Collagen production promoter and collagen degradation inhibitor

Abstract

The objective of the present invention is to provide a food-derived collagen production promoter and collagen degradation inhibitor that is effective and safe, and can be consumed on a daily basis. [Solution] The present invention provides a collagen production promoter and a collagen degradation inhibitor characterized by containing Bacopa monnieri, and a collagen production promoter and a collagen degradation inhibitor characterized by containing Bacopa monnieri and Vitis coignetiae. The collagen production promoter and collagen degradation inhibitor of the present invention exhibit excellent collagen production promoting and collagen degradation inhibiting effects, and can therefore be used as a food, quasi-drug, or pharmaceutical product that has preventive and ameliorative effects on various symptoms and diseases related to the decrease of collagen in the body.

Description

Technical Field

[0001] The present invention relates to a collagen production promoter and a collagen degradation inhibitor characterized by containing Bacopa monnieri. Furthermore, it relates to a collagen production promoter and a collagen degradation inhibitor characterized by containing Bacopa monnieri and grape.

Background Art

[0002] Collagen is a major structural protein that accounts for about one-third of mammalian tissues and is an essential component of many matrix tissues such as skin, bone, cartilage, blood vessels, cornea, gingiva, tendon, and ligament. Therefore, it is known that a decrease in collagen production can cause various diseases.

[0003] In the skin, fibroblasts and collagen are present in the dermis layer, and type I collagen accounts for 80% of the total collagen. With aging and ultraviolet rays, when collagen production in fibroblasts decreases and collagen degradation progresses due to an increase in matrix metalloproteinase (MMP), which is a collagen-degrading enzyme, the amount of collagen decreases, causing skin aging such as wrinkles and sagging. Therefore, in order to prevent and improve skin aging such as wrinkles and sagging and maintain an attractive appearance, it is important to promote collagen production and suppress degradation.

[0004] Collagen is also present in blood vessels and contributes to maintaining homeostasis such as maintaining elasticity and repairing wounds. In arteriosclerosis, plaques (lumps of lipids) are present in blood vessels, and when the plaques rupture, it can cause myocardial infarction, cerebral infarction, etc. Extracellular matrix such as collagen and elastin plays a role in stabilizing the plaques and preventing rupture. On the other hand, when MMP is activated in the plaques and the extracellular matrix is degraded, plaque rupture is caused. Therefore, in order to maintain the elasticity of blood vessels, prevent plaque rupture, and keep blood vessels healthy, it is important to promote collagen production in blood vessels and suppress degradation.

[0005] Furthermore, a decrease in collagen in the body is known to cause osteoporosis, arthritis, and gingival recession. Therefore, promoting collagen production and suppressing its breakdown is effective in preventing and improving osteoporosis, arthritis, and gingival recession.

[0006] As described above, collagen is an essential component in various tissues in the body, so promoting collagen production and suppressing excessive breakdown is important for maintaining collagen levels. From this perspective, sphingoids (Patent Document 1) and other food materials with collagen production-promoting effects have been proposed. In addition, extracts of Caesalpinia sappan (Patent Document 2) and other food materials with collagen production-promoting and collagen breakdown-inhibiting effects have been proposed. Given this situation, there is a need for the development of food-derived collagen production promoters and collagen breakdown inhibitors that are highly safe, can be taken over a long period of time, and are even more effective.

[0007] The inventors, after conducting studies using various food materials, discovered that Bacopa monnieri, a plant belonging to the Plantaginaceae family, possesses excellent collagen production-promoting and collagen degradation-inhibiting effects. Furthermore, they found that combining Bacopa monnieri with Vitis coignetiae significantly enhances both collagen production-promoting and collagen degradation-inhibiting effects. Prior art related to Bacopa monnieri includes known effects such as inducible nitric oxide synthase inhibition (Patent Document 3), anticonvulsant effects, antidepressant / anxiety-reducing effects, and antibacterial effects (Non-Patent Document 1). However, the collagen production-promoting and collagen degradation-inhibiting effects of Bacopa monnieri are completely unknown, and even more so, the collagen production-promoting and collagen degradation-inhibiting effects of combining Bacopa monnieri with Vitis coignetiae are completely unknown. [Prior art documents] [Patent Documents]

[0008] [Patent Document 1] Patent Application No. 2008-269806 [Patent Document 2] Patent Application No. 2009-135978 [Patent Document 3] Patent Application No. 2006-155273 [Non-patent literature]

