Cyclic compound library and method for constructing same
A method for constructing cyclic compound libraries using controlled ring-closure reactions on solid supports addresses diversity and stability issues, enabling efficient and accurate screening of potential drugs.
Patent Information
- Application Number
- JP2025247423
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-03-18
- Filing Date
- 2025-12-12
- Publication Date
- 2026-03-10
AI Technical Summary
Existing methods for constructing cyclic compound libraries face limitations such as limited diversity, stability issues, and inefficient screening due to harsh ring-closure reactions and DNA interference, which hinder the development of diverse and stable cyclic compounds for drug discovery.
A method for constructing cyclic compound libraries involving solid supports, photocleavable groups, and controlled ring-closure reactions using linkers and DNA tags, allowing for the synthesis of monocyclic and bicyclic compounds with high throughput and accuracy, suitable for DEL screening and secondary screening techniques like FACS.
The method enables the creation of diverse cyclic compound libraries with improved stability and screening efficiency, facilitating high-throughput screening and accurate identification of potential drugs through fluorescence-activated cell sorting and other advanced screening methods.
Smart Images

Figure 2026042007000122 
Figure 2026042007000123 
Figure 2026042007000124
Abstract
Description
[Technical Field]
[0001] The present invention relates to the field of medicinal chemistry, and in particular to cyclic compound libraries and methods for their construction. Regarding. [Background technology]
[0002] Advances in disease characterization and target identification continue to move drug discovery into uncharted territory. While attractive from a pathological perspective, at the same time, established low-level mechanisms that regulate these target functions The number of challenging new targets in terms of molecular compound and biologic discovery continues to grow. One approach to solving this problem is to use low-molecular-weight compounds derived from conventional compound libraries. The compound is essentially bioavailable, allowing it to penetrate cells and with limited protein content. The goal is to establish a library of compounds that specifically bind to proteins (e.g., enzymes).
[0003] Compounds derived from DNA-encoded libraries (DELs) resemble small molecules and contain one or more There is an opportunity to screen for potential chemicals. A new chemical starting point. However, small molecules usually do not interact with protein-protein interfaces. Protein interactions, on the other hand, do not work well for target-expanded binding. Biologics are well suited to such applications, offering better selectivity and stronger Often has binding properties.
[0004] Cyclic peptides are attracting attention as promising therapeutic candidates. Macrocyclization has several important advantages over cyclic peptides. By restricting the degrees of freedom of translation and minimizing the entropy during binding, cyclic molecules are targeted. It allows the antibody to bind more tightly and specifically to target proteins. Cyclic peptides are more stable than linear molecules under certain conditions of hydrolysis. However, cyclic peptides have a relatively broad structure, making them difficult to target with conventional drug-like small molecules. It is effective in covering large and shallow interfaces involved in protein-protein interactions. It is possible that
[0005] Currently, Reference 1 (Non-Patent Document 1: Min Hyeon Shin, et al. Bioconjugate Chemistry, 2019, 30, 2931-2938) describes the creation of a DNA-encoded cyclic mimetic peptide library. A method for generating DNA-encoded cyclic mimetic peptide libraries has been reported. However, the synthesis relies on chloroacetic acid to introduce building blocks at each step. The building blocks are only small molecules with a primary amine having one reactive group -NH2. The number and type of atoms between the structural blocks are fixed and the structural unit -CO-CH2-N- is repeated. The compound library lacks diversity. The length and type of carbon atoms between drugs affect the solubility and It has been demonstrated in many drug development tests that it makes a big difference in permeability. In addition, as shown in Reference 1, the cyclic peptide library is composed of N atoms and oxygen atoms. Highly binding protein-protein interactions depend on intramolecular or intermolecular hydrogen bonds formed by It is mainly used for screening PPI inhibitors. The N atom formed by the building block bonded to the molecule is a tertiary amine, and the bond with the protein is The compounds in the compound library had low affinity or insufficient binding ability. have always been limited and do not meet the need for a diverse cyclic compound library for modern drug discovery. Furthermore, the difficulty in constructing a library of cyclic compounds is due to the fact that the long-chain structure The ring closure method reported in Reference 1 involves the reaction of the first and last termini to form a ring. The reaction is limited to chemical ring closure, and the compound carrying the DNA sequence is used to complete the ring closure. Because of the need to construct a library, chemical ring-closure reactions have many constraints. Because metal ions are used, they may chelate with DNA molecules, adversely affecting the ring-closure reaction. The ring closure reaction uses metal ions, which may adversely affect the stability of DNA molecules. This limits the stability and accuracy of screening results.
[0006] Furthermore, Reference 2 (Patent Document 1: CN102471772A) describes peptides including bicyclic peptides. The bicyclic peptide molecules are useful for antibodies, small molecule drugs, peptides, and the like. They have the same affinity and precise target specificity as antibodies. Its small size allows for fast and deep tissue penetration, enabling targeting of lesions from within the tissue. The nature of the peptide allows for tunable pharmacokinetic half-life and renal clearance pathways This avoids the liver and gastrointestinal toxicity common to other drug forms. The technical approach disclosed in the paper is a phage screening technique, which is used to identify natural amines. This compound library is limited to mono- and di-acids.
[0007] Therefore, the art is in a position to obtain a richer library of cyclic compounds and to develop compound libraries. To increase the diversity of the system, we are developing more gentle and universal closed loops that are not limited to peptidomimetic peptides. It is necessary to establish the ring-closing reaction conditions and other ring-closing methods for cyclic molecular structures. To directly screen proteins and increase the utility of compound libraries, There is a need in the field to establish a technology for combining a compound library with a target protein. [Prior art documents] [Patent documents]
[0008] [Patent Document 1] Chinese Patent Application Publication No. 102471772 [Non-patent literature]
[0009] [Non-Patent Document 1] Min Hyeon Shin, et al. Bioconjugate Chemistry, 2019, 30, 2931-2938 Summary of the Invention [Problem to be solved by the invention]
[0010] One of the technical problems that the present invention aims to solve is the problem of the cyclic compound library in the prior art. It overcomes the limitations of the Lee ring-closure method and has the advantages of milder ring-closure conditions and high generality. It can be used to construct monocyclic and bicyclic compound libraries, and the cyclic compounds can be produced with few side reactions. The object of the present invention is to provide a method for constructing a compound library.
[0011] One of the technical problems to be solved by the present invention is to provide a novel cyclic compound having a cyclic molecular structure. By providing a new library, we aim to increase the diversity of the compound library and facilitate the screening of new drugs. The goal is to expand the scope of application to training. [Means for solving the problem]
[0012] The present invention provides a method for constructing a cyclic compound library, which comprises the following steps: Construction of a library of cyclic compounds based on the following: 1) A solid support G is directly or indirectly bound to a molecule M containing a photocleavable group to obtain GM. ; 2) Implement either Method 1, Method 2, or Method 3; Method 1: Follow steps a1 to g1; a1. Reactively attach GM to the closed ring A-terminated molecule A to obtain GMA; b1. GMA is reactively linked to a linker L1 having at least three functional groups to form GMA- Get L1; c1. GMA-L1 is reacted sequentially with the starting nucleotide molecule HP and the open primer OP. by linking the starting nucleotide molecule HP to the linker L1 to obtain GMA-L1-HP-OP; d1. The product obtained in the previous step is converted into a compound corresponding to the building block C1 and the building block C2. The building block C1 was reacted with the DNA tag tag1, which was then attached to L1, and the DNA tag tag1 was attached to OP. , to obtain GMA-L1(-HP-OP-tag1)-C1; e1. Define the binding reaction of the corresponding building blocks and DNA tag sets as an extension step The building blocks are spliced sequentially to form a chain, and the building blocks are The extension step is repeated so that the corresponding DNA tags are sequentially spliced to form a chain. Repeat, GMA-L1(-HP-OP-tag1-...-tag n )-C1-······-C n Get it here where 2≦n≦7 and n is a positive integer; f1. The product obtained in step e1 is reacted with the closed-circular B-terminal molecule B and the closed-circular primer CP. The closed ring B is converted to C. n , tag closing primer CP n Here, HP-OP-ta g1-······-tag n The complete DNA coding sequence is formed by -CP, and the GMA-L1(-DNA)-C1-... -C n -B, that is, compound library S1'' is obtained. g1. The product obtained in the previous step is decomposed under a light source to separate M from A, and AL 1(-DNA)-C1-···-C n -B, i.e., compound library S1' is obtained; Method 2: Proceed as in steps a2 to g2, but the order of steps e2 and f2 may be reversed; a2. Reactively linking GM to a linker L1 having at least three functional groups to form GM-L1 obtain; b2. GM-L1 is reacted sequentially with the starting nucleotide molecule HP and the open primer OP. and attaching the starting nucleotide molecule HP to a solid support G to obtain OP-HP-GM-L1; c2. OP-HP-GM-L1 was reacted with building block C1 and the DNA tag tag1 corresponding to building block C1. The building block C1 was bound to L1 and the DNA tag tag1 was bound to OP, resulting in tag1-OP-HP-GM-L1-C1. obtain. d2. Define the binding reaction of the corresponding building blocks and DNA tag sets as an extension step. The building blocks are spliced sequentially to form a chain, and the building blocks are The extension step is repeated so that the corresponding DNA tags are sequentially spliced to form a chain. Repeat, tag n -··············tag1-OP-HP-GM-L1-C1········-C n Here, 0 ≦n≦7, where n is an integer; e2. The product obtained in the previous step is reacted with the cyclic A-terminal molecule A, and the cyclic A-terminal molecule A is C n to be combined with; f2. The product obtained in the previous step is used as building block C n+1 ,...,C n+m and The corresponding DNA tags n+1 , ..., tag n+m and the extension step described Therefore, the reaction proceeds sequentially to form building block C n+1 to the linker L1, and the DNA tag tag n+1 Tag n Combined with After step e2 and step f2, tag n+m -·······tag1-OP-HP-GM-L1(-C1·· ····C n -A)-C n+1 -C n+m where 0≦n≦7, 0≦m≦7, and n and m are integers. , 2≦n+m≦7. g2. The product obtained in the previous step is reacted with the closed-circular B-terminal molecule B and the closed-circular primer CP. The closed ring B is converted to C. n+m Tag the closing primer CP n+m where HP -OP-tag1--tag n+m The complete DNA coding sequence is formed in -CP, and DNA-GM-L1(-C1· -C n -A)-C n+1 C n+m -B, i.e., compound library S2' is obtained; Method 3: Follow steps a3 to g3, but you can swap the order of steps e3 and f3; a3. Reactively linking GM with a linker L1 having at least tetrafunctional groups to form GM-L1 obtain; b3. GM-L1 is reacted sequentially with the starting nucleotide molecule HP and the open primer OP. Attaching the starting nucleotide molecule HP to the linker L1 to obtain GM-L1-HP-OP; c3. GM-L1-HP-OP was synthesized by combining building block C1 and the DNA tag tag1 corresponding to building block C1. By reacting them, the building block C1 was bound to L1 and the DNA tag tag1 was bound to OP to give GM-L1(-HP-OP -tag1)-get C1; d3. Define the binding reaction of the corresponding building blocks and DNA tag sets as an extension step The building blocks are spliced sequentially to form a chain, and the building blocks are The extension step is repeated so that the corresponding DNA tags are sequentially spliced to form a chain. Repeat, GM-L1(-HP-OP-tag1-...-tag n )-C1-······-C n where , 2≦n≦7, where n is a positive integer; e3. The product obtained in the previous step is reacted with the cyclic A-terminal molecule A, and the cyclic A-terminal molecule A is C n to be combined with; f3. The product obtained in the previous step is converted into building block C n+1 ,·····,C n+m and The corresponding DNA tags n+1 ,·····,tag n+m and the extension step described. Then, the compound C is reacted in sequence. n+1 to the linker L1, and the DNA tag tag n+1 Tag n Bind to After step e3 and step f3, GM-L1(-HP-OP-tag1...-tag n+m )(-C1... -Cn -A)-C n+1 -C n+m where 0≦n≦7, 0≦m≦7, n and m are integers, 2≦n+m≦7. g3. The product obtained in the previous step is reacted with the closed-circular B-terminal molecule B and the closed-circular primer CP. The closed ring B is converted to C. n+m Tag the closing primer CP n+m where HP -OP-tag1--tag n+m The complete DNA coding sequence is formed in -CP, and GM-L1(-DNA)(-C1 C n -A)-C n+1 -C n+m -B, i.e., compound library S3' is obtained. ru; 3) Cyclization of the compound library S1', S2', or S3' in the presence of cyclooxygenase The ring-closing A-end molecule A reacts with the ring-closing B-end molecule B to form a ring, and [ka] , i.e., obtaining a cyclic compound library S1; or [ka] , i.e., to obtain a cyclic compound library S2; or [ka] , i.e., a cyclic compound library S3 is obtained. [Brief explanation of the drawings]
[0013] [Figure 1] Graph I of the agarose gel electrophoresis detection results of Example 29. [Figure 2] Graph II of the agarose gel electrophoresis detection results of Example 29. [Figure 3] Graph III shows the agarose gel electrophoresis detection results of Example 29. [Figure 4] 1 is a graph showing the agarose gel electrophoresis detection results of Step 5 of Example 31. [Figure 5] 10 is a graph showing the Tag sequence abundance statistics results of Example 32. [Figure 6] 1 is a graph showing the test results of Example 33. [Figure 7] 1 is a graph showing the agarose gel electrophoresis detection results of Step 5 of Example 34. [Figure 8] 10 is a graph showing the Tag sequence abundance statistics results of Example 35. [Figure 9] 1 is a graph showing the results of flow cytometry analysis in Example 36. DETAILED DESCRIPTION OF THE INVENTION
[0014] In order to solve the above technical problems, the present invention provides a first technical solution: A method for constructing a cyclic compound library, comprising the following steps: 1) A solid support G is directly or indirectly bound to a molecule M containing a photocleavable group to obtain GM. : 2) Follow these steps: a1. Reactively attach GM to the closed ring A-terminated molecule A to obtain GMA; b1. GMA is reactively linked to a linker L1 having at least three functional groups to form GMA- Get L1; c1. GMA-L1 is reacted sequentially with the starting nucleotide molecule HP and the open primer OP. by linking the starting nucleotide molecule HP to the linker L1 to obtain GMA-L1-HP-OP; d1. The product obtained in step c1 is converted into a compound corresponding to the building block C1 and the building block C2. The building block C1 was reacted with the DNA tag tag1, which was then attached to L1, and the DNA tag tag1 was attached to OP. , to obtain GMA-L1(-HP-OP-tag1)-C1; e1. Define the binding reaction of the corresponding building blocks and DNA tag sets as an extension step The building blocks are spliced sequentially to form a chain, and the building blocks are The extension step is repeated so that the corresponding DNA tags are sequentially spliced to form a chain. Repeat, GMA-L1(-HP-OP-tag1-...-tag n )-C1-······-C n Get it here where 2≦n≦7 and n is a positive integer; f1. The product obtained in step e1 is reacted with the closed-circular B-terminal molecule B and the closed-circular primer CP. The closed ring B is converted to C. n , tag closing primer CP n Here, HP-OP-ta g1-······-tag n The complete DNA coding sequence is formed by -CP, and the GMA-L1(-DNA)-C1-... -C n -B, that is, compound library S1'' is obtained. g1. The product obtained in step f1 is decomposed under a light source to cleave M from A, and A-L1( DNA)-C1--C n -B, i.e., compound library S1' is obtained; 3) Compound library S1' is subjected to a cyclization reaction in the presence of cyclooxygenase to give cyclized A By reacting the terminal molecule A with the ring-closing terminal molecule B, [ka] , i.e., a cyclic compound library S1 is obtained.
[0015] In the first technical solution provided by the present invention, the finally obtained cyclic compound is separated from the solid support. The compound library obtained in this way is The compounds screened are suitable for conventional DEL screening mode and have high throughput. It needs to be subjected to put sequencing.
[0016] In order to solve the above technical problems, the present invention also provides a second technical solution: A method for constructing a cyclic compound library, comprising the following steps: 1) A solid support G is directly or indirectly bound to a molecule M containing a photocleavable group to obtain GM. ; 2) Follow these steps: a2. Reactively linking GM to a linker L1 having at least three functional groups to form GM-L1 obtain; b2. GM-L1 is reacted sequentially with the starting nucleotide molecule HP and the open primer OP. and attaching the starting nucleotide molecule HP to a solid support G to obtain OP-HP-GM-L1; c2. OP-HP-GM-L1 was reacted with building block C1 and the DNA tag tag1 corresponding to building block C1. The building block C1 was linked to L1 and the DNA tag tag1 to OP to form tag1-OP-HP-GM-L1-C1. obtain; d2. Define the binding reaction of the corresponding building blocks and DNA tag sets as an extension step. The building blocks are spliced sequentially to form a chain, and the building blocks are The extension step is repeated so that the corresponding DNA tags are sequentially spliced to form a chain. Repeat, tag n -·····tag1-OP-HP-GM-L1-C1-········-C n Here, 2 ≦n≦7, where n is a positive integer; e2. The product obtained in the previous step is reacted with the cyclic A-terminal molecule A, and the cyclic A-terminal molecule A is C n to be combined with; f2. The product obtained in the previous step is converted into building block C n+1 ,...,C n+m Oh and their corresponding DNA tags n+1 , ..., tag n+m and the extension step described The reaction is carried out in sequence according to the formula n+1 to the linker L1, and the DNA tag tag n+1 Tag n Combined into After step e2 and step f2, tag n+m -·······tag1-OP-HP-GM-L1(-C1· -C n -A)-C n+1 C n+m where 0≦n≦7, 0≦m≦7, and n and m are integers. The number, 2≦n+m≦7. g2. The product obtained in the previous step is reacted with the closed-circular B-terminal molecule B and the closed-circular primer CP. Step B: Transfer the terminal molecule B to C. n+m Tag the closing primer CP n+m where ,HP-OP-tag1-········tag n+m -CP forms the complete DNA coding sequence, and DNA-GM-L1(1(- C1-C n -A)-C n+1 C n+m -B, i.e., compound library S2' is obtained. ru; 3) Compound library S2' is subjected to a cyclization reaction in the presence of cyclooxygenase to give cyclized A By reacting the terminal molecule A with the ring-closed terminal molecule B, [ka] , i.e., a cyclic compound library S2 is obtained.
[0017] In the second technical solution, in step 2), the order of e2 and f2 can be swapped. , i.e.: In one embodiment, the product tag obtained in step d2 n -·······tag1-OP-HP-GM-L1-C1- -C n is reacted with the ring-closed A-terminated molecule A to form the ring-closed A-terminated molecule A into C n t ag n -···········tag1-OP-HP-GM-L1-C1-············································································································································ is n -A. Then tag n - -tag1-OP-HP-GM-L1-C l -C n -A to the building block C n+1 ,·····,C n +m and their corresponding DNA tags n+1 ,·····,tag n+m and the extension stage described The reaction proceeds in sequence according to the steps to form building block C. n+1 to the linker L1, and the DNA tag tag n+1 Tag n to Combine and tag n+m -············tag1-OP-HP-GM-L1(-C1-···································································································· n -A)-C n+1 -·· -C n+m get; Alternatively, the product tag from step d2 n -·········tag1-OP-HP-GM-L1-C1-···· -C n , building block Cn+1 ,·····,C n+m and their corresponding DNA tags n+1 ,·····,tag n+m and the extension steps described in the table are sequentially reacted to form the synthetic block. CK C n+1 is bound to the linker L1, and the DNA tag tag n+1 Tag n Bind to tag n+m - ·-tag1-OP-HP-GM-L1(-C1-·······-C n )-C n+1 -C n+m Then you get the tag n +m -············tag1-OP-HP-GM-L1(-C1-···································································································· n )-C n+1 -C n+m of , and react with the closed-ring A-terminal molecule A to form the closed-ring A-terminal molecule A into C n Bind to tag n+m -······- tag1-OP-HP-GM-L1(-C1-...-C n -A)-C n+1 -C n+m get.
[0018] In the second technical solution provided by the present invention, the final compound is on a solid support. Since the DNA code is also on a solid support, all synthesis steps are carried out on the solid support. The quality of the compound library is more assured. The compound library obtained with this solution This can be applied to fluorescence-activated cell sorting (FACS) screening, and the screened The selected cyclic compounds can be screened without the need for high-throughput sequencing. The resulting cyclic compound can be directly removed from the solid support by utilizing a decomposition reaction under light irradiation. The screening period is short and it is said to be highly efficient.
[0019] In order to solve the above technical problems, the present invention further provides a third technical solution: A method for constructing a cyclic compound library, comprising the following steps: 1) A solid support G is directly or indirectly bound to a molecule M containing a photocleavable group to obtain GM. : 2) Follow these steps: a3. Reactively linking GM to a linker L1 having at least four functional groups to form GM-L1 get; b3. GM-L1 is reacted sequentially with the starting nucleotide molecule HP and the open primer OP. Attaching the starting nucleotide molecule HP to the linker L1 to obtain GM-L1-HP-OP; c3. GM-L1-HP-OP was synthesized using building block C1 and the corresponding DNA tag tag1. The reaction was carried out to bind the building block C1 to L1 and the DNA tag tag1 to OP to form GM-L1(-HP-OP-tag1)-C get 1; d3. Define the binding reaction of the corresponding building blocks and DNA tag sets as an extension step The building blocks are spliced sequentially to form a chain, and the building blocks are The extension step is repeated so that the corresponding DNA tags are sequentially spliced to form a chain. Repeat, GM-L1(-HP-OP-tag1-...-tag n )-C1-······-C n where , 2≦n≦7, where n is a positive integer; e3. The product obtained in the previous step is reacted with the cyclic A-terminal molecule A, and the cyclic A-terminal molecule A is C n to be combined with; f3. The product obtained in the previous step is converted into building block C n+1 ,·····,C n+m and The corresponding DNA tags n+1 ,·····,tag n+m and the extension step described. Then, the compound C is reacted in sequence. n+1 to the linker L1, and the DNA tag tag n+1 Tag n Bind to After step e3 and step f3, GM-L1(-HP-OP-tag1...-tag n+m )(-C1... -C n -A)-C n+1 -C n+m where 0≦n≦7, 0≦m≦7, n and m are integers, 2≦n+m≦7. g3. The product obtained in the previous step is reacted with the closed-circular B-terminal molecule B and the closed-circular primer CP. Step B: Transfer the terminal molecule B to C. n+m Tag the closing primer CP n+m where ,HP-OP-tag1-········tag n+m -CP forms the complete DNA coding sequence, and GM-L1(-DNA)(- C1-C n -A)-C n+1 C n+m -B, i.e., compound library S3' is obtained. ru; 3) Compound library S3' is subjected to a cyclization reaction in the presence of cyclooxygenase to give cyclized A By reacting the terminal molecule A with the ring-closed terminal molecule B, [ka] , i.e., a cyclic compound library S3 is obtained.
[0020] In the third technical solution, in step 2), the order of e3 and f3 can be swapped. , i.e.: In one embodiment, the product GM-L1(-HP-OP-tag1-...-tag n )-C1 -C n is reacted with the ring-closed A-terminated molecule A to form the ring-closed A-terminated molecule A into C n Binding to G -M-L1(-HP-OP-tag1-·······-tag n )-C1······-C n -A is obtained. Then GM-L1(-HP-O P-tag1-······-tag n )-C1······-C n -A to the building block C n+1 ,····· ,C n+m and their corresponding DNA tags n+1 ,·····,tag n+m The growth rate is as follows: The reaction proceeds in a sequential manner along the long steps to form building block C n+1 to the linker L1, and the DNA tag tag n+1 A ag n GM-L1(-HP-OP-tag1-tag n+m )(-C1·····-C n -A)-C n+1 -C n+m get; Alternatively, the product GM-L1(-HP-OP-tag1--tag n )-C1- -Cn, as a building block C n+1 ,·····,C n+m and their corresponding DNA tag n+1 ,·····,tag n+m and the reaction is carried out in the following extension steps. Block C n+1 to the linker L1, and the DNA tag tag n+1 Tag n GM-L1(-HP-OP-tag1 -tag n+m )(-C1······-Cn)-C n+1 -C n+m Next, GM-L1 (-HP-OP-tag1...-tag n+m )(-C1······-Cn)-C n+1 -C n+m Ring closure A-terminal molecule A is reacted with the ring-closed A-terminal molecule A to form C n GM-L1(-HP-OP-tag1... -tag n+m )(-C1·····-C n -A)-C n+1 -C n+m get.
[0021] In the third technical solution provided by the present invention, the final compound is on a solid support. The DNA coding is on the compound, and all synthesis steps are carried out on a solid support, so the compound The quality of the product library is more assured. The library obtained by this method is photocleavable. Secondary screening can be performed by cleaving the molecule M containing the group. The screening is carried out by first screening on a solid support followed by screening of a molecule M containing a photocleavable group. The compound is removed from the solid support by cleavage of the cleavage site, at which point the DNA is coupled to the library compound. The resulting compound library is then subjected to secondary screening. To improve the accuracy of the screening results, the screening was carried out using fluorescence-activated cell sorting (FACS). FACS screening, conventional target protein affinity screening, AS-MS screening A combination of different screening techniques, such as filtration, filtration, and any combination of these. It can be combined.
[0022] In the third technical solution, the GM-L1(-DNA)(-C1·····-C obtained in step g3 n -A)- C n+1 -C n+m -B is decomposed under a light source to separate M from A, and DNA-L1 (―C1-C n -A)-C n+1 -C n+m -B, that is, compound library S4' can be obtained. The product library S4' is subjected to a cyclization reaction in the presence of cyclooxygenase to give a cyclized A-terminal molecule. A reacts with the ring-closing B terminal molecule B to form a ring, [ka] , i.e., a cyclic compound library S4 is obtained. Alternatively, the compound library S3 is is subjected to a decomposition reaction below to cleave M from L1, [ka] , i.e., compound S4 is obtained.
[0023] In the three technical solutions provided by the present invention, the solid support G is PEG resin, PEGA resin, , TentaGel resin, and solid support CPG.
