Immune-enhancing Salmonella strains for the treatment of cancer and uses thereof
An attenuated Salmonella strain expressing flagellin and an adjuvant protein effectively targets and destroys cancer cells, addressing the limitations of current cancer treatments by inducing a strong immune response and improving survival rates.
Patent Information
- Application Number
- JP2025527777
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-11-14
- Filing Date
- 2023-11-13
- Publication Date
- 2025-11-20
AI Technical Summary
Current cancer treatments, such as surgery, radiotherapy, and chemotherapy, are ineffective for certain cancer locations and induce severe side effects, and there is a lack of effective methods to target and kill cancer cells while minimizing harm to normal cells.
Development of an attenuated Salmonella strain engineered to produce immune-inducing substances, specifically expressing flagellin and an adjuvant protein, which selectively targets and destroys cancer cells, inducing a strong anti-cancer immune response.
The engineered Salmonella strain effectively treats primary and metastatic cancers by selectively killing cancer cells and enhancing the immune response, improving survival rates and treatment efficacy.
Smart Images

Figure 2025537780000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to immune-enhancing Salmonella strains for the treatment of cancer and their uses. [Background technology]
[0002] Currently, most cancers are treated by individual methods, such as surgery, radiotherapy, and chemotherapy, or by a combination of these.Surgery, which removes most of the cancerous tissue, can be very effective in removing cancerous tissue located in specific areas, such as the breast, colon, and skin, but it is difficult to treat cancerous tissue in certain areas, such as the spine.In addition, systemic chemotherapy, which is often used for breast cancer, lung cancer, and testicular cancer, can induce side effects that disrupt the replication or metabolic process of normal cells, and patients may develop resistance to the therapeutic agents used in chemotherapy.
[0003] Meanwhile, when cancer develops in an individual, angiogenesis and cell growth proceed at a very rapid rate within the body, creating an environment inside cancer tissue where angiogenesis is incomplete and oxygen-deficient, making it ideal for the proliferation of facultative anaerobic bacteria such as Salmonella or E. coli. Currently, cancer treatments using cancer-targeting bacteria such as Salmonella and Clostridium target solid tumors and rely on the ability of specific bacteria to grow within tumors. However, by introducing an oncolytic protein or reporter protein into the bacteria and administering the transformed bacteria to an individual, cancer tissue can be specifically identified and cancer can be treated while minimizing side effects that are toxic to normal cells.
[0004] Toxins secreted by various bacterial pathogens found in nature can cause illness in humans. Among these bacterial pathogens, Salmonella enterica, which is closely related to our diet, is a member of the Enterobacteriaceae family that inhabits the intestinal tract of primates, including humans, and secretes the exotoxin cytolysin. Cytolysin is a cytotoxic protein with a molecular weight of approximately 34 kDa. It is known to destroy red blood cells in the intestines of primates, including humans, by causing hemolysis and pore formation in the membranes of normal cells, resulting in cell lysis and severe vascular inflammation and local tissue necrosis, leading to death. However, recent research has shown that cytolysin isolated and purified from Salmonella enterica specifically reacts with cancerous tissue in the intestinal tract, inducing its destruction, and is therefore attracting attention as a next-generation anticancer therapeutic. Therefore, bacteria transformed with genes that secrete the cytotoxic substance cytolysin have great potential for use as anti-cancer therapeutic agents targeting cancer tissues. Although it is possible to diagnose or treat cancer using bacteria, there has been little research on expression vectors that enable the specific expression of proteins suitable for diagnosis and treatment in cancer tissues.
[0005] Therefore, the present invention was conceived to develop an effective cancer prevention or treatment agent that selectively kills only cancer cells, and demonstrated that an attenuated Salmonella strain can be designed to produce immune-inducing substances in cancer tissues, thereby inducing a strong anti-cancer immune response, effectively treating not only primary cancers but also metastatic cancers.The pharmaceutical composition of the present invention is expected to be widely used in the field of cancer treatment because it has the effect of specifically killing cancers in an in vivo system and improving survival rates. Summary of the Invention [Problem to be solved by the invention]
[0006] The present inventors have conducted extensive research to develop an effective cancer prevention or treatment agent that selectively kills only cancer cells. As a result, they have confirmed that an attenuated Salmonella strain can be engineered to produce immune-inducing substances in cancer tissue, thereby inducing a strong anti-cancer immune response and effectively treating not only primary cancer but also metastatic cancer. Based on this, they have confirmed the effectiveness of specifically killing cancer cells in an in vivo system and improving survival rates, which led to the completion of the present invention.
[0007] Therefore, an object of the present invention is to provide a DNA construct comprising a gene encoding a flagellin protein and a gene encoding an adjuvant protein.
[0008] Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, the claims and the drawings.
[0009] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the following description. [Means for solving the problem]
[0010] Various embodiments described herein are described below with reference to the drawings. In the following description, various specific details, such as specific configurations, compositions, and processes, are set forth to provide a thorough understanding of the present invention. However, certain embodiments may be practiced without one or more of these specific details or with other known methods and configurations. In other instances, known processes and manufacturing techniques are not described in specific detail to avoid unnecessarily obscuring the present invention. References throughout this specification to "one embodiment" or "an embodiment" mean that a particular feature, configuration, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the present invention. Thus, the appearance of "in one embodiment" or "an embodiment" in various places throughout this specification does not necessarily refer to the same embodiment of the present invention. Additionally, particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more embodiments.
[0011] Unless otherwise defined herein, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0012] Throughout the specification, when a part "comprises" a certain element, this means that it can further include other elements, but not to the exclusion of other elements, unless otherwise specified.
[0013] According to one aspect of the present invention, there is provided a DNA construct.
[0014] The DNA constructs of the present invention are a gene encoding a flagellin protein and a gene encoding an adjuvant protein.
[0015] The present inventors have conducted extensive research to develop an effective cancer prevention or treatment agent that selectively kills only cancer cells. As a result, they have engineered an attenuated Salmonella strain that produces an immune-inducing substance that selectively acts on cancer, and have confirmed that it induces a strong anti-cancer immune response, enabling effective treatment of primary cancer as well as metastatic cancer. As a result, they have discovered a novel and effective cancer treatment method and composition in an in vivo system, which led to the completion of the present invention.
[0016] According to the present invention, flagellin and an immunopotentiator can be expressed as a fusion protein using an expression vector, but the present invention is not limited to this.
[0017] As used herein, the term "fusion protein" refers to an artificial recombinant protein that is expressed after linking the genes of one or more other proteins to a protein. By linking two or more proteins, a fusion protein can be expected to have a synergistic effect on its functions.
[0018] According to the present invention, a signal peptide is added to the 5' end of the fusion protein to allow it to be secreted from the strain. Specifically, the signal peptide is any one selected from the group consisting of pectate lyase B (PelB), outer-membrane protein A (OmpA), heat-stable enterotoxin 2 (StII), endoxylanase, alkaline phosphatase (PhoA), outer-membrane protein F (OmpF), and outer-membrane pore protein E (PhoE).
[0019] As used herein, the term "Salmonella" refers to a type of Proteobacteria belonging to the genus Salmonella in the family Enterobacteriaceae. These rod-shaped bacteria are approximately 0.7 to 1.5 μm in diameter and 2 to 5 μm in length and primarily inhabit the digestive tracts of humans and animals.
[0020] The "flagellin" of the present invention refers to, but is not limited to, a granular protein that constitutes the helical filament of bacterial flagella. Its molecular weight varies greatly depending on the bacterial species (30,000-70,000), but its amino acid composition does not contain cysteine or tryptophan, and in the case of Salmonella, approximately half of the lysines are methylated. Flagellin types include flagellin A and B, and have diverse functions, but are known to have immune-enhancing effects.