[0009] [Non-Patent Document 1] Brain Sci. Vol.10(12) 964(2020) [Overview of the project] [Problems that the invention aims to solve]

[0010] The present invention relates to a collagen production promoter and a collagen degradation inhibitor characterized by containing Bacopa monnieri, and further to a collagen production promoter and a collagen degradation inhibitor characterized by containing Bacopa monnieri and Vitis coignetiae. [Means for solving the problem]

[0011] As a result of diligent research, the inventors of this invention have found that Bacopa monnieri has excellent collagen production promoting and collagen degradation inhibiting effects. Furthermore, they have found that combining Bacopa monnieri with Vitis coignetiae significantly enhances both the collagen production promoting and collagen degradation inhibiting effects.

[0012] The Bacopa monnieri used in this invention can be Bacopa monnieri, a member of the Plantaginaceae family. Bacopa monnieri, also known as Otomeazena, is a perennial aquatic plant distributed in tropical and subtropical regions. In Ayurveda, the traditional Indian system of medicine, it has been used to improve various symptoms, including anxiety. While there are no particular limitations on the part of the Bacopa monnieri used in this invention, it is preferable to use the whole plant, especially the leaves.

[0013] The wild grape used in this invention is Ampelopsis glandulosa, a member of the genus Ampelopsis in the family Vitaceae. Wild grape, also known as wild grape or snake grape, is a deciduous climbing shrub native to Japan and East Asia. The part of the wild grape used in this invention is not particularly limited, but examples include the entire plant or various parts (above-ground parts such as flowers, leaves, stems, fruits, pericarp, seeds, and roots), and it is especially preferable to use the above-ground parts.

[0014] The Bacopa monnieri and Vitis coignetiae used in this invention can be used as is, or processed by pressing, drying, crushing, or shredding as needed. Extracts obtained by extracting Bacopa monnieri or Vitis coignetiae as is or after the above processing can also be used. Examples of solvents for extraction include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, petroleum ether, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). These solvents may be used individually or in mixtures of two or more. Extraction of Bacopa monnieri used in this invention is preferably done with polar solvents such as water or lower alcohols, and ethanol extraction is particularly preferred. Furthermore, the wild grapes used in this invention are preferably extracted with a polar solvent such as water or a lower alcohol, and aqueous ethanol is particularly preferred.

[0015] The above extract may be used as is, or it may be treated as needed by concentration, dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, fermentation, etc. Furthermore, the extracted solution may be treated by concentration to dryness, spray drying, freeze-drying, etc., and used as a dried product.

[0016] The dosage of Bacopa monnieri and Grapevine used in this invention can be appropriately adjusted depending on the form of administration, purpose of use, age, body weight, etc. Bacopa monnieri can be administered orally once to several times a day in an extract of 0.05 to 2,000 mg per day, preferably in an extract of 0.5 to 100 mg per day. Grapevine can be administered orally once to several times a day in an extract of 0.1 to 2,000 mg per day, preferably in an extract of 1 to 100 mg per day. In some cases, a smaller amount than the above dosage range may be sufficient, and in other cases, it may be necessary to take an amount exceeding the range. Furthermore, regarding the method of adding the pharmacoactive ingredients in formulation, they may be added in advance or added during manufacturing, and the appropriate method should be selected considering workability.

[0017] The collagen production promoter and collagen degradation inhibitor of the present invention can be used as food, quasi-drug, or pharmaceutical. As food, they can be used in the form of tablets, soft capsules, hard capsules, granules, gummies, beverages, jellies, etc. As quasi-drugs and pharmaceuticals, they can be used as oral capsules, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, liquids, emulsions, etc., as well as parenteral external preparations, injections, etc. To achieve the objectives of the present invention, oral administration is more preferable.