[0024] In the first and third technical solutions, the solid support G contains one active functional group R1. The solid support G is , can be represented by the general formula G0-R1, where R1 represents the activated functional group of the solid support G, and G0 is The solid support structure of the solid support G other than the activated functional group is shown. The solid support G has this activated functional group R1 R1 is directly or indirectly linked to the molecule M containing the photocleavable group by It can be selected from: an amino group, a carboxyl group, or a hydroxyl group. In a preferred embodiment, The solid support G is selected from solid supports having amino-active functional groups; Preferably, the active functional group R1 is selected from amino groups such as primary amino groups and secondary amino groups. More preferably, the active functional group R1 is selected from primary amino groups. Preferably, the solid support is selected from PEGA.
[0025] In the second technical solution, the solid support G comprises two activating functional groups R1 and R1'. The compound G can be represented by the general formula R1'-G0-R1, where R1 is an active group for binding to the linker L1. R represents a reactive functional group for binding to a DNA coding sequence. In the form, R1 is an amino group and R1' is a carboxyl group.
[0026] In the three technical solutions provided by the present invention, the molecule M containing a photocleavable group is Contains at least two activating functional groups, denoted R2 and R3, respectively. Contains a photocleavable group. The molecule M can be represented by the general formula R2-M0-R3, where R2 and R3 are two mutually independent groups. R2 is an activated functional group that is responsible for binding to the solid support G, and R3 is a functional group that is responsible for ring-closing A. R2 and R3 are activated functional groups that are responsible for the binding of the terminal molecule A or the linker L1. Each independently exists in a protected or unprotected form, and R2 and R3 do not interfere with each other's binding reaction. In particular, R3 mainly inhibits the reaction of R2 in relation to the solid phase carrier G. or R3 does not interfere with the reaction process, or R2 is a protecting group when reacted in conjunction with the solid support G. It is therefore a protected form.
[0027] In a preferred embodiment, R2 is present in unprotected form and R3 is protected by a protecting group. After R2 binds to the solid support G to give GM, R3 is protected before the next reaction. The group needs to be removed.
[0028] The solid support G can be attached to the molecule M containing the photocleavable group in two ways. This is a method to obtain GM by direct complementary pairing reaction of R2 with R1. , two activated functional groups are bonded together so that the chemical structures on which the two activated functional groups are located are covalently bonded. A reaction in which groups react, for example, to covalently bond two molecules to form one molecule. Based on different reaction principles, R1 can remove all or part of its fragment when reacting with R2. For example, R1 can remove a water molecule when it combines with R2; or For example, when an addition reaction occurs, R1 reacts with R2 without removing the fragment. When reacting with R2 by direct complementary pairing, the following combinations can be selected: an amino group and Carboxyl group, amino group and hydroxy group, amino group and phosphate group, amino group and halogenated group Such as alkyl groups or halogenated aryl groups.
[0029] Alternatively, R2 can be indirectly linked to R1 via another linker with two functional groups, resulting in a GM For example, a bifunctional linker has two activating groups, the first of which is , which can react with the activating group R1 of the solid support G by complementary pairing, and the second activating group is a photocleavable It is possible to react with the active group R2 of the molecule M containing the group by complementary pairing. The reaction process is First, the first activating group is first attached to the activating functional group R1 of the solid support G. and then using a second activating group to activate the activating group of a molecule M that contains a photocleavable group. The second is to first attach a second activating group to a molecule containing a photocleavable group. M is then reactively coupled to the activated functional group R2 of the solid support G using the first activating group. In the indirect bonding method, R It is no longer required that R2 and R1 have a complementary pairing relationship.
[0030] In said molecule M comprising a photocleavable group, the photocleavable group is preferably: [ka] where R3 is located on the C atom directly bonded to the benzene ring of the side chain adjacent to the nitro group. R2 is [ka] is located at the C atom on the benzene ring, and R2 is spaced apart by one or more covalent bonds. or R2 is spaced apart by one or more covalent bonds from the C atom to which R3 is attached. The benzene ring is bonded to zero, one or more side chains that do not interfere with the bonding reaction of R2 and R3. Alternatively, it may contain a substituent.
[0031] The molecule M containing this photocleavable group forms a bond between R3 and the C atom to which R3 is attached under appropriate light conditions. The molecule M containing the photocleavable group can be decomposed at 365 nm.
[0032] In some preferred embodiments, the molecule M comprising a photocleavable group is selected from the following structures: Can be selected: [ka] In the above structure, R3 can be selected from -OH, -NH2, -NHNH2, -N3, Cl, Br, etc. In the formula, R2 is represented by a carboxyl group.
[0033] In some specific embodiments, the solid support G and the molecule M comprising the photocleavable group are bifunctional The bond can be indirectly linked by a small molecule compound bearing a group.
[0034] In some specific embodiments, the solid support G has an active functional amino group, and the bifunctional The low molecular weight compound having a functional group has an active functional group carboxyl and an amino group protected by a protecting group. The reaction solvent is an organic solvent such as dichloromethane or N,N-dimethylformamide; The reaction temperature is 15 to 30°C, preferably 20 to 25°C; the reaction time is 1 to 12 hours, preferably 2 to 6 hours. Next, the amino group protected by the protecting group of the low molecular weight compound having two functional groups is deprotected. The protecting group of the amino group is preferably F. The moc protecting group is used; the reaction solvent for deprotection is dichloromethane, N,N-dimethylformamide. The reaction solvent is an organic solvent such as ethanol, and piperidine is added to the reaction solvent; the reaction temperature is 15-30°C. The reaction temperature is preferably 20 to 25°C, and the reaction time is 1 to 12 hours, preferably 1 to 6 hours. After deprotection, it is bonded to a molecule M containing a photocleavable group; after deprotection, it becomes a small molecule compound with two functional groups. provides an activated functional amino group, and the molecule M containing the photocleavable group provides an activated functional carboxyl group. The reaction solvent is an organic solvent, e.g., N,N '-Diisopropylcarbodiimide (DIC), 1-hydroxybenzotriazole (HOBt), 4 -Dimethylaminopyridine (DMAP) is added; the reaction temperature is 15 to 30°C, preferably 20 to 25°C. ° C.; the reaction time is 1 to 12 hours, preferably 1 to 6 hours.
[0035] In some specific embodiments, the solid support G and the molecule M comprising the photocleavable group are directly The solid support G has an activated functional amino group, and the molecule M containing the photocleavable group can be attached to the activated The reaction provides a functional carboxyl group, resulting in the formation of an amide bond; the reaction solvent is dichloromethane. Organic solvents such as methane and N,N-dimethylformamide; reaction solvents include N,N'-diisopropyl Propylcarbodiimide (DIC), 1-hydroxybenzotriazole (HOBt), 4-dimethyl The reaction temperature is 15 to 30°C, preferably The reaction temperature is generally 20 to 25° C., and the reaction time is 1 to 12 hours, preferably 1 to 6 hours.
[0036] In the three technical solutions provided by the present invention, the closed-ring A-terminal molecule A and the closed-ring B molecule B is a molecule in which the A-terminal molecule A is converted into a part or the whole of its molecular fragment by the cyclooxygenase ring closure reaction. The ring-closed A-terminal molecule A has two activated functional groups R4 and R5; R4 is , an activating functional group involved in the cyclooxygenase ring closure reaction, which is eliminated during the ring closure reaction. R5 is an activated functional group that is responsible for the bond to the linker L1 or building block, and After that, R5 is maintained in the ring structure of the cyclic compound molecule; R4 and R5 are either protected by a protecting group or R4 and R5 exist independently in unprotected or unprotected forms, and R4 and R5 do not interfere with each other's bonding reaction. The molecular structure of the closed ring A-terminal molecule A is mainly removed during the cyclooxygenase ring closure reaction. It consists of two parts: a molecular fragment A1 that is attached to the ring and a molecular fragment A0 that is retained in the ring during the ring closure reaction. The closed ring A-terminal molecule A can be represented by the general formula R4-A1-A0-R5. R4 is a cyclooxy group. It is located on the molecular fragment A1, which is removed during the ring closure reaction of cyclodiazepam. R5 is located on the molecular fragment A0 that is kept in the ring structure during the ring closure reaction. Since R4 is spliced first, R5 is spliced to R3 of molecule M containing a photocleavable group. or R4 binds to a molecule M containing a photocleavable group. In the reaction, it is mainly required that R5 is in a form protected with a protecting group.
[0037] The molecular fragment A0 has a site-blocking group in its structure, and the site-blocking group is directly bonded to R5. The blocking group is part or all of the structure of the molecular fragment A0. The site blocking group is the space between M and A. A group that increases site blocking, and the site blocking group may be selected from: carboxy a group having an alkyl group, an aliphatic chain, a polyethylene glycol chain, a rigid ring. The site-blocking group is an amino acid residue consisting of one or more amino acids. The blocking group is an amino acid residue consisting of 1 to 10 amino acids. The site-blocking group is retained on the ring. Therefore, the site-blocking group is preferably 2 to 5, taking into consideration the ring size as well as the site-blocking effect. It is an amino acid residue made up of amino acids.
[0038] In a preferred embodiment, R4 is present in unprotected form and R5 is protected with a protecting group. When R4 is bonded to R3 of a molecule M containing a photocleavable group to give GMA, R5 is The protecting group is removed before the reaction. Once R4 is attached to the building block, R5 is protected by the protecting group before the next reaction. is removed.
[0039] In the first technical solution, R4 is an activating group that forms a complementary pair with R3 of the molecule M containing the photocleavable molecule. The reaction of R4 and R3 splices a molecule M containing a photocleavable group and a ring-closed A-terminated molecule A. GMA is obtained by isolating, isolating, and purifying. R4 and R3 are reactive groups for complementary pairing. In some preferred embodiments, R4 and R3 may be selected from the following combinations: Amino and carboxyl groups, hydroxy and carboxyl groups, phosphate and hydroxyl groups and the like. Examples of such groups include an alkoxy group, an amino group, and a halogenated alkyl group or a halogenated aryl group.
[0040] In the second and third technical solutions, R4 is complementary to one of the activated functional groups of the building blocks. The activated functional group that forms a pair is the ring-closed A terminal molecule A, which is the activated functional group of R4 and the building block. In some preferred embodiments, the building blocks are spliced together by reaction with R4 and one of the activating functional groups of the building blocks may be selected from the following combinations: : Amino and carboxyl groups, hydroxy and carboxyl groups, phosphate groups and Hydroxy groups, amino groups, and halogenated alkyl or aryl groups.
[0041] In a preferred embodiment, the structure of the closed ring A-terminated molecule A, in which a portion of A1 has been removed from the molecular structure, is: It is an amino acid residue consisting of one or more amino acids. This amino acid residue is a peptide The closed ring A is connected to A0 in the molecular structure of the molecule A by a bond. For example, some preferred In a preferred embodiment, the amino acid sequence of the removed portion A1 in the molecular structure of the closed-ring A-terminal molecule A is are as follows: FAGDDAE (-Phe-Ala-Gly-Asp-Asp-Ala-Glu), AYDGE (-Ala-Tyr-Asp), sp-Gly-Glu), -OCam-L, FL(-Phe-Leu), AL(-Ala-Leu), GL(-Gly-Leu), HL(-His- Leu) or HV(-His-Val) or SL(Ser-Leu).
[0042] In a preferred embodiment, the closed A-terminal molecule A is a peptide consisting of at least three amino acids. More preferably, the closed-ring A-terminal molecule A is a peptide consisting of 3 to 20 amino acids. It's a chain.
[0043] In the first technical solution, in some specific embodiments, a molecule M comprising a photocleavable group can react and bond directly to the closed ring A-terminal molecule A. The molecule M having a photocleavable group is active The terminal molecule A provides an activated functional group, an amino group or a hydroxyl group, and the closed ring A provides an activated functional group, a carboxyl group. provides a carboxyl group which reacts to form an ester or amide bond to bind the The reaction solvent is an organic solvent such as dichloromethane or N,N-dimethylformamide. The reaction solvent contains N,N'-diisopropylcarbodiimide (DIC), 1-hydroxybenzotriazolium Add one or more of the following: 4-dimethylaminopyridine (DMAP), 4-dimethylaminopyridine (HOBt), or 4-dimethylaminopyridine (DMAP); The reaction temperature is 15 to 30°C, preferably 20 to 25°C, and the reaction time is 1 to 24 hours, preferably The reaction time is usually 12 to 18 hours. The other activated functional groups of the terminal molecule A are protected by amino groups. Preferably, the closed ring A terminal molecule A is a tetrapeptide protected with an Fmoc-protected amino group. The amino group serves as an activating functional group for the reaction between the ring-closed A-terminal molecule A and the linker L1. It is necessary to undergo a deprotection reaction before reacting with the linker L1; The reaction solvent is an organic solvent such as dichloromethane or N,N-dimethylformamide. Peridine is added; the reaction temperature is 15 to 30°C, preferably 20 to 25°C; the reaction time is 1 to 2 The time is 4 hours, preferably 12 to 18 hours.
[0044] In the first and third technical solutions, the closed ring A terminal molecule A is directly reacted with the synthesis block 3. The reaction between the two forms an ester or amide bond for connection. The reaction solvent is an organic solvent such as dichloromethane or N,N-dimethylformamide. The reaction solvent was N,N'-diisopropylcarbodiimide (DIC), 1-hydroxybenzotriazole, and Add one or more of azole (HOBt) and 4-dimethylaminopyridine (DMAP); The reaction temperature is 15 to 30°C, preferably 20 to 25°C, and the reaction time is 1 to 24 hours, preferably The reaction time is usually 12 to 18 hours. The other activated functional groups of the terminal molecule A are protected by protecting groups. Preferably, the closed ring A terminal molecule A is an allylic hydroxyl group (AllO-). During the ring formation reaction, the terminal molecule A is a protected tetrapeptide. The protecting group of the hydroxyl group must be removed, followed by ring closure with cyclooxygenase.
[0045] In the three technical solutions provided by the present invention, the linker L1 has at least three active The linker has an activated functional group, optionally at least four activated functional groups.
[0046] In the first technical solution, the linker L1 has at least three activating functional groups R6, R7 and R8 The linker L1 can be represented by the following general formula: [ka] where R6, R7 and R8 are three activating functional groups. R6, R7 and R8 are respectively independently, present in a protected or unprotected form, R6, R7 and R8 do not interfere with each other's bonding reaction. In the first technical solution, R6 is a closed ring A-terminal molecule A R7 is an activated functional group that forms a complementary pair with the activated functional group R5 above, and R7 is the starting nucleotide moiety. HP is an activated functional group reactively spliced into the building block C1. The reaction sequence of the three activated functional groups is as follows: first, R6 reacts with R5 to be spliced, and R7 and R8 interfere with the splicing reaction of R6 and R5. Second, R7 reacts with the starting nucleotide molecule HP to initiate splicing. Therefore, R8 does not interfere with the splicing reaction of R7 with the starting nucleotide molecule HP. Finally, R8 reacts with building block C1 to effect splicing. In another embodiment, R6 is present in an unprotected form, and R7 and R8 have different deprotection mechanisms. For example, R6 is an unprotected carboxyl group. wherein R7 is a carboxyl group protected by a protecting group, and R8 is an amino group protected by a protecting group. After R6 is bonded to R5 of the closed-ring A-terminal molecule A to obtain GMA-L1, the deprotection reaction mechanism is first The protecting group of R7 is removed using nucleotide splicing, and R7 is reactively spliced to the starting nucleotide molecule HP. Sometimes the open primer OP can continue splicing; then another deprotection reaction mechanism to remove the protecting group of R8, splice R8 to building block C1, and then perform another deprotection. Using a reaction mechanism, the protecting group of R8 is removed, R8 is spliced to building block C1, and The reaction after
[0047] In the second technical solution, the linker L1 has at least three activating functional groups R6, R7 and R8. and the linker L1 can be represented by the following general formula: [ka] where R6, R7 and R8 are three activating functional groups. R6, R7 and R8 are each independently In other words, R6, R7 and R8 may be present in a protected or unprotected form. and R8 do not interfere with each other's bonding reaction. In the second technical solution, R6 contains a photocleavable group. is an activated functional group that forms a complementary pair with the activated functional group R3 of molecule M, and R7 is a building block C1 and R8 is the activated functional group spliced with building block C n+1 Reacts and sprites The reaction sequence of the three activated functional groups is as follows: first, R6 is photocleavable; R7 and R8 react with the molecule M containing the group M to splice, so R6 reacts with the molecule M containing the group M to splice, R7 then reacts with building block C1 to initiate splicing. Therefore, it is required that R8 does not interfere with the splicing reaction process of R7; is building block C n+1 In a preferred embodiment, R6 is a protected R7 and R8 are protected with protecting groups that have different deprotection mechanisms. It exists in form.
[0048] In the third technical solution, the linker L1 has at least four active functional groups R6, R6', R7 and and R8. The linker L1 can be represented by the following general formula: [ka] where R6, R6', R7 and R8 are four activating functional groups. R6, R6', R7 and R8 are , each independently present in a protected or unprotected form; However, R6, R6', R7 and R8 do not interfere with each other's bonding reaction. R6 is a molecule M containing a photocleavable group. R6' is an active functional group that forms a complementary pair with the active functional group R3 of the starting nucleotide molecule H P is the spliced active functional group, and R7 is the spliced active functional group in response to building block C1. The spliced active functional group, R8 is the building block C n+1 Splice in response to It is an active functional group that has been bonded.
[0049] In the third technical solution, a preferred embodiment is that the linker L1 is It is composed of two trifunctional linkers L1', L1'', which are linked together, and is represented by the following general formula: L1'-L1''. wherein L1' has three activating functional groups R6, R6' and R6'', and L1'' has three It has activated functional groups R7, R8, and R8', and R6'' is bonded to R8' in a complementary pairing reaction. .
[0050] In the third technical solution, a preferred embodiment is that the linker L1 has a degradable functional group R L Including This functional group R L When degraded, it splits the linker L1 into two molecular fragments, The molecular fragments are a molecular fragment consisting of R6 and R6' and a molecular fragment consisting of R7 and R8.
[0051] In the above preferred embodiment of the third technical solution provided by the present invention, The compound library obtained after the screening was then transferred to the cleavable functional group R in the linker L1. The library compounds are subjected to secondary segment cleavage to obtain the screened compounds. It can be obtained directly and can achieve high efficiency in a short period of time.
[0052] In some specific embodiments, the linker molecule L1 is a trifunctional linker molecule L1′ , L1″, and a linker molecule L0 bonded between L1′ and L1″. Possible functional group R L is located within the structure of the linker molecule L0 and is bonded to the linker molecule L1. A functional group L1' of a linker molecule L0, or a functional group L1' of a linker molecule L0 bonded to a linker molecule L1 The linker L1 can be represented by the following general formula: L1'-L0-L1''. wherein L1' has three activating functional groups R6, R6' and R6'', and L1'' has three activating functional groups R7, L0 has two active functional groups R7 and R7', and R7 is a functional group that is capable of complementary pairing reaction. R7' is bound to R8' in a complementary pairing reaction. Degradable functional group R L may be a functional group formed after the complementary pairing reaction of R7 and R6″. , may be a functional group formed after the complementary pairing reaction between R7 and R8, or ... The degradable functional groups may be independently located within the structure.
[0053] In some specific embodiments, the method further comprises providing a degradable functional group R L is acid cleavage or a photocleavable group having a cleavage wavelength different from that of the molecule M containing the photocleavable group. Examples of the acid-cleavable group include an ester bond and an amide bond.
[0054] In particular, the linker L0 is selected from the following structures: [ka] (Formula 1), [ka] (Formula 2), [ka] (Equation 3), [ka] (Equation 4), [ka] (Equation 5), [ka] (Equation 6), [ka] (Equation 7), [ka] (Equation 8), [ka] (Equation 9), Here, in the molecular structure of the degradable linker molecule L0 represented by Formulas 1 to 7, a hydroxyl group and an alkyl group are The aldehyde group reacts with and bonds to the activated functional groups of the linker molecules L1 and L1'', forming degradable functional groups. base R L It is possible to form R L can be cleaved under acidic conditions or in the presence of light For example, hydroxyl groups react with carboxyl groups to form ester bonds, and ester bonds are formed under acidic conditions. The ether bond can be cleaved into two molecular fragments; the aldehyde group reacts with the amine group to form In the molecular structure of the degradable linker L0 shown in Formulas 8 and 9, In this case, the hydroxyl group and the amine group react with the carboxyl group of L1'' to form an ester bond and and amide bonds, which can be cleaved by light. The irradiation wavelength for photocleavage is 290 nm. be.
[0055] In some preferred embodiments, any of the activated functional groups attached to molecule L1 is complementary to The paired activating functional groups can be selected from the following combinations: an amino group and a carboxyl group. Silyl group, hydroxyl group and carboxyl group, phosphate group and hydroxyl group, amino group and halo group halogenated alkyl groups or halogenated aryl groups.
[0056] In the first technical solution, in some specific embodiments, the closed-ring A-terminal molecule A is The activated functional group R6 of the linker L1 can react directly with and be bonded to the linker L1. The closed ring A terminal molecule A provides an activated functional amino group, and the two react to form an amide bond. The reaction solvent is an organic solvent, such as dichloromethane, N,N-dimethylform, Amide; Reaction solvent contains N,N'-diisopropylcarbodiimide (DIC), 1-hydroxybenzoxazole triazole (HOBt), 4-dimethylaminopyridine (DMAP); the reaction temperature is 15 to 35°C, preferably The reaction time is 1 to 12 hours, preferably 1 to 6 hours.
[0057] In the second and third technical solutions, in some specific embodiments, the photocleavable group The molecule M containing the activating functional group R of the linker L1 can be directly reacted with and attached to the linker L1. 6 is a carboxyl group, and the molecule M containing the photocleavable group provides an activated functional hydroxyl group. The two react to form an ester bond; the reaction solvent is dichloromethane, N,N-dimethyl The reaction solvent is N,N'-diisopropylcarbodiimide ( DIC), 1-hydroxybenzotriazole (HOBt), 4-dimethylaminopyridine (DMAP); The reaction temperature is 15 to 35°C, preferably 20 to 30°C; the reaction time is 1 to 12 hours, preferably 1 to 6 hours. It is between.
[0058] In the three technical solutions provided by the present invention, the starting nucleotide molecule HP has an activating group. functional groups R9, R9, which are complementary to the activated functional groups of the linker L1 or the activated functional groups of the solid support G. React with formation.
[0059] In the first technical solution, the activated functional group R7 of the linker L1 reacts with R9 to form the starting nucleoside. The starting nucleotide molecule HP is ligated to the linker L1. The open primer OP reaction is combined with GMA-L1-HP-OP under the action of The action of ligase also serves the purpose of lengthening the DNA coding sequence. The nucleotide molecule HP is the starting point of the DNA strand in the DNA splicing technique. Mer-OP refers to a DNA strand that can be extended in DNA splicing techniques.
[0060] In the second technical solution, the solid support G has two activated functional groups R1 and R1', R of the solid support G By reaction with R9, the starting nucleotide molecule HP is spliced onto the solid support G. Furthermore, the starting nucleotide molecule HP is converted to an open primer O under the action of DNA ligase. The DNA coding sequence is lengthened by the action of DNA ligase. The objective is also achieved.
[0061] In the third technical solution, the activated functional group R6' of the linker L1 reacts with R9 to form the starting nucleoside. The starting nucleotide molecule HP is ligated to the linker L1. The open primer OP reaction is bound under the action of DNA ligase, and then the D The goal of lengthening the NA coding sequence is also achieved.
[0062] In some specific embodiments, the active functional group R9 of the starting nucleotide molecule HP is an amino The linker L1 or the solid support G is selected from the group consisting of a hydroxyl group, ... The functionalizing group is a carboxyl group. The carboxyl group reacts with R9 (amino group) to form an amino group. A bond is formed, and the linker L1 or the solid support G is spliced with the starting nucleotide molecule HP. The carboxyl group is protected by a carboxyl group forming a tert-butyl ester group. The deprotection conditions for the carboxyl tert-butyl group are 95% trifluoromethyl. After the deprotection, the activated functional group carboxyl group is deprotected from the starting nucleic acid. It reacts with the activated functional group R9 amino group of the nucleotide molecule HP (HDNA) to form an amide bond; First, N,N'-diisopropyl alcohol is dissolved in an organic solvent such as dichloromethane or N,N-dimethylformamide. propylcarbodiimide (DIC), N-hydroxysuccinimide (NHS), and 1-12 hours, preferably The reaction is preferably carried out for 1 to 6 hours; then, the reaction is carried out with the starting nucleotide molecule HP under the following conditions: The reaction with the starting nucleotide molecule HP (HDNA) is preferably carried out in a HEPES buffer at 15 to 30°C. The reaction can be carried out at a reaction temperature of about 20 to 25° C. for 1 to 48 hours, preferably 12 to 24 hours.
[0063] In some specific embodiments, the starting nucleotide molecule HP is ligated in the presence of T4 DNA ligase. Below, an open primer OP is attached to extend the DNA sequence in preparation for the attachment of the DNA tag.
[0064] In the first technical solution, in some specific embodiments, the activity of the ligand molecule L1 The functional group R8 is an amino group protected with an Fmoc protecting group. The Fmoc protecting group contains a piperidine group. The hydroxyl group can then be removed using organic solvent conditions, including those previously described, and then used for coupling of building blocks. It can be prepared.
[0065] In the second and third technical solutions, the activated functional groups R7 and R8 of the linker L1 are deprotected by a deprotection reaction. In some specific embodiments, R1 has a different protecting group for the aryl group. R8 is a carboxyl group protected by a hydroxyl group (AllO-), and R8 is fluorenyl. The amino group is protected using a methoxycarbonyl group (Fmoc).
[0066] The three technical solutions provided by the present invention involve the sequencing of building blocks and corresponding DNA tags. Completion of pricing is called passing through the extension step. By repeating this process, the building blocks and DNA tags are attached, resulting in the synthesis of a compound library. Each block has a unique DNA tag, and the number of blocks is expanded. The blocks and corresponding DNA tags form a list. The list is further divided into building blocks and corresponding DNA tags. The tags are chosen arbitrarily, and each building block is connected sequentially to the building block of the previous extension step. The DNA tags are then sequentially connected to the DNA tags of the previous extension step, i.e., synthetic blocks. The extension step is repeated so that the chain of DNA tags and the chain of DNA tags are each extended. .
