Targeted gene therapy for DM-1 myotonic dystrophy
Recombinant adeno-associated virus (rAAV) particles with RNAi molecules targeting the DMPK gene effectively silence DMPK expression, addressing the lack of therapies for myotonic dystrophy type 1 by improving survival and correcting splicing abnormalities in DM1 models.
Patent Information
- Application Number
- JP2025558197
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-10-11
- Filing Date
- 2024-04-04
- Publication Date
- 2026-04-14
AI Technical Summary
There are no approved therapies for myotonic dystrophy type 1 (DM1), a monogenic, autosomal dominant disorder caused by the elongation of the CTG repeat in the DMPK gene locus, leading to significant physical, cognitive, and behavioral impairments, and bodily disability.
Recombinant adeno-associated virus (rAAV) particles containing RNAi molecules, specifically designed to target and silence the DMPK gene, are developed using a guide region with a specific nucleic acid sequence and an AAV capsid with amino acid modifications, packaged with muscle-specific promoters and introns to enhance gene silencing in muscle tissues.
The rAAV particles effectively inhibit DMPK expression and RNA accumulation, correcting splicing abnormalities and improving survival and weight gain in DM1 mouse models, demonstrating therapeutic potential for DM1.
Smart Images

Figure 2026511976000033 
Figure 2026511976000034 
Figure 2026511976000035
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 63 / 494,453, filed on April 5, 2023, and to U.S. Provisional Patent Application No. 63 / 589,417, filed on October 11, 2023.
[0002] Submission of sequence listing The contents of the following XML file submission: a computer-readable format (CRF) sequence listing (filename: 752749-SA9-363BPC.xml, creation date: April 3, 2024, size: 84,754 bytes) are incorporated herein by reference in their entirety.
[0003] This invention relates to variant RNAi molecules. In some embodiments, this invention relates to variant RNAi molecules for treating muscular dystrophy. [Background technology]
[0004] RNA interference (RNAi) has been shown to be a useful means of gene silencing in basic research on gene function, and is highly anticipated as a therapeutic agent for suppressing genes associated with the development of numerous diseases. In nature, gene regulation by RNAi is carried out via small RNA molecules known as microRNAs (miRNAs) (Ambros, (2004) Nature 431:350-355; Krol et al., (2010) Nat. Rev. Genet. 11:597-610). MicroRNAs have emerged as potent regulators of diverse cellular processes, and when delivered via viral vectors, they continuously express artificial miRNAs, resulting in potent and sustained suppression of target genes. By elucidating the mechanisms involved in miRNA processing, scientists have made it possible to induce the degradation of target gene products by utilizing endogenous cellular RNAi mechanisms and using artificial miRNAs (see, for example, U.S. Patent Application Publication No. 2014 / 0163214 and Davidson et al., (2012) Cell 150:873-875).
[0005] Myotonic dystrophy type 1 (DM1) is a monogenic, autosomal dominant, progressive disorder caused by the elongation (more than 50) of the CTG repeat in the DMPK gene locus. DMPK with the repeat is transcribed into mRNA, which forms a hairpin that binds to RNA-binding proteins, sequestering them from their normal function. This leads to the appearance of nuclear foci, mRNA missplicing, and ultimately myotonia. DM1 primarily affects skeletal, cardiac, and smooth muscle, resulting in significant physical, cognitive, and behavioral impairments, as well as bodily disability. Currently, there are no approved therapies for DM1. Therefore, there is a high unmet medical need for treatments for DM1.
[0006] All references cited herein, including patent applications and publications, are incorporated in their entirety by reference. [Overview of the project] [Means for solving the problem]
[0007] In some embodiments, the present invention provides recombinant adeno-associated virus (rAAV) particles comprising RNAi comprising a first strand and a second strand, wherein the first and second strands form a double helix, the first strand comprising a guide region comprising a nucleic acid having sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) or a sequence having about 90% identity with sequence SEQ ID NO: 1, and the second strand comprising a non-guide region and comprising an AAV capsid having an amino acid sequence having about 90% identity with wild-type AAVrh74 capsid. In some embodiments, the first strand comprises a nucleic acid having sequence SEQ ID NO: 1, and the non-guide region comprises a nucleic acid having sequence SEQ ID NO: 2. In some embodiments, the first and second strands are linked by an RNA linker capable of forming a loop structure. In some embodiments, the RNA linker comprises about 4 to about 50 nucleotides. In some embodiments, the loop structure comprises about 4 to about 20 nucleotides. In some embodiments, the loop structure comprises a nucleic acid having the sequence of SEQ ID NO: 3 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 3. In some embodiments, the RNAi comprises a second strand, an RNA linker, and a first strand, from 5' to 3'. In some embodiments, the RNAi comprises a first strand, an RNA linker, and a second strand, from 5' to 3'. In some embodiments, the RNAi comprises a nucleic acid having the sequence of SEQ ID NO: 7 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 7. In some embodiments, the RNAi is a small inhibitory RNA (siRNA), a microRNA (miRNA), or a small hairpin RNA (shRNA).
[0008] In some embodiments of the present invention, the RNAi further comprises a scaffold. In some embodiments, the scaffold comprises all or part of the nucleic acid of SEQ ID NO: 11. In some embodiments, the miRNA is embedded within the scaffold. In some embodiments, the scaffold has a 5' arm located on the 5' side of the nucleic acid encoding the RNAi and a 3' arm located on the 3' side of the nucleic acid encoding the RNAi. In some embodiments, the scaffold is a miR-155 scaffold. In some embodiments, the miR-155 scaffold comprises a nucleic acid located on the 5' side of the RNAi, having approximately 90% identity with the sequence of SEQ ID NO: 9 or SEQ ID NO: 9. In some embodiments, the miR-155 scaffold comprises a nucleic acid located on the 3' side of the RNAi, having approximately 90% identity with the sequence of SEQ ID NO: 10 or SEQ ID NO: 10.
[0009] In some embodiments of the present invention, RNAi targets RNA encoding a polypeptide associated with myotonic dystrophy type 1 (DM1). In some embodiments, the polypeptide is myotonic dystrophy protein kinase (DMPK). In some embodiments, DMPK contains mutations associated with DM1. In some embodiments, the gene encoding DMPK contains five or more CTG trinucleotide repeats.
