Human parainfluenza virus type i hn recombinant antigen and use thereof

Abstract

The present application relates to the technical field of molecular biology, and particularly relates to a human parainfluenza virus type I HN recombinant antigen and application thereof. The amino acid sequence of the human parainfluenza virus type I recombinant HN recombinant antigen provided by the present application is shown as SEQ ID NO:1. The amino acid sequence provided by the present application can be efficiently expressed in insect cells, and a stable antigen can be obtained after purification and preparation of the expression product, and the antigen has high immunological activity and can be used for serum specific antibody detection or parainfluenza virus infection diagnosis.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, in particular to human parainfluenza virus type I HN recombinant antigen and its application. BACKGROUND

[0002] Parainfluenza virus (PIV) belongs to paramyxoviridae, and often causes lower respiratory tract infection in infants and children. According to serology, human parainfluenza virus can be divided into four types (PIV1-PIV4), and PIV4 can be further divided into 4A and 4B. PIV1 and PIV2 are the main pathogens causing infantile croup and laryngotracheobronchitis, PIV3 often causes pneumonia or bronchitis, and PIV4 rarely causes serious diseases. PIV virus often causes repeated infection of the lower respiratory tract, especially in the elderly and immunodeficient population.

[0003] Human parainfluenza virus (HPIVs) is a kind of pleomorphic, membrane-enclosed negative-strand RNA virus with a diameter of 125-250 nm. The viral membrane envelope is composed of lipids and glycoproteins, and the glycoproteins generally have two types: one is HN protein with hemagglutination activity and neuraminidase activity, and the other is F protein with cell fusion promoting effect and hemolysis characteristics. HN protein is located on the surface of the virus particle and is the main antigen for the production of virus neutralizing antibodies, and it plays its biological activity through the formation of a tetramer by disulfide bond, which is the main antigen for clinical detection.

[0004] Early rapid diagnosis of parainfluenza can guide the development of appropriate antiviral and antibacterial treatment programs in a timely manner, and reduce the harm of HPIVs to infants. There are many methods for detecting parainfluenza virus, the most classic method is virus culture and isolation, but its operation is complex, time-consuming and often has false positives, so it generally has no clinical diagnostic significance; electron microscopy can detect virus particles, but electron microscopy equipment is expensive and the operation is complex, which is not suitable for clinical use; nucleic acid detection technology requires high requirements and specific sites and instruments; antigen serum specific antibody detection has high sensitivity and simple operation, and is widely used in clinical diagnosis.

[0005] HN protein is the main antigen for the production of virus neutralizing antibodies, and it plays its biological activity through the formation of a tetramer by disulfide bond, which is the important antigen required for serum specific antibody diagnosis. HN is a type II integral membrane protein, which contains an N-terminal cytoplasmic tail, a single N-terminal transmembrane domain, a membrane proximal stalk domain and a large C-terminal globular head domain. The membrane proximal stalk domain plays a major role in the formation of a tetramer.

[0006] Human type I parainfluenza HN protein (HPIV1-HN) consists of 575 amino acids and has a molecular weight of 63,955 Da. The hydrophobic transmembrane region and tetrameric helical region in its sequence are the main reasons for protein instability and difficulty in expression and purification. Modifying its HN sequence to reduce these unstable factors is crucial for stable and efficient protein expression. Currently, research on parainfluenza antigen expression mainly focuses on HPIV3, with very little research on human type I parainfluenza.

[0007] Therefore, providing recombinant antigens of human type I parainfluenza virus HN and their applications are of great practical significance. Summary of the Invention

[0008] In view of this, the technical problem to be solved by the present invention is to provide a recombinant protein of a highly immunogenic fragment of human type I parainfluenza HN with high immunogenicity and good thermostability, and its application. The highly immunogenic HPIV1-HN recombinant protein obtained by the present invention through modification can be used for clinical serum sample IgM detection.

[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0010] In a first aspect, the present invention provides a highly immunogenic fragment of human type I parainfluenza HN, which has the following characteristics:

[0011] (I) An amino acid sequence as shown in SEQ ID No. 1; or

[0012] (II) An amino acid sequence obtained by substituting, deleting, or adding one or more residues as shown in (I), and whose function is the same as or similar to that of (I); or

[0013] (III) An amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homologous to the amino acid sequence shown in (I) or (II).

[0014] In some specific embodiments of the present invention, the plurality includes 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0015] Secondly, the present invention also provides a recombinant protein, including the aforementioned highly immunogenic fragment of human type I parainfluenza HN.