[0021] In the present invention, the flagellin is flagellin A (FlaA) or B (FlaB).
[0022] As used herein, the term "cancer" refers to a disease characterized by uncontrolled cell growth. This abnormal cell growth leads to the formation of a cell mass called a tumor, which infiltrates surrounding tissues and, in severe cases, metastasizes to other organs in the body. Academically, it is also known as a neoplasm. Cancer is an intractable chronic disease that often fails to be cured even with treatments such as surgery, radiation, and chemotherapy, causing pain and ultimately death to patients. There are various factors that contribute to cancer development, but these can be classified as internal or external. While the exact mechanism by which normal cells transform into cancer cells remains unclear, it is known that a significant number of cancers develop as a result of external factors, such as environmental factors. Internal factors include genetic and immunological factors, while external factors include chemicals, radiation, and viruses. Genes involved in cancer development include oncogenes and tumor suppressor genes. Cancer develops when the balance between these two is disrupted by internal or external factors. In the present invention, the targets of prevention, improvement, or treatment may be melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymphatic gland cancer, gallbladder cancer, blood cancer, thyroid cancer, endocrine gland cancer, oral cancer, liver cancer, biliary tract cancer, colon cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, stomach cancer, duodenal cancer, prostate cancer, breast cancer, brain tumor, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureter cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and solitary myeloma, but are not limited to these.
[0023] Because the first and second promoters of the present invention can be simultaneously induced by a regulatory protein expressed by another promoter, the expression levels of the proteins encoded by the host cell or the genes operably linked downstream of the first and second promoters within the host cell can be balanced compared to when a gene encoding the regulatory protein is operably linked downstream of the second promoter. Thus, when using the DNA construct of the present invention, diagnosis and therapy can be performed simultaneously.
[0024] The "DNA construct" of the present invention is a structure that enables expression of a target protein when introduced into a host strain or cell by transformation, and includes not only a gene encoding the target protein but also a base sequence corresponding to a promoter, which is an essential regulatory element operably linked to enable expression of the gene.
[0025] The "promoter" of the present invention refers to a base sequence present in the upstream region of a gene operably linked to a host strain or cell, and a base sequence at a specific site of the DNA construct to which RNA polymerase can bind to initiate transcription.
[0026] In the present invention, the 5'-untranslated region (5'-UTR) is a non-translated region located on both sides of the coding region, which is the 5' region that is translated into amino acids in mRNA. Although it was thought to be a junk region discarded during evolution, it has been found to play an important role in regulating gene expression.
[0027] In the present invention, the transcription factor binding site A transcription factor binding site is a DNA site that plays a role in turning on and off a specific gene in the vicinity. The transcription factor binding site may be at least one selected from the group consisting of a promoter, an enhancer, and a silencer of the gene encoding the regulatory protein, but is not limited thereto.
[0028] According to a specific embodiment of the present invention, the immunopotentiator is a DNA construct selected from the group consisting of metal salt compounds (gel-type adjuvants), lipid particle-type adjuvants (oil-in-emulsion adjuvants), cytokines, chemokines, particulate adjuvants, and microbial adjuvants. Specifically, the immunopotentiator is a DNA construct selected from the group consisting of IFN-α2, IL-2, IL-15, IL-21, IL-12, CXCR3, CCR5, T-cells, and B-cells. Even more specifically, the immunopotentiator is IL-15. More specifically, the immunopotentiator is human IL-15, which is a gene or protein represented by SEQ ID NO: 1.
[0029] According to a specific embodiment of the present invention, the flagellin is a DNA construct that is any one selected from the group consisting of flagellin A, flagellin B, flagellin C, flagellin D, and flagellin E. Specifically, the flagellin is flagellin A or B.
[0030] According to the present invention, the pBAD plasmid is used and arabinose is used as the derivative.
[0031] The arabinose of the present invention means a monosaccharide containing five carbon atoms, and is an aldose having an aldehyde group, and has the chemical formula CH10 O5. Due to biosynthetic reasons, most sugars occur in nature primarily in the "D" form, or in a form structurally similar to D-glyceraldehyde.
[0032] The promoter of the gene encoding the regulatory protein of the present invention may be any promoter that can be induced to be active under most environmental conditions and developmental states of host strains or cells, and preferably may be a weak promoter.
[0033] The "weak promoter" of the present invention is a promoter that expresses a transcript transcribed from a gene operably linked downstream at a level of 1×10 -2 Less than 1 × 10 -3 a promoter that induces expression of the transcript at levels below 1×10 -3 The term "DNA construct" as used herein includes any promoter that enables expression of the following: E. coli σ70 promoter; E. coli σ5 promoter; E. coli σ32 promoter; B. subtilis σA promoter; B. subtilis σB promoter; Salmonella-derived promoters K112706 or K112707; bacteriophage T7 promoter; bacteriophage SP6 promoter; yeast-derived promoter; and eukaryotic cells. The term "DNA construct" as used herein refers to a structure that enables expression of a target protein or the like when introduced into a host strain or cell by transformation, and includes not only a gene encoding the target protein but also a nucleotide sequence corresponding to a promoter, which is an essential regulatory element operably linked to enable expression of the gene.
[0034] The "promoter" of the present invention refers to a base sequence present in the upstream region of a gene operably linked to a host strain or cell, and a base sequence at a specific site of the DNA construct to which RNA polymerase can bind to initiate transcription.
[0035] In the present invention, the 5'-untranslated region (5'-UTR) is a non-translated region located on both sides of the coding region, which is the 5' region that is translated into amino acids in mRNA. Although it was thought to be a junk region discarded during evolution, it has been found to play an important role in regulating gene expression.
[0036] In the present invention, the transcription factor binding site A transcription factor binding site is a DNA site that plays a role in turning on and off a specific gene in the vicinity. The transcription factor binding site may be at least one selected from the group consisting of a promoter, an enhancer, and a silencer of the gene encoding the regulatory protein, but is not limited thereto.
[0037] According to a specific embodiment of the present invention, the immunopotentiator is a DNA construct selected from the group consisting of metal salt compounds (gel-type adjuvants), lipid particle-type adjuvants (oil-in-emulsion adjuvants), cytokines, chemokines, particulate adjuvants, and microbial adjuvants. Specifically, the immunopotentiator is a DNA construct selected from the group consisting of IFN-α2, IL-2, IL-15, IL-21, IL-12, CXCR3, CCR5, T-cells, and B-cells. Even more specifically, the immunopotentiator is IL-15. More specifically, the immunopotentiator is human IL-15, which is a gene or protein represented by SEQ ID NO: 1.
[0038] According to a specific embodiment of the present invention, the flagellin is a DNA construct that is any one selected from the group consisting of flagellin A, flagellin B, flagellin C, flagellin D, and flagellin E. Specifically, the flagellin is flagellin A or B.
[0039] According to the present invention, the pBAD plasmid is used and arabinose is used as the derivative.
[0040] The arabinose of the present invention means a monosaccharide containing five carbon atoms, and is an aldose having an aldehyde group, and has the chemical formula CH 10 Due to biosynthetic reasons, most sugars occur in nature primarily in the "D" form, or in a form structurally similar to D-glyceraldehyde.
[0041] The promoter of the gene encoding the regulatory protein of the present invention may be any promoter that can be induced to be active under most environmental conditions and developmental states of host strains or cells, and preferably may be a weak promoter.
[0042] The "weak promoter" of the present invention is a promoter that expresses a transcript transcribed from a gene operably linked downstream at a level of 1×10 -2 Less than 1 × 10 -3 a promoter that induces expression of the transcript at levels below 1×10 -3The promoter may include any promoter that causes expression of the following, for example, at least one selected from the group consisting of E. coli σ70 promoter; E. coli σS promoter; E. coli σ32 promoter; B. subtilis σA promoter; B. subtilis σB promoter; Salmonella-derived promoters K112706 or K112707; bacteriophage T7 promoter; bacteriophage SP6 promoter; yeast-derived promoter; eukaryotic cell-derived promoter I712004 or K076017; and plant-derived promoter, but is not limited to this.
