Pain relievers for osteoarthritis of the knee and periarthritis of the shoulder
Endothelin A receptor antagonists like bosentan address the underlying causes of synovial pain in osteoarthritis and periarthritis by inhibiting endothelin-1, reducing NGF expression and myofibroblast activity, providing a fundamental treatment for these conditions.
Patent Information
- Application Number
- JP2023011513
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-01-30
- Publication Date
- 2026-03-18
AI Technical Summary
Current treatments for osteoarthritis of the knee and periarthritis of the shoulder are primarily symptomatic and lack a fundamental approach, with the underlying mechanisms of pain and stiffness not well understood, particularly involving nerve growth factor (NGF) and myofibroblast expression in synovial tissue.
Administration of an endothelin A receptor antagonist, such as bosentan, to inhibit the action of endothelin-1, thereby reducing synovial pain by suppressing NGF expression and myofibroblast activity in the synovial tissue.
The endothelin A receptor antagonist effectively reduces joint pain in osteoarthritis of the knee and periarthritis of the shoulder, improving quality of life and preventing loss of independence in elderly patients by addressing the underlying causes of synovial symptoms.
Smart Images

Figure 2026049047000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an agent for improving pain in osteoarthritis of the knee and periarthritis of the shoulder.
Background Art
[0002] Osteoarthritis of the knee is a disease in which cartilage of the knee joint degenerates and disappears with aging, causing inflammation and deformation of bone tissue, further resulting in pain and swelling, and leading to a decline in knee joint function. It is considered that there are 10 million patients in Japan alone, and including potential patients, 30 million people are suffering from osteoarthritis of the knee. Due to the progress of aging, the number of patients with osteoarthritis of the knee tends to increase.
[0003] In osteoarthritis of the knee, patients experience severe pain during movements that place a load on the knee, such as walking or ascending / descending stairs, and stiffness and swelling occur in the knee joint area, restricting the range of motion of the knee. Therefore, osteoarthritis of the knee causes a decline in the QOL of elderly patients and can also lead to loss of independence. Thus, dealing with this disease has important social significance. However, almost all of the current treatments are symptomatic, and at present, no fundamental treatment method has been established.
[0004] Here, pathological changes in the synovium of the knee joint are involved in the occurrence of pain and stiffness in the knee joint in osteoarthritis of the knee (Non-Patent Document 1). Regarding "pain" among the symptoms of osteoarthritis of the knee, since a neutralizing antibody against nerve growth factor (NGF), which is a type of neurotrophic factor, exhibits a strong pain inhibitory effect, it is considered that NGF is involved in the occurrence of pain in osteoarthritis of the knee (Non-Patent Document 2). However, the mechanism by which the expression of NGF, which is the cause of pain, is induced has not been known until now. Also, although there is a report that myofibroblasts appear in synovial tissue in osteoarthritis of the knee (Non-Patent Document 3), its pathological significance has been unclear.
[0005] Periarthritis of the shoulder is a disease characterized primarily by shoulder joint pain and limited range of motion, and it most commonly affects people in their 40s to 60s. The prevalence in the general population is estimated to be 2-5% (Non-patent Literature 4), but, like osteoarthritis of the knee, the pathogenesis is not well understood, and currently, there is no established drug therapy that is highly effective. [Prior art documents] [Non-patent literature]
[0006] [Non-Patent Document 1] Remst DFG, et al. Rheumatology 2015; 54: 1954-1963. [Non-Patent Document 2] Tive L, et al. J Pain Res 2019; 12: 975-995. [Non-Patent Document 3] Kragstrup TW, et al. BMC Rheumatol 2019; 3: Article number: 46. [Non-Patent Document 4] Mertens M, et al. Rheumatol Int 2022; 42: 925-936. [Overview of the project] [Problems that the invention aims to solve]
[0007] The present invention aims to provide a novel drug effective in improving pain associated with osteoarthritis of the knee and periarthritis of the shoulder. [Means for solving the problem]
[0008] The present inventors have found that administration of an endothelin A receptor antagonist to patients with osteoarthritis of the knee reduces synovial symptoms, including tenderness; that myofibroblast expression is enhanced in the synovial tissue of patients with osteoarthritis of the knee exhibiting synovial symptoms; and that statistically significant positive correlations are observed between NGF expression and the expression of ET-1, ETA, and α-smooth muscle actin in the synovial tissue of patients with osteoarthritis of the knee. The present invention is based on these findings.