[0067] In the first technical solution, the extension step is repeated to obtain GMA-L1(-HP-OP-t ag1-······-tag n )-C1-······-C n The number of building blocks to be combined and The number n of DNA tags corresponding to the DNA fragments is determined according to the desired circular size. , n takes a value in the range of 2≦n≦7, and n is a positive integer.
[0068] In the second technical solution, the tag is generated by repeating the extension step. n - -tag1-OP-HP-GM-L1-C1-C n Japanese tag n+m -······-tag1-OP-HP-GM-L1(-C1······- C n -A)-C n+1 -C n+m where 0≦n≦7, 0≦m≦7, n and m are integers, and 2 ≦n+m≦7.
[0069] In the third technical solution, the extension step is repeated to obtain GM-L1(-HP-OP-tag1 -tag n )-C1······-C n and GM-L1(-HP-OP-tag1·····-tag n+m )(-C1 -C n -A)-C n+1 -C n+m where 0≦n≦7, 0≦m≦7 , n and m are integers, and 2≦n+m≦7.
[0070] The building blocks are small molecules with dual activated functional groups. The first activated functional group and the second activated functional group of the compound are protected by unprotected groups. The first activating functional group and the second activating functional group do not exist simultaneously in a separated form, and the first activating functional group and the second activating functional group do not interfere with each other. Building blocks also include backbone structures (e.g., backbone units). The backbone structure may be attached to the ring either intracyclically or in the form of a side chain of the ring. The activated functional groups of two adjacent building blocks are complementary, i.e., That is, two activated functional groups are joined by reacting together to form a covalent bond. The doubly activated functional groups of the building blocks are each independently an amino group, a carboxyl group, Aldehyde group, alkenyl group, alkynyl group, halogen group, azide group, hydroxyl group, and a hydrophobic group.
[0071] In a preferred embodiment, the first activated functional group is in a form protected by a protecting group, or is present in a form unprotected by a protecting group, and the second activated functional group is present in a form unprotected by a protecting group. When the first activated functional group is in a protected form, The mechanism of deprotection of the first activated functional group is is different.
[0072] In a preferred embodiment, the first activated functional group is present in unprotected form and the second activated functional group is present in unprotected form. The functional groups are present in protected form. carrying out a direct splicing reaction using the first activated functional group that is not protected by a protecting group; Then, protection of the second activated functional group of the building block prior to the next step of the splicing reaction. The agent needs to be removed.
[0073] By repeating this extension step, the building blocks are spliced sequentially. In the technical solution, each building block is spliced sequentially, and the first active site of building block C1 is The functional group is responsible for splicing with the linker L1, and the first active site of each subsequent building block is The activated functional group of the building block is sequentially spliced with the second activated functional group of the previous building block to form a building block. CK C n The second activation functional group of the cyclized B molecule is responsible for splicing with the closed B-terminal molecule B; The functional group and the second reactive functional group are not simultaneously present in unprotected form, and the first activated functional group In the second and third technical solutions, the synthetic block The first activated functional group of the lock C1 activates splicing with one activated functional group of the linker L1. Carrier, C1 and C n and the first activated functional group of each building block between building blocks C and C. n No. 1 is sequentially spliced with a second activated functional group of the previous building block, Building Block Cn The second activated functional group of the cyclized A is responsible for splicing with the terminal molecule A; Block C n+1 The first activated functional group of the linker L1 is spliced with the other activated functional groups of the linker L1. C n+1 and C n+m Each building block between the building blocks and building block C n+m The first activated functional group is sequentially spliced with the second activated functional group of the previous building block to give building block C. n+ m The second activation functional group of the cyclized B molecule is responsible for splicing with the closed B molecule; the first activation functional group and the second reactive functional group are not simultaneously present in unprotected form, and the first activated functional group and the second reactive functional group are not simultaneously present in unprotected form. The two activating functional groups do not interfere with each other.
[0074] In a preferred embodiment, adjacent building blocks are linked by the following chemical bond: Amide bonds, ester bonds.
[0075] In a preferred embodiment, the first activated functional group of each building block is the same activated functional group. For example, all are carboxyl groups; the second activated functional group of each building block is also the same. reactive functional groups, e.g., all amino groups; and the first activated functional group is a second It is different from an activated functional group.
[0076] In a preferred embodiment, the dual activated functional groups of the building blocks are carboxyl and amino groups. The carboxyl group and the amino group are each independently in a protected form or exists in an unprotected form.
[0077] In a preferred embodiment, the building block is a divalent amine having both an amino group and a carboxyl group. In some embodiments, the amino groups and The carboxyl and aryl groups are attached to the same carbon atom, as in α-amino acids. In this embodiment, the amino and carboxyl groups in the building blocks are bonded to different atoms. It may be a non-amino acid compound having both an amino group and a carboxyl group. In other embodiments, the building blocks may be substituted or N-substituted amino acids. substituted or unsubstituted dicarboxylic acids, substituted or unsubstituted diamines, substituted or unsubstituted diols , substituted or unsubstituted alkenes, substituted or unsubstituted alkynes, substituted or unsubstituted alkene The compound is selected from the group consisting of aldehydes.
[0078] In a preferred embodiment, the first activated functional group is a carboxyl group, is present in a form that is not protected by a protecting group.
[0079] In a preferred embodiment, the first activated functional group is an amino group, and the amino group is The protecting group is in the form of an Fmoc protecting group.
[0080] In a preferred embodiment, the building blocks are Fmoc-amino acids.
[0081] In a preferred embodiment, at least one of said building blocks is capable of binding to an E3 ligase. It contains a backbone structure with a suitable E3 ligase substrate structure. E3 ligase applicable to PROTAC Libraries of compounds with substrate structures allow for versatile screening of libraries. To perform Noh.
[0082] In some specific embodiments, the backbone structure is selected from the following: [ka]
[0083] In a preferred embodiment, each of said building blocks comprises a total of at least one cyclic outer chain. The cyclic outer chain expands the diversity of the compound library, resulting in a more diverse library. A compound is provided.
[0084] In a preferred embodiment, each of said building blocks comprises a total of at least two ring-closing side chains. At least two cyclic outer chains are joined by a chemical reaction to form a bicycle. The cyclization of the outer cyclic chain can occur either before or after the enzymatic cyclization. The formation of the bicyclic ring is carried out in all three technical solutions provided by the present invention. This can be done.
[0085] The DNA tags are sequentially ligated to each other by DNA ligase. In this study, the splicing reaction of a DNA tag and a corresponding building block was carried out by the synthetic block. The extension step is completed so that the lock strand and the DNA tag strand are elongated separately. A tag splicing reaction is performed to extend the DNA tag strand, followed by the DNA corresponding to the tag. A splicing reaction of the building blocks may be carried out to extend the chain of the building blocks, or A block splicing reaction is carried out to extend the chain of the synthetic block, followed by the synthesis of the synthetic block. The strand of the DNA tag may be extended by performing a splicing reaction of the DNA tag corresponding to the block.
[0086] In the three technical solutions provided by the present invention, when the DNA tag is spliced, DNA ligase joins the closing primer CP to form the complete DNA coding sequence. The strand primer CP is the terminal strand where DNA extension stops in the DNA splicing technique.
[0087] In the three technical solutions provided by the present invention, the closed ring B-terminal molecule B has a doubly activated functional group. The ring-closed B-terminal molecule B can be represented by the general formula R10-B0-R11. R10 is Activation of the final building block with a second activated functional group to be used for reactive splicing R10 and R11 are functional groups, and R11 is an activating functional group used in the ring-closing reaction. Each independently exists in a protected or unprotected form. R10 and R11 do not interfere with each other's binding reaction. Since R10 is the first to react with the second activated functional group of the block, R11 connects R10 to the final synthetic block. Do not interfere with the reaction process that connects R10 to the second activated functional group of the block, or connect R10 to the final bond. In the reaction to bond to the second activated functional group of the building block, R10 is protected with a protecting group. The main requirement is that the form is well-defined.
[0088] In a preferred embodiment, R10 is present in an unprotected form and R11 is present in a protected form. R10 is present in a protected form. R10 reacts first with the second activated functional group of the last building block. When R11 is used in the ring-closure reaction, the protecting group of R11 is are removed first.
[0089] R10 and the second activated functional group of the last building block are complementary pairing reactive groups, In some preferred embodiments, R10 and the second activated functional group of the last building block are The amino and carboxyl groups may be selected from the following combinations: amino and carboxyl groups, hydroxy and and carboxyl groups, phosphate groups and hydroxyl groups, amino groups and alkyl halides groups or halogenated aryl groups, etc.
[0090] In a new preferred embodiment, compounds R10 and R11 are two activated cyclic B-terminal molecules of the closed ring B. One of the functional groups is an amino group and the other is a carboxyl group.
[0091] The first technical solution involves splicing a closed primer OP and a closed circular B-terminal molecule B, By isolating and purifying the GMA-L1(-DNA)-C1- C n The compound -B is obtained. A library S1'' can be constructed. The compound library S1'' includes a solid support G. , the desired ring structure has not yet been formed. n reacts with the second activated functional group of The other activated functional group R11 is at the free end of molecule B, which is the closed ring B end.
[0092] In the second technical solution, a closed primer OP and a closed circular B-terminal molecule B are spliced together, and the fragment is then split into two. By isolating and purifying the DNA-GM-L1(-C1-C n -A)-C n+1 -C n+m -B The compound library S2' can be constructed. R10 is C n Second activation of The other activated functional group, R11, reacts with the functional group to form a ring-closing molecule B. It is at the free end of the B terminus.
[0093] In the third technical solution, a closed primer OP and a closed circular B-terminal molecule B are spliced together, and the fragment is then separated. By isolating and purifying the -GM-L1(-DNA)(-C1·····-C n -A)-C n+1 -C n+m - B, i.e., compound library S3' is obtained. R10 is C n reacting with the second activated functional group of After splicing, another activating functional group R11 is located at the free end of the closed B-terminal molecule B.
[0094] In a preferred embodiment, R11 is located at the free end of the closed ring B-terminal molecule B, and R11 is an amino group. Preferably, the active functional group R11 at the free end of the closed ring B-terminal molecule B is a primary amino group. be.
[0095] In a preferred embodiment, the closed-ring B-terminal molecule B is a peptide chain consisting of 2 to 10 amino acids. be.
[0096] In some specific embodiments, the ring-closed B-terminal molecule B is an Fmoc-protected dipeptide.
[0097] In some specific embodiments, the molecular structure of the closed ring B-terminal molecule B is an amino acid residue GL (Gl y-Leu-), LL(Leu-Leu-), QL(Gln-Leu-), KL(Lys-Leu-), GF(Gly-Phe-), Gl(Gly-Ile- ), FSA, VGAG, GV, GF, GM.
[0098] In the technical solutions provided by the present invention, the first technical solution is GMA-L1 The bond between M and A in (-DNA)-C1--Cn-B is cleaved by photocleavage, and A-L1(-D NA)-C1-······-C n-B is obtained, and the compound itself constitutes the compound library S1'. The compound library S1' does not contain the solid support G, and the desired ring structure has not yet been formed.
[0099] In the technical solution provided by the present invention, the compound library S1', S2' or S3' is , is subjected to a ring-closure reaction in the presence of cyclooxygenase, whereby the ring-closed A-terminal molecule A is Ring closure reaction: B reacts with the terminal molecule B to form a peptide bond, forming a ring. The free end activated functional group of B-terminal molecule B reacts with A-terminal molecule A to form A-terminal Some or all of the molecular fragments of the molecule are removed, and the free end activated functional group of the closed ring B end molecule B is It bonds to the remaining removed portion to form a ring structure.
[0100] The cyclooxygenase described in the present invention reacts two terminal amino acid residues in the molecule. It refers to an enzyme that forms a peptide bond connecting the two. The enzyme is a cyclic peptide synthase, which synthesizes the N-terminal amino acid residue of one of the terminal amino acids in the molecule. The α-carboxyl group at the C-terminus of the other terminal amino acid residue is catalyzed by the dehydration reaction of the α-carboxyl group at the C-terminus of the other terminal amino acid residue to form a cyclic It is an enzyme that forms polypeptides.
[0101] The cyclooxygenases include the ligases VyPAL2, Butelase1, PatG, PagG, and ominiligase -1, PCY1 or OaAEP1B&3-5.
[0102] In particular, Butelase 1 contains an Asx(Asp / Asn)-His-Val tripeptide sequence at the carboxy terminus. A unique asparagine that efficiently catalyzes intramolecular and intermolecular cyclization of linear polypeptides. Butelase1 is an acid / aminyl ligase that ligates linear polypeptides from the carboxyl terminus to His- The Vai dipeptide is cleaved and then attached to the amino terminus to form a cyclic structure.
[0103] In some specific embodiments, the temperature of the enzymatic ring closure reaction is 25 to 45°C; preferably In the case of the enzymatic cyclization reaction, the temperature is 30 to 45°C; more preferably, the temperature of the enzymatic cyclization reaction is The temperature is 35 to 40 degrees Celsius.
[0104] In some specific embodiments, the pH range for the enzymatic ring closure reaction is 4.5 to 6.0; preferred Preferably, the pH range of the enzymatic ring closure reaction is 4.8 to 5.5; more preferably, the pH range of the enzymatic ring closure reaction is 4.8 to 5.5. The range is 4.9 to 5.3.
[0105] In some specific embodiments, the reaction time for the enzymatic ring closure reaction is 12 hours to 48 hours. Preferably, the reaction time for the enzymatic ring-closure reaction is 18 to 36 hours; more preferably, The reaction time for the elementary ring-closure reaction is 20 to 24 hours.
[0106] In some specific embodiments, the pH is adjusted to sodium acetate buffer in the enzymatic ring closure reaction. It is adjusted using a liquid.
[0107] In some specific embodiments, disodium ethylenediaminetetraacetic acid or a solution thereof The solution (0.05M) is added to the enzymatic ring closure reaction.
[0108] In some specific embodiments, sodium chloride or a solution thereof (0.25M) is used for the enzyme cyclization. is added to the reaction.
[0109] In some specific embodiments, TCEP is added as a reducing agent to the enzymatic ring closure reaction.
[0110] In the present invention, a linker L1 is used to separate 1) a DNA coding sequence, 2) an A-terminal molecule A, and 3) a synthetic block. and B-terminal molecules B. The amino acid residue structure of the B-terminal molecule B completes ring closure in the presence of cyclooxygenase. This led to milder ring closure conditions and greater universality, and Expand the chemical reaction types and diversity of the compound library.
[0111] The present invention provides a method for constructing a library of cyclic compounds, wherein the cyclic structure The number and type of atoms provided by each building block can be variably adjusted, and each The building blocks can be spliced together using amide bonds (-CO-NH-) to form a circular structure. The ring structure provides many hydrogen bonding possibilities, which facilitates the binding of the ring structure to the protein. can contribute to improving it.
[0112] The present invention provides a method using photocleavage under mild reaction conditions, which is advantageous over other harsh methods. Detrimental effects on the stability of DNA coding sequences caused by the elimination of solid-phase synthesis under conditions Targeted avoidance.
[0113] The present invention provides a method for synthesizing DNA-encoded compounds using solid support-supported DNA-encoded compounds. The post-reaction purification procedure is simple and usually requires only a few simple filtration and washing steps. The post-treatment, separation and purification steps of each reaction step are simplified, and As a result, the synthesis cycle time for DNA-encoded compound libraries has been significantly reduced. This allows for significant cost reductions.
[0114] In the compound library synthesis method of the present invention, a linker bonded to the compound library side After linking the DNA coding sequence to the linker, the DNA coding sequence is linked to the starting nucleotide The synthetic ratio of molecular HP and docking compound was approximately 1:250, which significantly reduced the DNA administration ratio. , can save costs.
[0115] In the compound library synthesis method of the present invention, the steps corresponding to the splicing of DNA tags are The remaining 249 copies of unspliced DNA must be removed, and then the protecting groups must be removed. One of the doubly activated functional groups of the building block is attached to the corresponding DNA tag. The building blocks must be bonded by alternating reactions. It is possible to block the reactive sites of the unbound DNA compound library and remove excess DNA. It promotes removal, reduces interference, and exerts purification effect, improving the efficiency, uniqueness and final DNA coding. Improve product purity.
[0116] The present invention also provides a linker having at least five functional groups, which is a compound selected from the above three technical solutions. A method for constructing a library of bicyclic structure compounds by using a linker L1 of the determination means wherein one functional group of the linker L1 directly or indirectly connects the DNA coding sequence to the The other four functional groups of the linker L1 are used to connect the two closed ring A-terminal molecules A, Before linking A and the two closed-ring B-terminal molecules B and B', respectively, the linkage with the building blocks is dried. It is used to pass or not pass cyclooxygenase. Two ring-closure reactions were carried out in the presence of cyclooxygenase 1 and cyclooxygenase 2 to generate two pairs of ring-closed A-terminal molecules, A and the closed B-terminal molecule B, the A-terminal molecule A', and the closed B-terminal molecule B' are ring-closed to form a bicyclic compound. Got a library.
[0117] The relationship between cyclooxygenase and the closed A and B termini is as follows: When the oxygenase is OaAEP1B&3-5, the A terminus may be selected from: NFL, NAL, NG L, NHL, DFL, DAL, DGL, DHL; the B terminus may be selected from: GL (Gly-Leu-), LL (Leu-Leu-), u-), QL (Gln-Leu-), KL (Lys-Leu-), GF (Gly-Phe); cyclooxy When the enzyme is VyPAL2, the A terminus is selected from NSL and the B terminus is selected from Gl; If the hydroxygenase is Butelase 1, the A-terminus is selected from NHV and the B-terminus is selected from Gl. When the cyclooxygenase is PatG, the A-terminus is selected from FAGDDAE; When the cyclooxygenase is ominiligase-1, the A-terminus is selected from OCam-Leu and OCam- When the cyclooxygenase is PCY1, the A terminus is selected from FQA and IQT, and the B terminus is FSA, VGAG. Specifically, in the above three technical solutions, step f2 Or f3 is carried out two more times to form a closed circular A-terminated molecule A and a closed primer CP before reacting with the closed primer CP. The ring B terminal molecules B are bonded to each other.
[0118] Taking the first technical solution as an example, the method for constructing a bicyclic compound library can be as follows: It is composed as follows: said linker L1 being at least a pentafunctional linker; After step e1, the following steps are performed: e1-1. The product obtained in step e1 is reacted with the closed-ring B-terminal molecule B, and the closed-ring B-terminal molecule B is C n to, tag B Tag n to be combined with; e1-2. The product obtained in the previous step is used as building block C n+1 ,·····,C n+m and The corresponding DNA tags n+1 ,·····,tag n+m and follow the expansion steps described. Then, the compound C is reacted in sequence. n+1 to L1, and the DNA tag n+1 Tag B GMAL 1(-HP-OP-tag1-······-tag n+m )(-C1-······-C n -B)-C n+1 -C n+m get; e1-3. The product obtained in the previous step is reacted with the cyclic A-terminal molecule A' to form the cyclic A-terminal molecule A' C n+m to, tag A' combine with tagn+m; e1-4. The product obtained in the previous step is used as building block C n+m+1 ,·····,C n+m+x oh and their corresponding DNA tags n+m+1 ,·····,tag n+m+x and the extended stage The reaction proceeds in sequence according to the steps to form building block C. n+1 to L1, and the DNA tag n+m+1 Tag A' Combined with GM-A1-L1(-HP-OP-tag1-·······-tag n+m+x )(-C1-······-C n -B)-(C n+1 · -Cn+m -A')-C n+m+1 -C n+m+x get; e1-5. The product obtained in the previous step is reacted with the closed ring B terminal molecule B' and tagB' to form the closed ring B Terminal molecule B' to C n+m+x to, tag B' Tag n+m+x to be combined with; e1-6. The product obtained in the previous step is reacted with the closing primer CP to form the closing primer merCP is attached to tagB', where HP-OP-tag1-...-tag n -tag B -tag n+1 - -tag n+m -tag A' -tag n+m+1 -···-tag n+m+x -tag B' -CP forms the complete DNA coding sequence, GMA-L1(-DNA)(-C1·····································−C n -B)(-C n+1 -C n+m -A')-C n+m+1 ... -C n+m+x --get B'; e1-7. The product obtained in the previous step is decomposed under a light source to cleave M from A, and AL 1(-DNA)(-C1····Cn-B)(-C n+1 C n+m -A')-C n+m+1 -C n+m+x -B', where 0≦n≦7, 0≦m≦7, n, m, and x are integers, and 2≦n+m+x≦7. ru; e1-8. The product obtained in the previous step is subjected to a ring-closure reaction in the presence of cyclooxygenase 1. and reacting the ring-closed A-end molecule A with the ring-closed B-end molecule B to form a ring, [ka] get. e1-9. The product obtained in the previous step is subjected to a ring-closure reaction in the presence of cyclooxygenase 2. and reacting two pairs of ring-closed A-terminal molecules A' and ring-closed B-terminal molecules B' to form rings, [ka] , i.e., a bicyclic compound library is obtained.
[0119] Taking the second technical solution as an example, the method for constructing a bicyclic compound library is as follows: It is composed as follows: said linker L1 being at least a pentafunctional linker; After step e2, perform the following steps: e2-2. The product obtained in step e2 is fused to the DNA tag tag corresponding to the A-terminus of the closed-ring molecule. A and tagn to be combined with; e2-2. The product obtained in step e2-1 is reacted with a closed-ring B-terminal molecule B to form a closed-ring B-terminal molecule. Child B is C n+m , is bound to tagB at the position of the corresponding DNA tag tag, and tag B -tag n+m - ····tag1-OP-HP-GM-L1(-C1································ n -A)-C n+1 -C n+m Get -B. e2-3. The product obtained in the previous step is used as building block C n+m+1 ,·····,C n+m+x oh and the corresponding DNA tag n+m+1 ,·····,tag n+m+x and follow the expansion steps described. Then, the compound C is reacted in sequence. n+m+1 to L1, and the DNA tag n+m+1is bound to tagB, and tag n+m+x -············tag1-OP-HP-GM-L1(-C1·························································−tag1-OP-HP-GM-L1(-C1··································−C n -A)(-C n+1 -C n+ m -B)-C n+m+1 -C n+m+x get; e2-4. The product obtained in the previous step is reacted with the cyclic A-terminal molecule A' to form the cyclic A-terminal molecule A' C n+m+x , tag at the corresponding DNA tag position A' Combine; e2-5. The product obtained in the previous step is used as building block C n+m+x+1 ,·····,C n+m+x +y and their corresponding DNA tags n+m+x+1 ,·····,tag n+m+x+y It is stated that The reaction proceeds in the following expansion steps to form building block C. n+m+x+1 to L1, and the DNA tag n+m+x+ Tag 1 A' Bind to tag n+m+x+y -············tag1-OP-HP-GM-L1(-C1·························································−tag1-OP-HP-GM-L1(-C1··································−C n -A)(-C n+1 -C n+m -B)(-C n+m+1 -C n+m+x -A')-C n+m+x+1 ... C n+m+x+y get; e2-6. The product obtained in the previous step is divided into a closed-ring B-terminal molecule B and a DNA tag tag B' React with Closed ring B terminal molecule B' to C n+m+x+y Then, tagB' to tag n+m+x+y to be combined with; e1-7. The product obtained in the previous step is reacted with the closing primer CP to form the closing primer HP-OP-tag1-...-tag B' is attached to the CP. n+m+x+y -tagB'-CP The entire DNA coding sequence was formed, and DNA-GM-L1(-C1·····-C n -A)(-C n+1 ·····- C n+m -B)(-C n+m+1 -C n+m+x -A')-C n+m+x+1 -C n+m+x+y -B' is obtained. where 0≦n≦7, 0≦m≦7, 0≦x≦7, 0≦y≦7, n, m, x, and y are integers, and 2≦n+m+x+ y ≤ 7; e2-8. The product obtained in the previous step is subjected to a ring-closure reaction in the presence of cyclooxygenase 1. and reacting the ring-closed A-end molecule A with the ring-closed B-end molecule B to form a ring, [ka] get; e2-9. The product obtained in the previous step is subjected to a ring-closure reaction in the presence of cyclooxygenase 2. and reacting the ring-closed A-terminal molecule A' with the ring-closed B-terminal molecule B' to form a ring; [ka] , i.e., a bicyclic compound library is obtained.