[0016] Thirdly, the present invention also provides a nucleic acid molecule encoding the highly immunogenic fragment of human type I parainfluenza HN, which has the following characteristics:

[0017] (i) A nucleotide sequence as shown in SEQ ID No. 2;

[0018] (ii) A nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (i), but differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0019] (iii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0020] (iv) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with any of the nucleotide sequences described in (i) to (iii).

[0021] In some specific embodiments of the present invention, the plurality includes 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0022] Fourthly, the present invention also provides an expression vector, including the aforementioned nucleic acid molecule and backbone vector.

[0023] In some specific embodiments of the present invention, the skeleton carrier includes a pFastBac1 carrier; and / or

[0024] The expression vector includes baculovirus.

[0025] Fifthly, the present invention also provides a host, including the aforementioned expression vector.

[0026] In some specific embodiments of the present invention, the host includes insect cells;

[0027] Preferably, the insect cells include eukaryotic insect cells;

[0028] Preferably, the eukaryotic insect cells are sf9 or hi5 cell lines.

[0029] In a sixth aspect, the present invention also provides a method for preparing the highly immunogenic fragment of human type I parainfluenza HN or the recombinant protein, culturing the host, and expressing the protein.

[0030] In a seventh aspect, the present invention also provides the use of any of the following in the preparation of detection reagents or kits for serum-specific IgM antibodies and / or parainfluenza viruses:

[0031] (I) The highly immunogenic fragment of human type I parainfluenza HN;

[0032] (II) The recombinant protein mentioned above;

[0033] (III) The aforementioned nucleic acid molecules;

[0034] (IV) The aforementioned expression vector;

[0035] (V) the host; and / or

[0036] (VI) The highly immunogenic fragment or recombinant protein of human type I parainfluenza HN obtained by the preparation method.

[0037] Eighthly, the present invention also provides a detection reagent or kit for parainfluenza virus, comprising any one of the following:

[0038] (I) The highly immunogenic fragment of human type I parainfluenza HN;

[0039] (II) The recombinant protein mentioned above;

[0040] (III) The aforementioned nucleic acid molecules;

[0041] (IV) The aforementioned expression vector;

[0042] (V) the host; and / or

[0043] (VI) The highly immunogenic fragment or recombinant protein of human type I parainfluenza HN obtained by the preparation method.

[0044] This invention provides a highly immunologically active HPIV1-HN recombinant protein that can be used for IgM detection in clinical serum samples. The amino acid sequence of the human type I parainfluenza HN recombinant protein is shown in SEQ ID NO:1. The full-length HN protein is expressed only in trace amounts in insect cells. This patent screens extracellular fragments that can be efficiently expressed in the host and can be used for IgM antibody detection in parainfluenza serum samples. Attached Figure Description

[0045] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0046] Figure 1 This invention presents the SDS-PAGE detection results of recombinant human type I parainfluenza HN protein according to an embodiment of the present invention. Detailed Implementation

[0047] This invention discloses a recombinant human type I parainfluenza HN protein and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0048] The amino acid sequence of the recombinant human type I parainfluenza HN protein provided by this invention is shown in SEQ ID NO:1.

[0049] The recombinant human parainfluenza type I (HN) protein fragment described in this invention is constructed by recombination based on human HN type I. By removing the intracellular region (1-35) and transmembrane region (36-56) of the protein, as well as removing hydrophobic helices and disordered regions of different lengths at the N-terminus, the highly immunogenic extracellular region fragment is retained.

[0050] The present invention also provides an expression vector comprising the polynucleotide described herein. That is, the present invention provides an expression vector encoding the recombinant protein described herein. In some embodiments, the backbone vector of the expression vector is selected from the pFastBac1 vector.

[0051] The expression vector of the present invention is a baculovirus, and the cell line containing the polynucleotide or the expression vector described herein is an insect cell capable of transfecting baculovirus and expressing protein.

[0052] In this invention, the host cell is a eukaryotic insect cell containing an expression vector for the polynucleotide or expressed in insect cells. In some embodiments, the host insect cell is an sf9 or hi5 cell line.

[0053] The expression vector of the present invention is a baculovirus, and the cell line containing the polynucleotide or the expression vector described herein is an insect cell capable of transfecting baculovirus and expressing protein.

[0054] The present invention also provides a method for preparing the recombinant protein, comprising: culturing the host cells, transfecting the host cells with baculovirus and expressing the protein.