[0010] In some embodiments, the present invention provides an expression cassette comprising a nucleic acid encoding one of the RNAi described herein. In some embodiments, the nucleic acid encoding the RNAi is operably ligated to a promoter. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the promoter is a desmin promoter or a variant thereof. In some embodiments, the desmin promoter comprises one or more enhancer elements of the human desmin gene and a promoter. In some embodiments, the desmin promoter comprises two enhancer elements of the human desmin gene and a promoter. In some embodiments, the desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO: 21 and / or one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO: 22. In some embodiments, the desmin promoter comprises the nucleotide sequence of SEQ ID NO: 12 or a sequence having about 90% identity with the nucleotide sequence of SEQ ID NO: 12. In some embodiments, the expression cassette further includes an intron. In some embodiments, the intron is a rabbit β-globin intron. In some embodiments, the intron includes the nucleotide sequence of SEQ ID NO: 13 or a sequence having about 90% identity with the sequence of SEQ ID NO: 13. In some embodiments, the nucleic acid encoding RNAi is embedded in the intron. In some embodiments, the intron includes a 5' arm and a 3' arm, the 5' arm located on the 5' side of the nucleic acid encoding RNAi, and the 3' arm located on the 3' side of the nucleic acid encoding RNAi. In some embodiments, the 5' arm of the intron includes the nucleotide sequence of SEQ ID NO: 14 or a sequence having about 90% identity with the sequence of SEQ ID NO: 14.In some embodiments, the 3' arm of the intron includes the nucleotide sequence of SEQ ID NO: 15 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 15. In some embodiments, the expression cassette further includes a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA. In some embodiments, the polyadenylation signal is a minimal bovine growth hormone polyadenylation signal. In some embodiments, the bovine growth hormone polyadenylation signal includes the nucleotide sequence of SEQ ID NO: 16 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 16. In some embodiments, the expression cassette includes the nucleotide sequence of SEQ ID NO: 17 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 17.
[0011] In some embodiments, the present invention provides an expression cassette comprising a modified desmin promoter, the modified desmin promoter comprising one or more enhancer elements and a promoter of the human desmin gene. In some embodiments, the modified desmin promoter comprises two enhancer elements and a promoter of the human desmin gene. In some embodiments, the modified desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements. In some embodiments, the modified desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO: 21 and / or one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO: 22. In some embodiments, the desmin promoter comprises the nucleotide sequence of SEQ ID NO: 12 or a sequence having about 90% identity with the nucleotide sequence of SEQ ID NO: 12. In some embodiments, the expression cassette further comprises an intron. In some embodiments, the intron is a rabbit β-globin intron. In some embodiments, the intron includes the nucleotide sequence of SEQ ID NO: 13 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 13. In some embodiments, the nucleic acid encoding the transgene is embedded in the intron. In some embodiments, the intron includes a 5' arm and a 3' arm, the 5' arm located on the 5' side of the nucleic acid encoding the transgene, and the 3' arm located on the 3' side of the nucleic acid encoding the transgene. In some embodiments, the 5' arm of the intron includes the nucleotide sequence of SEQ ID NO: 14 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 14. In some embodiments, the 3' arm of the intron includes the nucleotide sequence of SEQ ID NO: 15 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 15. In some embodiments, the expression cassette further includes a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA.In some embodiments, the polyadenylation signal is a minimal bovine growth hormone polyadenylation signal. In some embodiments, the bovine growth hormone polyadenylation signal includes the nucleotide sequence of SEQ ID NO: 16 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 16. In some embodiments, the transgene encodes a polypeptide or nucleic acid. In some embodiments, the transgene encodes RNAi.
[0012] In some embodiments, the present invention provides a vector comprising one of the expression cassettes described herein. In some embodiments, the expression cassette is adjacent to one or more Stuffer nucleic acid sequences. In some embodiments, one or more Stuffer nucleic acid sequences are derived from the human SerpinA1 gene. In some embodiments, the Stuffer nucleic acid sequence located at the 5' end of the expression cassette is derived from the human SerpinA1 gene. In some embodiments, the Stuffer sequence located at the 5' end of the expression cassette comprises the nucleotide sequence of SEQ ID NO: 18 or a sequence having about 90% identity with the sequence of SEQ ID NO: 18. In some embodiments, the Stuffer nucleic acid sequence located at the 3' end of the expression cassette is derived from the human SerpinA1 gene. In some embodiments, the Stuffer sequence located at the 3' end of the expression cassette comprises the nucleotide sequence of SEQ ID NO: 19 or a sequence having about 90% identity with the sequence of SEQ ID NO: 19.
[0013] In some embodiments of the present invention, the vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the expression cassette is adjacent to one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the expression cassette is adjacent to two AAV ITRs. In some embodiments, the AAV ITR is an ITR of an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV serotype. In some embodiments, the AAV ITR is an AAV2 ITR. In some embodiments, the rAAV vector contains the nucleotide sequence of SEQ ID NO: 20 or a sequence having about 90% identity with the sequence of SEQ ID NO: 20. In some embodiments, the vector is a self-complementary rAAV vector.
[0014] In some embodiments, the present invention provides cells comprising any of the expression cassettes described herein, any of the vectors described herein, or any of the rAAV vectors described herein.
[0015] In some embodiments, the present invention provides viral particles comprising any of the vectors described herein. In some embodiments, the present invention provides recombinant AAV particles comprising any of the rAAV vectors described herein. In some embodiments, the AAV capsid comprises an amino acid sequence comprising an amino acid substitution at position 502. In some embodiments, the amino acid substitution at position 502 is isoleucine (I). In some embodiments, the rAAV viral particle comprises a capsid of the AAVrh74 N502I serotype. In some embodiments, the ITR is AAV2 ITR, and the capsid of the rAAV particle is a capsid of the AAVrh74 N502I serotype. In some embodiments, the AAV capsid comprises an amino acid sequence comprising an amino acid substitution at position 505. In some embodiments, the amino acid substitution at position 505 is arginine (R). In some embodiments, the rAAV particle comprises a capsid of the AAVrh74 W505R serotype. In some embodiments, the ITR is an AAV2 ITR, and the capsid of the rAAV particle is a capsid of the AAVrh74 W505R serotype.
[0016] In some embodiments, the present invention provides rAAV particles comprising an rAAV vector and a capsid, wherein the rAAV vector comprises the following nucleic acids from 5' to 3': AAV2 ITR, nucleic acid encoding a Stuffer nucleic acid sequence derived from the human serpin A1 gene, Byrne desmin enhancer element, Paulin desmin enhancer element, desmin promoter, 5' arm of rabbit β-globin intron, 5' miR155 scaffold sequence, and DMPK. 204 miRNA guide sequence, miR155 terminal loop sequence, DMPK 204 The capsid contains a miRNA passenger sequence, a 3' miR155 scaffold sequence, a 3' arm of a rabbit β-globin intron, a minimal bovine growth hormone polyadenylation sequence, a nucleic acid encoding a human serpin A1 gene-derived staffer nucleic acid sequence, and an AAV2 ITR, and the capsid is the AAVrh74 N502I capsid.