[0009] The present invention provides the following inventions. [1] A synovial pain reliever for arthritis, comprising an endothelin A receptor antagonist as the active ingredient, wherein the arthritis is osteoarthritis of the knee or periarthritis of the shoulder. [2] The pain reliever described in [1] above, wherein the arthritis is osteoarthritis of the knee. [3] The pain reliever described in [2] above for improving joint pain caused by movements that put a load on the knee joint and / or joint pain at rest in patients with osteoarthritis of the knee. [4] The pain reliever described in [1] above, wherein the arthritis is periarthritis of the shoulder joint. [5] The pain reliever described in [4] above for improving joint pain caused by movements that put a load on the shoulder joint and / or joint pain at rest in patients with periarthritis of the shoulder joint. [6] The pain reliever according to any of [1] to [5] above, wherein the endothelin A receptor antagonist is one or more selected from the group consisting of bosentan, ambrisentan, macitentan, and clazosentan. [7] A pain reliever according to any of the above [1] to [5], wherein the endothelin A receptor antagonist is bosentan. [8] The pain reliever described in [7] above, which administers bosentan at a dose of 125 mg to 250 mg per day to adults.
[0010] According to the present invention, joint pain, one of the symptoms that afflicts patients with osteoarthritis of the knee and periarthritis of the shoulder, can be improved by addressing its underlying cause. Therefore, the present invention is advantageous in that it contributes to improving the quality of life and preventing loss of independence in elderly patients. [Brief explanation of the drawing]
[0011] [Figure 1] Figure 1 shows the pain-reducing effect of oral administration of bosentan on osteoarthritis of the knee (Example 1). Pain at the start of bosentan administration (BL) and pain 2 to 4 weeks after the start of administration (FU) were evaluated. A shows the results evaluated using the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC), B shows the results evaluated using the Japanese Knee Injury Osteoarthritis Outcome Score (J-KOOS), and C shows the results evaluated using the Visual Analogue Scale (VAS). The solid, dotted, dashed, and dashed lines correspond to four patients with osteoarthritis of the knee. In all evaluation methods, a higher score indicates more severe pain, and a lower score indicates less severe pain. [Figure 2] Figure 2 shows a comparison of α-smooth muscle actin (ACTA2) expression levels in the synovial tissue of patients with osteoarthritis of the knee, with and without synovial symptoms (pain) (Example 2). Gene expression levels are relative values with β-actin (ACTB) set to 1, and are shown as mean values with standard deviation bars. Significant difference testing was performed using an unpaired t-test. **: p<0.01. [Figure 3] Figure 3 is a scatter plot showing the relationship between the gene expression levels of NGF in the synovial tissue of patients with osteoarthritis of the knee and the gene expression levels of (A) ET-1 (EDN1), (B) ETA (EDNRA), and (C) α-smooth muscle actin (ACTA2). The gene expression levels are shown as common logarithms, relative to β-actin (ACTB) which is set to 1. The regression equation, correlation coefficient, and the results of the significance test are shown in the graph. The regression line is also shown as a solid line in the graph. Detailed description of the invention
[0012] The endothelin A receptor antagonist, which is the active ingredient of the present invention, refers to a drug that acts on the endothelin A receptor (ETA) and inhibits the action of the agonist endothelin-1 (ET-1). Known endothelin A receptor antagonists include bosentan, ambrisentan, macitentan, and clazosentan. The pain-relieving agent of the present invention may contain one endothelin A receptor antagonist as an active ingredient, or two or more endothelin A receptor antagonists as active ingredients.