[0055] In some embodiments, the method for preparing the recombinant protein further includes steps of changing the medium and extracting and purifying the supernatant after expression. The medium change is performed using hollow fiber filtration. The extraction is performed using Ni metal chelation chromatography.

[0056] The application of the recombinant protein, the polynucleotide, the expression vector, the cell line, the host cell, or the product obtained by the preparation method described in this invention in the detection of serum-specific IgM antibodies.

[0057] The amino acid sequence of the recombinant human type I parainfluenza HN protein is shown in SEQ ID NO:1. The full-length HN protein is expressed only in trace amounts in insect cells. This patent screens for extracellular fragments that can be efficiently expressed in the host and can be used for the detection of IgM antibodies in parainfluenza serum samples.

[0058] Unless otherwise defined, all technical terms used herein have the same meaning as understood by one of ordinary skill in the art. For definitions and terminology in this field, those skilled in the art may refer to Current Protocols in Molecular Biology (Ausubel). The abbreviations for amino acid residues are the standard 3-letter and / or 1-letter codes used in this field to refer to one of the 20 commonly used L-amino acids.

[0059] The amino acid sequence of the recombinant human type I parainfluenza HN protein is shown in SEQ ID NO:1.

[0060] SEQ ID NO:1

[0061] MAEKGKTISSYWSTTRNDNSTVNTHINTPAGRTHIWLLIATTMHAALSLIIMILCIDLIIKQDTCMKTNIMTVSSVNESAKTIKETITELIRQEVISRTINIQSSVQSGIPILLNKQSRDLTQLIEKSCNKQELAQICENTIAIHHADGITPLDPHDFWRCPVGEPLLSNNPNISLLPGPSLLSGSTTISGCVRLPSLSIGDAIYAYSSNLITQGCADIGKSYQVLQLGYISLNSDMYPDLNPVISHTYDINDNRKSCSVIAAGTRGYQLCSLPTVNETTDYSSEGIEDLVFDILDLKGKTKSHRYKNEDITFDHPFSAMYPSVGSGIKIENTLVFLGYGGLTTPLQGNTKCVINRCPNVNQSVCNDALKITWLKKRQVVNVLIRINNYLSDRPKIVVETIPITQNYLGAEGRLLKLGKKIYIYTRSSGWHSNLQIGSLDINKPMTINWAPHKVLSRPGNPDCNWFNKCPRECISGVYTDAYPLSPDAVNVATTTLYANTSRVNPTIMYSNTSKIINMLRLKNGQLEAAYTTTSCITHFGKGYCFHIVEINQTSLNTLQPMLFKTSIPKICKITS

[0062] The nucleotide sequence encoding the human parainfluenza type I HN recombinant protein is shown in SEQ ID NO:2.

[0063] ATGGCTGAAAAAGGTAAAACTATATCATCATACTGGTCTACAACAAGAAATGATAATTCCACTGTCAATACTCACATAAACACCCCTGCAGGGAGAACACATATTTGGTTGTTGATTGCAACAACCATGCACGCCGCTCTGTCATTAATTATCATGATTTTATGTATAGACCTAATCATTAAACAAGACACATGTATGAAGACGAATATTATGACAGTTTCATCAGTCAATGAAAGTGCGAAAACTATTAAGGAAACGATTACTGAGTTGATACGTCAAGAAGTTATCTCAAGAACCATCAATATACAATCATCCGTACAGTCTGGCATTCCAATATTGCTTAACAAGCA

[0064]

[0065] The test materials used in this invention are all common commercial products and can be purchased on the market.

[0066] The present invention will be further illustrated below with reference to the embodiments:

[0067] Example 1: Gene Synthesis

[0068] The gene containing the type I parainfluenza HN recombinant protein (GeneBank ID: AFP49365.1) was synthesized after adding a 10*his tag to the C-terminus and undergoing codon optimization (SEQ ID No. 2).

[0069] Example 2: Preparation of pFastbac-1HN plasmid

[0070] Take 1 μg of 1HN polynucleotide aqueous solution and 2 μg of pFastbac1 plasmid, and add 100 units of NotI and 100 units of XbaI restriction endonucleases respectively. React at 37°C for 30 minutes. After the reaction, remove excess enzymes using a purification kit. Mix the digested 1HN and pFastBac1 plasmids and add 100 units of T4 ligase. Incubate at room temperature for 2 hours, and remove excess T4 enzymes using a purification kit. Transform the purified pFastBac-1HN construct plasmid into electrocompetent E. coli DH10BacTM using a Gene Pulser Xcell electroporator. Add 1 mL of SOC convalescent medium and incubate at 37°C for 1 hour. Plate the culture onto LB agarose plates containing 100 μg / mL ampicillin and 70 μg / mL gentamicin. After overnight culture, positive clones were selected and inoculated into a culture medium containing 100 μg / mL ampicillin and 70 μg / mL gentamicin SB. The bacteria were cultured to the logarithmic growth phase, and the purified pFastBac-1HN plasmid was obtained using the QIAGEN Maxi Prep plasmid extraction kit.