[0017] In some embodiments, the present invention provides rAAV particles comprising an rAAV vector, the rAAV vector comprising, from 5' to 3', the following nucleic acids: an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO: 43; a nucleic acid encoding a human serpinA1 gene-derived Stuffer nucleic acid sequence comprising the polynucleotide sequence of SEQ ID NO: 18; a Byrne desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 21; a Paulin desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 22; a desmin promoter comprising the polynucleotide sequence of SEQ ID NO: 23; a 5' arm of a rabbit β-globin intron comprising the polynucleotide sequence of SEQ ID NO: 14; a 5' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO: 40; and a DMPK comprising the polynucleotide sequence of SEQ ID NO: 4. 204 The miRNA guide sequence, the miR155 terminal loop sequence containing the polynucleotide sequence of SEQ ID NO: 6, and the DMPK containing the polynucleotide sequence of SEQ ID NO: 5. 204 The capsid comprises a miRNA passenger sequence, a 3' miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 41, a 3' arm of a rabbit β-globin intron containing the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylated sequence containing the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a human serpinA1 gene-derived stuffer nucleic acid sequence containing the polynucleotide sequence of SEQ ID NO: 19, and an AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 49, and the capsid is the AAVrh74 N502I capsid. In some embodiments, the AAVrh74 N502I capsid comprises a capsid protein containing the amino acid sequence of SEQ ID NO: 50.
[0018] In some embodiments, the present invention provides rAAV particles comprising an rAAV vector and a capsid, wherein the rAAV vector comprises the following nucleic acids from 5' to 3': AAV2 ITR, nucleic acid encoding a Stuffer nucleic acid sequence derived from the human serpin A1 gene, Byrne desmin enhancer element, Paulin desmin enhancer element, desmin promoter, 5' arm of rabbit β-globin intron, 5' miR155 scaffold sequence, and DMPK. 204 miRNA guide sequence, miR155 terminal loop sequence, DMPK 204 The capsid is a capsid protein consisting of the amino acid sequence of Sequence ID No. 50, comprising a miRNA passenger sequence, a 3' miR155 scaffold sequence, a 3' arm of a rabbit β-globin intron, a minimal bovine growth hormone polyadenylated sequence, a nucleic acid encoding a staffer nucleic acid sequence derived from the human serpin A1 gene, and an AAV2 ITR.
[0019] In some embodiments, the present invention provides rAAV particles comprising an rAAV vector, the rAAV vector comprising, from 5' to 3', the following nucleic acids: an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO: 43; a nucleic acid encoding a human serpinA1 gene-derived Stuffer nucleic acid sequence comprising the polynucleotide sequence of SEQ ID NO: 18; a Byrne desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 21; a Paulin desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 22; a desmin promoter comprising the polynucleotide sequence of SEQ ID NO: 23; a 5' arm of a rabbit β-globin intron comprising the polynucleotide sequence of SEQ ID NO: 14; a 5' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO: 40; and a DMPK comprising the polynucleotide sequence of SEQ ID NO: 4. 204 The miRNA guide sequence, the miR155 terminal loop sequence containing the polynucleotide sequence of SEQ ID NO: 6, and the DMPK containing the polynucleotide sequence of SEQ ID NO: 5. 204An miRNA messenger sequence, a 3'miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO: 41, a 3'arm of the rabbit β-globin intron comprising the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylation sequence comprising the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a stuffer nucleic acid sequence derived from the human serpinA1 gene comprising the polynucleotide sequence of SEQ ID NO: 19, and an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO: 49, wherein the capsid comprises a capsid protein comprising the amino acid sequence of SEQ ID NO: 50.
[0020] In some embodiments, the invention provides an rAAV particle comprising an rAAV vector and a capsid, the rAAV vector comprising, from 5' to 3', the following nucleic acids: AAV2 ITR, a nucleic acid encoding a stuffer nucleic acid sequence derived from the human serpinA1 gene, Byrne desmin enhancer element, Paulin desmin enhancer element, desmin promoter, 5'arm of the rabbit β-globin intron, 5'miR155 scaffold sequence, DMPK 204 miRNA guide sequence, miR155 terminal loop sequence, DMPK 204 Comprising an miRNA messenger sequence, a 3'miR155 scaffold sequence, a 3'arm of the rabbit β-globin intron, a minimal bovine growth hormone polyadenylation sequence, a nucleic acid encoding a stuffer nucleic acid sequence derived from the human serpinA1 gene, and an AAV2 ITR, wherein the capsid is an AAVrh74 W505R capsid.
[0021] In some embodiments, the present invention provides rAAV particles comprising an rAAV vector, the rAAV vector comprising, from 5' to 3', the following nucleic acids: an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO: 43; a nucleic acid encoding a human serpinA1 gene-derived Stuffer nucleic acid sequence comprising the polynucleotide sequence of SEQ ID NO: 18; a Byrne desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 21; a Paulin desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 22; a desmin promoter comprising the polynucleotide sequence of SEQ ID NO: 23; a 5' arm of a rabbit β-globin intron comprising the polynucleotide sequence of SEQ ID NO: 14; a 5' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO: 40; and a DMPK comprising the polynucleotide sequence of SEQ ID NO: 4. 204 The miRNA guide sequence, the miR155 terminal loop sequence containing the polynucleotide sequence of SEQ ID NO: 6, and the DMPK containing the polynucleotide sequence of SEQ ID NO: 5. 204 The capsid comprises a miRNA passenger sequence, a 3' miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 41, a 3' arm of a rabbit β-globin intron containing the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylated sequence containing the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a human serpinA1 gene-derived stuffer nucleic acid sequence containing the polynucleotide sequence of SEQ ID NO: 19, and an AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 49, and the capsid is the AAVrh74 W505R capsid. In some embodiments, the AAVrh74 W505R capsid comprises a capsid protein containing the amino acid sequence of SEQ ID NO: 52.
[0022] In some embodiments, the present invention provides rAAV particles comprising an rAAV vector and a capsid, wherein the rAAV vector comprises the following nucleic acids from 5' to 3': AAV2 ITR, nucleic acid encoding a Stuffer nucleic acid sequence derived from the human serpin A1 gene, Byrne desmin enhancer element, Paulin desmin enhancer element, desmin promoter, 5' arm of rabbit β-globin intron, 5' miR155 scaffold sequence, and DMPK. 204 miRNA guide sequence, miR155 terminal loop sequence, DMPK 204 The capsid is a capsid protein consisting of the amino acid sequence of SEQ ID NO: 52, comprising a miRNA passenger sequence, a 3' miR155 scaffold sequence, a 3' arm of a rabbit β-globin intron, a minimal bovine growth hormone polyadenylated sequence, a nucleic acid encoding a staffer nucleic acid sequence derived from the human serpin A1 gene, and an AAV2 ITR.
[0023] In some embodiments, the present invention provides rAAV particles comprising an rAAV vector, the rAAV vector comprising, from 5' to 3', the following nucleic acids: an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO: 43; a nucleic acid encoding a human serpinA1 gene-derived Stuffer nucleic acid sequence comprising the polynucleotide sequence of SEQ ID NO: 18; a Byrne desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 21; a Paulin desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 22; a desmin promoter comprising the polynucleotide sequence of SEQ ID NO: 23; a 5' arm of a rabbit β-globin intron comprising the polynucleotide sequence of SEQ ID NO: 14; a 5' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO: 40; and a DMPK comprising the polynucleotide sequence of SEQ ID NO: 4. 204 The miRNA guide sequence, the miR155 terminal loop sequence containing the polynucleotide sequence of SEQ ID NO: 6, and the DMPK containing the polynucleotide sequence of SEQ ID NO: 5. 204The capsid comprises a miRNA passenger sequence, a 3' miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 41, a 3' arm of a rabbit β-globin intron containing the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylated sequence containing the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a human serpinA1 gene-derived stuffer nucleic acid sequence containing the polynucleotide sequence of SEQ ID NO: 19, and an AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 49, and the capsid contains the amino acid sequence of SEQ ID NO: 52.