[0018] The collagen production promoter and collagen degradation inhibitor of the present invention may, as necessary, contain ingredients commonly used in foods, quasi-drugs, or pharmaceuticals, such as excipients, stabilizers, lubricants, preservatives, binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH adjusters, preservatives, and fragrances, within limits that do not impair their effectiveness. Furthermore, they may also contain ingredients such as plant materials, polyphenols, vitamins, sugars, proteins, and oils and fats. [Effects of the Invention]

[0019] The collagen production promoter and collagen degradation inhibitor containing Bacopa monnieri of the present invention exhibit excellent collagen production promoting action and collagen degradation inhibiting action. Furthermore, the collagen production promoter and collagen degradation inhibitor containing Bacopa monnieri and grape also exhibit extremely excellent collagen production promoting action and collagen degradation inhibiting action. The collagen production promoter and collagen degradation inhibitor of the present invention are also effective for the prevention and improvement of various symptoms and diseases associated with the decrease of collagen in vivo, such as skin aging, arteriosclerosis, osteoporosis, arthritis, gingival recession, etc.

Mode for Carrying Out the Invention

[0020] The following examples are for illustrative purposes and the scope of the claims of the present invention is not limited to these examples in any way. The % of the content shown in the examples indicates weight %.

Examples

[0021] Production Example 1: Hot water extract of Bacopa monnieri 2 kg of purified water was added to 100 g of Bacopa monnieri and heated for extraction, and then the extract was concentrated and dried to obtain 9.5 g of solid matter.

[0022] Production Example 2: 50% ethanol extract of Bacopa monnieri 2 kg of 50% ethanol was added to 100 g of Bacopa monnieri and extracted at room temperature for 7 days, and then the extract was concentrated and dried to obtain 5.6 g of solid matter.

[0023] Production Example 3: Ethanol extract of Bacopa monnieri 2 kg of ethanol was added to 100 g of Bacopa monnieri and extracted at room temperature for 7 days, and then the extract was concentrated and dried to obtain 3.5 g of solid matter.

[0024] Production Example 4: Hot water extract of grape 2 kg of purified water was added to 100 g of grape and heated for extraction, and then the extract was concentrated and dried to obtain 7.2 g of solid matter.

[0025] Manufacturing Example 5: 30% Ethanol Extract of Wild Grape 100g of wild grapes was mixed with 2kg of 30% ethanol and extracted at room temperature for 7 days. The extract was then concentrated and dried to obtain 4.8g of solid matter.

[0026] Manufacturing Example 6: Grapevine Ethanol Extract 100g of wild grapes was mixed with 2kg of ethanol and extracted at room temperature for 7 days. The extract was then concentrated and dried to obtain 2.9g of solid material.

[0027] Next, we will give examples of formulations using Bacopa monnieri and Grapevine, but the present invention is not limited thereto. [Examples]

[0028] Prescription example 1: Tablets <Prescription> Component Content (%) 1. Bacopa monnieri hot water extract (Production Example 1) 1.0 2. Add maltitol so that the total amount becomes 100. 3. Cellulose 5.0 4. Sucrose fatty acid ester 3.0 <Manufacturing method> Components 1-3 were mixed, 10% water was added as a binder, and the mixture was granulated in a fluid bed. Component 4 was added to the formed granules and mixed, and then compressed into tablets to obtain 300 mg tablets. <Usage> Take 3 tablets per day.

[0029] Prescription Example 2: Beverages <Prescription> Component Content (%) 1. Bacopa monnieri 50% ethanol extract (Production Example 2) 0.05 2. Maltitol 5.00 3. Malic acid 1.00 4.Fragrance 0.50 5.Purified water 93.45 <Manufacturing method> Dissolve components 1-4 in a portion of component 5 by stirring. Then, add the remaining component 5 and mix, heat to 90°C, and fill into 50mL glass bottles. <Usage> Take one bottle (50mL) per day.

[0030] Prescription example 3: Granules <Prescription> Component Content (%) 1. Bacopa monnieri ethanol extract (Production Example 3) 1.5 2.Lactose 78.5 3. Cellulose 20.0 <Manufacturing method> Components 1-3 were granulated using a dry process to obtain granules. <Usage> Take one packet (1g) per day.

[0031] Prescription Example 4: Hard Capsules <Prescription> Component Content (%) 1. Bacopa monnieri hot water extract (Production Example 1) 6.0 2. Wild grape hot water extract (manufacturing example 4) 6.0 3. Sucrose fatty acid ester 3.0 4. Add cornstarch until the total amount is 100. <Manufacturing method> Components 1-4 were mixed and filled into No. 2 hard capsules with 250 mg each to obtain hard capsules. <Usage> Take two tablets per day.