[0071] Example 3: Expression of recombinant HN protein in human type I parainfluenza

[0072] SF9 insect cells were cultured in Grace insect culture medium supplemented with 10% fetal bovine serum until the logarithmic growth phase (1.5-2.5 × 10⁻⁶). 6 Cells per milliliter of culture medium with a survival rate higher than 95%. Add 2 ml of LGrace insect culture medium to each well of a 6-well plate, and without adding additional antibiotics, add 8 x 10⁸ g of the medium to each well. 5 sf9 cells.

[0073] Add 8 μL of Cellfectin II (purchased from Thermo Fisher Scientific) to 100 μL of additive-free Grace insect culture medium, and dilute 1 μg of pFastBac-1HN to 100 μL of additive-free Grace insect culture medium. Mix the diluted Cellfectin II and pFastBac-1HN plasmid, and incubate at 25℃±5℃ for 15-30 minutes.

[0074] The Cellfectin II and pFastBac-1HN plasmid mixture was added dropwise to sf9 cells cultured in 6-well cell culture plates and incubated at 27°C for 3-5 hours. After removing the transfection mixture, 2 mL of Grace insect culture medium containing 10% fetal bovine serum was added to each well, along with 100 μg / mL ampicillin and 70 μg / mL gentamicin.

[0075] sf9 cells were cultured in culture medium for 72 hours until viral infection could be observed.

[0076] 72 hours later, when the cells entered the late stage of infection, 2 ml of culture supernatant was aspirated from each culture well. The supernatant contained P1 generation virus storage solution. The supernatant was centrifuged again at 5000xg for 5 minutes to remove cells and other residues, and then P1 generation virus was obtained.

[0077] Passage the P1 generation virus and prepare 6-well cell culture plates, adding 2 x 10⁶ cells to each well.

[0078] SF9 insect cells were incubated at room temperature for 1 hour to allow the cells to adhere to the culture plate.

[0079] An appropriate amount of P1 generation virus was added to each culture well, with the amount of virus added adjusted to maintain the copy number of infection (MOI) between 0.05 and 0.1 as needed. Cells and virus were incubated at 27°C under humid conditions for 48 hours.

[0080] Forty-eight hours later, 2 mL of culture medium was aspirated from each well. After mixing all the culture media, the mixture was centrifuged at 5000 x g for 5 minutes, and the supernatant was collected. The collected virus is the P2 generation, and its viral load must reach 1 x 10⁸.

[0081] Only when the concentration of pfu / mL is sufficient can it be used to reinfect cells and express proteins.

[0082] Add an appropriate amount of P2 generation virus to each culture flask, ensuring the infection copy number (MOI) is between 0.05 and 0.1 as needed. Incubate the cells and virus at 27°C under humid conditions for 48 hours.

[0083] Forty-eight hours later, all cell culture media were transferred to a 1000ml centrifuge cup and centrifuged at 8000rpm and 4℃ for 20min. The culture supernatant containing recombinant human type I parainfluenza HN protein was collected.

[0084] Example 4 Screening of 1HN protein expression fragments

[0085] The recombinant human type I parainfluenza HN protein fragment was constructed by recombination based on human type I parainfluenza HN. Different lengths of 1HN polypeptide sequences were expressed (Sequence 1: 61-575, Sequence 2: 66-575, Sequence 3: 77-575, Sequence 4: 106-575, Sequence 5: 130-575, Sequence 6: 143-575, Sequence 7: 154-575, Sequence 8: 180-575). Fragments with high expression levels were screened for process studies, with sequence 6: 143-575 being the preferred choice.

[0086] Table 1

[0087]

[0088] Example 5: Purification and preparation of recombinant human type I parainfluenza HN protein

[0089] (1) Buffer replacement: Assemble 10kD hollow fibers and rinse with purified water until neutral. Rinse the tubing with buffer (20mM PB + 150mM NaCl + 20mM imidazole pH 7.4). After harvesting, place the insect cell expression supernatant in an ice-water bath. After appropriate concentration with the hollow fibers, change the solution. First, concentrate the solution to half volume and then add an equal volume of 20mM PB + 150mM NaCl + 20mM imidazole pH 7.4. Repeat 5-6 times to complete the solution replacement.