[0120] Taking the third technical solution as an example, the method for constructing a bicyclic compound library can be as follows: It is composed as follows: said linker L1 being at least a hexafunctional linker; After step e3, perform the following steps: e3-1. The product obtained in step e3 is fused to the DNA tag tag corresponding to the A-terminus of the closed-ring molecule. A and tagn to be combined with; e3-2. The product obtained in step e3-1 is reacted with a ring-closed B-terminal molecule B to form a ring-closed B-terminal molecule B to C n+m Tag B is then attached to the corresponding DNA tag to form GM-L1(-HP-OP-tag1... -tag n+m -tag B )(-C1·····-C n -A)-C n+1 -C n+m Get -B. e3-3. The product obtained in the previous step is used as building block C n+m+1 ,·····,C n+m+x oh and their corresponding DNA tags n+m+1 ,·····,tag n+m+x and the extended stage The reaction proceeds in sequence according to the steps to form building block C. n+m+1 to L1, and the DNA tag n+m+1 Tag B Combined into GM-L1(-HP-OP-tag1...-tag n+m+x )(-C1·····-C n -A)(-C n+1 ... ···C n+m -B)-C n+m+1 -C n+m+x get; e3-4. The product obtained in the previous step is reacted with the cyclic A-terminal molecule A' to form the cyclic A-terminal molecule A' C n+m+x , and tagA' is attached to the corresponding DNA tag position; e3-5. The product obtained in the previous step is used as building block C n+m+x+1 ,·····,C n+m+ x+y and their corresponding DNA tagsn+m+x+1 ,·····,tag n+m+x+y It is stated that The reaction proceeds in the following expansion steps to form building block C. n+m+x+1 to L1, and the DNA tag n+m+x+ 1 was bound to tagA', and GM-L1(-HP-OP-tag1-tag n+m+x+y )(-C1·····-C n -A)(-C n+1 -C n+m -B)(-C n+m+1 -C n+m+x -A')-C n+m+x+1 ... -C n+m+x+y get; e3-6. The product obtained in the previous step is converted into a closed B-terminal molecule B' and a DNA tag tag B' and close Chain B end molecule B' is C n+m+x+y , DNA tag B' Tag n+m+x+y to be combined with; e3-7. The product obtained in the previous step is reacted with the closing primer CP to form the closing primer Tag Mar CP B' where HP-OP-tag1-tag n+m+x+y -tag B' -Complete with CP The entire DNA coding sequence was formed, and GM-L1(-DNA)(-C1-C n -A)(-C n+1 ... -C n+m -B)(-C n+m+1 -C n+m+x -A')-C n+m+x+1 -C n+m+x+y -Get B' where 0≦n≦7, 0≦m≦7, 0≦x≦7, 0≦y≦7, n, m, x, and y are integers, and 2≦n+m+x +y ≤ 7; e3-8. The product obtained in the previous step is subjected to a ring-closure reaction in the presence of cyclooxygenase 1. and the ring-closed A-end molecule A1 reacts with the ring-closed B-end molecule B1 to form a ring; [ka] get. e3-9. The product obtained in the previous step is subjected to a ring-closure reaction in the presence of cyclooxygenase 2. and reacting the ring-closed A-terminal molecule A2 with the ring-closed B-terminal molecule B2 to form a ring, [ka] , i.e., a bicyclic compound library is obtained.
[0121] In a preferred embodiment, the at least pentafunctional linker L1 comprises three trifunctional linkers. It is obtained by splicing.
[0122] In a preferred embodiment, at least the pentafunctional linker L1 is a tetrafunctional linker and and one trifunctional linker.
[0123] The present invention also provides a cyclic compound having the following structural formula, obtained by the construction of the above-mentioned method: Provide a library: [ka] where 2≦n≦7 and n is a positive integer; L1 is at least a trifunctional linker, and the DNA coding sequence is linked to L1, and L1 and the DNA coding sequence are linked to each other. The C1 to Cn sequences are linked by amide bonds; C1 to Cn have sequentially attached doubly activated functional groups. A represents a closed-ring A-terminal molecule and is an amino acid residue; B represents a closed-ring B-terminal molecule. L1 and A are linked by an amide or ester bond. Building block C n is linked to B by an amide or ester bond; A and B forms a peptide bond in the presence of cyclooxygenase to form a ring.
[0124] The present invention also provides a second library of cyclic compounds obtained by constructing the aforementioned method. and having the following structural formula: [ka] where 0≦n≦7, 0≦m≦7, n and m are integers, and 2≦n+m≦7; L1 is at least a trifunctional linker molecule having a DNA coding sequence attached to a solid support G. G is linked to the DNA coding sequence by an amide bond; C1 to C n The first and last C is a building block having a highly activated functional group. n+1 ~C n+m The first and last are double-active. G is a solid support, and M is a molecule with a photocleavable group. A indicates the closed-ring A-terminal molecule and amino acid residue; B indicates the closed-ring B-terminal molecule and amino acid residue. ; Building block C n and A are bonded by an amide bond or an ester bond; building block C n+m is linked to B by an amide or ester bond; A and B are cyclooxygenase In the presence of , a peptide bond is formed to form a ring.
[0125] The present invention also provides a third cyclic compound library obtained by the above-described method, It has the following structural formula: [ka] where 0≦n≦7, 0≦m≦7, n and m are integers, and 2≦n+m≦7; L1 is at least a tetrafunctional linker, the DNA coding sequence is linked to L1, and L1 is linked to the DNA coding sequence by an amide bond; C1-C n are sequentially bonded double active C is a building block having a functionalizing group. n+1 ~C n+m is a doubly activated functional group bonded in turn G represents a solid support, and M represents a molecule containing a photocleavable group; indicates a closed ring A-terminal molecule that is an amino acid residue; B indicates a closed ring B-terminal molecule that is an amino acid residue. Building block C n is linked to A by an amide or ester bond; synthesis Block C n+m is linked to B by an amide or ester bond; A and B are In the presence of cyclooxygenase, a peptide bond is formed to form a ring.
[0126] The present invention also provides a fourth cyclic compound library obtained by the above-described method, It has the following structural formula: [ka] where 0≦n≦7, 0≦m≦7, n and m are integers, and 2≦n+m≦7; L1 is at least a tetrafunctional linker, the DNA coding sequence is linked to L1, and L1 is linked to the DNA coding sequence by an amide bond; C1-C n are doubles that are concatenated in order. C is a building block having an activated functional group. n+1 ~C n+m are sequentially combined double activations G is a building block having a functional group; G represents a solid support, and M represents a molecule containing a photocleavable group. A represents a closed ring A-terminal molecule that is an amino acid residue; B represents a closed ring B-terminal molecule that is an amino acid residue Building block C n is linked to A by an amide or ester bond ; Building block C n+m is linked to B by an amide or ester bond; A and A and B form a peptide bond in the presence of cyclooxygenase to form a ring.
[0127] The present invention also provides a bicyclic compound having the following structural formula, obtained by the construction of the above-mentioned method: It also provides a first library of things: [ka] where 0≦n≦7, 0≦m≦7, 0≦x≦7, n, m, and x are integers, and 2≦n+m+x≦7; L1 is at least a pentafunctional linker, the DNA coding sequence is linked to L1, and L1 is linked to the DNA coding sequence by an amide bond; C1-C n are doubles that are concatenated in order. C is a building block having an activated functional group. n+1 ~C n+m are sequentially combined double activations C is a building block having a functional group. n+m+1 ~C n+m+x are sequentially combined double activations A and B are building blocks having functional groups; A and B are each one type of cyclooxygen. represents the closed A- and B-terminal molecules that undergo circular closure in the presence of ribozyme, and A' and B' represent The cyclized A-terminal molecules and the cyclized A-terminal molecules undergo cyclization in the presence of different types of cyclooxygenase, respectively. and B-terminal molecules, where A, B, A', and B' are all amino acid residues; QC n is linked to B by an amide or ester bond; building block C n+m is bonded to A by an amide or ester bond; A and B and A' and B' are cyclic In the presence of hydroxygenase, a peptide bond is formed between the two to form a bicyclic structure.
[0128] The present invention also provides a bicyclic compound having the following structural formula, obtained by the construction of the above-mentioned method: It also provides a second library of things: [ka] where 0≦n≦7, 0≦m≦7, 0≦x≦7, 0≦y≦7, n, m, x, and y are integers, and 2≦n+m+x +y ≤ 7; L1 is at least a pentafunctional linker, and the DNA coding sequence is attached to a solid support G. G is linked to the DNA coding sequence by an amide bond; C1-C n are concatenated in order C is a building block with dual activated functional groups. n+1 ~C n+m is a double active compound that is bonded in order. C is a building block having a functionalizing group. n+m+1 ~C n+m+x are sequentially combined double activations C is a building block having a functional group. n+m+x+1 ~C n+m+x+y are sequentially combined double activations A and B are building blocks having functional groups; A and B are each one type of cyclooxygen. represents the closed A- and B-terminal molecules that undergo circular closure in the presence of ribozyme, and A' and B' represent The cyclized A-terminal molecules and the cyclized A-terminal molecules undergo cyclization in the presence of different types of cyclooxygenase, respectively. and B-terminal molecules, where A, B, A', and B' are all amino acid residues; QC n is linked to A by an amide or ester bond; building block C n+m is linked to B by an amide or ester bond; building block C n+m+x Haa linked to A' by an amide or ester bond; building block C n+m+x+y Ami A and B and A' and B' are connected by a cyclohexyl or ester bond; In the presence of hydroxygenase, a peptide bond is formed between the two to form a bicyclic structure.
[0129] The present invention also provides a bicyclic compound having the following structural formula, obtained by the construction of the above-mentioned method: It also provides a third library of things: [ka] where 0≦n≦7, 0≦m≦7, 0≦x≦7, 0≦y≦7, n, m, x, and y are integers, and 2≦n+ m+x+y≦7; L1 is at least a hexafunctional linker, the DNA coding sequence is linked to L1, and L1 is linked to the DNA coding sequence by an amide bond; C1-C n are doubles that are concatenated in order. C is a building block having an activated functional group. n+1 ~C n+m are sequentially combined double activations C is a building block having a functional group. n+m+1 ~C n+m+x are doubly activated functionalities that are bonded in turn. a building block having a C group; n+m+x+1 ~C n+m+x+y are doubly activated functionalities that are bonded in turn. G is a building block having a group; G represents a solid support, and M represents a molecule containing a photocleavable group; A and B are each a ring-closing A that undergoes ring closure in the presence of one type of cyclooxygenase. A' and B' represent different types of cyclooxygen. The cyclized A- and B-terminal molecules undergo cyclization in the presence of phosphodiesterase, and the A, B, A', and B' are both amino acid residues; building block C n is an amide or ester bond is connected to A by building block C n+m is connected by an amide bond or an ester bond. and linked to B; building block C n+m+x A' is formed by an amide bond or an ester bond. is bonded to building block C n+m+x+y is connected to B' by an amide bond or an ester bond A and B and A' and B' are bonded by peptide bonds in the presence of cyclooxygenase. bond with each other to form a bicyclic structure.
[0130] The present invention also provides a bicyclic compound having the following structural formula, obtained by the construction of the above-mentioned method: It also provides a fourth library of things: [ka] where 0≦n≦7, 0≦m≦7, 0≦x≦7, 0≦y≦7, n, m, x, and y are integers, and 2≦n+ m+x+y≦7; L1 is at least a hexafunctional linker, the DNA coding sequence is linked to L1, and L1 is linked to the DNA coding sequence by an amide bond; C1-C n are doubles that are concatenated in order. C is a building block having an activated functional group. n+1 ~C n+m are sequentially combined double activations C is a building block having a functional group. n+m+1 ~Cn+m+x are doubly activated functionalities that are bonded in turn. a building block having a C group; n+m+x+1 ~C n+m+x+y are doubly activated functionalities that are bonded in turn. A and B are building blocks having one type of cyclooxygen group; A' and B' denote the closed A-terminal and B-terminal molecules that undergo circular closure in the presence of an enzyme. The cyclized A-terminal molecules and B-terminal molecules undergo cyclization in the presence of different types of cyclooxygenases. A, B, A' and B' are all amino acid residues; building block C n teeth , linked to A by an amide bond or an ester bond; building block C n+m Ami is bonded to B by a bond or an ester bond; building block C n+m+x is an amide bond A' is bonded to building block C by a bond or ester bond; n+m+x+y is an amide bond or by an ester bond to B'; A and B and A' and B' are cyclooxygen In the presence of enzymes, they form peptide bonds to form a bicyclic structure. The fourth library of compounds can be prepared by cleaving a molecule M containing a photocleavable group under a light source. The bicyclic structure compounds can be obtained from the third library.
[0131] Specifically, each of the building blocks (C1, . . . , C n , C n+1 ,...,C n +m , C n+m+1 ,...,C n+m+x , C n+m+x+1 ,...,C n+m+x+y ),teeth each independently a substituted or unsubstituted amino acid, a substituted or unsubstituted dicarboxylic acid, a substituted substituted or unsubstituted diamines, substituted or unsubstituted diols, α,β-unsaturated aldehydes, α,β-unsaturated ketones, α,β-unsaturated acids, natural amino acids or unnatural amino acids. can be.
[0132] Specifically, at least one of the building blocks is a backbone. The backbone structure has an E3 ligase substrate structure that binds to the E3 ligase. The backbone structure is attached to the ring either within the ring or in the form of a side chain of the ring. is doing.
[0133] Specific backbone structures are selected from the following: [ka]
[0134] Specifically, among each of said synthetic building blocks, each synthetic building block comprises, in total, at least The cyclic outer chain provides a greater variety of library compounds, At the same time, several functional modifications similar to lipidation can be performed on the branched chains. Based on the molecule's own membrane permeability, it is also possible to further enhance the membrane permeability and osmotic properties of the molecule. This will lead to an expansion of the diversity of the compound library.
[0135] Specifically, in each of the building blocks, each building block contains a total of at least two It comprises a cyclic outer chain, and at least two cyclic outer chains are joined by a chemical reaction to form a bicycle. The bicyclic or polycyclic structure stabilizes the conformation of the macrocycle and and increasing the rigidity of the cyclic structure molecule, thereby increasing the stability of the cyclic structure molecule and extending the half-life of the cyclic structure molecule drug. can be done.
[0136] The compound library of the present invention provides a cyclic compound library, This will increase the diversity of the DNA and expand its application to new drug screening.
[0137] The compound library of the present invention has a wide variety of ring structure atoms and types using different building blocks. This allows for a wide variety of compound libraries to be created.
[0138] In the compound library of the present invention, an amide bond (-CO-NH-) is It can be used for block splicing, and the hydrogen bonding of the ring structure offers many possibilities. This can also contribute to improving the binding strength of the ring structure to proteins.
[0139] The building blocks on the rings of the cyclic compound libraries of the present invention are similar to E3 ligase substrate structures. This allows for the inclusion of various backbone structures, increasing the application of compound libraries in PROTACs. To make. [Example]
[0140] The following clearly and completely describes the technical solutions of the present invention, and the described embodiments are not intended to be limiting of the present invention. It is clear that the present invention is only a part of the embodiments and not all of the embodiments. Based on the embodiment, all other embodiments that a person skilled in the art can obtain without creative effort. The embodiments fall within the scope of protection of the present invention.
[0141] In the reaction roadmap for each embodiment below: [ka] indicates a solid support (PEGA resin), and the others [ka] indicates a building block. [ka] The letters L, N, A, I, E, P, etc. are one-letter abbreviations of amino acids, e.g., L is leucine (Leu), N represents aspartic acid (Asn), A represents alanine (Ala), and I represents isoform. indicates leucine (Ile), E indicates glutamic acid (Glu), and P indicates proline (Pro). [ka] indicates that the building block is leucine, and other one-letter abbreviations are used in the art. The amino acid sequence is interpreted as the usual one-letter amino acid abbreviation. [ka] The letters AA1, ..., and AA4 in the formula indicate that the building blocks are amino acids. They are distinguished only by serial numbers such as 1...4. [ka] Letters C1, ..., C in n , C n+1 ,...,C n+m All of the synthetic blocks are Indicates that the compound is one of the types of compound blocks covered by the application, and serial number 1... They are distinguished only by n, n+1, and n+m. Photo linker indicates a photocleavable group. Ahx stands for 6-aminohexanoic acid.
[0142] Example 1: Synthesis of a cyclic compound library [ka] [ka] [ka]
[0143] Step 1. Amino-modified PEGA resin (1 g, 0.5 mmol / g) was dissolved in N,N-dimethylformamide for 1 h. Dissolve and add 10% N,N-diisopropylethylamine, N,N-dimethylformamide The resin was washed with 10 mL of N,N-dimethylformamide and drained. Acetic anhydride (26 mg, 0.25 mmol) and N,N-diisopropylethylamine (129 mg, 1 mmol) were added. The resin was stirred at room temperature for 30 minutes. (3×3 mL) and N,N-dimethylformamide (3×5 mL), respectively, and then drained. was dissolved in N,N-dimethylformamide (5 mL), and Fmoc-ε-Amx-OH (397 mg, 4.5 eq), HOAt( Add 153mg, 4.5eq), HATU (428mg, 4.5eq), and DIEA (323mg, 10eq) and stir at room temperature for 2 hours. The resin was dissolved in N,N-dimethylformamide (3 x 3 mL), dichloromethane (3 x 3 mL), N,N-dimethylformamide (3 x 3 mL), The mixture was washed with ethylformamide (3 x 5 mL) and drained to give 1 g of resin. Step 2. Add 10 mL of 20% piperidine in N,N-dimethylformamide to 1 g of resin. The resin was stirred at room temperature for 1 hour. Wash with 100 mL of dimethylformamide (3 × 3 mL) and 100 mL of N,N-dimethylformamide (3 × 5 mL), drain, and add 980 mg of A resin was obtained. Step 3. Mix DIC (126 mg, 4 eq), HOBt (135 mg, 4 eq) and the photocleavable group molecule M (225 mg , 3 eq) in N,N-dimethylformamide (5 mL) and stirred for 3 minutes, and then the well-dissolved resin 980 mg was added and the mixture was stirred at room temperature for 2 hours. Wash with dimethylmethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL), and drain to obtain 1 g of resin. Got it. Step 4. Add DIC (126 mg, 4 eq), HOBt (135 mg, 4 eq), DMAP (15 mg, 0.5 eq) and Fmoc-protected tetrahydrofuran. The tripeptide (225 mg, 3 eq) was stirred in 10 mL of N,N-dimethylformamide for 10 minutes, and then 1 g of the dissolved resin was added, and the mixture was stirred at room temperature for 16 hours. × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), After draining, 1 g of resin was obtained. Step 5. Refer to the Fmoc removal method in Step 2 and condense the compound according to the condensation conditions in Step 3. Product 18 was used to obtain 950 mg of resin. Step 6. Add 950 mg of resin to 25 ml of 95% aqueous trifluoroacetic acid and react at room temperature for 2 hours. The resin was reacted with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N, Wash with N-dimethylformamide (3 x 5 mL), drain, and add 25 mL of the resulting resin. The resin was added to a 20% DIEA solution in N,N-dimethylformamide and stirred at room temperature for 2 hours. -Dimethylformamide (3 x 3 mL), dichloromethane (3 x 3 mL), N,N-dimethylformamide After washing with 3×5 mL of ethanol and draining, 900 mg of resin was obtained. Step 7. Dissolve DIC (40 mg, 5 eq) and NHS (36 mg, 5 eq) in 5 mL of N,N-dimethylformamide. The solution was added to 250 mg of resin and reacted at room temperature for 2 hours. (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL). The resin was dissolved in 4 mL of HEPES (100 mM) buffer at pH 8.0 and eluted with 250 nmol of HDNA. lmM) was added and the reaction was allowed to proceed at room temperature overnight to obtain 240 mg of resin. Step 8. Add 10 mL of 20% piperidine in N,N-dimethylformamide to 240 mg of resin. The resin was washed with N,N-dimethylformamide (3 x 5 mL), water (3 x 5 mL), and stirred at room temperature for 1 hour. Each tube was washed and drained. 3. Add 400 μL of water, 400 μL of 10× T4 DNA ligase buffer, 8 1 μL of T4 DNA ligase (40 U / μL), 175 μL of OP(AAATCGATGTG) (300 nM, 1.74 nM / μL) to the resin After adding the ligase and reacting overnight at room temperature, the resin was dissolved in water (3 × 10 mL), T4 DNA ligase buffer (3 × The resin was washed with 3 mL of water and drained to obtain 230 mg of resin. 0 μL 10× T4 DNA ligase buffer, 8 μL T4 DNA ligase (40 U / μL), 294 μL DNAta g1(ATCTGACA) (300 nm, 1.7 nm / μL) was added and reacted at room temperature overnight. The resin was then ligated with T4 DNA ligase. ase buffer (3 × 3 mL), water (3 × 10 mL), and N,N-dimethylformamide (3 × 10 mL), respectively. After washing and draining, the mixture was diluted with DIC (40 mg, 5 eq), HOBt (42 mg, 5 eq), and amino acid AA1 (110 mg, 5 eq). ) was stirred in N,N-dimethylformamide (5 mL) for 10 minutes, and then 230 mg of the well-dissolved resin was added. The resin was washed with N,N-dimethylformamide (3×3 mL), dichloromethane (2×10 mL), and hexane (1×10 mL). Wash with chloromethane (3 x 3 mL) and N,N-dimethylformamide (3 x 5 mL), then drain. 5 mL of a 20% solution of piperidine in N,N-dimethylformamide was added to the resin, and the mixture was stirred at room temperature for 1 hour. The resin was dissolved in N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), N, Washing with N-dimethylformamide (3 x 5 mL) and draining gave 220 mg of resin. . GTTACACGT Step 9. DNA tag 2 (GTTACACGT) and amino acid AA2 are prepared by following the procedure in Step 9. Resin of 1000 kJ / g was obtained. Step 10. DNA tag 3 (CTGTAACGA) and amino acid AA3 are combined using the procedure in Step 9 to create a 200mM DNA tag. g of resin was obtained. Step 11. DNA tag 4 (TTCGAACTT) and amino acid AA4 are synthesized by the procedure in step 9. g of resin was obtained. Step 12. Mix DIC (40 mg, 5 eq), HOBt (42 mg, 5 eq) and Fmoc-protected dipeptide (128 mg, 5 eq) was stirred in 5 ml of N,N-dimethylformamide for 10 minutes, and 190 mg of well-dissolved resin was added. The mixture was stirred at room temperature for 2 hours. The resin was then washed with N,N-dimethylformamide (3 x 3 mL), dichloromethane, and hexane. Wash with chloromethane (3 x 3 mL) and N,N-dimethylformamide (3 x 5 mL), then drain. After the resin was cooled, 5 mL of a 20% solution of piperidine in N,N-dimethylformamide was added to the resin and the mixture was left at room temperature for 1 hour. The resin was stirred for 1 hour. The resin was dissolved in N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), Wash with N,N-dimethylformamide (3 x 5 mL) and drain to give 185 mg of resin. Ta. Step 13. Add 185 mg of resin to 3400 μL of water, 400 μL of 10x T4 DNA Ligase Buffer, and 8 1 μL of T4 DNA ligase (40 U / μL), 175 μL of CP(TAGCCTATTGTCAGACAAGCTTCACCTGC) (300 nM, 1 After adding 0.74 nm / μL and reacting overnight at room temperature, the resin was dissolved in water (3 × 10 mL) and T4 DNA ligase. The resin was washed with buffer (3×3 mL) and drained to give 180 mg of resin. Step 14. Add 1 mL of N-methylpyrrolidone to 180 mg of resin and irradiate with 365 nm UV light for 5 hours. Afterwards, the resin was filtered and freeze-dried by solvent dialysis to give 5 mg of compound 16. Step 15. Dissolve 2 mg of compound 16 in 800 μl of water and add 100 μl of sodium acetate (pH = 5.0 , 0.5M), 2 μl of sodium chloride solution (0.25M), 20 μl of ethylenediaminetetraacetic acid disodium sodium solution (0.05 M), 10 μl of TCEP solution (0.05 M), 60 μl of cyclization enzyme OaAEP3 (1.34 mg / mL) were added to each other, and the mixture was reacted overnight at 37°C to obtain 1.2 mg of product after preparation.
[0144] In this embodiment, linker compound 18 was synthesized as follows. [ka] Step 1. Compound Fmoc-Asp(Alloc)-OH (750 mg, 1.83 mmol), NH-PEG-CH-CH-COO t Bu(588 mg, 1.83 mmol) and DIPEA (472 mg, 3.66 mmol) were dissolved in 10 ml of N,N-dimethylformamide. HATU (836 mg, 2.2 mmol) was added at 0°C, and the mixture was stirred at room temperature for 2 hours. The mixture was then quenched with water and diluted with 10 ml of Ethyl acetate was added and the aqueous phase was extracted three times with ethyl acetate. The crude product was dried over sodium, filtered, and spun dry to give the crude product. The resulting mixture was passed through a column using 1.2 g of hexane as an eluent to give a colorless oil (1.2 g, 92.3%). Step 2. Compound 2 (1.2 g, 1.68 mmol) and Pd(PPh3)4 (97 mg, 0.084 mmol) were mixed in a tetrahydrofuran solution. Dissolved in 20 ml of phosphorus solution, phenylsilane (363 mg, 3.36 mmol) was added at 0°C under a nitrogen atmosphere. The mixture was stirred at room temperature for 1 hour. The mixture was then spun dry and loaded onto a column (6% methanol in dichloromethane). The resulting mixture was purified by passing it through a hexanes solution (eluent) to give a white solid (1 g, 88.5%). LCMS: 673.7 (M+H) + .
[0145] <Example 2: Verification of the enzymatic ring closure method> [ka] [ka]
[0146] Step 1. Dissolve DIC (40 mg, 5 eq) and NHS (36 mg, 5 eq) in 5 mL of N,N-dimethylformamide. The resulting solution was added to 250 mg of resin and reacted at room temperature for 2 hours. The resin was then diluted with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively. 5 mL of 20% piperidine N,N-dimethylformamide solution was added to the resin, and the mixture was stirred at room temperature. After stirring for 1 hour, N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), N The resin was washed with N-dimethylformamide (3×5 mL) and drained to give 240 mg of resin. Step 2: DIC (40 mg, 5 eq), HOBt (42 mg, 5 eq), and amino acid AA1 (110 mg, 5 eq) were added to the flask. After stirring in dimethylformamide (5 mL) for 10 minutes, 230 mg of well-dissolved resin was added. The mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3×3 mL), methylene chloride, and Wash with toluene (3 × 3 mL) and N,N-dimethylformamide (3 × 5 mL), drain, and 240 mg of resin was obtained. Step 3. 5 mL of 20% piperidine in N,N-dimethylformamide, DIC (40 mg, 5 eq), HOB The Fmoc deprotection in step 1 and the condensation procedure in step 2 were carried out using t (42 mg, 5 eq) and amino acid AA2 (142 mg, 5 eq). 235 mg of resin was obtained by referring to the procedure. Step 4. 5 mL of 20% piperidine in N,N-dimethylformamide, DIC (40 mg, 5 eq), HOB The Fmoc deprotection in step 1 and the condensation procedure in step 2 were carried out using t (42 mg, 5 eq) and amino acid AA3 (119 mg, 5 eq). 230 mg of resin was obtained by referring to the procedure. Step 5. 5 mL of 20% piperidine in N,N-dimethylformamide, DIC (40 mg, 5 eq), HOB The Fmoc deprotection in step 1 and the condensation procedure in step 2 were carried out using t (42 mg, 5 eq) and amino acid AA4 (105 mg, 5 eq). 220 mg of resin was obtained by referring to the procedure. Step 6. 5 mL of 20% piperidine solution of N,N-dicarboxamide, DIC (40 mg, 5 eq), HO Bt (42 mg, 5 eq) and dipeptide (128 mg, 5 eq) were used to carry out the de-Fmoc step in step 1 and the condensation step in step 2. By referring to the synthesis procedure, 215 mg of resin was obtained. Step 7. Add 1 mL of N-methylpyrrolidone to 215 mg of resin and irradiate with 365 nm UV light for 5 hours. Afterwards, the resin was filtered and freeze-dried by solvent dialysis to obtain 25 mg of compound 8. Step 8. Dissolve 0.3 mg of compound 8 in 800 μl of water and add 100 μl of sodium acetate buffer ( pH=5.0, 0.5M), 2 μl of sodium chloride solution (0.25M), 20 μl of ethylenediaminetetraacetic acid Disodium solution (0.05 M), 10 μl of TCEP solution (0.05 M), 30 μl of OaAEP3 (1.34 mg / mL) Each was added, and the mixture was reacted overnight at 37° C. to give cyclic compound 9. LCMS: 1154.72 (M+H) + .