[0032] Prescription Example 5: Soft Capsules <Prescription> Component Content (%) 1. Bacopa monnieri 50% ethanol extract (Production Example 2) 1.0 2. Grapevine ethanol extract (Production Example 6) 0.5 3. Add medium-chain triglyceride oil until the total amount is 100. 4. Beeswax 5.0 5. Glycerin fatty acid ester 5.0 6. Vitamin E 3.0 <Manufacturing method> Components 1-6 were mixed, 250 mg of the mixture was filled into a gelatin and glycerin coating, and after drying, soft capsules were obtained. <Usage> Take 3 tablets per day.

[0033] Prescription Example 6: Beverages <Prescription> Component Content (%) 1. Bacopa monnieri ethanol extract (Production Example 3) 0.02 2. Wild grape 30% ethanol extract (Production Example 5) 0.08 3. Maltitol 5.00 4. Malic acid 1.00 5.Fragrance 0.50 6.Purified water 93.40 <Manufacturing method> Dissolve components 1-5 in a portion of component 6 by stirring. Then, add the remaining component 6 and mix, heat to 90°C, and fill into 50mL glass bottles. <Usage> Take one bottle (50mL) per day. [Examples]

[0034] Test Example 1: Collagen production promoting and collagen degradation inhibiting effects of Bacopa monnieri (skin) Human dermal fibroblasts were cultured in DMEM containing 10% fetal bovine serum. Next, in serum-free DMEM, Bacopa monnieri hot water extract (Preparation Example 1), Bacopa monnieri 50% ethanol extract (Preparation Example 2), and Bacopa monnieri ethanol extract (Preparation Example 3) were added to a final concentration of 10 μg / mL and cultured for 24 hours. Cells were then harvested and gene expression analysis was performed. Gene expression for type I collagen (COL1A1) and matrix metalloproteinase 1 (MMP1), the major degrading enzyme for type I collagen, was evaluated by real-time PCR. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal standard. Gene expression in the sample-free state was set to 1, and the gene expression ratio was calculated.

[0035] Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT(array 1) TTGCAGTGGTAGGTGATGTTCTG (Sequence 2) Primer set for GAPDH TGCACCACCAACTGCTTAGC (Sequence 3) TCTTCTGGGTGGCAGTGATG (array 4) Primer set for MMP1 GGGAGATCATCGGGACAACTC (Sequence 5) TGAGCATCCCCTCCAATACC (sequence 6)

[0036] The results of Test Example 1 are shown in Table 1. Bacopa monnieri hot water extract (Production Example 1), Bacopa monnieri 50% ethanol extract (Production Example 2), and Bacopa monnieri ethanol extract (Production Example 3) promoted COL1A1 gene expression and suppressed MMP1 gene expression. From these results, the collagen production promoting and collagen degradation inhibiting effects of Bacopa monnieri in the skin were clarified.

[0037] [Table 1]

[0038] Test Example 2: Collagen production promoting and collagen degradation inhibiting effects of Bacopa monnieri (blood vessels) Human vascular endothelial cells were cultured in a medium containing 10% fetal bovine serum. Then, Bacopa monnieri hot water extract (Preparation Example 1), Bacopa monnieri 50% ethanol extract (Preparation Example 2), and Bacopa monnieri ethanol extract (Preparation Example 3) were added to a final concentration of 10 μg / mL, and the cells were cultured for 24 hours. The cells were then harvested and gene expression analysis was performed. Gene expression for COL1A1 and MMP1 was evaluated by real-time PCR. GAPDH was used as the internal standard. Gene expression in the sample-free cell was set to 1, and the gene expression ratio was calculated. The primers used were the primer set of sequences 1 to 6 described in Test Example 1.

[0039] The results of Test Example 2 are shown in Table 2. Bacopa monnieri hot water extract (Production Example 1), Bacopa monnieri 50% ethanol extract (Production Example 2), and Bacopa monnieri ethanol extract (Production Example 3) promoted COL1A1 gene expression and suppressed MMP1 gene expression. From these results, the collagen production promoting and collagen degradation inhibiting effects of Bacopa monnieri in blood vessels were clarified.