[0090] (2) Centrifugation: After the liquid replacement is completed, the sample is placed in a 500ml centrifuge cup, balanced, and centrifuged. Centrifugation conditions: 4℃, 10000rpm, 30min. Immediately after centrifugation, pour the supernatant into a clean beaker.

[0091] (3) Filtration: Use an ultrafiltration cup with a pore size of 0.45 μm to filter the filtrate into another clean beaker.

[0092] (4) Ni metal chelation chromatography was performed using AKTA pure. Washing: After loading and rebalancing, impurities were washed away with 20mM PB + 150mM NaCl + 100mM imidazole at pH 7.4. The trend of UV curve changes was observed. When the UV absorbance value increased, the waste liquid tube was placed into a clean beaker to collect the eluent. The collection was stopped when the UV value reached the level, and then the waste liquid tube was put back into the waste liquid container.

[0093] (5) Dissociation of target protein: The target protein was eluted with 20mM PB + 150mM NaCl + 250mM imidazole at pH 7.4. The trend of UV curve change was observed. When the UV value increased, the sample was collected. When the UV value was at a certain level, the collection was stopped and the waste liquid tube was put back into the waste liquid bucket.

[0094] (8) Sample processing: Use a dialysis bag with a molecular cutoff of 14KD for the final solution change. The buffer solution is 20mMPB + 150mM NaCl + 50% glycerol pH 7.4. Dialyze three times, each time for no less than 3 hours.

[0095] Example 6: Application of recombinant human type I parainfluenza HN protein in the detection of IgM antibody in serum samples using the capture method.

[0096] The sequence 6 fragment was prepared using the purification methods described in Examples 3 and 5 and used as an enzyme-labeled antigen for detection in different populations. The results are shown in Table 2. The positive rate of 1HN antigen in parainfluenza PCR positive samples was 2.08%, and the positive rate in children's respiratory positive samples was 1.29%.

[0097] Table 2

[0098]

[0099] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A highly immunogenic fragment of human type I parainfluenza HN, characterized in that, Its amino acid sequence is positions 143-575 of the amino acid sequence shown in SEQ ID No.

1.

2. A recombinant protein, characterized in that, It consists of the highly immunogenic fragment of human type I parainfluenza HN as described in claim 1 and a His tag.

3. A nucleic acid molecule encoding the highly immunogenic fragment of human type I parainfluenza HN as described in claim 1 or the recombinant protein as described in claim 2.

4. An expression carrier, characterized in that, Includes the nucleic acid molecules and backbone carriers as described in claim 3.

5. The expression vector as described in claim 4, characterized in that, The skeletal carrier is the pFastBac1 carrier.

6. The expression vector as described in claim 4, characterized in that, The expression vector is a baculovirus.

7. The host, characterized in that, Including the expression vector as described in any one of claims 4 to 6.

8. The host as described in claim 7, characterized in that, The host is a eukaryotic insect cell.

9. The host as described in claim 8, characterized in that, The eukaryotic insect cells are sf9 or hi5 cell lines.

10. The method for preparing the highly immunogenic fragment of human type I parainfluenza HN as described in claim 1 or the recombinant protein as described in claim 2, characterized in that, Cultivate the host as described in any one of claims 7 to 9 to express the protein.

11. The use of any of the following in the preparation of reagents or kits for the detection of human type I parainfluenza serum-specific IgM antibodies and / or human type I parainfluenza virus: (I) The highly immunogenic fragment of human type I parainfluenza HN as described in claim 1; (II) The recombinant protein as described in claim 2; (III) The nucleic acid molecule as described in claim 3; (IV) The expression vector as described in any one of claims 4 to 6; (V) The host as described in any one of claims 7 to 9; and / or (VI) Human type I parainfluenza HN highly immunogenic fragments or recombinant proteins obtained by the preparation method described in claim 10.

12. A detection reagent or kit for human type I parainfluenza virus, characterized in that, Including any of the following: (I) The highly immunogenic fragment of human type I parainfluenza HN as described in claim 1; (II) The recombinant protein as described in claim 2; (III) The nucleic acid molecule as described in claim 3; (IV) The expression vector as described in any one of claims 4 to 6; (V) The host as described in any one of claims 7 to 9; and / or (VI) Human type I parainfluenza HN highly immunogenic fragments or recombinant proteins obtained by the preparation method described in claim 10.

Images