[0024] In some embodiments, the present invention provides compositions comprising either the viral particles or rAAV particles described herein. In some embodiments, the present invention provides pharmaceutical compositions comprising either the viral particles or rAAV particles described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.
[0025] In some embodiments, the present invention provides a kit comprising one or more RNAi as described herein, viral particles as described herein, AAV particles as described herein, or compositions as described herein. In some embodiments, the kit further comprises instructions for use.
[0026] In some embodiments, the present invention provides a method for treating myotonic dystrophy type 1 (DM1) in a mammal in need, comprising administering an effective amount of any of the RNAi described herein to the mammal. In some embodiments, the present invention provides a method for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 in need, comprising administering an effective amount of any of the RNAi described herein to the mammal. In some embodiments, the present invention provides a method for inhibiting the accumulation of DMPK RNA in cells of a mammal having DM-1 in need, comprising administering an effective amount of any of the RNAi described herein to the mammal.
[0027] In some embodiments, the present invention provides a method for treating myotonic dystrophy type 1 (DM1) in a mammal in need, comprising administering an effective amount of any of the viral particles described herein (e.g., rAAV particles) to the mammal. In some embodiments, the present invention provides a method for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 in need, comprising administering an effective amount of any of the viral particles described herein (e.g., rAAV particles) to the mammal. In some embodiments, the present invention provides a method for inhibiting the accumulation of DMPK RNA in cells of a mammal having DM-1 in need, comprising administering an effective amount of any of the viral particles described herein (e.g., rAAV particles) to the mammal.
[0028] In some embodiments of the present invention, the effective amount of virus particles (e.g., rAAV particles) is about 1 × 10⁻⁶ 8 ~Approx. 2×10 13 The dose is in genome copies / mL. In some embodiments of the present invention, the dose is approximately 5 × 10 12The dose is genome copies / mL. In some embodiments of the present invention, the dose is approximately 1 × 10⁻⁶ 13 The dose is genome copies / mL. In some embodiments of the present invention, the dose is approximately 2 × 10⁻⁶ 13 This is genome copies / mL.
[0029] In some embodiments of the present invention, the effective amount of virus particles (e.g., rAAV particles) is about 1 × 10⁻⁶ 8 ~Approx. 2×10 14 The dose is per genome copy / kg of body weight. In some embodiments of the present invention, the dose is approximately 5 × 10 13 The value is genome copies / kg of body weight. In some embodiments of the present invention, the dose is approximately 1 × 10⁻⁶ 14 The value is genome copies / kg of body weight. In some embodiments of the present invention, the dose is approximately 2 × 10 14 The value is genome copies per kilogram of body weight.
[0030] In some embodiments, the present invention provides a method for treating myotonic dystrophy type 1 (DM1) in a mammal in need, comprising administering an effective amount of any of the compositions described herein to the mammal. In some embodiments, the present invention provides a method for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 in need, comprising administering an effective amount of any of the compositions described herein to the mammal. In some embodiments, the present invention provides a method for inhibiting the accumulation of DMPK RNA in cells of a mammal having DM-1 in need, comprising administering an effective amount of any of the compositions described herein to the mammal.
[0031] In some embodiments of the present invention, RNAi is administered in combination with an immunosuppressant, the immunosuppressant being administered before, simultaneously with, and / or after, the RNAi. In some embodiments, viral particles or rAAV particles are administered in combination with an immunosuppressant, the immunosuppressant being administered before, simultaneously with, and / or after, the viral particles or rAAV particles. In some embodiments, a composition is administered in combination with an immunosuppressant, the immunosuppressant being administered before, simultaneously with, and / or after, the composition.
[0032] This application can be understood by referring to the following description in conjunction with the accompanying drawings. [Brief explanation of the drawing]
[0033] [Figure 1A] A schematic diagram of the nDes-miR155-amiR-DMPK204 gene cassette sequence is shown. A hybrid muscle promoter is located upstream of the miR155-amiR-DMPK204 sequence. Downstream of the miRNA is a bovine growth hormone polyadenylated sequence (minBGHpA). On both sides of the cassette are stuffer sequences derived from A1AT introns. All of these are adjacent to two AAV2 ITRs, generating a combined vector genome with a size of 3739 bp. [Figure 1B] This shows the ITR plasmid used for cloning the nDes-miR155-amiR-DMPK204 gene cassette. The ITR plasmid contains an A1AT stuffer sequence adjacent to the 5'ITR and 3'ITR of AAV2. The A1AT stuffer sequence contains the NcoI restriction site and the SphI restriction site for cloning. [Figure 1C]The results of a small-scale packaging assay performed in HEK293 cells to confirm the packaging of the DC969-nDes-miR155-amiR-DMPK204 plasmid are shown. Small-scale production was performed using the AAV rep / cap plasmid. The y-axis shows the amount of vector produced per HEK293 cell compared to a standard EGFP plasmid gene cassette (CD627-CBA-GFP). DRP: DNase-resistant particle. [Figure 2A] This report evaluates DMPK knockdown in DMSXL mice after tail vein injection using an AAV and nDes-miR155-amiR-DMPK204 (amiR155-204) expression cassette. Figure 2A shows the transduction efficiency and in vivo distribution of AAV, evaluated by quantifying the copy number of the transgene in different organs. The qPCR results are expressed as the average ratio of AAV copy number to cell nuclei. Figure 2B shows the level of amiR-DMPK204 in the transduced tissue. The microRNA input level was normalized to U6 nuclear small RNA and set compared to BSS (equilibrium salt solution) treated cells. Figure 2C shows DMPK silencing in the transduced tissue. Total DMPK was determined by qRT-PCR. The mRNA input amount was normalized to tata-box binding protein (TBP) and set compared to BSS treated cells. The dotted line indicates 50% DMPK expression compared to TBP expression. For Figures 2A-2C, the data were evaluated using paired Student's t-tests: *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. n=13 (BSS), n=12 (amiR155-204). [Figure 2B] Same as above. [Figure 2C] Same as above. [Figure 3A]This study demonstrates the suppression of human DMPK by AAV nDes-miR155-amiR-DMPK204. DMSXL mice were administered AAV nDes-miR155-amiR-DMPK204 systemically in a dose-dependent manner. Mice were euthanized after 8 weeks, organs were collected, and levels of amiR-DMPK204 and DMPK transcripts were measured. Figure 3A shows