was followed for 50 days with two sampling time points at 20 and 50 days after challenge, and heart and kidney tissues were sampled for analysis by qPCR and evaluation of histopathology in the heart as described above.

[0162]

[0166] The results showed that significant protection against PMCV infection was achieved by all vaccines by the final challenge, 183 days / 2196 days after vaccination. The combination of G-ORF1 and IFNb provided better protection than the two components separately (Tables 23, 24). The overall results indicate that the vaccines provide long-term and sustained protection. [Table 23] [Table 24] [Table 25] [Table 26]

[0163] Example 7 - Optimization of adjuvant efficiency

[0167] To further optimize the adjuvant potential of IFNb, we identified homologous genes in Atlantic salmon and closely related species. Salmonid fishes have undergone evolutionary recent whole genome duplications, and therefore many salmon genes are found duplicated (divergent homologs). Three new genes were selected that were similar, but not identical, to the first tested IFNb adjuvants (Table 27). These were: -Atlantic salmon (Salmo salar) - IFNb1 (divergent paralog gene) -Brown trout (Salmo trutta) - IFN a3-like gene - Sockeye salmon (Onchorhynchus nerka) - IFNa3-like gene. [Table 27]

[0164]

[0168] Since vaccine integration into the salmon genome through homologous recombination may be a concern, risk mitigation may be obtained by reducing the sequence similarity between the adjuvant and the salmon genome. This was done by first translating the plasmid-encoded adjuvant into protein sequences. These sequences were then reverse-translated back from protein to nucleotide sequences (reverse translation) based on codon frequency distribution (codons assigned with a probability given by their frequency of use in Atlantic salmon). The reverse conversion was performed using CLC Main Workbench (Qiagen) with the software set to use codons based on frequency distribution.

[0165]

[0169] The new adjuvant sequences returned after this procedure were 74-80% identical to the wild-type IFNb sequence at the nucleotide level. An in vitro assay was then used to compare the activity of the four original natural adjuvant candidates, including the four codon-changed versions (referred to as RTs).

[0166]

[0170] Thus, the wild-type nucleic acid sequence of IFNb (SEQ ID NO: 18) was about 76% identical to the RT nucleic acid sequence of IFNb (SEQ ID NO: 17), and the wild-type nucleic acid sequence of IFNb1 (SEQ ID NO: 19) was about 78% identical to the RT nucleic acid sequence of IFNb1 (SEQ ID NO: 20).

[0167]

[0171] To facilitate the testing of different IFNb candidates and to evaluate their adjuvant potential, an in vitro screening assay was established. The principle of this test is to quantify Mx expression (an IFN-inducible gene) by RT-qPCR. Mx proteins belong to the superfamily of large GTPases that have antiviral activity against a wide range of RNA viruses. In vivo, the expression of Mx genes is tightly regulated by the presence of type I interferons (IFNs) and their induction has been described during several viral infections. As CHH-1 cells do not express Mx in response to IFNb stimulation (a potential consequence of lacking the receptor) and TO cells cannot be easily transfected, the assay is set up in the following way.

[0168]

[0172] The functionality / activity of the IFNb gene was studied by transfecting CHH-1 cells with various adjuvant constructs, including a non-adjuvant construct as a negative control. Seven days after transfection, cell culture medium containing secreted IFN molecules from CHH-1 cell transfectants was collected and transferred to another fish cell line (TO cells) at different dilutions. The final ratios of conditioned medium used for incubation of TO cells were typically 1:6, 1:60, 1:600, and 1:6000, allowing the in vitro model to also provide a quantitative measure of adjuvant activity. After 3 days of incubation in conditioned medium, TO cells were sampled by carefully removing the cell culture medium and extracting RNA from the cells. The Mx response induced by IFNb was analyzed by qPCR, using the following primers / probes: SEQ ID NO: 42 Mx forward: GATGCTGCACCTCAAGTCCTATTA SEQ ID NO: 43 Mx reverse: CGGATCACCATGGGAATCTGA SEQ ID NO: 44 Mx probe: 6-FAM-CAGGATATCCAGTCAACGTT-MGB

[0169]

[0173] The results are shown in Table 28 below. [Table 28]

[0170]

[0174] These results demonstrate that the RT construct has slightly higher immunomodulatory activity compared to the wild-type sequence. The results also clearly show that IFNb1 has higher immunomodulatory activity than IFNb.