[0043] The E. coli σ70 promoter of the present invention is selected from the group consisting of I14018, I14033, I14034, I732021, I742126, J01006, J23103, J23109, J23112, J23113, J23117, J23119, J23150, J23151, J44002, J48104, J 56015, J64951, K088007, K119000, K119001, K1330002, K137029, K137030, K 137031, K137032, K137085, K137086, K137087, K137088, K137089, K137090, K 137091, K1585100, K1585101, K1585102, K1585103, K1585104, K1585105, K1 585106, K1585110, K1585113, K1585115, K1585116, K1585117, K1585118, K1 585119, K2486171, K256002, K256018, K256020, K256033, K292000, K823007 , K823010, K823013, M13101, M13102, M13103, M13104, M13105, M13106, M1310 8, M13110, M31519, R1074, R1075 and S03331, but is not limited thereto.
[0044] The E. coli σ S promoter of the present invention may be, but is not limited to, J45992 or J45993.
[0045] The E. coli σ32 promoter of the present invention may be, but is not limited to, J45504, K1895002 or K1895003.
[0046] The B. subtilis σA promoter of the present invention may be at least one selected from the group consisting of K143012, K143013, K823000, K823002 and K823003, but is not limited thereto.
[0047] The B. subtilis σB promoter of the present invention may be, but is not limited to, K143010, K143011 or K143013.
[0048] The bacteriophage T7 promoter of the present invention may be at least one selected from the group consisting of I719005, J34814, J64997, K113010, K113011, K113012, K1614000, R0085, R0180, R0181, R0182, R0183, Z0251, Z0252 and Z0253, but is not limited thereto.
[0049] The bacteriophage SP6 promoter of the present invention may be, but is not limited to, J64998.
[0050] The yeast-derived promoter of the present invention may be at least one selected from the group consisting of I766557, J63005, K105027, K105028, K105029, K105030, K105031, K122000, K124000, K124002, K319005, M31201, K2365040, K2365036, K2365041, K2365042, K2365032, K2365051, K2365514, K2365515 and K2365516, but is not limited thereto.
[0051] The promoter may be at least one selected from the group consisting of, but not limited to, the promoter of the present invention, which is a promoter of the present invention derived from a plant, I712004 or K076017; and a plant-derived promoter.
[0052] The E. coli σ70 promoter of the present invention is selected from the group consisting of I14018, I14033, I14034, I732021, I742126, J01006, J23103, J23109, J23112, J23113, J23117, J23119, J23150, J23151, J44002, J48104, J56015, J64951, K088007, K119000, K119001, K1330002, K137029, K137030, K137031, K137032, K137085, K137086, K137087, K1370 88, K137089, K137090, K137091, K1585100, K1585101, K1585102, K158 5103, K1585104, K1585105, K1585106, K1585110, K1585113, K1585115 , K1585116, K1585117, K1585118, K1585119, K2486171, K256002, K256 018, K256020, K256033, K292000, K823007, K823010, K823013, M13101, It may be at least one selected from the group consisting of M13102, M13103, M13104, M13105, M13106, M13108, M13110, M31519, R1074, R1075 and S03331, but is not limited thereto.
[0053] The E. coli σ S promoter of the present invention may be, but is not limited to, J45992 or J45993.
[0054] The E. coli σ32 promoter of the present invention may be, but is not limited to, J45504, K1895002 or K1895003.
[0055] The B. subtilis σA promoter of the present invention may be at least one selected from the group consisting of K143012, K143013, K823000, K823002 and K823003, but is not limited thereto.
[0056] The B. subtilis σB promoter of the present invention may be, but is not limited to, K143010, K143011 or K143013.
[0057] The bacteriophage T7 promoter of the present invention may be at least one selected from the group consisting of I719005, J34814, J64997, K113010, K113011, K113012, K1614000, R0085, R0180, R0181, R0182, R0183, Z0251, Z0252 and Z0253, but is not limited thereto.
[0058] The bacteriophage SP6 promoter of the present invention may be, but is not limited to, J64998.
[0059] The yeast-derived promoter of the present invention may be at least one selected from the group consisting of I766557, J63005, K105027, K105028, K105029, K105030, K105031, K122000, K124000, K124002, K319005, M31201, K2365040, K2365036, K2365041, K2365042, K2365032, K2365051, K2365514, K2365515 and K2365516, but is not limited thereto.
[0060] The plant-derived promoter of the present invention may be at least one selected from the group consisting of PLPR0203, PLPR0210, PLPR0177, PLPR0193, PLPR0507, PLPR0422, PLPR0228, PLPR0226, PLPR0223, PLPR0040, PLPR0465, PLPR0232, PLPR0205, PLPR0247, PLPR0328, PLPR0525, AtREG383, AtREG415, AtREG416, OsREG438, OsREG443, OsREG501, PpREG186, PpREG194, and PpREG197, but is not limited thereto.
[0061] For the purposes of the present invention, when a gene encoding a regulatory protein is operably linked downstream of the weak promoter, the transcription of the gene located downstream of the first and second promoters can be regulated so that it can occur specifically only when a substance that inhibits the regulatory protein is administered, compared to when the gene is operably linked downstream of the first or second promoter.
[0062] According to another aspect of the present invention, there is provided a recombinant vector comprising the DNA construct.
[0063] The recombinant vector of the present invention comprises the DNA construct of the present invention, and the regulatory protein is expressed by a separate promoter, thereby enabling balanced expression of genes operably linked downstream of the first promoter and the second promoter specifically only when a substance that inhibits the regulatory protein is administered from the outside.
[0064] The recombinant vector of the present invention is a means for introducing into cells to express proteins, and known recombinant vectors such as plasmid vectors, cosmid vectors, and bacteriophage vectors can be used. The recombinant vector can be easily produced by a person skilled in the art by any known method using DNA recombination technology.
[0065] In the present invention, specific examples of the recombinant vector can be selected from the group consisting of commercially widely used pCDNA vectors, F, R1, RP1, Col, pBR322, ToL, Ti vectors, cosmids, phages such as lambda, lambdoid, M13, Mu, p1 P22, Qμ, T-even, T2, T3, and T7, and plant viruses, but are not limited thereto. For the purposes of the present invention, a suitable recombinant vector can be selected depending on the properties of the host cell.
[0066] In yet another embodiment of the present invention, there is provided a host cell or strain into which a recombinant vector containing the DNA construct of the present invention has been introduced.
[0067] The host cell of the present invention may include cells of mammalian, plant, insect, fungal or cellular origin, for example, at least one selected from the group consisting of bacterial cells such as Escherichia coli, Streptomyces or Salmonella strains, yeast cells, fungal cells such as Pichia pastoris; insect cells such as Drosophila or Spodoptera Sf9 cells; animal cells such as CHO (Chinese hamster ovary cells), SP2 / 0 (mouse myeloma), human lymphoblastoid, COS, NSO (mouse myeloma), 293T cells, Bowes melanoma cells, HT-1080 cells, BHK cells (Baby hamster kidney cells), HEK cells (Human embryonic kidney cells) or PERC.6 cells (human retinal cells); and plant cells, but is not limited thereto. For the purposes of the present invention, the strain may be an anaerobic strain, for example, at least one selected from the group consisting of Salmonella strains, Clostridium strains, Bifidobacterium strains, and Escherichia coli strains, preferably at least one selected from the group consisting of Salmonella typhimurium, Salmonella choleraesuis, and Salmonella enteritidis, and more preferably, Salmonella typhimurium, but is not limited thereto.