[0147] <Example 3: Verification of Library Construction Method 3> [ka] [ka]
[0148] Synthesis method: 1. PEGA resin (100 mg, 25 μmol) was dissolved in 3 ml of N,N-dimethylformamide for 2 hours. Standard solid phase peptide synthesis procedures were followed to obtain 95 mg of resin. 2. 95 mg of resin was dissolved in 95% trifluoroacetic acid, 2.5% water, and 2.5% triisopropylsilane. The resin was stirred at room temperature for 2 hours. Formamide solution (3 mL) was added and stirred at room temperature for 2 hours. (3 × 3 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively. DIC (32 mg, 10 eq) and NHS (28 mg, 10 eq) were added to 3 ml of N,N-dimethylformamide. The resin was dissolved in N,N-dimethylformamide, added to the resin while stirring for 1 minute, and reacted at 37°C for 4 hours. N,N-dimethylformamide (3 × 2 mL), dichloromethane (3 × 2 mL), N,N-dimethylformamide ( 3 × 2 mL), drained, and dissolved in 3 mL of 100 mM HEPES buffer pH 8.0. A (100 nmol) was added to the resin and reacted at 37°C for 16 hours. Add 5 mL of N,N-dimethylformamide solution, stir at room temperature for 1 hour, and then add 1 mL of N,N-dimethylformamide ( Wash with dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL), After draining, 85 mg of resin was obtained. 3. For 85 mg of resin, add 2095 μL of water, 250 μL of 10x T4 DNA ligase buffer, and 25 μL of T4 DNA ligase. Add NA ligase (10,000 U / µL) and 58 µL of OP (AAATCGATGTG) (100 nM, 1.74 nM / µL) and incubate at room temperature. After overnight reaction, the resin was washed with water (3 x 5 mL) and T4 DNA ligase buffer (3 x 3 mL). The resin was then drained to obtain 75 mg of resin. 2095 μL of water and 250 μL of 10×T4 DNA ligase were added to the 75 mg of resin. Add 25 μL of enzyme buffer and 25 μL of T4 DNA ligase (10,000 U / μL), divide the mixture into 96 portions, and DNA tags (1.35 nm, 1 nm / μ) were added to the wells and reacted overnight at room temperature. The resin was then ligated with T4 DNA ligase. Wash with enzyme buffer (3 × 3 mL), water (3 × 3 mL), N,N-dimethylformamide (3 × 3 mL), and water DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) were dissolved in N,N-dimethylformamide (5 mL). The mixture was dissolved in 96 aliquots, and 5 eq of amino acid was added to each well of the resin. The mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 3 mL), and The resin was washed with ethylformamide (3 x 5 mL) and drained. 5 mL of dimethylformamide solution was added and stirred at room temperature for 1 hour. amide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL) After washing and draining, 70 mg of resin was obtained. Repeat this four times. After the fourth amino acid and DNA tag, the resin is combined and N,N-dimethylformamide is added. Wash with hexane (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively. After washing and draining, 70 mg of resin was obtained. 4. Dissolve DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (51 mg, 5 eq) in 5 mL of N,N-dichloromethane. After stirring in methylformamide for 2 minutes, 70 mg of resin was added, and the mixture was stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 3 mL), and The resin, palladium tetrakis(III), and the resulting mixture were washed with ethylformamide (3 x 5 mL) and drained. (2.89 mg, 0.2 eq) and phenylsilane (54.12 mg, 20 eq) in 5 ml of dichloromethane. The resin was stirred at room temperature for 1 hour under nitrogen protection. After washing with methyl amide (3 × 3 mL) and draining, 65 mg of the product was obtained by standard solid phase synthesis. A resin was obtained. 5. 65 mg of resin, palladium tetrakis (2.89 mg, 0.2 eq) and phenylsilane (54.12 mg 20 eq) was stirred in 5 mL of dichloromethane under nitrogen protection at room temperature for 1 hour. Wash with methane (3 × 3 mL) and N,N-dimethylformamide (3 × 3 mL), drain, and add 5 ml The resin was added to a 20% solution of piperidine in N,N-dimethylformamide and stirred at room temperature for 1 hour. N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide The resin was washed with methyl amide (3 x 5 mL) and drained to give 60 mg of resin. 6. For 60 mg of resin, add 2095 μL of water, 250 μL of 10x T4 DNA ligase buffer, and 25 μL of T4 DNA ligase. NA ligase (10,000 U / μL) and 57 μL of CP (100 nm, 1.74 nm / μL) were added and reacted at room temperature overnight. Afterwards, it was washed with T4 DNA ligase buffer (3 x 3 mL) and water (3 x 5 mL), and then drained. Dissolve the resin in 830 μL of water, add 100 μL of sodium acetate buffer (pH = 5.0, 0.5 M), 2 μL of Sodium chloride solution (0.25 M), 20 μL of disodium EDTA solution (0.05 M), 10 μL of TC EP aqueous solution (0.05 M) and 30 μL of OaAEP3 (1.34 mg / mL) were added, and the mixture was reacted at 37°C overnight. , a DNA-encoded cyclic peptide library was obtained.
[0149] Example 4: Construction of a library of different A-terminal cyclized molecules [ka] [ka]
[0150] Synthesis method: 1. 100 mg of resin 1 was synthesized by standard solid phase synthesis using the above synthesis method. Ta. 2. 90 mg of resin was added to 5 mL of 95% aqueous trifluoroacetic acid solution and reacted at room temperature for 2 hours. The oil was dissolved in N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethyl After washing with formamide (3 × 5 mL) and draining, the resulting resin was The resin was added to 5 mL of N,N-dimethylformamide solution containing 100% N,N-dimethylformamide, and stirred at room temperature for 2 hours. N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide ( 3×5 mL) and drained to give 85 mg of resin. 3. Dissolve DIC (16 mg, 5 eq) and NHS (15 mg, 5 eq) in 5 mL of N,N-dimethylformamide. The resulting solution was added to 85 mg of resin and reacted at room temperature for 2 hours. The resin was then diluted with N,N-dimethylformamide (3 × 3 ml). L), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), respectively. The resin was dissolved in 2 mL of HEPES (100 mM) buffer at pH 8.0, and the resulting solution was mixed with 100 nmol of HDNA. The resin was added with 20% piperidine N,N- 5 mL of dimethylformamide solution was added, and the mixture was stirred at room temperature for 1 hour. Wash with hexane (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL). After the water was removed, 75 mg of resin was obtained. 4. For 75 mg of resin, add 2095 μL of water, 250 μL of 10x T4 DNA ligase buffer, and 25 μL of T4 DNA ligase. Add NA ligase (10,000 U / µL) and 58 µL of OP (AAATCGATGTG) (100 nM, 1.74 nM / µL) and incubate at room temperature. After overnight reaction, the resin was washed with water (3 x 5 mL) and T4 DNA ligase buffer (3 x 3 mL). The resin was then drained to obtain 75 mg of resin. 2095 μL of water and 250 μL of 10×T4 DNA ligase were added to the 75 mg of resin. Add 25 μL of enzyme buffer and 25 μL of T4 DNA ligase (10,000 U / μL), divide the mixture into 96 portions, and DNA tags (1.35 nm, 1 nm / μ) were added to the wells and reacted overnight at room temperature. The resin was then ligated with T4 DNA ligase. Wash with enzyme buffer (3 × 3 mL), water (3 × 3 mL), N,N-dimethylformamide (3 × 3 mL), and water DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) were dissolved in N,N-dimethylformamide (5 mL). The mixture was dissolved in 96 aliquots, and Fmoc-amino acids (5 eq) were added to each well of the resin. The mixture was then incubated at room temperature for 1 hour. The resin was dissolved in N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), N, The resin was washed with N-dimethylformamide (3 x 5 mL) and drained. 5 mL of N,N-dimethylformamide solution containing the resin was added and stirred at room temperature for 1 hour. Formamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL) The resin was washed with 1 mL of PEG and drained to obtain 70 mg of resin. After completion, the resins were combined to give 65 mg of resin. 5. Dissolve DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (51 mg, 5 eq) in 5 mL of N,N-dimethylformamide. The resin was stirred in hexane for 2 minutes, and 65 mg of resin was added, followed by stirring at room temperature for 2 hours. Methylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × The resin was washed with dichloromethane (3 × 3 mL), N,N-dimethylformamide (1 mL), and then drained. Wash with 20% pyridine in N,N-dimethylformamide (3 × 3 mL), drain, and 5 mL of peridine solution was added to the resin and stirred at room temperature for 1 hour. (3×3 mL) and water (3×5 mL), respectively, and drained to give 60 mg of resin. 6. For 60 mg of resin, add 2095 μL of water, 250 μL of 10x T4 DNA ligase buffer, and 25 μL of T4 DNA ligase. NA ligase (10,000 U / μL) and 57 μL of CP (100 nm, 1.74 nm / μL) were added and reacted at room temperature overnight. Afterwards, the resin was washed with T4 DNA ligase buffer (3 x 3 mL), water (3 x 5 mL) and drained. 7. 1 mL of N-methylpyrrolidone was added to 55 mg of resin, and the resin was irradiated with 365 nm ultraviolet light for 5 hours. The oil was filtered, solvent dialysis and freeze-dried to obtain 5 mg of compound 8. 8. 5 mg of compound 8 was dissolved in 800 μl of water and 100 μl of sodium acetate buffer (pH = 5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate A mixture of 10 μl of 0.05 M TCEP solution, 10 μl of 0.05 M TCEP solution, and 60 μl of the cyclization enzyme OaAEP3 (1.34 mg / mL) was added. The mixture was incubated overnight at 37°C, and the aqueous phase was lyophilized to obtain 3 mg of DNA-encoded circular peptides. A library of peptides was obtained, in which, when the ring-closure reaction was carried out, the ring-closed A-terminal molecule was formed as the fragment -GL is peeled off from
[0151] Example 5: Construction of a library of different A-terminal cyclized molecules [ka] [ka]
[0152] Synthesis method: 1. 100 mg of resin was synthesized by standard solid phase synthesis using the above synthesis method. Ta. 2. 90 mg of the resin was added to 5 ml of 95% aqueous trifluoroacetic acid solution and reacted at room temperature for 2 hours. The resin was dissolved in N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethyl After washing with formamide (3 × 5 mL) and draining, the resulting resin was The resin was added to a 20% DIEA solution (5 mL) of dichloromethane and stirred at room temperature for 2 hours. N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL) and drained to obtain 85 mg of resin. 3. Dissolve DIC (16 mg, 5 eq) and NHS (15 mg, 5 eq) in 5 mL of N,N-dimethylformamide. The resin was added to the HCl solution and reacted at room temperature for 2 hours. The resin was then washed with N,N-dimethylformamide (3 × 3 mL), Wash with dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL), and drain. The resin was dissolved in 2 mL of pH 8.0 HEPES (100 mM) buffer and added with hDNA (100 nmol, 1 mM). The resin was then added to the reaction mixture and reacted overnight at room temperature to obtain 80 mg of resin. Add 5 mL of N,N-dimethylformamide solution, stir at room temperature for 1 hour, then add 3 mL of N,N-dimethylformamide (5 mL) Wash with dichloromethane (3 × 3 mL) and N,N-dimethylformamide (3 × 5 mL), then drain. As a result, 75 mg of resin was obtained. 4. For 75 mg of resin, add 2095 μL of water, 250 μL of 10x T4 DNA ligase buffer, and 25 μL of T4 DNA ligase. Add NA ligase (10,000 U / µL) and 58 µL of OP (AAATCGATGTG) (100 nM, 1.74 nM / µL) and incubate at room temperature. After overnight reaction, the resin was washed with water (3 x 5 mL) and T4 DNA ligase buffer (3 x 3 mL). The resin was then drained to obtain 75 mg of resin. 2095 μL of water and 250 μL of 10×T4 DNA ligase were added to the 75 mg of resin. Add 25 μL of enzyme buffer and 25 μL of T4 DNA ligase (10,000 U / μL), divide the mixture into 96 portions, and DNA tags (1.35 nm, 1 nm / μ) were added to the wells and reacted overnight at room temperature. The resin was then ligated with T4 DNA ligase. Wash with enzyme buffer (3 × 3 mL), water (3 × 3 mL), N,N-dimethylformamide (3 × 3 mL), and water DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) were dissolved in N,N-dimethylformamide (5 mL). The mixture was dissolved in 96 aliquots, and Fmoc-amino acids (5 eq) were added to each well of the resin. The mixture was then incubated at room temperature for 1 hour. The resin was dissolved in N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), N, The resin was washed with N-dimethylformamide (3 x 5 mL) and drained. 5 mL of N,N-dimethylformamide solution containing the resin was added and stirred at room temperature for 1 hour. Formamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL) The resin was washed with 1 mL of PEG and drained to obtain 70 mg of resin. After completion, the resins were combined to give 65 mg of resin. 5. Dissolve DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (51 mg, 5 eq) in 5 mL of N,N-dimethylformamide. The resin was stirred in hexane for 2 minutes, and 65 mg of resin was added, followed by stirring at room temperature for 2 hours. Methylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × The resin was washed with dichloromethane (3 × 3 mL), N,N-dimethylformamide (1 mL), and then drained. Wash with 20% pyridine in N,N-dimethylformamide (3 × 3 mL), drain, and 5 mL of peridine solution was added to the resin and stirred at room temperature for 1 hour. (3×3 mL) and water (3×5 mL), respectively, and drained to give 60 mg of resin. 6. For 60 mg of resin, add 2095 μL of water, 250 μL of 10x T4 DNA ligase buffer, and 25 μL of T4 DNA ligase. NA ligase (10,000 U / μL) and 57 μL of CP (100 nm, 1.74 nm / μL) were added and reacted at room temperature overnight. Afterwards, the resin was washed with T4 DNA ligase buffer (3 x 3 mL), water (3 x 5 mL) and drained. 7. 1 mL of N-methylpyrrolidone was added to 55 mg of resin, and the resin was irradiated with 365 nm ultraviolet light for 5 hours. The oil was filtered, solvent dialysis and freeze-dried to obtain 5 mg of compound 8. 8. 5 mg of compound 8 was dissolved in 800 μl of water and 100 μl of sodium acetate buffer (pH = 5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate A mixture of 10 μl of 0.05 M TCEP solution, 10 μl of 0.05 M TCEP solution, and 60 μl of the cyclization enzyme OaAEP3 (1.34 mg / mL) was added. The mixture was incubated overnight at 37°C, and the aqueous phase was lyophilized to obtain 3 mg of DNA-encoded circular peptides. A library of peptides was obtained, in which, when the ring-closure reaction was carried out, the ring-closed A-terminal molecule was fragment-FL. is peeled off from
[0153] Example 6: Construction of a library of different A-terminal cyclized molecules [ka] [ka]
[0154] Synthesis method: Referring to the library construction method in Example 4, 3 mg of DNA-encoded circular peptides were obtained from 100 mg of starting resin. A peptide library was obtained, where, when the ring-closure reaction was carried out, the ring-closed A-terminal molecule was fragmented into the fragment - It is peeled off from the AL.
[0155] Example 7: Construction of a library of different A-terminal cyclizations [ka] [ka]
[0156] Synthesis method: 1. Dissolve PEGA resin (100 mg, 25 μmol) in 3 ml of N,N-dimethylformamide for 2 hours. Fmoc-Amx-OH (4.77 equiv), mono-tert-butyl succinate (0.23 equiv), HOBt (5 equiv) v), HBTU (5 equiv), and DIPEA (10 equiv) were added, and the mixture was stirred at room temperature for 2 hours. The resin was dissolved in N,N-dimethylformamide (3 × 2 mL), dichloromethane (3 × 2 mL), N,N-dimethyl The resin was washed with formamide (3 x 2 mL) and drained. Add 4 mL of methylformamide solution, stir at room temperature for 1 hour, then add N,N-dimethylformamide (3 × 2 mL), dichloromethane (3 × 2 mL), and N,N-dimethylformamide (3 × 2 mL). DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), 4-(4-(1-hydroxyethyl)-2- (Methoxy-5-nitrophenoxy)butyric acid (38 mg, 5 eq) in N,N-dimethylformamide (3 mL) After stirring at RT for 5 min, the resin was added to the drained resin and the mixture was stirred at room temperature for 2 h. Dimethylformamide (3 × 2 mL), dichloromethane (3 × 2 mL), and N,N-dimethylformamide The mixture was washed with 3 x 2 mL of ethanol and drained. P (2 mg, 0.5 eq) and Fmoc-Glu-OAll (51 mg, 5 eq) in N,N-dimethylformamide (3 mL) After stirring for 5 minutes in N, the resin was added to the drained resin and the mixture was stirred at room temperature for 2 hours. N-dimethylformamide (3 x 2 mL), dichloromethane (3 x 2 mL), N,N-dimethylformamide (3×2 mL) and drained to give 95 mg of resin. 2. 90 mg of resin, palladium tetrakis (2.89 mg, 0.2 eq) and phenylsilane (54.12 mg 20 eq) was stirred in 5 mL of dichloromethane under nitrogen protection at room temperature for 1 hour. N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide ( 3×5 mL) and drained to give 85 mg of resin. 3. DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) were used as condensation agents, and aryl-protected amino acids were used as raw materials. Standard solid phase synthesis procedures were followed to give 80 mg of resin. 4. Add 80 mg of resin to 95% TFA, 2.5% HO, and 2.5% triisopropylsilane at room temperature for 2 hours. A solution of 10% DIPEA in N,N-dimethylformamide (3 mL) was added to the resin, and the mixture was stirred at room temperature for 2 hours. The resin was stirred for 1 hour. The resin was dissolved in N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), N,N- Each was washed with dimethylformamide (3 x 5 mL) and drained. (28 mg, 10 eq) was dissolved in 3 ml of N,N-dimethylformamide and added to the resin with stirring for 1 minute. The resin was then washed with N,N-dimethylformamide (3 x 2 mL), dichloromethane (2 mL), and HCl. Wash with ethanol (3 × 2 mL) and N,N-dimethylformamide (3 × 2 mL), drain, and HDNA (100 nmol) dissolved in 3 ml of 100 mM HEPES buffer, pH 8.0, was added to the resin and incubated at 37°C for 16 hours. To the resin was added 5 mL of a 20% solution of piperidine in N,N-dimethylformamide, and the mixture was stirred at room temperature for 1 After stirring for 1 hour, N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), N, Washing with N-dimethylformamide (3 x 5 mL) and draining gave 75 mg of resin. 5. For 75 mg of resin, add 2095 μL of water, 250 μL of 10x T4 DNA ligase buffer, and 25 μL of T4 DNA ligase. Add NA ligase (10,000 U / µL) and 58 µL of OP (AAATCGATGTG) (100 nM, 1.74 nM / µL) and incubate at room temperature. After overnight reaction, the resin was washed with water (3 x 5 mL) and T4 DNA ligase buffer (3 x 3 mL). The resin was then drained to obtain 75 mg of resin. 2095 μL of water and 250 μL of 10×T4 DNA ligase were added to the 75 mg of resin. Add 25 μL of enzyme buffer and 25 μL of T4 DNA ligase (10,000 U / μL), divide the mixture into 96 portions, and DNA tags (1.35 nm, 1 nm / μ) were added to the wells and reacted overnight at room temperature. The resin was then ligated with T4 DNA ligase. Wash with enzyme buffer (3 × 3 mL), water (3 × 3 mL), N,N-dimethylformamide (3 × 3 mL), and water DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) were dissolved in N,N-dimethylformamide (5 mL). The mixture was dissolved in 96 aliquots, and 5 eq of amino acid was added to each well of the resin. The mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 3 mL), and The resin was washed with ethylformamide (3 x 5 mL) and drained. 5 mL of dimethylformamide solution was added and stirred at room temperature for 1 hour. amide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL) After washing and draining, 70 mg of resin was obtained. This was repeated four times, and after the fourth amino acid and DNA tag addition, resin was added. DIC (16 mg, 5 eq), HOBt (1 7 mg, 5 eq) and Fmoc-Gly-Leu-OH (51 mg, 5 eq) in 5 mL of N,N-dimethylformamide for 2 min. After stirring, 70 mg of resin was added and the mixture was stirred at room temperature for 2 hours. N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL) The resin, palladium tetrakis (2.89 mg, 0.2 eq) and phenyl Lucilan (54.12 mg, 20 eq) was stirred in 5 ml of dichloromethane under nitrogen protection at room temperature for 1 hour. The resin was washed with dichloromethane (3 × 3 mL) and N,N-dimethylformamide (3 × 3 mL), respectively. Wash, drain, and apply 5 mL of 20% piperidine in N,N-dimethylformamide to the resin. The resin was added and stirred at room temperature for 1 hour. 5 mL) and drained to obtain 65 mg of resin. 6. For 65 mg of resin, add 2095 μL of water, 250 μL of 10x T4 DNA ligase buffer, and 25 μL of T4 DNA ligase. NA ligase (10,000 U / μL) and 57 μL of CP (100 nm, 1.74 nm / μL) were added and reacted at room temperature overnight. Afterwards, it was washed with T4 DNA ligase buffer (3 x 3 mL) and water (3 x 5 mL), and then drained. Dissolve the resin in 830 μL of water, add 100 μL of sodium acetate buffer (pH = 5.0, 0.5 M), 2 μL of Sodium chloride solution (0.25 M), 20 μL of disodium EDTA solution (0.05 M), 10 μL of TC An aqueous solution of EP (0.05 M) and 30 μL of OaAEP3 (1.34 mg / mL) were added to carry out the ring-closure reaction, and the mixture was then heated at 37°C. The reaction was carried out overnight at RT to obtain a DNA-encoded cyclic peptide library. When the fragment is broken down, the closed A-terminal molecule is detached from fragment -GL.
[0157] Example 8: Construction of a library of different A-terminal cyclized molecules [ka] [ka]
[0158] Synthesis method: Referring to the resin synthesis and database construction method in Example 7, 55 mg of solid was synthesized from 100 mg of starting resin. A DNA-encoded cyclic peptide library was obtained, in which the cyclization reaction was carried out. The ring A terminal molecule is detached from fragment-FL.
[0159] Example 9: Construction of a library of different A-terminal cyclizations [ka]
[0160] Synthesis method: Referring to the resin synthesis and database construction method in Example 7, 50 mg of solid was synthesized from 100 mg of starting resin. A DNA-encoded cyclic peptide library was obtained, in which the cyclization reaction was carried out. The ring A terminal molecule is detached from fragment -AL.