[0171]

[0175] Based on in vitro studies, four RT INFb adjuvants were selected for testing as vaccine adjuvants in fish (all groups receiving PMCV capsid antigen (G-ORF1) and adjuvant on two separate plasmids). In addition, one group received G-ORF1 vaccine antigen + eGFP-encoding plasmid as a negative adjuvant control group. All fish received one intramuscular injection on both sides of the fish. All fish received antigen and plasmid-encoded adjuvant on separate plasmids, with the dose of each plasmid being 20 μg. A non-immunized control group was included and received 2×50 μl PBS, as summarized in Table 29. [Table 29]

[0172]

[0176] Atlantic salmon (Salmo salar) (n=30 per group) kept in fresh water and with an average weight of 20 grams were anesthetized using Tricain (PHARMAQ), tagged by shortening of the adipose fin and / or upper jaw, assigned to groups and injected intramuscularly twice with 0.05 ml of the test vaccine under the same anesthesia period (one injection on each side of the fish). After allowing immunity to develop for 48 days at 12°C (light:dark 12:12), the fish were anesthetized again using Tricain (PHARMAQ) and challenged with infectious PMCV by intraperitoneal injection of 0.1 ml of homogenized heart (isolate ID ALV1273 heart) originating from an outbreak in the Norwegian area of ​​CMS. Fish (n=15 per group) were then sampled at two time points, 19 and 49 days after challenge. Ventricles and kidneys were harvested on RNALATER® from all sampled fish for subsequent RNA extraction. Hearts (ventricles and atria) were also fixed in formalin from all fish at the last sampling time point (day 49) for histopathological analysis. RNA was extracted from all samples stored on RNALATER® and analyzed by real-time RT-PCR for the presence of PMCV RNA using a commercial service from PHARMAQ Analytiq (Norway). Hearts stored on formalin were sectioned and histopathology was scored from 0 to 3 according to severity, with 0 indicating no pathological findings and 3 indicating the presence of severe pathology (service provided by PHARMAQ Analytiq, Norway).

[0173]

[0177] The results are shown in Tables 30 and 31 below. [Table 30] [Table 31]

[0174]

[0178] The overall conclusion is that all tested RT adjuvants offered similar protection, but the protection induced using the IFNb1 RT construct was slightly higher than that induced by the IFNb RT construct. Codon-altered versions of these adjuvants are preferred to reduce the risk of homologous recombination.

[0175]

[0179] The best way to deliver the adjuvant is on the same plasmid as the antigen, using a separate but identical promoter from the antigen, although delivery of antigen and adjuvant using different plasmids is also effective.

[0176]

[0180] All publications, both patent and non-patent publications, cited in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains, and all such publications are herein fully incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0177]

[0181] Although the invention herein has been described with reference to particular embodiments, it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention. It is thus to be understood that numerous modifications can be made to the exemplary embodiments and other configurations can be devised without departing from the spirit and scope of the invention as defined by the following claims.

Claims

1. A protein comprising, from the N-terminus to the C-terminus: a. a sequence that is at least 90% identical, or at least 91% identical, or at least 92% identical, or at least 93% identical, or at least 94% identical, or at least 95% identical, or at least 96% identical, or at least 97% identical, or at least 98% identical, or at least 99% identical, or 100% identical to SEQ ID NO: 34 or SEQ ID NO: 35; b. an amino acid sequence at least 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 25-33; i) the amino acid sequence lacks SEQ ID NO: 15 or a sequence at least 90% identical to SEQ ID NO: 15, and / or ii) A protein, wherein, compared to SEQ ID NO: 1, said protein comprises an internal deletion that is at least 4 consecutive amino acids in length.

2. 2. The protein of claim 1, comprising a sequence at least 95% identical to SEQ ID NO:25 and lacking SEQ ID NO:14 or a sequence at least 90% identical to SEQ ID NO:

14.

3. 3. The protein of claim 2, which lacks SEQ ID NO: 15 or a sequence that is at least 90% identical to SEQ ID NO:

15.

4. 4. The protein of claim 2 or 3, which lacks SEQ ID NO:5 or a sequence that is at least 90% identical to SEQ ID NO:

5.