[0013] The pain-relieving agent of the present invention improves synovial pain in osteoarthritis of the knee, a type of arthritis. The knee joint has a structure in which the entire joint is enclosed in a joint capsule, and the inner surface of the joint capsule is covered with a thin membrane called the synovial membrane. In osteoarthritis of the knee, changes occur in this synovial tissue, and symptoms caused by changes in the synovial membrane, such as pain and stiffness (sometimes referred to as "synovial symptoms" in this specification), are observed. The pain-relieving agent of the present invention improves the pain caused by changes in the synovial membrane, i.e., synovial pain, among the synovial symptoms. Here, pain improvement includes not only reducing pain and eliminating pain, but also suppressing further worsening of pain. Furthermore, pain improvement also includes the treatment of pain.
[0014] As shown in the examples below, in the synovial tissue of patients with osteoarthritis of the knee exhibiting synovial symptoms, myofibroblast expression increased, and it was suggested that the action of ET-1 via ETA increased NGF expression in myofibroblasts, potentially causing synovial symptoms. Although not bound by the following theory, it is thought that in osteoarthritis of the knee exhibiting synovial symptoms, myofibroblasts are induced in the synovial tissue, and the action of endothelin-1 via the endothelin A receptor enhances NGF expression from myofibroblasts, resulting in pain. Therefore, administering an endothelin A receptor antagonist to patients with osteoarthritis of the knee exhibiting synovial symptoms can improve the pain of these symptoms by inhibiting the action of endothelin-1 and suppressing NGF expression. In other words, endothelin A receptor antagonists other than bosentan can be used as active ingredients to improve pain in osteoarthritis of the knee exhibiting synovial symptoms, similar to bosentan.
[0015] Furthermore, it has been reported that myofibroblasts appear in the synovial tissue of periarthritis of the shoulder, similar to osteoarthritis of the knee (Bunker TD and Esler CAN, J Bone Joint Surg Br 1995; 77-B: 677-83. and Rodeo SA, et al. J Orthop Res 1997; 15: 427-436.). Therefore, in periarthritis of the shoulder with synovial symptoms, it is thought that myofibroblasts are induced in the synovial tissue, and NGF expression from myofibroblasts is enhanced by the action of endothelin-1 via the endothelin A receptor, resulting in pain. In other words, the endothelin A receptor antagonist, which is the active ingredient of the present invention, is effective in improving synovial pain in periarthritis of the shoulder, a type of arthritis.
[0016] The pain-relieving agent of the present invention can be provided as a pharmaceutical or pharmaceutical composition. The pharmaceutical and pharmaceutical composition of the present invention comprises the active ingredient of the present invention and a pharmaceutically acceptable carrier.
[0017] The pain reliever of the present invention may be used in combination with other drugs other than the active ingredient of the present invention. That is, the pain reliever of the present invention may further contain other drugs other than the active ingredient of the present invention. In this case, the dosage form may be integrated as a combined preparation. Further, the pain reliever of the present invention may be administered as different preparations together with other drugs other than the active ingredient of the present invention. In this case, they may be administered simultaneously or at different times. According to another aspect of the present invention, a combination of the active ingredient of the present invention and other drugs is provided. The combination of the present invention can be used for improving pain in osteoarthritis of the knee or periarthritis of the shoulder, similar to the pain reliever of the present invention.
[0018] Examples of other drugs other than the active ingredient of the present invention include therapeutic agents for osteoarthritis of the knee or periarthritis of the shoulder. Such other drugs include, for example, non-steroidal anti-inflammatory analgesics, analgesics such as acetaminophen and tramadol hydrochloride. Further, as other drugs, sodium hyaluronate and corticosteroids, which are drugs directly administered into joints, are included.
[0019] When administering the active ingredient of the present invention, the administration route is not particularly limited as long as the effect of improving synovial pain in osteoarthritis of the knee or periarthritis of the shoulder can be obtained, but oral administration or parenteral administration (for example, intravenous administration, subcutaneous administration, intraperitoneal administration, intra-articular administration, transdermal administration) can be selected.
[0020] Examples of oral dosage forms include granules, powders, tablets (including sugar-coated tablets), pills, capsules, syrups, solutions, jellies, emulsions, and suspensions. As parenteral dosage forms, an appropriate dosage form can be selected according to the specific administration form. Examples include injections, suppositories, dressings, ointments, gels, and lotions. These preparations can be formulated using pharmaceutically acceptable carriers by methods commonly used in the art (for example, known methods described in the General Rules for Preparations of the Japanese Pharmacopoeia, 18th Edition). Examples of pharmaceutically acceptable carriers include excipients, binders, diluents, additives, fragrances, buffers, thickeners, colorants, stabilizers, emulsifiers, dispersants, suspending agents, preservatives, and the like.