the abundance of U6-normalized amiR-DMPK204 in various tissues. Figure 3B shows the abundance of mTBP-normalized hDMPK transcripts in various tissues. Multiple comparison tests using ANOVA were used to evaluate the data: *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. (n=wild-type 10, BSS 7, low-dose 5, medium-dose 13, and high-dose 7). [Figure 3B] This study demonstrates the suppression of human DMPK by AAV nDes-miR155-amiR-DMPK204. DMSXL mice were administered AAV nDes-miR155-amiR-DMPK204 systemically in a dose-dependent manner. Mice were euthanized after 8 weeks, organs were collected, and levels of amiR-DMPK204 and DMPK transcripts were measured. Figure 3A shows the abundance of U6-normalized amiR-DMPK204 in various tissues. Figure 3B shows the abundance of mTBP-normalized hDMPK transcripts in various tissues. Multiple comparison tests using ANOVA were used to evaluate the data: *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. (n=wild-type 10, BSS 7, low-dose 5, medium-dose 13, and high-dose 7). [Figure 4] This study demonstrates the correction of splicing abnormalities in DMSXL mice after systemic treatment with AAV nDes-miR155-amiR-DMPK204. Splicing of alternative exon 11 of LDB3 was evaluated in the gastrocnemius muscle 8 weeks after treatment using RT-PCR. Multiple comparison tests using ANOVA were used to evaluate the data: *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. (n=10 wild-type, 7 BSS, 5 low-dose, 13 medium-dose, and 7 high-dose). [Figure 5A]Figure 5A shows the survival rate and weight gain of female DMSXL mice treated with AAV nDes-miR155-amiR-DMPK204 in a dose-dependent manner. Figure 5A shows the Kaplan-Meier survival curve, demonstrating the improvement in survival rate at the medium dose 8 weeks after treatment compared to low-dose or BSS-treated animals. Figure 5B shows the improvement in weight observed in DMSXL animals treated with AAV nDes-miR155-amiR-DMPK204 compared to BSS-treated or low-dose-treated animals. [Figure 5B] Figure 5A shows the survival rate and weight gain of female DMSXL mice treated with AAV nDes-miR155-amiR-DMPK204 in a dose-dependent manner. Figure 5A shows the Kaplan-Meier survival curve, demonstrating the improvement in survival rate at the medium dose 8 weeks after treatment compared to low-dose or BSS-treated animals. Figure 5B shows the improvement in weight observed in DMSXL animals treated with AAV nDes-miR155-amiR-DMPK204 compared to BSS-treated or low-dose-treated animals. [Figure 6] This study demonstrates the reversal of electrophysiological features of DM1 disease when a DMSXL DM1 mouse model is systemically treated with the dose-dependent AAV nDes-miR155-amiR-DMPK204. Data were evaluated using multiple comparison tests of ANOVA: *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. (n=10 wild-type, 7 BSS, 5 low-dose, 13 medium-dose, and 7 high-dose). [Figure 7A] A schematic diagram of the experimental protocol is shown. To reconfirm the neutralizing antibody, blood (
number
[0034] In some embodiments, the present invention provides an RNAi comprising a first strand and a second strand, wherein a) the first and second strands form a double helix, b) the first strand comprises a guide region comprising a nucleic acid having sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) or a sequence having about 90% identity with sequence SEQ ID NO: 1, and c) the second strand comprises a non-guide region comprising a nucleic acid having sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2) or a sequence having about 90% identity with sequence SEQ ID NO: 2. In some embodiments, the present invention provides an expression cassette for expressing the nucleic acid encoding the RNAi, for example, for expressing the RNAi in mammalian muscle. In some embodiments, the expression cassette resides within an rAAV vector.
[0035] In some embodiments, the present invention provides a method for treating mammalian myotonic dystrophy 1 (DM-1) by administering the RNAi of the present invention to a mammal. In some embodiments, the administered RNAi inhibits the expression of mammalian myotonic dystrophy protein kinase (DMPK), thereby relieving mammalian DM-1.
[0036] general technology The techniques and procedures described or referenced herein are generally well understood by those skilled in the art, for example, Molecular Cloning: A Laboratory Manual (Sambrook et al., 4 thed.,Cold Spring Harbor Laboratory Press,Cold Spring Harbor,N.Y.,2012);Current Protocols in Molecular Biology(F.M.Ausubel,et al.eds.,2003);the series Methods in Enzymology(Academic Press,Inc.);PCR 2:A Practical Approach(M.J.MacPherson,B.D.Hames and G.R.Taylor eds.,1995);Antibodies,A Laboratory Manual(Harlow and Lane,eds.,1988);Culture of Animal Cells:A Manual of Basic Technique and Specialized Applications(R.I.Freshney,6 thed.,J.Wiley and Sons,2010);Oligonucleotide Synthesis(M.J.Gait,ed.,1984);Methods in Molecular Biology,Humana Press;Cell Biology:A Laboratory Notebook(J.E.Cellis,ed.,Academic Press,1998);Introduction to Cell and Tissue Culture(J.P.Mather and P.E.Roberts,Plenum Press,1998);Cell and Tissue Culture:Laboratory Procedures(A.Doyle,J.B.Griffiths,and D.G.Newell,eds.,J.Wiley and Sons,1993-8);Handbook of Experimental Immunology(D.M.Weir and C.C.Blackwell,eds.,1996);Gene Transfer Vectors for Mammalian Cells(J.M.Miller and M.P.Calos,eds.,1987);PCR:The Polymerase Chain Reaction,(Mullis et al.,eds.,1994);Current Protocols in Immunology(J.E.Coligan et al.,eds.,1991);Short Protocols in Molecular Biology(Ausubel et al.,eds.,J.Wiley and Sons,2002);Immunobiology(C.A.Janeway et al.,2004);Antibodies(P.Finch,1997);Antibodies:A Practical Approach(D.Catty.,ed.,IRL Press,1988-1989);Monoclonal Antibodies:A Practical Approach(P.Shepherd and C.Dean,eds.It is commonly used with conventional methodologies, such as those described in *Oxford University Press, 2000*, *Using Antibodies: A Laboratory Manual* (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999), *The Antibodies* (M. Zanetti and JDCapra, eds., Harwood Academic Publishers, 1995), and *Cancer: Principles and Practice of Oncology* (VT DeVita et al., eds., JBLippincott Company, 2011), which are widely used.
[0037] definition As used herein, “vector” refers to a recombinant plasmid or virus containing nucleic acid that is delivered to a host cell either in vitro or in vivo.
[0038] The terms “polynucleotide” or “nucleic acid,” as used herein, refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Therefore, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases, or other natural, chemically or biochemically modified, unnatural, or derivatized nucleotide bases. The backbone of a polynucleotide may contain sugars and phosphate groups (as typically found in RNA or DNA) or modified or substituted sugars or phosphate groups. Alternatively, the backbone of a polynucleotide may contain polymers of synthetic subunits, such as phosphoramidates, and thus may be oligodeoxynucleoside phosphoramidates (P-NH2) or mixed phosphoramidate-phosphodiester oligomers. In addition, double-stranded polynucleotides can be obtained from chemically synthesized single-stranded polynucleotide products by synthesizing complementary strands and annealing the strands under appropriate conditions, or by synthesizing novel complementary strands using DNA polymerase with appropriate primers.