[0068] The strains of the present invention may be attenuated.
[0069] The term "attenuation" as used herein means that genes have been modified to reduce toxicity and other side effects when the microorganism is administered to a patient. For the purposes of the present invention, when the strain is a Salmonella strain, the attenuation is achieved by modifying aroA, aroC, aroD, aroE, Rpur, htrA, ompR, ompF, ompC, galE, The gene may be one obtained by modifying at least one gene selected from the group consisting of cya, crp, cyp, phoP, phoQ, rfaY, dksA, hupA, sipC, clpB, clpP, clpX, pab, nadA, pncB, pmi, rpsL, hemA, rfc, poxA, galU, cdt, pur, ssa, guaA, guaB, fliD, flgK, flgL, relA, and spoA, but is not limited thereto.
[0070] The gene of the present invention can be modified by various gene deletion or disruption methods known in the art. For example, the deletion and disruption methods can be performed by homologous recombination, chemical mutagenesis, irradiation mutagenesis, transposon mutagenesis, etc.
[0071] In the present invention, the strain targets the interior of cancer tissue, which is an oxygen-deficient environment with incomplete angiogenesis, which is very suitable for the growth of anaerobic strains. Therefore, when a recombinant vector capable of simultaneously expressing a reporter protein that can be imaged in real time and an anti-cancer protein in a balanced manner is introduced into such a strain, cancer can be diagnosed and treated simultaneously very effectively.
[0072] The recombinant vectors of the present invention can be introduced into host cells or bacterial strains by transformation (or transfection). The transformation method used in the present invention can be any transformation method commonly used in the art, and can be easily performed using methods commonly used in the art. Specifically, recombinant vectors can be introduced into the strains using commonly used methods for transforming bacteria such as the Salmonella strains, such as the CaCl precipitation method, the Hanahan method (in which the efficiency of the CaCl method is enhanced by using the reducing agent DMSO (dimethyl sulfoxide)), electroporation, calcium phosphate precipitation, protoplast fusion, agitation using silicon carbide fibers, Agrobacterium-mediated transformation, PEG-mediated transformation, dextran sulfate, lipofectamine, and desiccation / repression-mediated transformation, but are not limited to these.
[0073] According to a specific embodiment of the present invention, the bacterial strain is at least one cell selected from the group consisting of a Salmonella strain, a Clostridium strain, a Bifidobacterium strain and an Escherichia strain.
[0074] In yet another embodiment of the present invention, the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising the strain as an active ingredient.
[0075] As used herein, the term "prevention" means inhibiting the occurrence of a disease or condition in a subject who has not been diagnosed as having the disease or condition but is susceptible to such disease or condition.
[0076] As used herein, the term "treatment" refers to any action taken to improve symptoms caused by cancer or otherwise benefit an individual using the active ingredient of the present invention, and refers to an attempt to achieve useful or desired results, including clinical results. Useful or desired clinical results may include, but are not limited to, the alleviation or amelioration of one or more symptoms or conditions, reduction in the extent of disease, stabilization of the disease state, inhibition of disease occurrence, inhibition of disease spread, delay or slowing of disease progression, delay or slowing of disease onset, and amelioration or reduction, and attenuation (partial or total), whether detectable or not. "Treatment" may also mean extending a patient's survival beyond that expected in the absence of treatment. Furthermore, "treatment" may refer to the inhibition of disease progression, temporary slowing of disease progression, or, more preferably, permanent halting of disease progression. As will be understood by those skilled in the art, a result may be unbeneficial or undesirable if it produces an opposite result in the patient treated while improving a particular disease state, i.e., a result that exceeds all the benefits of the treatment.
[0077] Therefore, the composition of the present invention may be used by itself to treat these diseases, or may be administered together with other anticancer drugs to be used as a therapeutic adjunct for the diseases. Therefore, in this specification, the terms "treatment" or "therapeutic agent" include the meaning of "therapeutic adjunct" or "therapeutic adjunct."
[0078] As used herein, the term "pharmaceutical composition" is not limited to, and can be formulated into oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, as well as topical preparations, suppositories, and sterile injectable solutions by conventional methods. The pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier. For oral administration, the pharmaceutically acceptable carrier may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, flavorings, etc.; for injections, the pharmaceutically acceptable carrier may include buffers, preservatives, soothing agents, solubilizers, isotonicity agents, stabilizers, etc.; and for topical administration, the pharmaceutically acceptable carrier may include bases, excipients, lubricants, preservatives, etc. The dosage forms of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with the pharmaceutically acceptable carriers described above. For example, oral administration can be made into tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and injections can be made into unit-dose ampoules or multi-dose forms. Other formulations include solutions, suspensions, tablets, capsules, sustained-release preparations, etc. Suitable carriers, excipients, and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. Additionally, fillers, anti-agglomerating agents, lubricants, wetting agents, flavorings, emulsifiers, preservatives, etc. may be included.
[0079] As used herein, the term "administration" or "administering" refers to directly administering a therapeutically effective amount of a composition of the present invention to a subject so that the same amount is formed in the subject's body. This includes introducing the composition of the present invention into a patient by any suitable method. The administration route of the composition of the present invention may be any common route that can reach the target tissue. Administration may be oral, intraperitoneal, intravenous, intramuscular, subcutaneous, intranasal, intrapulmonary, rectal, intracavitary, intraperitoneal, or intrathecal. In the present invention, the effective amount can be adjusted depending on various factors, including the type of disease, the severity of the disease, the type and content of the active ingredient and other ingredients contained in the composition, the type of dosage form, the patient's age, weight, general health, sex, and diet, the administration time, administration route, the excretion rate of the composition, the duration of treatment, and concurrently used drugs. For adults, the therapeutic pharmaceutical composition can be administered intravenously in a volume of 50 ml to 500 ml, with compounds administered at a dose of 0.1 ng / kg to 10 mg / kg and monoclonal antibodies administered at a dose of 0.1 ng / kg to 10 mg / kg. The administration interval may be once to 12 times per day, or, in the case of 12 doses per day, once every two hours. Furthermore, the pharmaceutical composition of the present invention may be administered alone or in combination with other therapies known in the art, such as chemotherapy, radiation, and surgery, to treat the target cancer. Additionally, the pharmaceutical compositions of the present invention can be administered in combination with other therapies designed to enhance immune responses, such as adjuvants or cytokines (or nucleic acids encoding cytokines), as are well known in the art. Other standard delivery methods, such as biolistic delivery or ex vivo treatment, may also be used. In ex vivo treatment, for example, antigen-presenting cells (APCs), dendritic cells, peripheral blood mononuclear cells, or bone marrow cells may be obtained from a patient or suitable donor, activated ex vivo as the pharmaceutical composition, and then administered to the patient.
[0080] In the present invention, the term "therapeutically effective amount" means the content of the composition of the pharmacological component of the composition in an amount sufficient to provide a therapeutic or prophylactic effect to an individual to whom the pharmaceutical composition of the present invention is to be administered, and thus includes a "prophylactically effective amount."
[0081] According to a specific embodiment of the present invention, the cancer is at least one selected from the group consisting of melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymphatic gland cancer, gallbladder cancer, blood cancer, thyroid cancer, endocrine gland cancer, oral cancer, liver cancer, biliary tract cancer, colon cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, stomach cancer, duodenal cancer, prostate cancer, breast cancer, brain cancer, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureter cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and solitary myeloma.
[0082] According to a specific embodiment of the present invention, the pharmaceutical composition is for inhibiting cancer growth or cancer metastasis.