5. 5. The protein of claim 4, which lacks SEQ ID NO:4 or a sequence that is at least 90% identical to SEQ ID NO:

4.

6. 2. The protein of claim 1, comprising a sequence at least 95% identical to SEQ ID NO:26 and lacking SEQ ID NO:14 or a sequence at least 90% identical to SEQ ID NO:

14.

7. 7. The protein of claim 6, which lacks SEQ ID NO: 15 or a sequence that is at least 90% identical to SEQ ID NO:

15.

8. 8. The protein of claim 6 or 7, which lacks SEQ ID NO:5 or a sequence that is at least 90% identical to SEQ ID NO:

5.

9. 7. The protein of claim 6, which lacks SEQ ID NO:24 or a sequence that is at least 90% identical to SEQ ID NO:

24.

10. 2. The protein of claim 1, comprising a sequence at least 95% identical to SEQ ID NO:27 and lacking SEQ ID NO:14 or a sequence at least 90% identical to SEQ ID NO:

14.

11. 11. The protein of claim 10, which lacks SEQ ID NO: 15 or a sequence that is at least 90% identical to SEQ ID NO:

15.

12. 12. The protein of claim 10 or 11, which lacks SEQ ID NO:3 or a sequence that is at least 90% identical to SEQ ID NO:

3.

13. 11. The protein of claim 10, which lacks SEQ ID NO:24 or a sequence that is at least 90% identical to SEQ ID NO:

24.

14. The protein of claim 1, comprising a sequence that is at least 90% identical to SEQ ID NO:

28.

15. 15. The protein of claim 14, which lacks SEQ ID NO:4 or a sequence that is at least 90% identical to SEQ ID NO:

4.

16. 16. The protein of claim 14 or 15, which lacks SEQ ID NO:3 or a sequence that is at least 90% identical to SEQ ID NO:

3.

17. 15. The protein of claim 14, which lacks SEQ ID NO:24 or a sequence that is at least 90% identical to SEQ ID NO:

24.

18. 2. The protein of claim 1, comprising SEQ ID NO: 29, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical thereto.

19. 8. A protein according to any one of claims 1, 6 and 7, comprising SEQ ID NO: 30 or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical thereto.

20. 20. The protein of claim 19, which lacks SEQ ID NO:24 or a sequence that is at least 90% identical to SEQ ID NO:

24.

21. 2. The protein of claim 1, comprising SEQ ID NO: 31, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical thereto.

22. 22. The protein of claim 21, which lacks at least one of SEQ ID NO: 3 or SEQ ID NO: 24, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 3 or SEQ ID NO:

24.

23. 2. The protein of claim 1, comprising SEQ ID NO: 32, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical thereto.

24. 24. The protein of claim 23, which lacks at least one of SEQ ID NO: 14 or SEQ ID NO: 15, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 14 or SEQ ID NO:

15.

25. 2. The protein of claim 1, comprising SEQ ID NO: 33, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical thereto.

26. 26. The protein of claim 25, which lacks SEQ ID NO:24 or an amino acid sequence that is at least 90% identical to SEQ ID NO:

24.

27. 2. The protein of claim 1, which lacks SEQ ID NO:23 or a sequence that is at least 90% identical to SEQ ID NO:

23.

28. 2. The protein of claim 1, which lacks SEQ ID NO:22 or a sequence that is at least 90% identical to SEQ ID NO:

22.

29. 2. The protein of claim 1, wherein the protein comprises SEQ ID NO: 15, or a sequence at least 90% identical thereto, and any one of SEQ ID NOs: 4, 5, 25, 26 27, 29, 30, 32, or an amino acid sequence at least 90% identical to SEQ ID NO: 4, 5, 25, 26 27, 29, 30, or 32, and wherein, compared to SEQ ID NO: 1, the protein comprises an internal deletion that is at least four consecutive amino acids in length.

30. 2. The protein of claim 1, which lacks SEQ ID NO: 13, or a sequence at least 90% identical to SEQ ID NO: 13, and contains SEQ ID NO: 25, or a sequence at least 95%, or 96%, or 97%, or 98%, or 99% identical to SEQ ID NO:

25.