[0039] The terms “polypeptide” and “protein” are used interchangeably to refer to polymers of amino acid residues and are not limited to minimum length. Such polymers of amino acid residues may include natural or unnatural amino acid residues and include, but are not limited to, amino acid peptides, oligopeptides, dimers, trimers, and polymers. Both full-length proteins and their fragments are included in the definition. The term also includes post-expression modifications of polypeptides, such as glycosylation, sialylation, acetylation, and phosphorylation. Furthermore, for the purposes of this invention, “polypeptide” refers to a protein that includes modifications such as deletions, additions, and substitutions (generally inherently conserved) of the natural sequence, as long as the protein maintains the desired activity. These modifications may be intentional, such as through site-directed mutagenesis, or accidental, such as mutations in the host producing the protein or errors in PCR amplification.
[0040] A "recombinant viral vector" refers to a recombinant polynucleotide vector containing one or more heterogeneous sequences (i.e., nucleic acid sequences that are not of viral origin). In the case of a recombinant AAV vector, the recombinant nucleic acid is flanked by at least one, and in some embodiments two, inverted terminal repeat sequences (ITRs).
[0041] A "recombinant AAV vector (rAAV vector)" refers to a polynucleotide vector containing one or more heterogeneous sequences (i.e., nucleic acid sequences not of AAV origin) adjacent to at least one, and in some embodiments two, AAV inverted terminal repeat sequences (ITRs). Such rAAV vectors, if present in host cells infected with a suitable helper virus (or expressing suitable helper function) and expressing the AAV Rep and Cap gene products (i.e., AAV Rep and Cap proteins), can replicate and package into infectious viral particles. When an rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), the rAAV vector may be referred to as a "provector" that can be "rescued" by replication and capsid formation in the presence of AAV packaging function and appropriate helper function. rAAV vectors can be in any of several forms, including, but not limited to, plasmids, linear artificial chromosomes, or complexed with lipids and encapsulated within liposomes to form viral particles, particularly AAV particles, or linear artificial chromosomes. The rAAV vector can be packaged into an AAV viral capsid to produce "recombinant adeno-associated virus particles (rAAV particles)."
[0042] "Heterogeneous" means that it originates from an entity whose genotype is different from the rest of the entity being compared to, or into which it is introduced or incorporated. For example, a polynucleotide introduced into a different cell type by genetic engineering is a heterogeneous polynucleotide (and can encode a heterogeneous polypeptide when expressed). Similarly, a cellular sequence (e.g., a gene or part thereof) incorporated into a viral vector is a heterogeneous nucleotide sequence for the vector.
[0043] The term "transgene" refers to a polynucleotide introduced into a cell, which is transcribed into RNA and can be translated and / or expressed under appropriate conditions by choice. In some embodiments, this confers a desired characteristic to the cell into which it is introduced, or otherwise results in a desired therapeutic or diagnostic outcome. In other embodiments, the transgene may be transcribed into an RNA interference-mediating molecule such as miRNA, siRNA, or shRNA.
[0044] The terms “genomic particles (gp),” “genomic equivalents,” or “genomic copies (gc)” used in relation to viral titer refer to the number of virions containing the recombinant AAV DNA genome, regardless of infectivity or functionality. The number of genomic particles in a particular vector preparation can be measured by procedures such as those described in the examples herein or, for example, Clark et al. (1999) Hum. Gene Ther., 10:1031-1039; Veldwijk et al. (2002) Mol. Ther., 6:272-278.
[0045] As used herein, the term “vector genome (vg)” may refer to one or more polynucleotides comprising a series of polynucleotide sequences of a vector, such as a viral vector. A vector genome may be encapsulated in a viral particle. Depending on the specific viral vector, a vector genome may include single-stranded DNA, double-stranded DNA, or single-stranded RNA or double-stranded RNA. A vector genome may include endogenous sequences associated with a particular viral vector and / or any heterologous sequences inserted into a particular viral vector by recombinant technology. For example, a recombinant AAV vector genome may include a promoter, a stuffer, the sequence of interest (e.g., RNAi), and at least one ITR sequence adjacent to the polyadenylated sequence. A complete vector genome may include the complete set of polynucleotide sequences of the vector. In some embodiments, the nucleic acid titer of a viral vector may be measured in vg / mL. Preferred methods for measuring this titer are known in the art (e.g., quantitative PCR).
[0046] As used herein, the term “inhibit” may mean an action that interferes with, reduces, eliminates, or otherwise antagonizes the presence or activity of a particular target. Inhibition may mean partial or complete inhibition. For example, inhibiting gene expression may mean any action that results in interference with, reduction with, elimination of, or any other antagonism of gene expression, including a decrease in mRNA abundance (e.g., silencing of mRNA transcripts), mRNA degradation, or inhibition of mRNA translation. In some embodiments, inhibiting DMPK expression may mean interference with, reduction with, elimination of, or any other antagonism of DMPK expression, including a decrease in DMPK mRNA abundance (e.g., silencing of DMPK mRNA transcripts), DMPK mRNA degradation, or inhibition of DMPK mRNA translation. As another example, inhibiting intracellular protein accumulation may mean any action that results in interference with, reduction with, elimination of, or other antagonism of protein expression, including a decrease in mRNA abundance (e.g., silencing of mRNA transcripts), mRNA degradation, inhibition of mRNA translation, or protein degradation. In some embodiments, inhibiting the accumulation of DMPK protein within cells refers to interference, reduction, elimination, or other antagonism of DMPK protein expression within cells, including a decrease in the abundance of DMPK mRNA (e.g., silencing of DMPK mRNA transcripts), degradation of DMPK mRNA, inhibition of DMPK mRNA translation, and degradation of DMPK protein.
[0047] The terms “infectious unit (iu),” “infectious particle,” or “replication unit,” when used in relation to viral titer, refer to the number of infectious and reproducible recombinant AAV vector particles measured in an infectious center assay, also known as a replication center assay, as described, for example, in McLaughlin et al. (1988) J. Virol., 62:1963-1973.
[0048] The term “transduction unit (tu)” as used in relation to viral titer refers to the number of infectious recombinant AAV vector particles that result in the production of a functional transgene product, as measured by the examples herein or by functional assays such as those described in Xiao et al. (1997) Exp. Neurobiol., 144:113-124 or Fisher et al. (1996) J. Virol., 70:520-532.
[0049] An "inverted terminal repeat" or "ITR" sequence is a well-understood term in this art, referring to a relatively short sequence found at the end of a reversed viral genome.