[0021] The dosage of the endothelin A receptor antagonist, which is the active ingredient of the present invention, can be determined depending on the sex, age, and weight of the recipient, symptoms, dosage form, and route of administration. The daily dose of the active ingredient of the present invention for adults can be determined, for example, in the range of 0.0001 mg to 1000 mg, but is not limited thereto. Furthermore, when bosentan is administered orally as the active ingredient of the present invention, the daily dose for adults can be, for example, in the range of 125 mg to 250 mg. The above dose of bosentan can be administered once a day, or divided into 2 to 4 doses per day, preferably divided into 2 doses per day. In the present invention, the above dose of bosentan can also be administered for at least 1 week, preferably at least 2 weeks.
[0022] The pain-relieving agent of the present invention can improve synovial pain. Therefore, the pain-relieving agent of the present invention can be administered to patients who have synovial pain. The presence or absence of synovial pain can be determined by a physician's visual inspection, palpation, etc. Furthermore, since myofibroblasts are induced in the synovial tissue when synovial pain is present, the pain-relieving agent of the present invention can be administered to patients in whom myofibroblasts are induced in the synovial tissue.
[0023] In osteoarthritis of the knee, joint pain occurs due to movements that place a load on the knee joint (for example, walking, climbing stairs, bending and straightening the knee, and standing up). In some cases, pain may also occur at rest. The pain-relieving agent of the present invention can improve such joint pain in osteoarthritis of the knee.
[0024] In periarthritis of the shoulder joint, joint pain occurs when movements that place a load on the shoulder joint (for example, raising and lowering the arm, or rotating the arm backward). In some cases, pain may also occur at rest. The pain-relieving agent of the present invention can alleviate such joint pain in periarthritis of the shoulder joint.
[0025] The present invention provides a method for improving synovial pain in arthritis, comprising the step of administering an endothelin A receptor antagonist to a subject requiring it, wherein the arthritis is osteoarthritis of the knee or periarthritis of the shoulder. The improvement method of the present invention can be carried out according to the description of the agent of the present invention.
[0026] The present invention also provides the use of an endothelin A receptor antagonist as a synovial pain reliever for arthritis, or in an improved method of the present invention, wherein the arthritis is osteoarthritis of the knee or periarthritis of the shoulder. The use of the present invention can be carried out in accordance with the description of the agent of the present invention and the description of the improved method of the present invention.
[0027] The present invention also provides an endothelin A receptor antagonist and a composition comprising the same for use in improving synovial pain in arthritis, wherein the arthritis is osteoarthritis of the knee or periarthritis of the shoulder. These inventions can be carried out according to the description of the agent of the present invention. [Examples]
[0028] The present invention will be described more specifically based on the following examples, but the present invention is not limited to these examples.
[0029] Example 1: Effect of endothelin A receptor antagonist on osteoarthritis pain of the knee The effectiveness of bosentan, an endothelin A receptor antagonist, in reducing pain was investigated in patients with osteoarthritis of the knee exhibiting synovial symptoms such as tenderness and stiffness. Specifically, four patients with osteoarthritis of the knee exhibiting severe synovial symptoms (n=4) were orally administered two tablets (125 mg) of bosentan daily for two weeks. In two cases where sufficient pain relief was not achieved with bosentan administration, the dosage was increased to four tablets (250 mg) daily for another one to two weeks after the initial two tablets (125 mg) were administered daily for two weeks.
[0030] Changes in pain due to bosentan administration were evaluated using three methods: the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC), the Japanese Knee Injury Osteoarthritis Outcome Score (J-KOOS), and the Visual Analogue Scale (VAS). Specifically, pain at the start of bosentan administration (BL) and pain 2 to 4 weeks after the start of administration (FU) were evaluated using these methods. The results are shown in Figure 1. As is clear from Figure 1, all evaluation methods showed that bosentan administration reduced synovial pain in osteoarthritis of the knee with synovial symptoms.