[0083] In the present invention, the term "cancer metastasis" refers to the tendency of cancer to spread to other locations separated by a distance from the organ or part where it originated. A metastatic cancer is a cancer that has the tendency to metastasize or has already metastasized. In particular, the metastatic cancer may metastasize to the liver, lungs, bones, lymph nodes, or abdominal cavity, but is not limited thereto. The metastatic cancer may be difficult to treat, and the progression and treatment process may be more complicated than the initial treatment course.
[0084] In the present invention, the term "cancer recurrence" refers to cancer that is not detected after treatment and is then rediscovered after a certain period of time. Recurrent cancer refers to cancer that occurs as a result of cancer recurrence, as described above. When cancer recurs, resection is often difficult, and even when resection is possible, extensive surgery may be required. In addition, there may be limitations on anticancer treatment and radiation therapy.
[0085] The pharmaceutical composition of the present invention may be in the form of a capsule, tablet, granule, injection, ointment, powder or drink, and may be intended for humans.
[0086] The pharmaceutical compositions of the present invention can be formulated into oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, as well as topical preparations, suppositories, and sterile injectable solutions, using conventional methods, but are not limited thereto. The pharmaceutical compositions of the present invention can also contain a pharmaceutically acceptable carrier. For oral administration, pharmaceutically acceptable carriers include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, and flavorings. For injections, buffers, preservatives, soothing agents, solubilizers, isotonicity agents, and stabilizers can be mixed. For topical administration, bases, excipients, lubricants, and preservatives can be used. The pharmaceutical compositions of the present invention can be prepared in various dosage forms by mixing with the pharmaceutically acceptable carriers described above. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injections, it can be prepared in the form of unit-dose ampoules or multiple-dose forms. Other examples include solutions, suspensions, tablets, capsules, sustained-release formulations, etc. It can be formulated as follows.
[0087] On the other hand, examples of carriers, excipients, and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, fillers, anti-agglomerating agents, lubricants, wetting agents, flavorings, emulsifiers, preservatives, etc. may also be included.
[0088] The routes of administration of the pharmaceutical composition of the present invention include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual, or rectal, with oral or parenteral administration being preferred.
[0089] The term "parenteral" as used herein includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intradural, intralesional and intracranial injection or infusion techniques. The pharmaceutical compositions of the present invention may also be administered in the form of suppositories for rectal administration.
[0090] The dosage of the pharmaceutical composition of the present invention may vary depending on various factors, including the activity of the specific compound used, age, body weight, general health, sex, dietary requirements, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. The dosage of the pharmaceutical composition varies depending on the patient's condition, body weight, severity of disease, drug form, administration route, and duration, but can be appropriately selected by those skilled in the art and may be administered at 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg per day. Administration may be once a day or in several divided doses. The dosage is not intended to limit the scope of the present invention in any way. The pharmaceutical composition of the present invention may be formulated as a pill, dragee, capsule, liquid, gel, syrup, slurry, or suspension.
[0091] According to yet another aspect of the present invention, there is provided a bacterial strain transformed with a recombinant vector separately comprising a DNA construct comprising a gene encoding a flagellin protein and a DNA construct comprising a gene encoding an immunopotentiator protein.
[0092] According to a specific embodiment of the present invention, the immune enhancer is any one selected from the group consisting of metal salt compounds (gel-type adjuvants), lipid particle-type adjuvants (oil-in-emulsion adjuvants), cytokines, chemokines, particulate adjuvants, and microbial adjuvants. Specifically, the immune enhancer is any one strain selected from the group consisting of IFN-α2, IL-2, IL-15, IL-21, IL-12, CXCR3, CCR5, T-cells, and B-cells. Even more specifically, the immune enhancer is IL-15. More specifically, the immune enhancer is human IL-15, which is a gene or protein represented by SEQ ID NO: 1.
[0093] In yet another aspect, the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising the strain as an active ingredient.
[0094] In yet another aspect, the present invention provides a composition for preventing or treating cancer, comprising as active ingredients a flagellin protein or a nucleotide encoding the same; and an immunopotentiator protein or a nucleotide encoding the same.
[0095] According to a specific embodiment of the present invention, the immunopotentiator is a composition selected from the group consisting of metal salt compounds (gel-type adjuvants), lipid particle-type adjuvants (oil-in-emulsion adjuvants), cytokines, chemokines, particulate adjuvants, and microbial adjuvants. Specifically, the composition is selected from the group consisting of IFN-α2, IL-2, IL-15, IL-21, IL-12, CXCR3, CCR5, T-cells, and B-cells. Even more specifically, the immunopotentiator is IL-15. More specifically, the immunopotentiator is human IL-15, which is a gene or protein represented by SEQ ID NO: 1.
[0096] The gene of the present invention may be delivered to a gene carrier, but it can also be administered in the form of a fully translated peptide to exert a similar pharmacological effect.
[0097] According to the present invention, the term "immune enhancer (adjuvant)" refers to an immune adjuvant that is used in the development of vaccines by enhancing antigenicity or in anti-cancer treatments by enhancing non-specific immune responses to antigens, and enables various treatments by utilizing the inherent immune system of an individual. The term "immune enhancer (adjuvant)" may include any substance that can activate immune cells and induce the death of disease-related cells, such as cancer cells.
[0098] According to the present invention, an "anti-cancer protein" is a peptide having the function of directly or indirectly inducing the death of cancer cells, and may be, for example, at least one selected from the group consisting of a toxin protein, an antibody or a fragment of said antibody specific to a cancer antigen, a tumor suppressor protein, an angiogenesis inhibitor, a cancer antigen, a prodrug-converting enzyme, a pro-apoptotic protein, and flagellin, but is not limited thereto.
[0099] According to the present invention, a "cytokine" is a protein secreted by immune cells, and the cytokines of the present invention include all cytokines that can be used in cancer immunotherapy, as long as they can regulate the host immune response and induce the death of disease-related cells, such as cancer cells, and preferably may be, but are not limited to, IFN-α2, IL-2, IL-15, IL-21 and IL-12.
[0100] According to the present invention, "chemokines" are those that regulate cell migration between tissues and the location and interaction of cells within tissues, and include all those that can mediate the host response to disease, e.g., cancer, by attracting leukocytes to the tumor microenvironment, preferably, but not limited to, CXCR3, CCR5, etc.
[0101] In yet another aspect of the present invention, there is provided a pharmaceutical composition for preventing or treating cancer, comprising the recombinant strain and an immune checkpoint inhibitor as active ingredients.
[0102] According to a specific embodiment of the present invention, the composition is a pharmaceutical composition for co-administration.
[0103] According to a specific embodiment of the present invention, the immune checkpoint inhibitor is selected from the group consisting of cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4), programmed cell death protein 1 (PD The pharmaceutical composition comprises at least one selected from the group consisting of CD137, CD276, CD27, GITR, and IL-1.
[0104] According to a specific embodiment of the present invention, the immune checkpoint inhibitor is Programmed death-ligand 1 (PD-L1).
[0105] In this invention, the term "Programmed Death-Ligand 1 (PD-L1)" refers to a protein present on the surface of cancer cells and hematopoietic cells. Also known as CD274 and B7-H1, PD-L1 and PD-L2, proteins present on the surface of cancer cells, bind to PD-1, a protein present on the surface of T cells, preventing the T cells from attacking the cancer cells. Anticancer immunotherapy binds to the PD-1 receptor on T cells and inhibits the cancer cells' evasive function.
[0106] In a specific embodiment of the present invention, the cancer is one or more selected from the group consisting of melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymphatic gland cancer, gallbladder cancer, blood cancer, thyroid cancer, endocrine gland cancer, oral cancer, liver cancer, biliary tract cancer, colon cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, stomach cancer, duodenal cancer, prostate cancer, breast cancer, brain cancer, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureter cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and solitary myeloma.
[0107] According to a specific embodiment of the present invention, the composition is a pharmaceutical composition for inhibiting cancer growth or cancer metastasis.