[0161] Example 10: Use of ONB-protected peptides in the synthesis of the DEL library of the present invention [ka]
[0162] Step 1. ONB-protected Fmoc-Asn-OH was synthesized. The protecting group was completely removed under UV irradiation at 365 nm. can. (1) Compound (2-nitrophenyl)methanamine hydrochloride (1.9 g, 10 mmol), Fmoc-Asp-OtBu( Dissolve DIPEA (3.9 g, 15 mmol) in 20 ml of N,N-dimethylformamide and add HCl. ATU (5.8 g, 15 mmol) was added at 0° C., and the mixture was stirred at room temperature for 2 hours. The mixture was then quenched with water and 10 ml of acetic acid was added. Ethyl acetate was added and the aqueous phase was extracted three times with ethyl acetate. The organic phases were combined and washed with anhydrous sodium sulfate. The crude product was dried on ice, filtered, and spun dry to give the crude product. The extract was passed through a column to obtain a white solid (4.5 g, 82.6%). (2) The compound obtained in the previous step (4.5 g, 8.25 mmol) was dissolved in 50 ml of 25% trifluoroacetic acid. The mixture was added to the dichloromethane solution and reacted at room temperature for 2 hours. The product was purified as a white solid (3.5 g, 86.7%) using a 6% methanol in dichloromethane solution as the synergist. ) was obtained. 1H NMR (400MHz, DMSO) δ 8.50 (t, J = 5.7 Hz, 1H), 8.03 (d, J = 8.1 Hz, 1H), 7.90 (d, J = 7. 4Hz,2H),7.71(d,J=7.3Hz,2H),7.67-7.59(m,2H),7.59-7.48(m,2H),7.42(t,J=7.4Hz,2H),7. 33(dd,J=6.9,4.5Hz,2H),4.56(d,J=4.2Hz,2H),4.47-4.36(m,1H),4.26(dt,J=137,7.2Hz,3H) ,2.74(dd,J=15.1,5.6Hz,1H),2.65-2.58(m,1H).LCMS:490.2(M+H) + . Step 2: Application of ONB-protected peptides to DEL library synthesis and ONB under 365 nm UV irradiation Examination of the effect of removing protecting groups Referring to the synthesis of the DEL library in Example 1, compound 15 was simultaneously removed from the resin by removing the ONB protecting group. and then irradiated with UV at 365 nm to give compound 16. The preparation method is as follows. [ka] [ka] [ka] [ka]
[0163] Example 11: Verification of ring closure method for compounds containing one side chain on the ring [ka]
[0164] Step 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Lys(Alloc)-OH (57 mg, 5 eq) were added to N,N-diisopropyl alcohol. After stirring in methylformamide (3 mL) for 10 minutes, 100 mg of well-dissolved resin was added and mixed. The mixture was stirred at room temperature for 1 hour. The resin was dissolved in N,N-dimethylformamide (3×3 mL), dichloromethane Wash with ethanol (3 × 3 mL) and N,N-dimethylformamide (3 × 5 mL), drain, and 0 mg of resin was obtained. Step 2. Add 5 mL of 20% piperidine in N,N-dimethylformamide to the resin and heat at room temperature. After stirring for 1 hour, N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), N The resin was washed with N-dimethylformamide (3 x 5 mL) and drained to give 100 mg of resin. 6mg, 5eq), HOBt (17mg, 5eq), building block Al (49mg, 5eq) Refer to the condensation procedure in Step 1 95 mg of resin was obtained. Step 3. 5 mL of 20% piperidine in N,N-dimethylformamide, DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq) and Fmoc-L-citrulline (building block A2) (50 mg, 5 eq) were used in the step 95 mg of resin was obtained by referring to the Fmoc removal and condensation procedures in Step 1. Step 4. 5 mL of 20% piperidine in N,N-dimethylformamide, DIC (16 mg, 5 eq) , HOBt (17 mg, 5 eq), and building block A3 (52 mg, 5 eq) were used to carry out the Fmoc removal and condensation of step 1. By referring to the synthesis procedure, 90 mg of resin was obtained. Step 5. 90 mg of resin, palladium tetrakis (2.89 mg, 0.2 eq) and phenylsilane (54.12 mg, 20 eq) was stirred in 5 mL of dichloromethane under nitrogen protection at room temperature for 1 hour. N,N-dimethylformamide (3 x 3 mL), dichloromethane (3 x 3 mL), N,N-dimethylform Washing with amide (3 x 5 mL) each and draining gave 85 mg of resin. Step 6. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), Fmoc-Gly-Leu-OH (50 mg, 5 eq), 20% Pipet 5 mL of lysine N,N-dimethylformamide solution was used to obtain 85 mg of resin. The resin was added to a mixed solution of acetonitrile and 0.5 mL of water, irradiated with 365 nm ultraviolet light for 5 hours, and then filtered. The mixture was filtered, and then subjected to solvent dialysis and freeze-dried to obtain 5 mg of Compound 7. Step 7. Dissolve 0.25 mg of compound 7 in 800 μl of water and 100 μl of sodium acetate buffer. (pH=5.0, 0.5M), 2 μl of sodium chloride solution (0.25M), 20 μl of ethylenediaminetetraacetic acid Disodium benzoate solution (0.05 M), 10 μl of TCEP solution (0.05 M), 30 μl of OaAEP3 (1.34 mg / mL) were added, and the mixture was reacted overnight at 37°C to give cyclic compound 8. LCMS: 1437.06 (M+H ) + .
[0165] <Example 12 Verification of ring closure method for compounds containing one side chain on the ring> [ka]
[0166] Step 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), building block Al(S)-2-((((9H-fluoren-1-yl)methyl) (3-(pyridin-3-yl)propanoic acid) (50 mg, 5 eq) After stirring in N-dimethylformamide (3 mL) for 10 minutes, 100 mg of well-dissolved resin was added and mixed. The mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3×3 mL), dichloromethane (2 mL), and HCl. Wash with ethanol (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL), drain, and collect 100 mg of To the resin was added 5 mL of a 20% piperidine-containing N,N-dimethylformamide solution, and the mixture was stirred at room temperature. After stirring for 1 hour, N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), N,N- Wash with dimethylformamide (3 x 5 mL) and dry to obtain 100 mg of resin. Step 2: Use DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and synthesis block A2 (50 mg, 5 eq). By referring to the condensation procedure in Step 1, 95 mg of resin was obtained. 5 mL of dimethylformamide solution was added, and the mixture was stirred at room temperature for 1 hour. Wash with hexane (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL), and dry. This yields 95 mg of resin. Step 3. Using DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Lys(Alloc)-OH (57 mg, 5 eq), Refer to Step 1 for Fmoc removal and condensation procedures to obtain 95 mg of resin. Step 4. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and synthesis block A3 (52 mg, 5 eq) were used to Refer to the condensation and Fmoc deprotection procedure in Step 1 to obtain 90 mg of resin. Step 5. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), Fmoc-Gly-Leu-OH (52 mg, 5 eq), 20% Pipet Using 5 mL of lysine in N,N-dimethylformamide, follow the procedure in step 1 for condensation and Fmoc removal. 85 mg of resin was obtained by illuminating the resin with 0.5 mL of acetonitrile and 0.5 mL of water. The resin was filtered, freeze-dried by solvent dialysis, and then irradiated with 365 nm ultraviolet light for 5 hours. g of compound 6 was obtained. Step 6. Dissolve 0.25 mg of compound 6 in 800 μL of water and 100 μL of sodium acetate buffer. (pH=5.0, 0.5M), 2 μL of sodium chloride solution (0.25M), 20 μL of ethylenediaminetetraacetic acid Disodium EDTA solution (0.05 M), 10 μL of TCEP solution (0.05 M), 30 μL of OaAEP3 (1.34 mg / mL) was subjected to a ring closure reaction, and the mixture was reacted at 37°C overnight to give cyclic molecular compound 7. LCMS: 1436. 11(M+H) + .
[0167] Example 13: Application of the cyclic molecular compound library of the present invention to protac [ka] [ka] [ka]
[0168] Synthesis method: Referring to the above synthesis process for synthesizing the DEL cyclic molecule library from bifunctional resin, POIs are added to compound libraries as specific building blocks to create compounds with specific functions and structures. A DEL cyclic molecule library will be synthesized.
[0169] Example 14: DEL cyclic molecule library using PROTAC technology (side chains containing target protein substrates) )> [ka] [ka] [ka]
[0170] Steps: Step 1. Dissolve DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-AA1-OH (100 mg, 5 eq) in 3 mL of N,N-dichloroisothiazolinone. After stirring in methylformamide for 10 minutes, 100 mg of the prepared resin was added, and the mixture was stirred at room temperature for 1 The resin was stirred for 1 hour. The resin was dissolved in N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), N, The resin was washed with N-dimethylformamide (3 x 5 mL) and drained. Add 5 mL of N,N-dimethylformamide solution, stir at room temperature for 1 hour, and then amide (3 × 5 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL) After washing and draining, 100 mg of resin was obtained. Step 2. Following the standard solid-phase synthesis method of Step 1, amino acids are sequentially linked to obtain 85 mg of the compound. I got item 8. Step 3. Dissolve 85 mg of resin in 95% trifluoroacetic acid, 2.5% water, and 2.5% triisopropylsilane. The resin was stirred with ethanol at room temperature for 2 hours. The resin was added with N,N-dimethylformamide (3 × 3 mL), dichloromethane (2 × 3 mL), and stirred at room temperature for 2 hours. The mixture was washed with fluorinated methane (3×3 mL) and N,N-dimethylformamide (3×5 mL), and then drained. 50 mg of resin was added to 3 ml of NMP solution and irradiated with 365 nm UV light for 5 hours. The resin was filtered and the solvent After dialysis and lyophilization, 8 mg of compound 9 was obtained. Step 4. Dissolve 0.6 mg of compound 9 in 800 µL of water and add 100 µL of sodium acetate buffer ( pH = 5.0, 0.5M), 2 μL of sodium chloride solution (0.25M), 20 μL of ethylenediaminetetraacetic acid Disodium solution (0.05 M), 10 μL of TCEP solution (0.05 M), 30 μL of OaAEP3 (1.34 mg / mL) The mixture was subjected to a ring-closure reaction and reacted at 37°C overnight to obtain cyclic molecular compound 10. LCMS: 1740.0 4(M+H) + .
[0171] Example 15: DEL of a cyclic molecule library in PROTAC: (target protein substrate in the ring) )> [ka] [ka]
[0172] Step 1. Dissolve DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-AA1-OH (100 mg, 5 eq) in 3 mL of N,N-dichloroisothiazolinone. After stirring in methylformamide for 10 minutes, 100 mg of the prepared resin was added, and the mixture was left at room temperature. The resin was stirred at rt for 1 h. The resin was then diluted with N,N-dimethylformamide (3 x 3 mL), dichloromethane (3 x 3 mL) and HCl. The resin was washed with 20% piperidine and N,N-dimethylformamide (3 × 5 mL) and drained. Add 5 mL of N,N-dimethylformamide solution of ethanol, stir at room temperature for 1 hour, and then add N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL) ) and drained to give 100 mg of resin. Step 2. Following the standard solid-phase synthesis method of Step 1, amino acids are sequentially linked to obtain 80 mg of the compound. I got item 7. Step 3. Dissolve 80 mg of resin in 95% trifluoroacetic acid, 2.5% water, and 2.5% triisopropylsilane. The resin was stirred with ethanol at room temperature for 2 hours. The resin was added with N,N-dimethylformamide (3 × 3 mL), dichloromethane (2 × 3 mL), and stirred at room temperature for 2 hours. The mixture was washed with fluorinated methane (3×3 mL) and N,N-dimethylformamide (3×5 mL), and then drained. 50 mg of resin was added to 3 ml of NMP solution and irradiated with 365 nm UV light for 5 hours. The resin was filtered and the solvent After dialysis and lyophilization, 8 mg of compound 8 was obtained. Step 4. Dissolve 0.5 mg of compound 8 in 800 µL of water and add 100 µL of sodium acetate buffer ( pH = 5.0, 0.5M), 2 μL of sodium chloride solution (0.25M), 20 μL of ethylenediaminetetraacetic acid Disodium solution (0.05 M), 10 μL of TCEP solution (0.05 M), 30 μL of OaAEP3 (1.34 mg / mL) The mixture was subjected to a ring-closure reaction and reacted at 37°C overnight to obtain cyclic molecular compound 9. LCMS: 1490.8( M+H) + .
[0173] <Example 16 Verification of bicyclic ring closure method> [ka]
[0174] Synthesis method: Step 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), Fmoc-NH-PEG3CH2COOH (55 mg, 5 eq) After stirring in 3 mL of N,N-dimethylformamide for 10 minutes, 100 mg of well-dissolved resin was added. The mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3×3 mL), dichloromethane, and hexane. methyl ether (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL), and HO (3 × 3 mL), respectively. After washing and draining, 100 mg of resin was obtained. Step 2. Add 2 mL of 95% trifluoroacetic acid to the resin and stir at room temperature for 2 days. , HO (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), N Wash the resin with N-dimethylformamide (3 × 5 mL), dry, rinse, and drain to obtain 100 mg of resin. A 50% solution of DIPEA in N,N-dimethylformamide was added to the resin and stirred at room temperature for 1 hour. Then, N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide The resin was washed with amide (3 x 5 mL) and dried to give 95 mg of resin. Following the peptide synthesis procedure, 92 mg of resin was obtained. Of this, DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), Fmoc-protected amino acid (60 mg, 5 eq). Step 3. Add 5 mL of 50% trifluoroacetic acid in dichloromethane to the resin and incubate at room temperature for 1 hour. The resin was stirred for 1 hour. The resin was dissolved in N,N-dimethylformamide (3 x 5 mL), dichloromethane (3 x 3 mL), N,N- After washing with dimethylformamide (3 x 5 mL) and draining, 87 mg of resin was obtained. p (27 mg, 2 eq) and DIPEA (17 mg, 5 eq) were stirred in 3 mL of N,N-dimethylformamide for 1 minute, The resin was added and the mixture was stirred at room temperature for 1 hour. The resin was then diluted with N,N-dimethylformamide (3 x 3 mL). Wash with dichloromethane (3 × 3 mL) and N,N-dimethylformamide (3 × 5 mL), drain, and 85m of resin was obtained. In this step of the reaction, the side chain of the glutamic acid (E) of the building block and the The side chain of the methionine (K) in the lock reacts and bonds to form a ring structure. Step 4. Add 5 mL of 20% piperidine in N,N-dimethylformamide to 85 mg of resin. The resin was stirred at room temperature for 1 hour. Wash with 100 mL of dimethylformamide (3 × 3 mL) and 100 mL of N,N-dimethylformamide (3 × 5 mL), drain, and add 80 mg of 80 mg of resin was added to a mixture of 0.5 mL of acetonitrile and 0.5 mL of water, and the resulting mixture was analyzed at 365 nm. After irradiation with ultraviolet light for 5 hours, the resin was filtered and freeze-dried by solvent dialysis to obtain 4 mg of compound 5. Step 5. Dissolve 0.25 mg of compound 6 in 800 μL of water and 100 μL of sodium acetate buffer. (pH=5.0, 0.5M), 2 μL of sodium chloride solution (0.25M), 20 μL of ethylenediaminetetraacetic acid Disodium EDTA solution (0.05 M), 10 μL of TCEP solution (0.05 M), 30 μL of OaAEP3 (1.34 mg / mL) was subjected to a ring closure reaction, and the mixture was reacted at 37°C overnight to give bicyclic molecular compound 6. LCMS: 1172 .(M+H) + It was.
[0175] From the above verification results, it is possible to construct a library of bicyclic compounds using the construction method of the present invention. Building blocks E and K each provide a cyclic outer chain, and The two cyclic outer chains are bonded by a chemical reaction to form a ring structure. The bicyclic ring structure of the library compounds has one or more building blocks shared between the two rings. It is a bridged ring.
[0176] <Example 17 Bicyclic ring closure verification test> [ka] [ka] [ka]
[0177] Synthesis method: 1. PEGA resin (100 mg, 25 μmol) was dissolved in 3 ml of N,N-dimethylformamide for 2 hours. Following standard solid-phase peptide synthesis procedures, the cyclic A-terminal molecule (LFNL tetrapeptide) was first synthesized. followed by Fmoc-O-tert-butyl l-glutamate (i.e., trifunctional linker L1') to obtain 95 mg of resin (compound 2). 2. 95 mg of the resin obtained in the previous step was dissolved in 95% TFA, 2.5% H2O, and 2.5% triisopropyl alcohol. The mixture was stirred with silane at room temperature for 2 hours. 10% DIPEA in N,N-dimethylformamide (3 mL) The resin was added and stirred at room temperature for 2 hours. The resin was then washed with N,N-dimethylformamide (3 x 3 mL), dichloromethane (2 x 10 mL), and hexane (2 x 10 mL). Wash with chloromethane (3 × 3 mL) and N,N-dimethylformamide (3 × 5 mL) and drain. DIC (32 mg, 10 eq), HOBt (35 mg, 10 eq) > Boc-Lys-OAll (76 mg, 10 eq), i.e., Functionalized linker (L1) 3 ml of N,N-dimethylformamide was added to the resin with stirring for 1 minute. The mixture was reacted for 1 hour to splice the trifunctional linker L1' with the trifunctional linker L1'. The resin was dissolved in N,N-dimethylformamide (3 × 2 mL), dichloromethane, and tetrafunctional linker L1. Wash with chloromethane (3 x 2 mL) and N,N-dimethylformamide (3 x 2 mL) and drain. As a result, 85 mg of resin (compound 3) was obtained. 3. 85 mg of resin, palladium tetrakis (3 mg, 0.2 eq) and phenylsilane (60.12 mg, 20 eq) was stirred in 5 mL of dichloromethane under nitrogen protection at room temperature for 1 hour. Wash with ethanol (3 × 3 mL) and N,N-dimethylformamide (3 × 3 mL), drain, and collect 80 mg A resin (compound 4) was obtained. 4. This allyl ester protected amino acid was subjected to standard solid phase peptide synthesis to obtain 70 mg of resin. (Compound 5). 5. Add 70 mg of resin to 95% TFA, 2.5% HO, and 2.5% triisopropylsilane at room temperature for 2 hours. A solution of 10% DIPEA in N,N-dimethylformamide (3 mL) was added to the resin, and the mixture was stirred at room temperature for 2 hours. The resin was washed with N,N-dimethylformamide (3 x 3 mL) and drained. The tert-butyloxycarbonyl-protected amino acid was subjected to standard solid-phase peptide synthesis procedures to give 6 0 mg of resin (compound 6) was obtained. 6. Add 5 mL of 20% piperidine in N,N-dimethylformamide to 60 mg of resin and let stand at room temperature for 1 minute. The resin was stirred for 1 hour. The resin was dissolved in N,N-dimethylformamide (3×3 mL), dichloromethane (3×3 mL), N, Wash with N-dimethylformamide (3 x 5 mL), drain, and add the Fmoc-protected amino acid Standard solid phase peptide synthesis was followed to obtain 55 mg of resin (compound 7). 7. The resin is deprotected using the deprotection method described above with the allyl, tert-butoxycarbonyl, 9-fluorouracil derivatives. Deprotection was carried out sequentially from fluorenylmethoxycarbonyl to give 45 mg of resin (Compound 8). 8. 45 mg of resin was added to 1 ml of NMP solution and irradiated with 365 nm UV light for 5 hours. The resin was filtered. The solution was subjected to solvent dialysis and freeze-dried to obtain 5 mg of compound 9. 9. 20% DMSO. 100 μM of peptide compound 9 and 20 μM of PagG were added to 10 mM MES buffer, pH 7.0. The mixture was reacted at 25°C for 16 hours. The reaction was quenched by steaming for 5 minutes and then freeze-dried. Compound 10 was obtained. 10. Dissolve compound 10 in 800 μL of water and 100 μL of sodium acetate buffer (pH = 5.0, 0.5 M). 2 μL of sodium chloride solution (0.25 M), 20 μL of disodium ethylenediaminetetraacetate solution A mixture of 10 μL of TCEP solution (0.05 M) and 30 μL of OaAEP3 (1.34 mg / mL) was subjected to a ring-closure reaction. The mixture was reacted at 37 °C overnight to simultaneously close the two rings, yielding bicyclic compound 6. LCMS: 1746.1 (M+H) + .
[0178] From the above verification results, it can be seen that the construction method of the present invention can construct a bicyclic compound library, It is particularly applicable to the screening of bicyclic peptide molecules. The formula structure stabilizes the conformation of the macrocyclic molecule, increasing the rigidity of the cyclic structure and Improve the stability of peptide molecules, extend the half-life of cyclic peptide drugs, and improve their application There is a prospect of this.
[0179] <Example 18 Verification test of ring closure> [ka]
[0180] 0.25 mg of peptide was dissolved in 800 μl of water and added to 100 μl of sodium acetate buffer (pH = 5.0, 0.5 M), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate A mixture of 10 μl of TCEP solution (0.05 M) and 60 μl of OaAEP3 (1.34 mg / mL) was used for ring closure. The mixture was reacted at 37°C overnight to obtain the product, which had a molecular weight of 554 by LC-MS. It was confirmed to be (M+H)+, and ring closure was possible.
[0181] Example 19: Verification test for ring closure [ka]
[0182] 0.5 mg of peptide was dissolved in 800 μl of water and 100 μl of sodium acetate buffer (pH = 5.0, 0.5 M ), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05M), 10 μl of TCEP solution (0.05M), and 60 μl of OaAEP3 (1.34 mg / mL) were added. The mixture was reacted overnight at 37°C, and the molecular weight of the product was 1306.5 (M+H) by LC-MS. + It is confirmed that It was possible to recycle it.
[0183] Example 20: Verification test for ring closure [ka]
[0184] 0.5 mg of peptide was dissolved in 800 μl of water and 100 μl of sodium acetate buffer (pH = 5.0, 0.5 M ), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05M), 10 μl of TCEP solution (0.05M), and 60 μl of OaAEP3 (1.34 mg / mL) were added. The mixture was reacted at 37°C overnight to give the product. LCMS: 984.98 (M+H) + .
[0185] <Example 21 Verification test of ring closure> [ka]
[0186] 0.5 mg of peptide was dissolved in 800 μl of water and 100 μl of sodium acetate buffer (pH = 5.0, 0.5 M ), 2 μl of sodium chloride solution (0.25 M), 20 μl of disodium ethylenediaminetetraacetate solution (0.05M), 10 μl of TCEP solution (0.05M), and 60 μl of OaAEP3 (1.34 mg / mL) were added. The mixture was reacted at 37°C overnight to give the product. LCMS: 984.71 (M+H) + .
[0187] <Example 22 Verification of a method for closing an aromatic ring contained in a cyclic molecule> [ka]
[0188] Step 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), Fmoc-benzylaminobenzoic acid (40 mg, 5 eq) After stirring in N,N-dimethylformamide (3 mL) for 10 minutes, 100 mg of well-swollen resin was added. The mixture was stirred at room temperature for 1 hour. The resin was then washed with N,N-dimethylformamide (3 x 3 mL), dichloromethane (2 mL), and HCl. After washing with ethanol (3 × 3 mL) and N,N-dimethylformamide (3 × 5 mL), the resin was drained to obtain 100 mg. Ta. Step 2. Add 5 mL of 20% piperidine in N,N-dimethylformamide to the resin and heat at room temperature. The resin was stirred for 1 hour. The resin was washed with N-dimethylformamide (3 x 5 mL), dried, and then drained to obtain 100 mg of resin. C (16 mg, 5 eq), HOBt (17 mg, 5 eq), Fmoc-Gly-Leu-OH (52 mg, 5 eq) Refer to the condensation procedure in Step 1. , 95 mg of resin is obtained. Step 3. Use 5 mL of 20% piperidine in N,N-dimethylformamide to 85 mg of resin was obtained by referring to the Fmoc removal procedure. 85 mg of resin was dissolved in a mixture of 0.5 mL of acetonitrile and 0.5 mL of water. After irradiating with 365 nm ultraviolet light for 5 hours, the resin was filtered and the solvent was freeze-dried to obtain the compound. 5 mg of 4 was obtained. Step 4. Dissolve 0.25 mg of compound 5 in 800 μl of water and 100 μl of sodium acetate buffer. (pH=5.0, 0.5M), 2 μl of sodium chloride solution (0.25M), 20 μl of ethylenediaminetetraacetic acid Disodium benzoate solution (0.05 M), 10 μl of TCEP solution (0.05 M), 30 μl of OaAEP3 (1.34 mg / mL) were added, and the mixture was reacted at 37°C overnight to give cyclic peptide compound 5. LCMS: 962 .53(M+H) + .
[0189] <Example 23 Verification of a method for closing an aromatic ring contained in a cyclic molecule> [ka]
[0190] Step 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), 4-((((9H-fluoren-9-yl)methacrylate) ((allyloxy)carbonyl)amino)methyl 2-(((allyloxy)carbonyl)amino)benzoate (45mg, 5eq) ) was stirred in 3 mL of N,N-dimethylformamide for 10 minutes, and then 100 mg of well-swollen resin was added. N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dichloromethane Washing with methane (3 x 5 mL) and draining gave 100 mg of resin. Step 2. Add 5 mL of 20% piperidine in N,N-dimethylformamide to the resin and allow to stand at room temperature. After stirring for 1 hour, N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), N,N- The resin was washed with dimethylformamide (3 x 5 mL) and dried to obtain 100 mg of resin. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (52 mg, 5 eq) were added to the resin 95 Obtained as mg. Step 3. Add 5 mL of a 20% solution of piperidine in N,N-dimethylformamide to the decomposed Fmo Obtain 85 mg of resin by following the procedure in c. Dissolve 85 mg of resin in a mixture of 0.5 mL of acetonitrile and 0.5 mL of water. The mixture was irradiated with 365 nm ultraviolet light for 5 hours, the resin was filtered, and the solvent was freeze-dried to obtain 5 mg of Compound 4. obtain. Step 4. Dissolve 0.25 mg of compound 5 in 800 μl of water and 100 μl of sodium acetate buffer. (pH=5.0, 0.5M), 2 μl of sodium chloride solution (0.25M), 20 μl of ethylenediaminetetraacetic acid Disodium benzoate solution (0.05 M), 10 μl of TCEP solution (0.05 M), 30 μl of OaAEP3 (1.34 mg / mL) were added, and the mixture was reacted at 37°C overnight to give cyclic compound 5. LCMS: 1061.56 (M+H ) + .