[0050] The term "AAV inverted terminal repeat (ITR)," a term well understood in this art, is a sequence of approximately 145 nucleotides present at both ends of a natural single-stranded AAV genome. The outermost 125 nucleotides of an ITR can exist in one of two different orientations, resulting in heterogeneity between different AAV genomes and between the ends of a single AAV genome. The outermost 125 nucleotides also include several short self-complementary regions (A, A', B, B', C, C', and D regions), which enable intra-strand base pairing within this portion of the ITR.
[0051] A "terminal decomposition sequence" or "TRS" is a sequence of the D region of the AAV ITR that is cleaved by the AAVrep protein during viral DNA replication. Mutant terminal decomposition sequences are resistant to cleavage by the AAVrep protein.
[0052] "AAV helper function" refers to a function that enables host cells to replicate and package AAV. AAV helper function may be provided in any of several forms, including, but not limited to, a helper virus or helper virus gene that facilitates AAV replication and packaging. Other AAV helper functions are known in the art, such as genotoxic agents.
[0053] A "helper virus" of AAV refers to a virus that enables host cells to replicate and package AAV (which is an abnormal parvovirus). Helper viruses provide a "helper function" that enables AAV replication. Numerous such helper viruses have been identified, including adenoviruses, herpesviruses, and poxviruses such as vacciniavirus and baculovirus. Adenoviruses encompass several different subgroups, but adenovirus type 5 (Ad5) of subgroup C is the most commonly used. Numerous adenoviruses originating from humans, non-human mammals, and birds are known and available from depositary organizations such as ATCC. Examples of herpes family viruses available from depositary organizations such as ATCC include herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), and pseudorabies virus (PRV). Examples of adenovirus helper functions for AAV replication include E1A, E1B, E2A, VA, and E4orf6 functions. Baculoviruses available from depositaries include Autographa californica nuclear polyhedron disease virus.
[0054] A preparation of rAAV is said to be "substantially free" of helper virus if the ratio of infectious AAV particles to infectious helper virus particles is at least about 10²:1, at least about 10⁴:1, at least about 10⁶:1, or at least about 10⁸:1 or higher. In some embodiments, the preparation also does not contain an equivalent amount of helper virus protein (i.e., the protein that would be present as a result of such a level of helper virus if the above-mentioned helper virus particle impurities were present in a disrupted form). Viral and / or cellular protein contamination can generally be observed as the presence of Coomassie staining bands on an SDS gel (e.g., the appearance of bands other than those corresponding to the AAV capsid proteins VP1, VP2, and VP3).
[0055] The “sequence identity percentage (%)” of a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical to an amino acid residue or nucleotide in the reference polypeptide or nucleic acid sequence, after the sequences have been aligned and gaps have been introduced, if necessary, to achieve the maximum possible sequence identity percentage, without considering conservative substitutions as part of the sequence identity. Alignment for the purpose of determining the sequence identity percentage of an amino acid or nucleic acid can be achieved in various ways within the scope of the art, such as using publicly available computer software programs, including BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software as described in Current Protocols in Molecular Biology (Ausubel et al., eds., 1987), Supp. 30, Section 7.7.18, Table 7.7.1. A preferred alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithm necessary to achieve the maximum alignment over the entire length of the sequences being compared. For the purposes of this specification, the amino acid sequence identity of a given amino acid sequence A to a given amino acid sequence B (which can also be expressed as a given amino acid sequence A having a specific amino acid sequence identity % to a given amino acid sequence B) is calculated as follows: fraction X / Y × 100 (wherein X is the number of amino acid residues scored as identical in the alignment of A and B by a sequence alignment program, and Y is the total number of amino acid residues in B). It will be understood that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, the amino acid sequence identity % of A to B is not equal to the amino acid sequence identity % of B to A.For the purposes of this specification, the nucleic acid sequence identity of a given nucleic acid sequence C to a given nucleic acid sequence D (which can also be expressed as a given nucleic acid sequence C having a specific nucleic acid sequence identity % to a given nucleic acid sequence D) is calculated as follows: fraction W / Z × 100 (wherein W is the number of nucleotides scored as identical in the alignment of C and D by a sequence alignment program, and Z is the total number of nucleotides in D). It will be understood that if the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the nucleic acid sequence identity % of C to D is not equal to the nucleic acid sequence identity % of D to C.
[0056] The term "isolated" means that a molecule (e.g., nucleic acid or protein) or cell has been identified and separated and / or recovered from its natural environment.
[0057] An "effective dose" is the amount sufficient to produce a beneficial or desired outcome, including clinical outcomes (e.g., remission of symptoms, achievement of clinical endpoints, etc.). An effective dose can be administered in one or more doses. With respect to the disease state, an effective dose is the amount sufficient to improve, stabilize, or slow the progression of the disease.
[0058] The “individual” or “subject” is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.
[0059] As used herein, “treatment” is an approach to obtain a beneficial or desired clinical outcome. For the purposes of the present invention, beneficial or desired clinical outcomes include, but are not limited to, symptom relief, reduction of disease severity, stabilization (e.g., no worsening) of the disease, prevention of disease spread (e.g., metastasis), delay or slowing of disease progression, remission or relief and remission (whether partial or whole), whether detectable or undetectable. “Treatment” may also mean an extension of survival compared to the survival expected without treatment.
[0060] As used herein, the term “preventive treatment” refers to treatment in which an individual is at risk of developing a disability, or is known or suspected to be at risk of developing a disability, but does not exhibit symptoms of the disability or exhibits minimal symptoms. Individuals receiving preventive treatment may be treated before symptoms develop.
[0061] As used herein, the term “myotonic dystrophy type 1” or “DM1” refers to a multi-system disorder affecting not only skeletal and smooth muscles, but also the eyes, heart, endocrine system, and central nervous system. There are three overlapping categories within DM1 (Bird, TD, Myotonic Dystrophy Type 1. 1999 Sep 17 [updated March 25, 2021]. In: Adam MP, Ardinger HH, Pagon RA, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2022). Mild DM1 is characterized by cataracts and mild myotonia; classic DM1 is characterized by muscle weakness and wasting, myotonia, cataracts, and often cardiac conduction disturbances; and congenital DM1 is characterized by hypotension and severe general weakness at birth, often accompanied by respiratory failure and early death, and intellectual disability is common.
[0062] As used herein, the terms “myotonic dystrophy protein kinase,” “DMPK,” “myotonin-protein kinase,” “MT-PK,” “myotonic dystrophy protein kinase,” or “MDPK” may refer to any of the genes or polypeptide products associated with most cases of DM1. The 3' untranslated region of the DMPK gene contains 5 to 37 copies of a CTG trinucleotide repeat. Myotonic dystrophy type I is caused by the extension of this unstable motif to 50 to 1,000 copies, with increasing severity as the number of copies of the repeating element increases.
[0063] As used herein, "RNAi" may refer to any RNA molecule that induces RNA interference within a cell. Examples of RNAi include, but are not limited to, small inhibitory RNA (siRNA), microRNA (miRNA), and small hairpin RNA (shRNA).