[0031] Example 2: Expression of myofibroblasts in synovial tissue of patients with osteoarthritis of the knee Although there have been reports of myofibroblasts appearing in the synovial tissue of patients with osteoarthritis of the knee (Non-Patent Literature 3), its pathological significance has remained unclear until now. In this study, we investigated the relationship between the presence or absence of synovial symptoms in osteoarthritis of the knee and the expression of myofibroblasts in the synovial tissue.
[0032] Specifically, synovial tissue was collected from patients with osteoarthritis of the knee without synovial symptoms (n=12) and from patients with osteoarthritis of the knee with synovial symptoms (n=6). For patients without synovial symptoms, synovial tissue was collected from two locations in each of the 14 knees, for a total of 28 samples being analyzed. For patients with synovial symptoms, synovial tissue was collected from 2 to 6 locations in each of the 7 knees, for a total of 22 samples being analyzed. Of the 12 cases without synovial symptoms, synovial tissue was collected from 2 cases, and of the 6 cases with synovial symptoms, synovial tissue was collected from both knee joints (left and right) in 1 case.
[0033] Myofibroblast expression was analyzed using α-smooth muscle actin (ACTA2) gene expression as an indicator. Specifically, total RNA was extracted from approximately 100 mg of synovial tissue (wet weight) using the PureLink® RNA Mini Kit (Thermo Fisher Scientific), and cDNA was synthesized from this RNA using the PrimeScript® RT Master Mix (Takara Bio). Furthermore, the expression levels of ACTA2 and β-actin (ACTB) as an internal standard were determined using this cDNA by qPCR using FastStart® Essential DNA Green Master and LightCycler® (both Roche Diagnostics). The following primer sets were used for qRT-PCR.
[0034] ACTA2 Forward 5'- TCCTCCCTTGAGAAGAGTTACG -3' (Sequence ID 1) ACTA2 Reverse 5'- CATGATGCTGTTGTAGGTGGTT -3' (Sequence ID 2) ACTB Forward 5'- ATTAAGGAGAAGCTGTGCTACGTC -3' (Sequence No. 3) ACTB Reverse 5'- ATGATGGAGTTGAAGGTAGTTTCG -3' (Sequence ID 4)
[0035] The results are shown in Figure 2. As is clear from Figure 2, α-smooth muscle actin expression was elevated in patients with osteoarthritis of the knee who exhibited synovial symptoms compared to patients without synovial symptoms. This indicates that myofibroblast expression is elevated in the synovial tissue of patients with osteoarthritis of the knee who exhibited synovial symptoms.
[0036] Example 3: Expression of NGF in synovial tissue of patients with osteoarthritis of the knee In this example, we investigated the relationship between the expression of nerve growth factor (NGF) in the synovial tissue of patients with osteoarthritis of the knee and the expression of endothelin-1 (ET-1), endothelin A receptor (ETA), and α-smooth muscle actin (ACTA2).
[0037] Specifically, synovial tissue samples were collected from 2-3 locations in each of 27 knees of patients with osteoarthritis of the knee (n=23), and a total of 72 samples were used for analysis. The patients included 12 cases (14 knees, 28 samples) without synovial symptoms, 6 cases (7 knees, 22 samples) with synovial symptoms, and 5 cases (6 knees, 22 samples) with mild synovial symptoms. Of the 23 cases, synovial tissue samples were collected from both knee joints in 4 cases. The expression of NGF, ET-1, ETA, and ACTA2 was evaluated by qPCR. Specifically, total RNA was extracted from approximately 100 mg of wet weight synovial tissue using the PureLink® RNA Mini Kit (Thermo Fisher Scientific), and cDNA was synthesized from this RNA using the PrimeScript® RT Master Mix (Takara Bio). Furthermore, using this cDNA, the expression levels of NGF, ET-1, ETA, ACTA2, and β-actin (ACTB) as an internal standard were determined by qPCR using FastStart® Essential DNA Green Master and LightCycler® (both from Roche Diagnostics). The following primer sets were used for qRT-PCR.