[0191] Example 24: Compound library with improved membrane permeability and its construction [ka] [ka] [ka]
[0192] 1. Using the above synthesis method, 100 mg of PEGA resin 1 was synthesized into 95 mg of resin according to the standard solid phase synthesis procedure. Product 2 was obtained as a fat. Product 2 has a molecular structure with two proline-constituent molecular fragments. 2. 90 mg of resin was purified by standard Fmoc deprotection and amino acid condensation methods based on solid phase synthesis. I got it. 3. 90 mg of the resin was added to 5 ml of 95% aqueous trifluoroacetic acid solution and reacted at room temperature for 2 hours. The resin was dissolved in N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 3 mL), After washing with dimethyl ether (3 × 5 mL) and draining, the resulting resin was dissolved in N,N-dimethyl ether containing 20% DIEA. The resin was added to 5 mL of dimethylformamide solution and stirred at room temperature for 2 hours. amide (3 × 3 mL), dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL) After washing and draining, 85 mg of resin was obtained. 4. Dissolve DIC (16 mg, 5 eq) and NHS (15 mg, 5 eq) in N,N-dimethylformamide (5 mL). The resin was added to 85 mg of the HCl solution and reacted at room temperature for 2 hours. The resin was then diluted with N,N-dimethylformamide (3 × 3 mL) ), washed with dichloromethane (3 × 3 mL), N,N-dimethylformamide (3 × 5 mL), and drained. The resin was dissolved in 2 mL of pH 8.0 HEPES (100 mM) buffer, and HDNA (100 nmol, 1 mM) was added. After adding the mixture and reacting overnight at room temperature, 80 mg of resin was obtained. 5 mL of formamide solution was added, and the mixture was stirred at room temperature for 1 hour. After that, the resin was dissolved in N,N-dimethylformamide. (3 × 5 mL), dichloromethane (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL). The water was drained to give 75 mg of resin. 5. For 75 mg of resin, add 2095 μL of water, 250 μL of 10x T4 DNA ligase buffer, and 25 μL of T4 DNA ligase. Add NA ligase (10,000 U / µL) and 58 µL of OP (AAATCGATGTG) (100 nM, 1.74 nM / µL) and incubate at room temperature. After overnight reaction, the resin was washed with water (3 x 5 mL) and T4 DNA ligase buffer (3 x 3 mL). The resin was then drained to obtain 75 mg of resin. 2095 μL of water and 250 μL of 10×T4 DNA ligase were added to the 75 mg of resin. Add 25 μL of enzyme buffer and 25 μL of T4 DNA ligase (10,000 U / μL), divide the mixture into 96 portions, and DNA tags (1.35 nm, 1 nm / μ) were added to the wells and reacted overnight at room temperature. The resin was then ligated with T4 DNA ligase. Wash with enzyme buffer (3 × 3 mL), water (3 × 3 mL), N,N-dimethylformamide (3 × 3 mL), and water DIC (16 mg, 5 eq) and HOBt (17 mg, 5 eq) were dissolved in N,N-dimethylformamide (5 mL). The dissolved material was divided into 96 portions, and Fmoc-N-methyl amino acid (5 eq) was added to the resin in each well. The resin was stirred at rt for 1 h. The resin was then diluted with N,N-dimethylformamide (3 × 3 mL), dichloromethane (3 × 3 m L), N,N-dimethylformamide (3 × 3 mL), and N,N-dimethylformamide (3 × 5 mL) were added. The resin was then washed and drained. 5 mL of 20% piperidine N,N-dimethylformamide solution was added. The resin was stirred at room temperature for 1 hour. The resin was washed with 3 mL of dimethylformamide (3 mL x 3 mL) and N,N-dimethylformamide (3 mL x 5 mL), and then drained to obtain 70 mg of resin. The reaction and DNA binding reaction were repeated four times in total. In the second round, Fmoc amino acids were added to the first, third, and fourth rounds. Pick up Fmoc-N-methyl amino acids in the first round, and then pick up amino acids in the fourth round and DNA fragments. After A labeling, the resins were combined to give 65 mg of resin. 6. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Gly-Leu-OH (51 mg, 5 eq) were mixed in a 100 mL flask. After stirring in N-dimethylformamide (5 mL) for 2 minutes, 65 mg of resin was added, and the mixture was stirred at room temperature. The resin was stirred for 2 hours. The mixture was washed with 20% N,N-dimethylformamide (3 × 3 mL) and dried. 5 mL of dimethylformamide solution was added to the resin, and the resin was stirred at room temperature for 1 hour. The resin was washed with methylformamide (3×3 mL) and water (3×5 mL) and dried to give 60 mg of resin. . 7. For 60 mg of resin, add 2095 μL of water, 250 μL of 10x T4 DNA ligase buffer, and 25 μL of T4 DNA ligase. NA ligase (10,000 U / μL) and 57 μL of CP (100 nm, 1.74 nm / μL) were added and reacted at room temperature overnight. Afterwards, the resin was washed with T4 DNA ligase buffer (3 x 3 mL), water (3 x 5 mL) and drained. 8. 1 mL of N-methylpyrrolidone was added to 60 mg of resin, and the resin was irradiated with 365 nm ultraviolet light for 5 hours. The oil was filtered, solvent dialysis and freeze-dried to obtain 5 mg of compound 9. 9. Dissolve 5 mg of compound 16 in 800 μL of water and add 100 μL of sodium acetate buffer (pH = 5.0, 0 0.5M), 2 μL of aqueous sodium chloride solution (0.25M), 20 μL of ethylenediaminetetraacetic acid disodium salt Add 10 μL of sodium solution (0.05 M), 10 μL of TCEP solution (0.05 M), and 60 μL of OaAEP3 (1.34 mg / mL). The reaction was carried out at 37°C overnight to carry out the ring closure reaction, and 3 mg of product 10 was obtained after preparation.
[0193] Example 25: Compound library with improved membrane permeability and its construction [ka] [ka]
[0194] Synthesis method: 1. WDIC (16 mg, 5 eq), HOBt (17 mg, 5 eq) and Fmoc-Glu(O t Bu)-OH (100 mg, 5 eq) After stirring in N,N-dimethylformamide (3 mL) for 10 minutes, 100 mg of the prepared resin was added. The mixture was stirred at room temperature for 1 hour, and 5 mL of a 20% solution of piperidine in N,N-dimethylformamide was added to the resin. After stirring at room temperature for 1 hour, N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × The resin was washed with N,N-dimethylformamide (3×5 mL) and drained to give 95 mg of resin. . 2. Step 1: Following the standard solid-phase synthesis procedure, the amino acids are sequentially linked to form 80 mg of chromatin. Fat 7 was obtained. 3. 80 mg of this resin was added to 2 ml of NMP solution and irradiated with 365 nm ultraviolet light for 5 hours. The resin was filtered. The mixture was subjected to solvent dialysis and freeze-dried to obtain 10 mg of compound 8. 4. Dissolve 0.5 mg of compound 8 in 800 μL of water and add 100 μL of sodium acetate buffer (pH = 5.0, 0.5M), 2 μL of sodium chloride solution (0.25M), 20 μL of disodium ethylenediaminetetraacetic acid Add 10 μL of 0.05M TCEP solution, 10 μL of 0.05M TCEP solution, and 30 μL of OaAEP3 (1.34 mg / mL) to the mixture. The reaction was carried out at 7°C overnight to give cyclic peptide compound 9. LCMS: 1238.70 (M+H) + .
[0195] Compounds 10, 11, and 12 were synthesized according to the methods described in the above examples. The structure of the compound according to the chemistry table is as follows:
[0196] [Table 1]
[0197] Example 26: Evaluation of membrane permeability The membrane permeability of each of the cyclic peptide compounds 9 to 12 obtained in the above examples was measured. To investigate this, we established an MDCK model. The MDCK cell line was derived from the Martins D'Arby canine epithelial cell line. MDCK cell monolayers are useful for investigating the drug absorption and reabsorption process in renal tubules in vivo. MDCK cells are the most suitable cytological model. 5 x 10 to CPI 4 cells / cm 2 The cells were inoculated with MEM culture medium containing 10% FBS at 400°C on the A side (lumen side, apical). 800 μL was added to the B side (basal side), and 800 μL was added to the C side (basal side). The cells were cultured at 37°C in an incubator containing 5% CO2. The culture medium was changed every day, and care was taken not to touch the cell membrane with the pipette gun, in order to avoid damaging the cell layer. To detect the integrity of the cell monolayer, transepithelial electrical resistance (TER) was measured with Millicell2ERS. The transepithelial electrical resistance (TEER) was measured periodically.
[0198] A → B translocation from the apical (A) to the basolateral (B) end of MDCK cell monolayers. For the A→B assay, 450 μL of drug or positive control HEPES solution was used as the feeding pool. 100 μL was added to the apical end of the membrane, and 1300 μL of blank HEPES solution was added to the basolateral end as the receptor pool. The transwell plate was placed on a thermostatic shaker at 37°C and shaken. After 90 minutes, the feed cells and The sample solution from the receptor cells was removed, and proteins were precipitated by adding ethyl acetate. After vortexing, the mixture was centrifuged and transferred, and the amount of permeation was measured by LC / MS. The membrane permeability coefficient (Papp) was calculated based on the Papp (apparent permeability) parameter, 1×10 -6 If the flow rate is 10 × 10 cm / s or higher, more than 60% of the drug can be absorbed. -6 cm / s If this is the case, more than 80% of the drug molecules can be absorbed.
[0199] [Table 2]
[0200] From the above data, the Papp value of the synthesized compound is 10 -6 That's it. Compound 9 and Compound 11 The Papp value of is 10 x 10 -6 These results show that the compound exhibits superior cell permeability.
[0201] Example 27: Ring closure of synthetic cut blocks present in cyclic molecules linked by ether bonds Verification Test> [ka]
[0202] 1. Mix D1C (16 mg, 5 eq), HOBt (17 mg, 5 eq) and FmocNHPEG4CH2CH2COOH (104 mg, 5 eq) After stirring for 10 minutes in N,N-dimethylformamide (3 mL), 100 mg of well-dissolved resin was added. The mixture was stirred at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3×3 mL), dichloromethane, and hexane. Wash with methyl ether (3 x 3 mL) and N,N-dimethylformamide (3 x 5 mL), then drain. 5 mL of a 20% solution of piperidine in N,N-dimethylformamide was added to the resin, and the mixture was stirred at room temperature for 1 hour. After that, N,N-dimethylformamide (3 × 5 mL), dichloromethane (3 × 3 mL), N,N-dimethyl The resin was washed with dichloromethane (3×5 mL) and drained to give 95 mg of resin. 2. DIC (16mg,5eq), HOBt (17mg,5eq), Fmoc-p-benzylamine benzoic acid (40mg,5eq) The resin was stirred in 3 mL of N,N-dimethylformamide for 10 minutes. The resin was washed with N,N-dimethylformamide (3×3 mL), dichloromethane (2×10 mL), and hexane (1×10 mL). Wash with chloromethane (3 x 3 mL) and N,N-dimethylformamide (3 x 5 mL), then drain. 5 mL of 20% piperidine in N,N-dimethylformamide was added to the resin and the mixture was left at room temperature for 1 hour. The resin was washed with N,N-dimethylformamide (3 x 5 mL), dichloromethane (3 x 3 mL), N,N-dimethylformamide (3 x 5 mL), Washing with methylformamide (3 x 5 mL) each and draining gave 90 mg of resin. 3. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), Fmoc-Gly-Leu-OH (52 mg, 5 eq) were used. See the condensation procedure in Step 1. Next, add 5 ml of 20% piperidine in N,N-dimethylformamide. The resin was added with N,N-dimethylformamide (3×5 mL), and stirred at room temperature for 1 hour. Wash with dichloromethane (3 × 3 mL) and N,N-dimethylformamide (3 × 5 mL), then drain. , 80 mg of resin was obtained. 4. Add 80 mg of resin to a mixture of 0.5 ml of acetonitrile and 0.5 ml of water and expose to 365 nm UV light. The resin was filtered and the solvent was lyophilized to give 5 mg of compound 5. 5. Dissolve 0.25 mg of compound 5 in 800 μL of water and add 100 μL of sodium acetate buffer (pH = 5.0 , 0.5M), 2 μL of sodium chloride solution (0.25M), 20 μL of ethylenediaminetetraacetic acid disodium Add 10 μL of sodium solution (0.05 M), 10 μL of TCEP solution (0.05 M), and 30 μL of OaAEP3 (1.34 mg / mL). The reaction was continued at 37°C overnight to obtain cyclic peptide compound 6. LCMS: 1210.92 (M+H) + .
[0203] Example 28: Verification of cleavage in the presence of L0 and acid cleavage [ka]
[0204] Synthesis method: 1. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), 3-((((9H-fluoren-9-yl)methoxy)carbo (2-nitrophenyl)amino)-3-(2-nitrophenyl)propanoic acid (54 mg, 5 eq) was stirred in DMF (3 mL) for 10 min. After that, 100 mg of well-dissolved resin was added and the mixture was stirred at room temperature for 1 hour. The resin was washed with CM (3 × 3 mL) and DMF (3 × 5 mL), respectively, and then drained. 5 mL of MF solution was added and stirred at room temperature for 1 hour. The resin was washed with DMF (3 × 5 mL), DCM (3 × 3 mL), and DMF (3 × 5 mL) and drained to obtain 95 mg of resin. 2. Using DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), and Fmoc-Glu-OAll (52 mg, 5 eq), repeat the procedure in step 1. 92 mg of resin was obtained by referring to the condensation and removal of Fmoc. 3. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), 2-(4-((((((9H-fluorene-9-yl) (3,5-dimethoxyphenyl)methyl)phenoxy ) Using acetic acid (68 mg, 5 eq), 90 mg of resin was obtained by referring to the condensation and Fmoc removal procedures in Step 1. Ta. 4. DIC (16 mg, 5 eq), HOBt (17 mg, 5 eq), Fmoc-Glu-OAll (52 mg, 5 eq) were used. By referring to the condensation procedure in Step 1, 90 mg of resin was obtained. 5. Add 2 mL of 50% trifluoroacetic acid in dichloromethane to the resin and stir at room temperature for 1 hour. The resin was washed with DCM (3 x 3 mL) and the filtrate was spun to dryness to give 4 mg of compound 6. LCMS :409.12(M+H) + .
[0205] The segment cut was verified as follows: [ka]
[0206] Synthesis method: 1. Add 100 mg of resin to a mixture of 0.5 ml of acetonitrile and 0.5 ml of water and expose to 365 nm UV light. The resin was filtered and the solvent was lyophilized to give 4 mg of compound 5. LCMS: 877 .96(M+H) + .
[0207] <Example 29: Verification of DNA primer stability during multiple rounds of extension steps> The building blocks are spliced sequentially following the extension steps described herein. The DNA tags corresponding to the building blocks are spliced sequentially to form an extended strand. According to the resin synthesis method and library construction method described in the previous section of this application, multiple rounds of The library compounds synthesized in rounds 4, 5, and 7 were subjected to PCR, and the PCR products were analyzed. Detection was carried out by agarose gel electrophoresis.
[0208] Here, four rounds of DNA-containing resin were synthesized with primers (TGACTCCCAAATCGATGTG, GCAGGT PCR was performed using 2x taq master mix and distilled water. The PCR product was detected by agarose gel electrophoresis (PCR product band size: 85 bp). .
[0209] Five rounds of DNA-containing resin were synthesized with primers (TGACTCCCAAATCGATGTG, GCAGGTGAAGCTTGT PCR was performed using 2x taq master mix and distilled water. The product was detected by agarose gel electrophoresis (PCR product band size: 94 bp).
[0210] Seven rounds of DNA-containing resin were synthesized with primers (TGACTCCCAAATCGATGTG, GCAGGTGAAGCTTGT PCR was performed using 2x taq master mix and distilled water. The product was detected by agarose gel electrophoresis (PCR product band size: 94 bp).
[0211] The results of detection by agarose gel electrophoresis are shown in Figures 1 to 3. Figures 1 to 3 show the results of synthesis round 4. This indicates that the PCR purity of 5, 7 is high, which is due to the mild synthesis method of the present invention. The reaction conditions, especially the ring-closure reaction conditions, contribute to maintaining the stability of the DNA molecule. The stability and accuracy of screening results for compound libraries constructed with This indicates that there is something.
[0212] Example 30 Four rounds of synthesis were carried out with reference to the method described in Example 5, and the corresponding monocyclic compound library was obtained. I got Lee (almost 100 million level).
[0213] Example 31 Screening of compounds targeting KRAS protein using a synthesized DEL library Cleaning> Experimental Objective: Screening of target compounds targeting KRAS from the compound library (Example 30) G Experimental steps: 1. Incubation of compound library with target protein Put PBST, 0.25 mg / mL KRAS (dissolved in PBS), yeast tRNA, and 10.2 mg / mL DEL compound into a PCR tube. Add the following volumes of antibody library and 0.1 mg / mL BSA and incubate at room temperature for 60 minutes. Ta; Put PBST, PBS, yeast tRNA, 10.2 mg / mL DEL compound library, 0.1 mg / mL BSA was added according to the volume in Table 1 and incubated at room temperature for 60 minutes as the BSA group.
[0214] [Table 3]
[0215] 2. Bead pretreatment for the experimental and BSA groups Place 160 μL of beads in a PCR tube, place the tube in a magnetic rack, and allow the beads to settle in the tube. Wait until the mixture is absorbed by the wall of the tube, then discard the supernatant; remove the PCR tube and add 160 μL of PBST. Repeat the above step three times. Repeat; resuspend the beads in 160 μL of PBST and store at 4°C as a reserve.
[0216] 3. Capture / Elution 20 μL of pretreated beads was added and incubated at room temperature for 30 minutes. Place the system in the magnetic rack and discard the supernatant; take out the PCR tube and add 20 μL to 1 Resuspend in 100 μL of PBST, place in a magnetic rack, and discard the supernatant; repeat this process five times. Resuspend 20uL in 40uL of PBST, transfer to a new PCR tube, and heat in a water bath at 72℃ for 5 min. Place the PCR tube in a magnetic rack and transfer the supernatant to a new PCR tube. 10 μL of pretreated beads were added to the supernatant and incubated at room temperature for 10 min; the supernatant was used for the next step. Used for cleaning.
[0217] 4. Conduct 2 / 3 rounds of screening Round 2: Add appropriate reagents according to Table 2 to the supernatant obtained in step 3, and then add the BSA group. Note that PBS was added to the smeared samples, and the target protein was added to the experimental group. Subvert and repeat step 3.
[0218] [Table 4]
[0219] Round 3: Repeat step 3, place the sample in the magnetic rack, and remove the supernatant (≈40 uL) ) was used for subsequent PCR analysis.
[0220] 5. PCR (Bio-Rad T100 PCR machine) / NGS A PCR 50uL system was used and the conditions in Table 3 were followed:
[0221] [Table 5]
[0222] A 4% agarose gel was prepared, and 10 uL of the PCR sample was analyzed on the gel. Shown in Figure 4.
[0223] <Example 32 NGS analysis of PCR samples> NGS analysis of the PCR samples described in Example 31 was performed as follows. 1. Library construction: The library was constructed using a kit. The specific procedure is as follows: Library construction is performed directly using 50 ng or more of PCR purified product (starting from the (The enzyme solution must be gel cut or magnetic bead purified.) End repair (including phosphorylation of the 5' end and A' addition to the 3' end) was performed on the DNA, and adapters were added to both ends. The fragment was then purified using DNA Clean Beads, and finally the P5 and P7 primers were added. The quality of the libraries was confirmed using a Qseq 100 Bioanalyzer (Bioptic, Taiwan, China). The library concentration was investigated using Qubit3.0. 2. Sequencing: Mix the DNA libraries and use the NovaSeq Control Software provided with the NovaSeq. ware(NCS)+OLB+GAPipeline-1.6, Illumina Novaseq(Illumina, San Diego, CA, US The sequence information was read according to A). 3. Data Analysis - Quality Analysis of Sequencing Data: Raw Data from Downstream Instruments The data were subjected to preliminary statistical analysis. The raw data was optimized using the method described above, and the primer and junction sequences, both ends of which had a quality value of 20. Sequences with less than 10 bases and sequences with N base ratios greater than 10% were removed, and the clean data after QC was subjected to statistical analysis. The Qean reads were analyzed using Pandaseq [2] (version 2.7) to identify overlapping reads between Read 1 and Read 2. Merge based on regions, create complete sequences, and perform statistical analysis such as length distribution of merged sequences. was analyzed.
[0224] Data division: The data was divided according to the barcode sequence, and the division results were statistically analyzed.
[0225] Tag sequence abundance statistics: Tag sequences are assigned according to the constant region sequences upstream and downstream of the tag sequence. The tag sequence was divided into sequence units corresponding to different building blocks. Each sequence unit is divided into two parts and checked to see if it belongs to the collection of DNA sequences corresponding to the Building Block. We analyzed whether the sequences belonged to the same gene, and if so, extracted the sequences and performed abundance statistics.
[0226] As can be seen from the attached Figure 5, there is a significant difference in abundance values, with the number of repeats being higher. The sequence was selected for subsequent validation.
[0227] <Example 33 SPR analysis of screened compounds> 1. Protein immobilization: Proteins were immobilized using an NTA microarray. The microarray was then treated with 0.5M EDTA before immobilization. The KRAS protein was activated by regeneration with 100 mM NaOH (pH 8.0) for 120 seconds. The sample was diluted to 5 μg / mL with PBS and the flow rate was set to 10 μL / min. Capture KRAS protein by injecting for 360 seconds until protein capture stabilizes. The test channel was washed with PBS buffer for 90 seconds.
[0228] 2. Sample test conditions: PBS buffer pH 7.4 containing 0.05% Tween-20 and 5% DMSO was used as the running buffer. The running buffer was used as a control test sample, and serial concentrations were set (0.1953 μ M, 0.3906μM, 0.7812μM, 1.5625μM, 3.125μM, 6.25μM, 12.5μM, 25μM, 50μM, 10 0 μM), the flow rate was 30 μL / min, the binding time was 90 seconds, and the dissociation time was 300 seconds. To achieve this, eight gradient concentrations of DMSO-containing buffer were set up.
[0229] 3. Parameter fitting: The experiment was carried out over multiple cycles, with the response signal plotted as the abscissa and the analysis time plotted as the ordinate. The data obtained after solvent correction were subjected to a two-parameter deduction and analyzed using the BIAcore T200 analysis software. The fitted model was calculated using software. The binding dissociation constants and A 1:1 Langmuir binding model was used to determine other affinity indices. The constant indices are shown in Table 4.
[0230] [Table 6]
[0231] Conclusion: The test results are shown in Figure 6, but from the data in the table, it is clear that the screening The compounds identified were found to have a certain degree of binding ability to the target protein, and It was demonstrated that the compound was captured.
[0232] Example 34 Screening of compounds targeting DLL3 protein using a synthesized DEL library Leaning> Experimental Objective: Screening of target compounds targeting KRAS from the compound library (Example 30) G Experimental steps: 1. Incubation of compound library with target protein Put PBST, 40.2 mg / mL DLL3 (dissolved in PBS), yeast tRNA, and 10.2 mg / mL of delta-3 into a PCR tube. Compound library and 0.1 mg / mL BSA were added in the volumes corresponding to Table 1, and the mixture was incubated at room temperature for 60 minutes. Baited; In a PCR tube, add PBST, PBS, yeast tRNA, 10.2 mg / mL of DEL Compound Library, and 0.1 mg / mL of DEL Compound Library. of BSA was added in the volume corresponding to Table 1, and the mixture was incubated at room temperature for 60 minutes as the BSA group. Ta.
[0233] [Table 7]
[0234] 2. Bead pretreatment for the experimental and BSA groups Place 160 μL of beads in a PCR tube, place the tube in a magnetic rack, and allow the beads to settle in the tube. Wait until the mixture is absorbed by the wall of the tube, then discard the supernatant; remove the PCR tube and add 160 μL of PBST. Repeat the above step three times. Repeat; resuspend the beads in 160 μL of PBST and store at 4°C as a reserve.
[0235] 3. Capture / Elution 20 μL of pretreated beads was added and incubated at room temperature for 30 minutes. Place the system in the magnetic rack and discard the supernatant; take out the PCR tube and add 20 μL to 1 Resuspend in 100 μL of PBST, place in a magnetic rack, and discard the supernatant; repeat this process five times. Resuspend 20uL in 40uL of PBST, transfer to a new PCR tube, and heat in a water bath at 72℃ for 5 min. Place the PCR tube in a magnetic rack and transfer the supernatant to a new PCR tube. 10 μL of pretreated beads were added to the supernatant and incubated at room temperature for 10 min; the supernatant was used for the next step. Used for cleaning.
[0236] 4. Conduct 2 / 3 rounds of screening Round 2: Add appropriate reagents according to Table 2 to the supernatant obtained in step 3, and then add the BSA group. Note that PBS was added to the smeared samples, and the target protein was added to the experimental group. Substitute and repeat step 3;
[0237] [Table 8]
[0238] Round 3: Repeat step 3, place the sample in the magnetic rack, and remove the supernatant (≈40 uL) ) was used for subsequent PC analysis.
[0239] 5. PCR (Bio-Rad T100 PCR instrument) / NGS A PCR 50uL system was used, and the conditions in Table 3 were followed.
[0240] [Table 9]
[0241] A 4% agarose gel was prepared and 10 μL of the PCR sample was analyzed on the gel. Shown in Figure 7. Conclusion: After three rounds of screening and enrichment, 500 nM of DLL3 protein produced 2.5 nM of DEL The library can be screened for fragments that interact with it.
[0242] <Example 35 NGS analysis of PCR samples> NGS analysis of the PCR samples described in Example 34 was performed as follows: 1. Library construction: The library was constructed using a kit. The specific procedure is as follows: Library construction is performed directly using 50 ng or more of PCR purified product (starting from the (The enzyme solution must be gel cut or magnetic bead purified.) End repair (including phosphorylation of the 5' end and A' addition to the 3' end) was performed on the DNA, and adapters were added to both ends. The fragment was then purified using DNA Clean Beads, and finally the P5 and P7 primers were added. The quality of the libraries was confirmed using a Qseq 100 Bioanalyzer (Bioptic, Taiwan, China). The library concentration was investigated using Qubit3.0.
[0243] 2. Sequencing: Mix the DNA libraries and use the NovaSeq Control Software provided with the NovaSeq. The Illumina Novaseq (Illumina, San Diego, CA, USA) was used with ware (NCS) + OLB + GAPipeline-1.6. The sequence information was read according to the SA.
[0244] 3. Data Analysis - Quality Analysis of Sequencing Data: Raw Data from Downstream Instruments The data were subjected to preliminary statistical analysis. The raw data was optimized using the method described above, and the primer and junction sequences, both ends of which had a quality value of 20. Sequences with less than 10 bases and sequences with N base ratios greater than 10% were removed, and the clean data after QC was subjected to statistical analysis. The Qean reads were analyzed using Pandaseq [2] (version 2.7) to identify overlapping reads between Read 1 and Read 2. Merge based on regions, create complete sequences, and perform statistical analysis such as length distribution of merged sequences. was analyzed.
[0245] Data division: The data was divided according to the barcode sequence, and the division results were statistically analyzed.
[0246] Tag sequence abundance statistics: Tag sequences are assigned according to the constant region sequences upstream and downstream of the tag sequence. The tag sequence was divided into sequence units corresponding to different building blocks. Each sequence unit is divided into two parts and checked to see if it belongs to the collection of DNA sequences corresponding to the Building Block. If it did belong to a certain group, the sequence was extracted and abundance statistics were performed. As can be seen, there is a significant difference in abundance values, with sequences with a higher number of repeats being more abundant. was selected for validation.
[0247] <Example 36 FACS analysis of screened compounds> The compound obtained in Example 35 was incubated with DLL3-overexpressing CT-26 cells by FITC labeling. Afterwards, flow cytometry analysis revealed the following: 1. Digesting CT-26 cells and 25 cm 3 Resuspended and counted from culture flasks and placed in a 96-well plate 1×10 5 Planted per well; 2. Compounds were added to the culture medium at different concentrations, mixed well, and added to a 96-well plate. The plates were cultured in an incubator at ℃ for 6 hours. 3. The 96-well plate was centrifuged at 1000 rpm for 5 minutes and the supernatant was discarded. 100uL / well of 0.25% Trypsin was digested for 2 minutes, centrifuged, and the supernatant was discarded. The cells were then resuspended in PBS + 2% FBS, 200 μL / well. Resuspended. 4. Cells were analyzed by flow cytometry, and the green fluorescent channel was selected. The results are shown in attached FIG.