31. 2. The protein of claim 1, comprising SEQ ID NO: 11 or 12 or SEQ ID NO: 46, or a sequence that is at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% identical to SEQ ID NO: 11 or SEQ ID NO:

12.

32. 2. The protein of claim 1, wherein at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or 100% of the amino acids that differ from SEQ ID NO: 11, or SEQ ID NO: 12, or SEQ ID NO: 46 are conservative substitutions.

33. The protein of claim 1, c) an N-terminal secretory signal sequence of a secreted protein or a first membrane-bound protein upstream of the protein of claim 1; d) A fusion protein further comprising the transmembrane domain of a second membrane-associated protein downstream of the protein of claim 1.

34. 34. The fusion protein of claim 33, wherein the first membrane-associated protein is identical to the second membrane-associated protein.

35. 35. The fusion protein of claim 34, wherein the membrane-associated protein is viral hemorrhagic septicemia virus G-protein (VHSV-G).

36. 36. The fusion protein of claim 35, wherein the N-terminal secretory signal sequence is at least 90% identical to SEQ ID NO:7 or SEQ ID NO:48, or wherein the secretory signal sequence comprises SEQ ID NO:48 or a portion of a sequence at least 90% identical to SEQ ID NO:48, said portion comprising SEQ ID NO:7 or a sequence at least 90% identical to SEQ ID NO:

7.

37. 37. The fusion protein of claim 36, wherein at least half of the different amino acids in the N-terminal secretion signal are conservative substitutions.

38. 38. The fusion protein of any one of claims 33 to 37, wherein the transmembrane domain is at least 90% identical to SEQ ID NO:8 or SEQ ID NO:49, or wherein the transmembrane fragment comprises SEQ ID NO:49 or a portion of a sequence at least 90% identical to SEQ ID NO:49, said portion comprising SEQ ID NO:8 or a sequence at least 90% identical to SEQ ID NO:

8.

39. 34. The fusion protein of claim 33, wherein at least half of the different amino acids in the transmembrane domain are conservative substitutions.

40. A nucleic acid sequence encoding the protein of claim 1 or the fusion protein of claim 33.

41. 41. The nucleic acid sequence of claim 40, comprising SEQ ID NO:

16.

42. A vector comprising the nucleic acid sequence of claim 40.

43. 43. The vector of claim 42, further comprising a nucleic sequence encoding an immunomodulatory factor.

44. 44. The vector of claim 43, wherein the immunomodulator is an interferon.

45. The vector according to any one of claims 42 to 44, which is a plasmid vector.

46. A host cell comprising the vector of claim 42.

47. 43. A vaccine comprising the vector of claim 42, or a vector comprising a nucleic acid sequence encoding SEQ ID NO: 1 or an amino acid sequence which is 98% identical thereto.

48. 48. A method of preventing Piscine Myocarditis Virus (PMCV) infection in a salmonid fish in need thereof, comprising administering to said salmonid fish the vaccine of claim 47.

49. 49. The method of claim 48, wherein the salmonid fish weighs between 15 and 200 grams.

50. 50. The method of claim 49, wherein the salmonid fish weighs between 40 and 110 grams.

51. 51. The method of any one of claims 48 to 50, wherein the salmonid fish is Atlantic salmon (Salmo salar), rainbow trout (Oncorhynchus mykiss), Chinook salmon (Oncorhynchus tshawytscha), or Coho salmon (Oncorhynchus kisutch).

52. 48. The vaccine of claim 47 for use in a method for protecting salmonid fish from infection.

53. 53. The vaccine of claim 52, wherein the vector comprises a nucleic acid sequence encoding SEQ ID NO: 1, or an amino acid sequence that is 98% identical thereto.

54. 54. The vaccine of claim 52 or 53, wherein the salmonid fish weighs between 15 and 200 grams.

55. 54. The vaccine of claim 52 or 53, wherein the salmonid weighs between 40 and 110 grams.

56. 53. The vaccine of claim 52, wherein the salmonid is Atlantic salmon (Salmo salar), rainbow trout (Oncorhynchus mykiss), or coho salmon (Oncorhynchus kisutch).

57. 57. The vaccine of claim 56, wherein the salmonid fish is Salmo salar.

58. 52. The method of claim 51, wherein the salmonid fish is Salmo salar.