[0038] NGF Forward 5'- CAACAGGACTCACAGGAGCA -3' (Sequence ID 5) NGF Reverse 5'- ACCTCTCCCAACACCATCAC -3' (SEQ ID NO: 6) ET-1 Forward 5'- CCAAGGAGCTCCAGAAACAG -3' (Sequence ID 7) ET-1 Reverse 5'- GATGTCCAGGTGGCAGAAGT -3' (Sequence No. 8) ETA Forward 5'- CTTCCTGGTTACCACTCATCAAC -3' (Sequence ID 9) ETA Reverse 5'- TGGTAAATGATCCTGAGCAGAGT -3' (Sequence ID 10) ACTA2 Forward 5'- TCCTCCCTTGAGAAGAGTTACG -3' (Sequence ID 1) ACTA2 Reverse 5'- CATGATGCTGTTGTAGGTGGTT -3' (Sequence ID 2)
[0039] Figure 3 shows scatter plots illustrating the relationship between NGF and the gene expression of ET-1, ETA, and ACTA2. As is clear from Figure 3, statistically significant positive correlations were observed between NGF expression and the expression of ET-1, ETA, and ACTA2 in the synovial tissue of patients with osteoarthritis of the knee.
[0040] As shown in Example 2, it was found that in the synovial tissue of patients with osteoarthritis of the knee exhibiting synovial symptoms, myofibroblast expression was elevated compared to patients without synovial symptoms. Furthermore, as shown in this example, statistically significant positive correlations were observed between NGF expression, endothelin-1 (ET-1) expression, endothelin A receptor (ETA) expression, and α-smooth muscle actin (ACTA2), a marker for myofibroblasts, in the synovial tissue of patients with osteoarthritis of the knee (Figure 3). Here, it is thought that NGF is involved in the development of pain in osteoarthritis of the knee (Non-Patent Literature 2). Furthermore, several studies have reported that myofibroblasts produce NGF during the process of wound healing in the skin or repair of damaged myocardium (Hasan W, et al. Cell Tissue Res 2000; 300(1): 97-109.; Drapeau J, et al. J Cell Physiol 2005; 204(1): 51-62.; Hasan W, et al. Brain Res 2006; 1124(1): 142-154.; and El-Helou V, et al. J Appl Physiol 2008; 104(1): 150-156). Although the exact mechanism is not yet clear, it has been reported that endothelin-1 induces NGF expression via ETA in cardiomyocytes (Ieda M, et al. J Clin Invest 2004; 113(6): 876-884.; Saygili E, et al. Cell Signal 2012; 24(1): 99-105.). Based on the results of the expression analysis described above, it is possible that synovial symptoms appeared in the synovial tissue of osteoarthritis patients as a result of myofibroblasts expressing NGF through a similar mechanism. In other words, it was suggested that in the synovial tissue of patients with osteoarthritis of the knee exhibiting synovial symptoms, myofibroblast expression increased, and that NGF expression in myofibroblasts increased due to the action of ET-1 via ETA, which may be causing synovial symptoms.These results are consistent with the effect of endothelin A receptor antagonist (bosentan) on reducing synovial pain in patients with osteoarthritis of the knee, as demonstrated in Example 1.
Claims
1. An endothelin A receptor antagonist is the active ingredient in a synovial pain reliever for arthritis, wherein the arthritis is osteoarthritis of the knee or periarthritis of the shoulder.
2. The pain-relieving agent according to claim 1, wherein the arthritis is osteoarthritis of the knee.
3. The pain-relieving agent according to claim 2, for improving joint pain caused by movements that place a load on the knee joint and / or joint pain at rest in patients with osteoarthritis of the knee.
4. The pain-relieving agent according to claim 1, wherein the arthritis is periarthritis of the shoulder joint.
5. The pain-relieving agent according to claim 4, for improving joint pain caused by movements that place a load on the shoulder joint and / or joint pain at rest in patients with periarthritis of the shoulder joint.
6. The pain reliever according to claim 2 or 4, wherein the endothelin A receptor antagonist is one or more selected from the group consisting of bosentan, ambrisentan, macitentan, and clazosentan.
7. The pain reliever according to claim 2 or 4, wherein the endothelin A receptor antagonist is bosentan.
8. The pain reliever according to claim 7, wherein bosentan is administered to adults at a dose of 125 mg to 250 mg per day.