[0108] In yet another aspect, the present invention provides a method for preventing or treating cancer, comprising administering to an individual in need thereof a recombinant bacterial strain comprising a gene encoding a flagellin protein and a gene encoding an adjuvant protein.
[0109] According to yet another aspect of the present invention, there is provided a use of a recombinant bacterial strain comprising a gene encoding a flagellin protein and a gene encoding an adjuvant protein for the prevention or treatment of cancer. [Effects of the Invention]
[0110] The features and advantages of the present invention can be summarized as follows: (a) The present invention provides a gene encoding a flagellin protein; and A DNA construct is provided, which comprises a gene encoding an adjuvant protein. (b) The present invention is an effective cancer treatment that selectively kills only cancer cells. The attenuated Salmonella strain is designed to produce immune-inducing substances in cancer tissues, thereby inducing a strong anti-cancer immune response. This can be useful as a preventive or therapeutic composition that significantly suppresses tumor size in primary cancers as well as metastatic cancers, thereby improving survival rates. [Brief explanation of the drawings]
[0111] [Figure 1A] FIG. 1 shows a schematic diagram of the engineered plasmid pBAD IL15 / FlaB, according to one embodiment of the present invention. [Figure 1B]1 shows SDS-PAGE, anti-FlaB immunoblot analysis, and anti-mIL15 anti-FlaB immunoblot analysis of mouse IL15 / FlaB expression test according to an experimental example of the present invention. [Figure 1C] 1 shows SDS-PAGE, anti-FlaB immunoblot analysis, and anti-hIL15 immunoblot analysis of human IL15 / FlaB expression test according to an experimental example of the present invention. [Figure 2A] 1 shows a scheme for an IL15 / FlaB activity detection system during an in vitro biological activity analysis of secreted IL15 / FlaB according to an experimental example of the present invention. [Figure 2B] 1 shows TLR5 expression after transfection with p3XFlag-hTLR5 (concurrently transfected with pCMV-b-gal and pNF-kB-luc) according to an example of the present invention. [Figure 2C] An experimental example of the present invention demonstrates that the signal strength of IL15 / FlaB interacts with TLR5-transfected cells and induces TLR5-mediated NF-kB transcription. [Figure 2D] 1 shows the modulation of NF-kB and p-NF-Kb signaling pathways after treatment with IL15 / FlaB and immunoblot signal quantification according to an example of the present invention. [Figure 3] 1 shows an in vitro evaluation of IL15 / FlaB activity according to an experimental example of the present invention. [Figure 4] 1 shows the distribution of tumor-colonized SL-Lux_pBAD-IL15 / FlaB after injection of MC38 cells (1×10 6 cells / mice) according to an experimental example of the present invention. [Figure 5] 1 shows the anti-cancer effect of the recombinant strain after transplantation of MC38 cell tumors according to an experimental example of the present invention. [Figure 6] 1 shows the results of an experiment of the present invention, in which MC38 cell tumors were transplanted and then re-inoculated, showing the change in tumor size and survival rate. [Figure 7] 1 shows the tumor size and survival rate after tumor colonization following injection of CT26 cells (1×10 7 cfu / mice) according to an experimental example of the present invention. [Figure 8] 1 shows the results of an experiment of the present invention in which CT26 cell tumors were transplanted and then re-inoculated into Balb / c mice, showing the tumor size and survival rate. [Figure 9] In one example of the present invention, tumor size in a Balb / c group was shown, in which tumors were implanted again after CT26 cell tumor transplantation and no treatment was performed. [Figure 10] According to an example of the present invention, tumors were inoculated again after CT26 cell tumor transplantation, and the tumor size in a group of Balb / c mice treated with SLpFlaB is shown. [Figure 11] According to an example of the present invention, tumors were inoculated again after CT26 cell tumor transplantation, and the tumor size in a group of Balb / c mice treated with SLphIL15 / FlaB is shown. [Figure 12] According to an example of the present invention, tumors were inoculated again after CT26 cell tumor transplantation, and the tumor size in a group of Balb / c mice treated with SLpmIL15 / FlaB is shown. [Figure 13] 1 shows the results of 4T1 tumor treatment after pre-treatment or post-treatment according to an example of the present invention. [Figure 14] 1 shows the metastatic effect of IL15 / FlaB-expressing 4T1 cancer according to an experimental example of the present invention. [Figure 15A] According to one embodiment of the present invention, the anti-tumor efficacy of combined treatment of engineered bacteria with anti-PD-L1 antibody in mice with metastatic malignant tumors is shown. PD-L1 expression by 4T1-Luc and B16F10 cells was demonstrated; cells were stained with anti-PD-L1 antibody and isotype control prior to flow cytometry. [Figure 15B] Figure 1 shows a schematic diagram illustrating the immunotherapy schedule using engineered bacteria and anti-PD-L1 antibodies according to one embodiment of the present invention. Bacterial injection (SL), L-ara administration (+), and antibody injection were administered on the days indicated in the diagram. Isotype refers to the control antibody. [Figure 15C]1 shows bioluminescent light intensity (BLI) of ex vivo 4T1-Luc tumors and the weight of ex vivo 4T1-Luc tumors on day 15, according to one embodiment of the present invention. [Figure 15D] 1 shows the change in size of 4T1-Luc tumors after treatment with engineered bacteria, according to one embodiment of the present invention. [Figure 15E] 1 shows Kaplan-Meier survival curves and survival rates of 4T1 tumor-bearing mice according to one embodiment of the present invention. [Figure 15F] 1 shows the change in B16F10 tumor size after treatment with engineered bacteria, according to one embodiment of the present invention. [Figure 15G] 1 shows Kaplan-Meier survival curves, survival rates of B16F10 tumor-bearing mice, according to one embodiment of the present invention. DETAILED DESCRIPTION OF THE INVENTION
[0112] To confirm the anti-cancer effects of the recombinant strains of the present invention, 1 × 10 7 The growth-suppressive effects of intratumoral SLpBAD, SLphLI15, SLpmLI15, SLpFlaB, SLphIL15 / FlaB, and SLpmIL15 / FlaB recombinant strains on the CT26 cell line were confirmed by intravenous administration at CFU.
[0113] As a result, administration of the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains showed significantly increased tumor suppression ability and mouse survival rates compared to the control group, confirming the anti-cancer effects of the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains. [Example]
[0114] The present invention will be described in more detail with reference to the following examples. It will be obvious to those skilled in the art that these examples are merely for the purpose of explaining the present invention in more detail, and that the scope of the present invention is not limited by these examples according to the gist of the present invention.
[0115] Example
[0116] [Preparation Example 1] Cancer cell lines and culture conditions
[0117] The CT26 colon cancer cell lines CRL-2638 and HB-8064 (ATCC, USA) and the murine colon adenocarcinoma cell line MC38 (Massachusetts General Hospital and Harvard Medical School, USA, and Chonnam National University, Korea) were used in the experiments.
[0118] The cells were cultured in high-glucose Dulbecco's Modified Eagle's Medium (DMEM) medium (catalog number: #LM001-05, Welgene, Korea) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37°C in a 5% CO incubator.
[0119] [Preparation Example 2] Preparation of Salmonella strains carrying plasmids
[0120] The Salmonella strain is Salmonella Typhimurium (Salmonella typhimurium) deficient in ppGpp. monella typhimurium (S. typhimurium), SLΔppGpp (ΔrelA, ΔspoT) and CNC018 (ΔrelA, ΔspoT, ΔSPI1, ΔSPI2) were used. The Salmonella strains were transformed with the constructed plasmids using electroporation, and each transformed strain was cultured overnight in LB medium containing 100 μg / ml ampicillin. The culture was then diluted 1:100 with fresh LB medium containing ampicillin and cultured in a shaking incubator at 200 rpm and 37°C. The culture was centrifuged to obtain a bacterial pellet, which was washed with PBS buffer and then used in the experiment.