[0040] [Table 2]

[0041] Test Example 3: Examination of the effects of combining Bacopa monnieri and Vitis coignetiae (skin) Human dermal fibroblasts were cultured in DMEM containing 10% fetal bovine serum. Next, in serum-free DMEM, Bacopa monnieri ethanol extract (Preparation Example 3) and 30% ethanol extract of Vitis vinifera (Preparation Example 5) were added to a final concentration of 10 μg / mL each, and the cells were cultured for 24 hours. Gene expression analysis was then performed. Gene expression for COL1A1 and MMP1 was evaluated by real-time PCR. GAPDH was used as the internal standard. Gene expression in the sample-free cell was set to 1, and the gene expression ratio was calculated. The primers used were the primer set of sequences 1 to 6 described in Test Example 1.

[0042] Table 3 shows the results of Test Example 3. Bacopa monnieri ethanol extract (Production Example 3) promoted COL1A1 gene expression and suppressed MMP1 gene expression, thus demonstrating collagen production promoting and collagen degradation inhibiting effects. Wild grape 30% ethanol extract (Production Example 5) also promoted COL1A1 gene expression and suppressed MMP1 gene expression, albeit weakly, thus demonstrating collagen production promoting and collagen degradation inhibiting effects. Furthermore, when Bacopa monnieri ethanol extract and wild grape 30% ethanol extract were added in combination, a significant promotion of COL1A1 gene expression and suppression of MMP1 gene expression were observed. From these results, it is clear that the combination of Bacopa monnieri and wild grape exhibits extremely excellent collagen production promoting and collagen degradation inhibiting effects in the skin.

[0043] Furthermore, in Test Example 3, the same effect was observed even when Manufacturing Example 3 was replaced with Manufacturing Example 1 or Manufacturing Example 2, and Manufacturing Example 5 was replaced with Manufacturing Example 4 or Manufacturing Example 6.

[0044] [Table 3]

[0045] Test Example 4: Examination of the effects of combining Bacopa monnieri and Vitis vinifera (vascular) Human vascular endothelial cells were cultured in a medium containing 10% fetal bovine serum. Then, Bacopa monnieri ethanol extract (Preparation Example 3) and 30% ethanol extract of wild grape (Preparation Example 5) were added to a final concentration of 10 μg / mL each, and the cells were cultured for 24 hours. Gene expression analysis was then performed. Gene expression for COL1A1 and MMP1 was evaluated by real-time PCR. GAPDH was used as the internal standard. Gene expression in the sample-free cell was set to 1, and the gene expression ratio was calculated. The primers used were the primer set of sequences 1 to 6 described in Test Example 1.

[0046] Table 4 shows the results of Test Example 4. Bacopa monnieri ethanol extract (Production Example 3) promoted COL1A1 gene expression and suppressed MMP1 gene expression, thus demonstrating collagen production promoting and collagen degradation inhibiting effects. Wild grape 30% ethanol extract (Production Example 5) also promoted COL1A1 gene expression and suppressed MMP1 gene expression, albeit weakly, thus demonstrating collagen production promoting and collagen degradation inhibiting effects. Furthermore, when Bacopa monnieri ethanol extract and wild grape 30% ethanol extract were added in combination, a significant promotion of COL1A1 gene expression and suppression of MMP1 gene expression were observed. From these results, it is clear that the combination of Bacopa monnieri and wild grape exhibits extremely excellent collagen production promoting and collagen degradation inhibiting effects in blood vessels.

[0047] Furthermore, in Test Example 4, the same effect was observed even when Manufacturing Example 3 was replaced with Manufacturing Example 1 or Manufacturing Example 2, and Manufacturing Example 5 was replaced with Manufacturing Example 4 or Manufacturing Example 6.

[0048] [Table 4] [Industrial applicability]

[0049] The present invention can be used as a collagen production promoter and collagen degradation inhibitor containing Bacopa monnieri, or as a collagen production promoter and collagen degradation inhibitor containing Bacopa monnieri and Vitis coignetiae. The collagen production promoter and collagen degradation inhibitor of the present invention are useful for preventing and improving various symptoms and diseases associated with a decrease in collagen in the body, such as skin aging, arteriosclerosis, osteoarthritis, osteoporosis, and gingival recession.

Claims

1. A collagen production promoter characterized by containing Bacopa monnieri.

2. A collagen degradation inhibitor characterized by containing Bacopa monnieri.

3. A collagen production promoter characterized by containing Bacopa monnieri and Vitis coignetiae.

4. A collagen degradation inhibitor characterized by containing Bacopa monnieri and Vitis coignetiae.

5. A food composition for promoting collagen production and inhibiting collagen degradation, characterized by containing the agent described in any one of claims 1 to 4.

Images