[0248] Conclusion: The data in the attached Figure 9 (from top to bottom: DMSO, 2.5uM compound, 5uM compound, 10uM compound) Compounds screened from the library bind to DLL-overexpressing CT-26 cells in a concentration-dependent manner This indicates that
[0249] In summary, the above embodiments are merely better embodiments of the present invention and fall within the scope of protection of the present invention. is not intended to limit the scope of the present invention, but is within the spirit and principles of the present invention. Any modifications, equivalent replacements, improvements, etc. shall fall within the protection scope of the present invention.
Claims
1. The present invention provides a method for constructing a cyclic compound library, which comprises the following steps: Construction of a library of cyclic compounds based on the following: 1) A solid support G is directly or indirectly bound to a molecule M containing a photocleavable group to obtain GM. ; 2) Perform one of Method 1, Method 2, or Method 3; Method 1: Follow steps a1 to g1; a1. Reactively bond GM to the closed ring A-terminated molecule A to obtain GMA; b1. GMA is reactively linked to a linker L1 having at least three functional groups to form GMA- Get L1; c1. GMA-L1 is reacted sequentially with the starting nucleotide molecule HP and the open primer OP. to attach the starting nucleotide molecule HP to the linker L1 to obtain GMA-L1-HP-OP; d1. The product obtained in the previous step is converted into building block C 1 and building block C 1 Corresponding to DNA tag 1 and react with each other to form building block C 1 L 1 , DNA tag 1 Combined into the OP , GMA-L1(-HP-OP-tag 1 )-C 1 get; e1. Define the binding reaction of the corresponding building blocks and DNA tag sets as an extension step The building blocks are spliced sequentially to form a chain, and the building blocks are The extension step is repeated so that the corresponding DNA tags are sequentially spliced to form a chain. Repeat, GMA-L1(-HP-OP-tag 1 -・・・・・・-tag n )-C 1 -・・・・・・-C n Get it here where 2≦n≦7, and n is a positive integer; f1. The product obtained in step e1 is reacted with the closed-circular B-terminal molecule B and the closed-circular primer CP. The closed ring B is converted to C. n , tag closing primer CP n Here, HP-OP-ta g 1 -・・・・・・-tag n The complete DNA coding sequence is formed with -CP, and GMA-L1(-DNA)-C 1 -... -C n -B, that is, compound library S1'' is obtained. g1. The product obtained in the previous step is decomposed under a light source to separate M from A, and AL 1(-DNA)-C 1 -・・・-C n -B, i.e., compound library S1' is obtained; Method 2: Follow steps a2 to g2, but you can swap the order of steps e2 and f2; a2. Reactively linking GM to a linker L1 having at least three functional groups to form GM-L1 obtain; b2. GM-L1 is reacted sequentially with the starting nucleotide molecule HP and the open primer OP. Binding the starting nucleotide molecule HP to a solid support G to obtain OP-HP-GM-L1; c2. OP-HP-GM-L1 is used as building block C 1 and building block C 1 DNA tag corresponding to tag 1 and opposite By reacting the compound, building block C 1 to L1, and the DNA tag 1 Combine with OP and tag 1 -OP-HP-GM-L1-C 1 of obtain. d2. Define the binding reaction of the corresponding building blocks and DNA tag sets as an extension step. The building blocks are spliced sequentially to form a chain, and the building blocks are The extension step is repeated so that the corresponding DNA tags are sequentially spliced to form a chain. Repeat, tag n -・・・・・・-tag 1 -OP-HP-GM-L1-C 1 ....-C n Here, 0 ≦n≦7, where n is an integer; e2. The product obtained in the previous step is reacted with the cyclic A-terminal molecule A, and the cyclic A-terminal molecule A is C n to be bonded to; f2. The product obtained in the previous step is used as building block C n+1 , ...., C n+m and The corresponding DNA tags n+1 , ..., tag n+m and the extension step described Therefore, the reaction proceeds sequentially to form building block C n+1 to the linker L1, and the DNA tag tag n+1 Tag n Combined with After step e2 and step f2, tag n+m -・・・・・・-tag 1 -OP-HP-GM-L1(-C 1 ... ...C n -A)-C n+1 ....-C n+m where 0≦n≦7, 0≦m≦7, and n and m are integers. , 2≦n+m≦7. g2. The product obtained in the previous step is reacted with the closed-circular B-terminal molecule B and the closed-circular primer CP. The closed ring B is converted to C. n+m Tag the closing primer CP n+m where HP -OP-tag 1 -・・・・・・-tag n+m The complete DNA coding sequence is formed in -CP, and DNA-GM-L1(-C 1 ・ ・・・・・-C n -A)-C n+1 ...C n+m -B, i.e., compound library S2' is obtained; Method 3: Follow steps a3 to g3, but you can swap the order of steps e3 and f3; a3. Reactively linking GM with a linker L1 having at least tetrafunctional groups to form GM-L1 obtain; b3. GM-L1 is reacted sequentially with the starting nucleotide molecule HP and the open primer OP. ligating the starting nucleotide molecule HP to the linker L1 to obtain GM-L1-HP-OP; c3. GM-L1-HP-OP is synthesized by cleaving the building block C1 and the DNA tag tag corresponding to the building block C1. 1 and Each reaction produces building block C 1 to L1, and the DNA tag 1 GM-L1(-HP-OP) -tag 1 )-C 1 get; d3. Define the binding reaction of the corresponding building blocks and DNA tag sets as an extension step The building blocks are spliced sequentially to form a chain, and the building blocks are The extension step is repeated so that the corresponding DNA tags are sequentially spliced to form a chain. Repeat, GM-L1(-HP-OP-tag 1 -・・・・・・-tag n )-C 1 -・・・・・・-C n where , 2≦n≦7, where n is a positive integer; e3. The product obtained in the previous step is reacted with the cyclic A-terminal molecule A, and the cyclic A-terminal molecule A is C n to be bonded to; f3. The product obtained in the previous step is converted into building block C n+1 ,・・・・・・,C n+m and The corresponding DNA tags n+1 , ..., tag n+m and the extension step described. Then, the compound C is reacted in sequence. n+1 to the linker L1, and the DNA tag tag n+1 Tag n Bind to After step e3 and step f3, GM-L1(-HP-OP-tag 1 ・・・・・・-tag n+m )(-C 1 ... ...-C n -A)-C n+1 ....-C n+m where 0≦n≦7, 0≦m≦7, n and m are integers, 2≦n+m≦7. g3. The product obtained in the previous step is reacted with the closed-circular B-terminal molecule B and the closed-circular primer CP. The closed ring B is converted to C. n+m Tag the closing primer CP n+m where HP -OP-tag 1 -・・・・・・-tag n+m The complete DNA coding sequence is formed in -CP, and GM-L1(-DNA)(-C1 ...C n -A)-C n+1 ....-C n+m -B, i.e., compound library S3' is obtained. ru; 3) Cyclization of the compound library S1', S2', or S3' in the presence of cyclooxygenase The reaction is carried out such that the ring-closed A-end molecule A reacts with the ring-closed B-end molecule B to form a ring, and each 【Chemistry 1】 , i.e., to obtain a cyclic compound library S1; or 【Chemistry 2】 , i.e., a cyclic compound library S2 is obtained; or 【Transformation 3】 , i.e., a cyclic compound library S3 is obtained.
2. The solid phase carrier G is one or more of PEG resin, PEGA resin, TentaGel resin, and solid phase carrier CPG.
2. The method of claim 1, wherein the compound is selected from the group consisting of:
3. The solid support G has one active functional group R1, R1 being amino; or the solid support G has two active functional groups R1, R1 being amino; The activated functional groups R1 and R1' are characterized in that R1 is amino and R1' is carboxy. The method according to claim 2.
4. The molecule M containing a photocleavable group has at least two activating functional groups represented by R2 and R3. R2 is an activated functional group that binds to the solid support G, and R3 is a bond or terminal molecule A that is closed by ring A. or an activated functional group responsible for binding of the linker L1. Law.
5. R2 is present in an unprotected form and R3 is present in a protected form. The method according to claim 4, characterized in that
6. 5. The method of claim 4, wherein the molecule M containing a photocleavable group can be How to: 【Chemistry 4】 where R3 is located on the C atom directly bonded to the benzene ring of the side chain adjacent to the nitro group. R2 is 【Transformation 5】 is located at the C atom on the benzene ring, and R2 is spaced apart by one or more covalent bonds. or R2 is spaced apart by one or more covalent bonds from the C atom to which R3 is attached. The benzene ring is bonded to zero, one or more side chains that do not interfere with the bonding reaction of R2 and R3. Alternatively, it may contain a substituent.
7. The molecule M containing a photocleavable group can be selected from the following structures: The method according to item 6: 【Transformation 6】 wherein R3 may be selected from -OH, -NH2, -NHNH2, -N3, Cl, Br; R2 is carboxy. It is represented by a sil group.
8. The cyclized A-terminal molecule A and the cyclized B-terminal molecule B are cyclized by a cyclooxygenase cyclization reaction. The terminal molecule A is removed in part or in whole from its molecular fragments; the closed ring A terminal molecule A is It has two activating functional groups, R4 and R5; R4 is the activating functional group involved in the cyclooxygenase ring closure reaction. R5 is the bond to the linker L1 or building block; After the ring closure reaction, R5 is maintained in the ring structure of the cyclic compound molecule; R4 and R5 are present independently in a form protected by a protecting group or in an unprotected form. The method of claim 1, wherein R4 and R5 do not interfere with each other's binding reaction.
9. The molecular structure of molecule A at the A-terminal of the ring closure is The molecule is composed of two parts: a molecular fragment A1 that is removed during the ring closure reaction, and a molecular fragment A0 that is retained in the ring during the ring closure reaction. R4 is located on the molecular fragment A1 that is removed during the ring closure reaction by cyclooxygenase. and R5 is located on a molecular fragment A0 that is retained in the ring during the ring-closure reaction. The method according to claim 8.
10. Molecular fragment A0 has a site-blocking group in its structure, and the site-blocking group is directly attached to R5; The site-blocking group is an amino acid residue consisting of one or more amino acids. Item 9. The method according to item 9.
11. The site-blocking group is an amino acid residue consisting of 1 to 10 amino acids. The method of claim 10.
12. R4 is present in a protected form with an unprotected group and R5 is present in a protected form with a protected group.
9. The method of claim 8, wherein the ionic liquid is present in a soluble form.
13. R4 is an activated functional group that complementarily pairs with R3 of the molecule M containing a photocleavable group. The method according to claim 8, wherein
14. The structure of the molecular fragment A1, which is removed from the molecular structure of molecule A at the A-terminal of the closed ring, is 10. The amino acid sequence according to claim 9, wherein the amino acid sequence is an amino acid sequence consisting of 10 or more amino acids. How to do it.
15. The amino acid sequence of the portion A1 removed from the molecular structure of molecule A at the A-terminus of the closed ring is: FAGDDA 10. The method according to claim 9, characterized in that it is E, AYDGE, OCam-Leu, FL, AL, GL, HL or HV. How to do it.
16. The closed-ring A-terminal molecule A is a peptide chain consisting of at least three amino acids. The method of claim 8, wherein the characteristic is
17. In the method 1, the linker L1 has at least three activating functional groups R6, R7 and R8, and R6 and R7 and R8 are independently protected by a protecting group or not protected by a protecting group. R6, R7 and R8 can exist independently, and R6, R7 and R8 do not interfere with each other's bonding reaction; R7 is an activated functional group that forms a complementary pair with the activated functional group R5 on the terminal molecule A, and R7 is the closed ring A terminal is an activated functional group that forms a complementary pair with the activated functional group R5 on molecule A; The method of claim 1.
18. In the method 2, the linker L1 has at least three activating functional groups R6, R7 and R8; R6, R7 and R8 are either protected by a protecting group or not protected by a protecting group can exist independently of each other, and R6, R7 and R8 do not interfere with each other's binding reaction; R6 is an activating functional group that complements the activating functional group R3 of the molecule M containing a photocleavable group. , R7 is building block C 1 R8 is the activated functional group spliced by reacting with Rock C n+1 The method of claim 1, wherein the activated functional group is spliced by reacting with 。
19. In the method 3, the linker L1 has at least four activated functional groups R6, R6', R7 and R8 R6, R6', R7 and R8 are each independently protected by a protecting group or unprotected; R6, R6', R7 and R8 can exist independently, and R6, R6', R7 and R8 do not interfere with each other's binding reaction. R6 is an activating functional group that complements the activating functional group R3 of the molecule M containing the photocleavable group. and R6' is an activated functional group spliced in response to the starting nucleotide molecule HP; The spliced activated functional group, R7 is the building block C 1 reacts with and is spliced R8 is the activated functional group of building block C n+1 Activated spliced in response to The method of claim 1 , wherein the functional group is a hydroxyl group.
20. The linker L1 has a degradable functional group R L Contains R L The linker L1 is decomposed into two The two molecular fragments are divided into molecular fragments consisting of R6 and R6', respectively, and The method according to claim 19, characterized in that the molecular fragment consists of R7 and R8.
21. The decomposable functional group R L is different from the molecule M containing an acid-cleavable group or a photo-cleavable group.
21. The method of claim 20, wherein the photocleavable group has a cleavage wavelength.
22. The linker L1 is composed of two trifunctional linkers L1', L1'', and a linker bonded between L1' and L1''. and the degradable functional group R L represents the molecular structure of the linker L0 wherein L1' has three activating functional groups R6, R6', and R6'', and L1'' has three L0 has two activated functional groups R7 and R7', and R7 is R6' is connected to R6' in a complementary pairing reaction, and R7' is connected to R8' in a complementary pairing reaction.
21. The method of claim 20.
23. The method according to claim 22, characterized in that the linker L0 is selected from the following structures: Law: 【Transformation 7】
24. The starting nucleotide molecule HP is linked to an activated functional group of the linker L1 or an activated functional group of the solid support G.
10. The compound according to claim 1, characterized in that it has an activating functional group R, R which reacts with the group in a complementary pairing formation. The method described.
25. The starting nucleotide molecule HP has an activated functional group R9 as an amino group, and is complementary to R9. The activated functional group of the linker L1 or the activated functional group of the solid support G is carboxyl 25. The method of claim 24, wherein the aryl group is a group.
26. The building block is a small molecule compound having at least two active functional groups. The method according to claim 1 .
27. In the method 1, each building block is spliced sequentially to form building block C 1 No. 1 The activated functional group of is responsible for splicing with the linker L1, and the first The activated functional group is sequentially spliced with the second activated functional group of the previous building block, completing the synthesis. Block C n The second activated functional group of the cyclized B molecule is responsible for splicing with the closed B-terminal molecule B; The first activated functional group and the second reactive functional group are not simultaneously present in unprotected form. The functional group and the second activated functional group do not interfere with each other, and the third functional group is protected by a protecting group. and can be used for the subsequent modification and preparation of compounds.
27. The method of claim 26.
28. In the method 2 or 3, the building block C 1 The first activated functional group of the linker L1 responsible for splicing with one activated functional group, C 1 and C n The first of each building block between Activated functional groups and building blocks C n The first activated functional group of the second building block of the previous building block is Sequential splicing with activated functional groups to form building block C n The second activated functional group in the ring-closing A Responsible for splicing with terminal molecule A; building block C n+1 The first activated functional group is a linker - Responsible for splicing with other activating functional groups of L1, C n+1 and C n+m Each building block between Building Block C n+m The first activated functional group of the building block is sequentially linked to the second activated functional group of the previous building block. Spliced and synthesis block C n+m The second activated functional group of the ring B is the bond to the molecule B. Responsible for licencing; the first activated functional group and the second reactive functional group are not simultaneously protected and the first activating functional group and the second activating functional group do not interfere with each other.
27. The method of claim 26, wherein
29. Adjacent building blocks are bonded by the following chemical bonds: amide bond, or ester bond, amide They are bonded by bonds such as ester bonds, acid bonds, amine bonds, or imine bonds.
29. The method according to claim 27 or 28,
30. The building block is a compound having both an amino group and a carboxyl group as biactive functional groups.
27. The method of claim 26, wherein the compound is a mixture of the above.
31. The building blocks may be substituted or unsubstituted dicarboxylic acids, substituted or unsubstituted diamines, substituted or unsubstituted diamines, or unsubstituted diols, α,β-unsaturated aldehydes, α,β-unsaturated ketones, α,β-unsaturated Acid, reactive groups (hydroxyl group, amine group, aldehyde group, carboxyl group, sulfonic acid carbon-carbon double or triple bonds containing two or more carbon-carbon bonds (esters, or halogens) Aryl cyclic compounds containing the above reactive groups, natural or unnatural amino acids, N-substituted aryl 27. The method of claim 26, wherein the amino acid is selected from the group consisting of hydroxybenzoates, ...
32. The building block further comprises a backbone structure, and the backbone structure is bonded to a ring.
26. The compound according to claim 26, characterized in that it is bonded to the ring or in the form of a side chain of the ring. The method described below.
33. At least one of each of said building blocks comprises a backbone structure, 3. The structure of claim 3, wherein the structure has a substrate structure for E3 ligase that can bind to E3 ligase.
2. The method according to claim 2.
34. 33. The method of claim 32, wherein the backbone structure is selected from the following: method; 【Transformation 8】
35. each said building block comprises a total of at least one cyclic outer chain; 33. The method of claim 32.
36. each said building block comprises a total of at least two cyclic outer chains, 33. The compound according to claim 32, wherein at least two are chemically linked to form a bicyclic ring. The method described.
37. The DNA tags are sequentially ligated by DNA ligase; in the extension step, the DNA tags The splicing reaction between the building blocks corresponding to the DNA tags and the building blocks and the strands of the DNA tag are each completed to be extended. The method described below.
38. The ring-closed B-terminal molecule B is a compound having a dual reactive functional group, and the two reactive groups The functional groups are represented by R10 and R11, respectively; R10 reacts with the second activated functional group of the last building block. R11 is the activating functional group responsible for the ring-closing reaction. R10 and R11 are each independently a functional group protected by a protecting group. or may be in the form of an unprotected group, and R10 and R11 may be bonded to each other.
2. The method of claim 1, characterized in that it is non-interfering.
39. R10 is present in a protected form with an unprotected group, and R11 is present in a protected form with a protected group.
39. The method of claim 38, wherein the compound is in the form
40. The two activated functional groups R10 and R11 of the closed ring B terminal molecule B are one amino group and the other 39. The method of claim 38, wherein the group is a carboxy group.
41. The closed-ring B-terminal molecule B is a peptide chain consisting of 2 to 10 amino acids.
41. The method of claim 40,
42. 41. The method according to claim 40, wherein the closed ring B-terminal molecule B is an Fmoc-protected dipeptide. method.
43. The molecular structure of the closed-ring B-terminal molecule B is characterized by having amino acid residues GL, LL, QL, KL, GF, and Gl.
41. The method of claim 40, wherein the signal is a signal.
44. In the step 3), the compound library S1', S2' or S3' is selected from the group consisting of cyclooxygenase (Cyclooxygenase) and cyclooxygenase (Cyclooxygenase). In the presence of enzyme, the ring-closing A-terminal molecule A reacts with the ring-closing B-terminal molecule B to form an amide. A bond is formed to form a ring; in this ring-forming reaction, the free end of molecule B is activated by the closed ring B. The functional group reacts with the cyclic A-terminal molecule A, and a part or all of the cyclic A-terminal molecule A is removed. The free end activated functional group of molecule B binds to the removed residue to form a ring structure. wherein the cyclooxygenase is selected from the group consisting of ligases VyPAL2, Butelase1, PatG, PagG, and omi niligase-1, PCY1, or OaAEP1B&3-5. Item 1. The method according to item 1.
45. The ring structure formed is a single ring, a double ring, or a ring structure having a side chain.
45. The method of claim 44, wherein
46. The temperature of the enzymatic ring-closure reaction is 25 to 45°C; preferably, the temperature of the enzymatic ring-closure reaction is 30 to 45°C. More preferably, the temperature of the enzymatic ring-closure reaction is 35 to 40°C.
44. The method according to claim 44.
47. The pH of the enzymatic cyclization reaction is 4.5 to 6.0; preferably, the pH of the enzymatic cyclization reaction is 4.8 to 5.
5. More preferably, the pH of the enzymatic ring-closure reaction is 4.9 to 5.
3. The method described.
48. The reaction time of the enzymatic ring-closure reaction is 12 hours to 48 hours; preferably, the reaction time of the enzymatic ring-closure reaction is The reaction time for the enzymatic ring closure reaction is preferably 18 to 36 hours; more preferably, the reaction time for the enzymatic ring closure reaction is preferably 20 to 24 hours.
45. The method of claim 44, wherein:
49. The enzymatic ring closure reaction is characterized by adjusting the pH using a sodium acetate buffer solution.
45. The method of claim 44.
50. Disodium ethylenediaminetetraacetate, sodium chloride, and TCEP in the enzyme cyclization reaction system 45. The method of claim 44, further comprising adding
51. The compound library S3' is first subjected to a decomposition reaction under a light source to cleave M from L1, and L1(-C 1 ....-C n -A)-C n+1 ....-C n+m -B, i.e., compound library S4 Then, the compound library S4' is subjected to a ring closure reaction in the presence of cyclooxygenase. and reacting the ring-closed A-end molecule A with the ring-closed B-end molecule B to form a ring, 【Chemistry 9】 , i.e., to obtain cyclic compound library S4; Alternatively, the compound library S3 is subjected to a decomposition reaction under a light source to cleave M from L1, 【Chemistry 10】 10. The method according to claim 1, wherein compound library S4 is obtained.
52. A library of cyclic compounds characterized by the following general structural formula: 【Chemistry 11】 where 2≦n≦7, and n is a positive integer; L1 is at least a trifunctional linker, the DNA coding sequence is linked to L1, and L1 and the DNA coding sequence are linked by amide bonds; C1 to Cn are sequentially linked double bonds. A is a building block with an activated functional group. A represents a closed-ring A-terminal molecule, which is an amino acid residue. B represents the closed-ring B-terminal molecule and is an amino acid residue; L1 and A represent an amide bond or an ester bond. Bonded by a bond; Building Block C n is connected to B by an amide or ester bond A and B form a peptide bond in the presence of cyclooxygenase to form a ring. Complete.
53. A library of cyclic compounds characterized by the following general structural formula: 【Chemistry 12】 where 0≦n≦7, 0≦m≦7, n and m are integers, and 2≦n+m≦7; L1 is at least a trifunctional linker molecule, and the DNA coding sequence is attached to the solid support G. and G is linked to the DNA coding sequence by an amide bond; C 1 ~C n are combined in order C is a building block with a dual activated functional group. n+1 ~C n+m is the number of times that two is a building block with a heavily activated functional group; G represents a solid support and M contains a photocleavable group A indicates a closed ring A-end molecule, which is an amino acid residue; B indicates a closed ring B-end molecule, which is an amino acid residue Showing the end molecule; Building Block C n is bonded to A by an amide or ester bond Building block C n+m is linked to B by an amide or ester bond A and B form a peptide bond in the presence of cyclooxygenase to form a ring.
54. A library of cyclic compounds characterized by the following general structural formula: 【Chemistry 13】 where 0≦n≦7, 0≦m≦7, n and m are integers, and 2≦n+m≦7; L1 is at least a tetrafunctional linker, the DNA coding sequence is linked to L1, and L1 is linked to the DNA coding sequence by an amide bond; C 1 ~C n are sequentially bonded double active C is a building block having a functionalizing group. n+1 ~C n+m is a doubly activated functional group bonded in turn G represents a solid support, and M represents a molecule containing a photocleavable group; indicates a closed-ring A-terminal molecule that is an amino acid residue; B indicates a closed-ring B-terminal molecule that is an amino acid residue. Building block C n is linked to A by an amide or ester bond; synthesis Block C n+m is linked to B by an amide or ester bond; A and B are In the presence of cyclooxygenase, a peptide bond is formed to form a ring.
55. A library of cyclic compounds characterized by the following general structural formula: 【Chemistry 14】 where 0≦n≦7, 0≦m≦7, n and m are integers, and 2≦n+m≦7; L1 is at least a tetrafunctional linker, the DNA coding sequence is linked to L1, and L1 is linked to the DNA coding sequence by an amide bond; C 1 ~C n are doubles that are concatenated in order. C is a building block having an activated functional group. n+1 ~C n+m are sequentially combined double activations A is a building block with a functional group; A represents a closed ring A-terminal molecule that is an amino acid residue; B represents The molecule at the B end of the ring is an amino acid residue; building block C n is an amide bond or an ester bond. A is connected to building block C via a bond; n+m is an amide or ester bond A and B are bound to B by a peptide bond in the presence of cyclooxygenase. to form a ring.
56. Each of said building blocks is a substituted or unsubstituted amino acid, a substituted or unsubstituted dicarboxylic acid, Substituted or unsubstituted diamines, substituted or unsubstituted diols, α,β-unsaturated aldehydes, α , β-unsaturated ketones, α,β-unsaturated acids, natural or unnatural amino acids, N-substituted amino acids 56. The method according to claim 52, wherein the carboxylic acid is independently selected from the group consisting of carboxylic acids, ... A library of cyclic compounds.
57. At least one of each of said building blocks comprises a backbone structure, 57. The method of claim 56, wherein the structure has an E3 ligase substrate structure that binds to an E3 ligase. The cyclic compound library described.
58. 57. The method of claim 56, wherein the backbone structure is selected from the following: Cyclic Compound Library: 【Chemistry 15】
59. each said building block comprises a total of at least one cyclic outer chain; 58. The cyclic compound library according to claim 57.
60. Each of said building blocks comprises a total of at least two cyclic outer chains, and at least two cyclic 58. The method of claim 57, wherein the outer chains are chemically linked to form a bicyclic structure. A library of cyclic compounds.
Citation Information
Patent Citations
Peptide libraries
CN102471772A