[0121] [Preparation Example 3] Preparation of experimental animal model
[0122] C57BL / 6 and BALB / C mice (Orient Company, Korea) aged 5 to 6 weeks, weighing 20 to 30 g, were used. MC38 or CT26 from Preparative Example 1 was subcutaneously injected into the flank of the mice to establish tumor animal models.
[0123] For imaging of the tumor animal model and evaluation of tumor size, 2% isoflurane was used for anesthesia, and 200 mg / kg ketamine and 10 mg / kg xylazine were used during surgery.
[0124] The size of the tumor (mm 3 The evaluation of the tumor size can be calculated using (length × height × width) / 2. 3 In these cases, the animal model was euthanized.
[0125] [Experimental Example 1] Protein expression and activity evaluation of recombinant strains
[0126] -Comparison of recombinant strains with existing strains
[0127] The recombinant strains SLphIL15 / FlaB and SLpmIL15 / FlaB, as well as the control strain SLpEmpty, were grown overnight in LB liquid medium containing ampicillin, then diluted 1:100 with fresh LB medium. When the OD600 value reached 0.5-0.7 after further cultivation, L-arabinose was added to the culture medium to a final concentration of 0.2%, and the culture was then cultured in a shaking incubator at 200 rpm and 37°C. The OD600 value was measured over time to analyze the growth patterns of the strains.
[0128] [Experimental Example 2] Confirmation of the immune effect of recombinant strains
[0129] To confirm the immunological effects of the recombinant strains, we conducted in vitro cytotoxicity experiments against the CTLL-2 cell line. CTLL-2 cells were treated with the SLphIL15 / FlaB and SLpmIL15 / FlaB strains, as well as the control strains hLI15, mIL15, and SLpEmpty, and the proliferation rate of CTLL-2 cells was analyzed. The results are shown in Figure 3.
[0130] As shown in Figure 3, unlike the SLpEmpty strain, which showed no change in CTLL-2 cell proliferation, the IL15 / FlaB-expressing SLpmIL15 / FlaB recombinant strain significantly increased the CTLL-2 proliferation effect, confirming the immune-enhancing effect of the SLpmIL15 / FlaB recombinant strain. The human and mouse IL-15 sequences are listed in Table 1.
[0131] [Table 1]
[0132] [Experimental Example 3] Confirmation of the cancer targeting effect of the recombinant strain
[0133] To confirm the cancer targeting effect of the recombinant strain, in vivo experiments were performed to confirm the number of recombinant strains in tumors and targeting images. The attenuated SL△ppGpp-Lux recombinant strain was injected into the MC38 mouse model at 1 × 10 7 The SL△ppGpp-Lux strain was administered intravenously at CFU level, and the number of SL△ppGpp-Lux strains in the tumor was measured. The fluorescence image expressed by the SL△ppGpp-Lux strain in the tumor was confirmed and is shown in Figure 4.
[0134] As shown in Figure 4, the recombinant strain was confirmed to be specifically present in the tumor, confirming that the recombinant strain specifically targets cancer cells.
[0135] [Experimental Example 4] Confirmation of the anti-cancer effect of the recombinant strain (1)
[0136] To confirm the anti-cancer effects of the recombinant strains, in vivo experiments were performed as shown in Figure 5 to confirm the growth-suppressing effects of the SLpBAD, SLphLI15, SLpmLI15, SLpFlaB, SLphIL15 / FlaB, and SLpmIL15 / FlaB recombinant strains on the MC38 cell line in tumors. The attenuated recombinant strains were each injected into the MC38 mouse model at a dose of 1 × 10 7 The tumor size and survival rate of the mice are shown in Figure 5.
[0137] As shown in Figure 5, administration of the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains significantly increased the tumor-suppressing ability and mouse survival rate compared to the control group, confirming the anti-cancer effects of the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains.
[0138] [Experimental Example 5] Confirmation of the effect of recombinant strains in suppressing cancer recurrence
[0139] To confirm the inhibitory effect of the recombinant strains on cancer recurrence, in vivo experiments were performed to confirm the growth-suppressing effect of the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains on the MC38 cell line in tumors. The recombinant strains were each injected at a concentration of 1 × 10 7 CFU were administered intravenously to the mice, and the experiment was performed to completely cure the cancer. After 90 days, MC38 cells were administered again. The size of the re-administered tumors and the survival rate of the mice are shown in Figure 6.
[0140] As shown in Figure 6, when the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains were administered, the tumor growth inhibitory effect was significantly greater than that of the control group, and the survival rate of the mice was significantly increased. This confirmed the cancer recurrence inhibitory effect of the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains.
[0141] [Experimental Example 6] Confirmation of the anti-cancer effect of recombinant strains (2)
[0142] To confirm the anti-cancer effects of the recombinant strains, in vivo experiments were performed as shown in Figure 7 to confirm the growth-suppressing effects of the SLpBAD, SLphLI15, SLpmLI15, SLpFlaB, SLphIL15 / FlaB, and SLpmIL15 / FlaB recombinant strains on the CT26 cell line in tumors. The attenuated recombinant strains were each injected into a CT26 mouse model at a dose of 1 × 10 7 The tumor size and survival rate of the mice are shown in FIG.
[0143] As shown in Figure 7, administration of the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains significantly increased the tumor-suppressing ability and mouse survival rate compared to the control group, confirming the anti-cancer effects of the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains.
[0144] [Experimental Example 7] Confirmation of the effect of recombinant strains in suppressing cancer recurrence
[0145] To confirm the cancer recurrence suppression effect of the recombinant strains, in vivo experiments were performed to confirm the growth suppression effect of the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains on the CT26 cell line in tumors. The attenuated recombinant strains were injected into the CT26 mouse model at a dose of 1 × 10 7 CFU were administered intravenously to mice, and the experiment was performed. After the cancer was completely cured, CT26 cells were re-administered 90 days later. The size of the re-administered tumor and the survival rate of the mice are shown in Figure 8.
[0146] As shown in Figure 8, administration of the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains significantly suppressed tumor growth and significantly increased mouse survival rates compared to the control group, confirming the anti-cancer recurrence effects of the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains. In the untreated and SLpFlaB groups, tumors regrew in all mice that progressed through the experiment. In the SLphIL15 / FlaB-treated group, tumors were eliminated in 8 of 11 mice, indicating tumor eradication (72.7%). In the SLpmIL15 / FlaB-treated group, tumors were eliminated in 12 of 14 mice, indicating tumor eradication (85.7%) (Figures 9-12).
[0147] [Experimental Example 8] Confirmation of the inhibitory effect of recombinant strains on cancer metastasis
[0148] To confirm the inhibitory effect of the recombinant strains on cancer metastasis, in vivo experiments were conducted to confirm the growth inhibitory effect of the SLpBAD, SLphIL15, SLpmIL15, SLpFlaB, SLphIL15 / FlaB, and SLpmIL15 / FlaB recombinant strains on the 4T1-Luc cell line in tumors. Luciferase-expressing 4T1-Luc cell lines were prepared, and a mouse model was prepared by injecting the 4T1-Luc cell line. Subsequently, 1 x 10 attenuated recombinant strains were administered to each mouse. 7CFU was administered intravenously, and the location of the tumor was photographed and shown in FIG. 13. The lungs were excised and the number of tumors that had metastasized to the lungs was counted and shown in FIG.
[0149] As shown in Figures 13 and 14, SLphIL15 / FlaB and SLpmI When the L15 / FlaB recombinant strain was administered, it was confirmed that tumors did not metastasize to the lungs compared to the control group, confirming that the SLphIL15 / FlaB and SLpmIL15 / FlaB recombinant strains had a significant effect in inhibiting tumor metastasis.
[0150] [Experimental Example 9] Confirmation of the anti-cancer effect of combined administration of recombinant strains and immune checkpoint inhibitors
[0151] To confirm the anti-cancer effect of the recombinant strain in combination with the immune checkpoint inhibitor anti-PD-L1, in vivo experiments were performed. PBS, anti-PD-L1, SLphIF(+) + isotype, SLphIF(+) + anti-PD-L1, SLpmIF(+) + isotype, and SLpmIF(+) + anti-PD-L1 were injected into 4T1-Luc and B16F10 tumors, and tumor size and survival rates were monitored. Results showed that mice treated with SLphIF(+) and SLpmIF(+) strains had significantly greater tumor suppression than the control group (PBS). In particular, mice treated with the combination of SLphIF(+) + anti-PD-L1 and SLpmIF(+) + anti-PD-L1 showed significantly greater tumor suppression than mice treated with either strain alone. Mouse survival rates were also significantly improved in 4T1-Luc tumors treated with SLphIF(+) and SLpmIF(+) strains (Figures 15D and 15E). Furthermore, the survival rate of mice treated intratumorally with B16F10 was significantly increased (FIGS. 15F and 15G).
[0152] Although certain parts of the present invention have been described in detail above, it will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the true scope of the present invention is defined by the appended claims and their equivalents. [Industrial Applicability]
[0153] The present invention was conceived to develop an effective cancer prevention or treatment agent that selectively kills only cancer cells, and demonstrated that an attenuated Salmonella strain can be designed to produce immune-inducing substances in cancer tissues, thereby inducing a strong anti-cancer immune response, effectively treating not only primary cancers but also metastatic cancers. The pharmaceutical composition of the present invention is expected to be widely used in the field of cancer treatment because it has the effect of specifically killing cancer cells in the in vivo system and improving survival rates.
[0154] [Sequence Listing Free Text]
[0155] SEQ ID NO: 1: Human IL-15 ATGAATTGGGTCAACGTGATTAGCGATCTGAAAAAAGATCGAAGATCTCATTCAGAGCATGCATATTGATGCTACGCTGTATACAGAATCCGACGTGCATCCGAGCTGCAAAGTTACTGCAATGAAGTGCTTCCTGCTGGAACTGCAGGTAATAAGCCTGGAGAGCGGTGACGCG AGCATCCATGATACAGTTGAAAATCTGATAATCCTGGCAAACAACTCGCTGAGCAGCAATGGTAATGTGACGGAATCAGGCTGCAAAGAATGTGAGGAGCTGGAAGAAAAAAACATCAAAGAGTTCCTGCAGAGCTTCGTCCACATTGTTCAAATGTTTATTAACACCAGCTAA
[0156] SEQ ID NO: 2: Mouse IL-15 ATGAATTGGATCGATGTACGCTATGACCTGGAAAAAATTGAATCACTGATTCAGAGCATTCATATCGACACTACCCTGTATACCGATAGCGATTTTCATCCGTCCTGCAAAGTGACAGCAATGAACTGTTTCCTGCTCGAACTGCAGGTCATTCTGCACGAGTATAGCAATATGACCCTGAACGAGACGGTGCGTAATGTTCTGTACCTGGCGAATAGCACCCTGAGCAGCAATAAAAACGTTGCTGAAAGCGGATGTAAAGAATGCGAGGAACTCGAGGAAAAGACGTTTACTGAATTTCTGCAGAGCTTCATTCGGATAGTCCAAATGTTCATTAACACGTCA
[0157] Accession No. 3: PelB (pectate lyase B) ATGAAATACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAACCGGCCATGGCC
Claims
1. a gene encoding the Flagellin protein; and A DNA construct comprising: a gene encoding an immune enhancing agent (adjuvant) protein.
2. The immune enhancing agent may be a metal salt compound (gel-type adjuvant), a lipid particle type (oil-in-emulsion adjuvant), a cytokine, a chemokine, or a particulate.
2. The DNA construct of claim 1, which is any one selected from the group consisting of microbial adjuvants and microbial adjuvants.
3. The DNA construct of claim 1 , wherein the flagellin is any one selected from the group consisting of flagellin A, flagellin B, flagellin C, flagellin D, and flagellin E.
4. A recombinant vector comprising the DNA construct according to any one of claims 1 to 3.
5. A cell into which the recombinant vector according to claim 4 has been introduced.
6. The cell according to claim 5, wherein the bacterial strain is at least one selected from the group consisting of a Salmonella strain, a Clostridium strain, a Bifidobacterium strain, a Listeria strain, an Enterococcus strain, a Yersinia strain, and an Escherichia strain.
7. A pharmaceutical composition for preventing or treating cancer, comprising the strain according to claim 5 as an active ingredient.
8. 8. The pharmaceutical composition of claim 7, wherein the cancer is at least one selected from the group consisting of melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymphatic gland cancer, gallbladder cancer, blood cancer, thyroid cancer, endocrine gland cancer, oral cancer, liver cancer, biliary tract cancer, colon cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, stomach cancer, duodenal cancer, prostate cancer, breast cancer, brain cancer, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureter cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and solitary myeloma.
9. The pharmaceutical composition according to claim 7, wherein the cancer is one for inhibiting cancer growth or cancer metastasis.
10. A DNA construct comprising a gene encoding a flagellin protein; and A strain transformed with a recombinant vector individually containing a DNA construct comprising a gene encoding an immunopotentiator protein.
11. The immune enhancing agent may be a metal salt compound (gel-type adjuvant), a lipid particle type (oil-in-emulsion adjuvant), a cytokine, a chemokine, or a particulate. The strain of claim 10, which is any one selected from the group consisting of bacterial adjuvants and microbial adjuvants.
12. A pharmaceutical composition for preventing or treating cancer, comprising the strain according to claim 5 or 10 as an active ingredient.
13. A flagellin protein or a nucleotide encoding the same; and A composition for preventing or treating cancer, comprising an immune enhancing protein or a nucleotide encoding the same as an active ingredient.
14. The immune enhancing agent may be a metal salt compound (gel-type adjuvant), a lipid particle type (oil-in-emulsion adjuvant), a cytokine, a chemokine, or a particulate.
14. The composition of claim 13, wherein the adjuvant is any one selected from the group consisting of: bacterial adjuvants and microbial adjuvants.
15. A pharmaceutical composition for preventing or treating cancer, comprising the strain of claim 5 and an immune checkpoint inhibitor as active ingredients.
16. The pharmaceutical composition of claim 15, wherein the composition is administered in combination.
17. 16. The pharmaceutical composition of claim 15, wherein the immune checkpoint inhibitor comprises at least one selected from the group consisting of cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4), programmed cell death protein 1 (PD-1), programmed death-ligand 1 (PD-L1), KIR, LAG3, CD137, OX40, CD47, CD276, CD27, and GITR.
18. 16. The pharmaceutical composition of claim 15, wherein the cancer is one or more selected from the group consisting of melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymphatic gland cancer, gallbladder cancer, blood cancer, thyroid cancer, endocrine gland cancer, oral cancer, liver cancer, biliary tract cancer, colon cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, stomach cancer, duodenal cancer, prostate cancer, breast cancer, brain cancer, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureter cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and solitary myeloma.
19. The pharmaceutical composition according to claim 15, wherein the composition inhibits cancer growth or cancer metastasis.
20. administering the recombinant strain to an individual in need thereof, The recombinant strain comprises: a gene encoding the Flagellin protein; and a gene encoding an adjuvant protein.
21. a gene encoding the Flagellin protein; and 2. Use of a recombinant strain containing a gene encoding an adjuvant protein for the prevention or treatment of cancer.