[0064] "miRNA" may refer to a polynucleotide containing (i) a double-stranded sequence that targets a target gene for knockdown by RNAi, and (ii) an additional sequence that forms a stem-loop structure similar to an endogenous miRNA. In some embodiments, the miRNA includes nucleic acids adjacent to the stem-loop structure. These adjacent sequences are known as the "miRNA scaffold." The sequence that targets the target gene for RNAi (e.g., a short sequence of about 20 nt) may be ligated into a sequence that generates a miRNA-like stem-loop and a sequence that base-pairs with the target sequence to form a double helix when the polynucleotide is assembled into a miRNA-like secondary structure. As described herein, this double helix may be imperfectly hybridized and may contain, for example, one or more unpaired or mispaired bases. When this polynucleotide is cleaved by a dicer, this double helix containing the sequence that targets the target gene may be unwound and incorporated into the RISC complex. The miRNA scaffold may refer to the miRNA itself or a DNA polynucleotide that codes for miRNA. Examples of miRNA scaffolds include the miR-155 sequence (Lagos-Quintana, M. et al. (2002) Curr. Biol. 12:735-9) and the mirGE scaffold (International Publication No. 2014016817A2 pamphlet). Commercial kits for cloning sequences into miRNA scaffolds are known in the art (e.g., Life Technologies, Thermo Fisher Scientific; Invitrogen® BLOCK-iT® Pol II miR RNAi expression vector kit from Waltham, MA).
[0065] As used herein, the term “DMPK-mediated splicing abnormalities” refers to dysregulation of alternative splicing occurring in tissues affected by DM1. These splicing abnormalities contribute to core symptoms of the disease, such as insulin resistance, myotonia, muscle weakness, and cardiac arrhythmias. CUG repeat elongation in DMPK transcripts accumulates in the cell nucleus and impairs the physiological function of proteins involved in transcription, splicing, or RNA transport. These aggregations result in deregulation of alternative splicing of different transcripts due to alterations in the splicing mechanism. In some embodiments, gene transcripts known to have dysregulation of splicing in DM1 can be used to measure the effect of treatment with constructs as described herein. In some embodiments, splicing rescue can be measured. In some embodiments, splicing rescue may be about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% compared to equivalent healthy tissue. In some embodiments, the gene transcript measured may be one or more of MBNL1, SOS1, PKM, zTTN, GOGLA4, and CLASP1. Splicing can be measured by one or more techniques known in the art, such as RNA sequencing (RNA-seq) or platform technologies such as Nanostring platforms.
[0066] As used herein, the term “sense” nucleic acid refers to a nucleic acid containing a sequence that encodes all or part of a transgene. In some examples, the mRNA of a transgene is the sense nucleic acid.
[0067] As used herein, an "antisense" nucleic acid is a nucleic acid sequence complementary to a "sense" nucleic acid. For example, an antisense nucleic acid may be complementary to the mRNA encoding a transgene.
[0068] As used herein, the “guide region” of RNAi is typically the RNAi strand that binds to the target mRNA based on complementarity. The complementarity region may encompass all or part of the guide region. Typically, the complementarity region includes at least the seed region. In many cases, the antisense region of RNAi is the guide region.
[0069] As used herein, the “passenger region” or “non-guide region” of RNAi are interchangeable and are regions of RNAi that are complementary to the guide region. In many cases, the sense region of RNAi is the passenger region.
[0070] As used herein, the “seed region” of RNAi (e.g., miRNA) is a region of microRNA approximately 1 to 8 nucleotides long. In some cases, the seed region and its target mRNA’s 3’-UTR may be important determinants in RNAi recognition.
[0071] As used herein, “off-target gene silencing” refers to the pairing of the RNAi seed region with a sequence within the 3?-UTR of an unintended mRNA, inducing translational repression and destabilization of its transcripts (e.g., reducing the expression of the unintended mRNA).
[0072] References to “approximately” values or parameters in this specification include (and describe) embodiments relating to the value or parameter itself. For example, a statement referring to “approximately X” includes a statement of “X”.
[0073] As used herein, the singular articles "a," "an," and "that" include plural references unless otherwise indicated.
[0074] It is understood that the aspects and embodiments of the present invention described herein include aspects and embodiments that "include," "consist of," and / or "essentially consist of."
[0075] RNAi In some embodiments, the present invention provides improved RNAi targeting DMPK RNA for treating myotonic dystrophy type 1 (DM1). In some embodiments, the RNAi is a small inhibitory RNA (siRNA), a microRNA (miRNA), or a small hairpin RNA (shRNA). Small inhibitory RNA, or interfering RNA (siRNA), is known in the art as a double-stranded RNA molecule about 19–25 (e.g., 19–23) base pairs long that induces RNAi in cells. miRNAs are typically smaller than siRNAs and may have multiple targets and functions to repress translation, degrade mRNA, and in some examples endonuclease-like cleavage of mRNA. Small hairpin RNA (shRNA) is known in the art as an RNA molecule containing about 19–25 (e.g., 19–23) base pairs of double-stranded RNA linked by a short loop (e.g., about 4–11 nucleotides) that induces RNAi in cells. In some embodiments, the RNAi comprises a first strand and a second strand, where a) the first and second strands form a double helix, b) the first strand comprises a guide region comprising the nucleic acid sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1), and c) the second strand comprises a non-guide region. In some embodiments, the nuclear guide region comprises the nucleic acid sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1), and the non-guide region comprises the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2).
[0076] In some embodiments, the first strand includes a guide region, which contains a nucleic acid sequence having approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and more than 99% identity with 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1), but which contains a nucleic acid sequence that maintains at least one CpG motif. In some embodiments, the second strand includes a non-guide region containing a nucleic acid sequence having approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identity with 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2). In some embodiments, the second strand includes a non-guide region containing a nucleic acid sequence having approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identity with 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2), but maintaining at least one CpG motif.
[0077] In some embodiments, the RNAi includes the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the RNAi includes a nucleic acid sequence having approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or more than 99% identity with SEQ ID NO: 7. In some embodiments, the RNAi includes a nucleic acid sequence having approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or more than 99% identity with SEQ ID NO: 7, but retains at least one sequence (e.g., within the seed sequence).
[0078] In some embodiments, the present invention provides a nucleic acid encoding RNAi, comprising a first strand and a second strand, wherein a) the first and second strands form a double helix, b) the first strand comprises a guide region, and c) the second strand comprises a non-guide region. In some embodiments, the nucleic acid encoding RNAi comprises the nucleic acid sequence of SEQ ID NO: 4 and / or the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the nucleic acid encoding RNAi comprises a nucleic acid sequence having approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and more than 99% identity with SEQ ID NO: 4 and / or a nucleic acid sequence having approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and more than 99% identity with SEQ ID NO: 5. In some embodiments, RNAi is encoded by the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the RNAi is encoded by a nucleic acid sequence having approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and over 99% identity with SEQ ID NO: 8.
[0079] MicroRNAs (miRNAs) are known in the art as RNA molecules that induce RNAi in cells, comprising a short (e.g., about 19–25 base pairs) sequence of double-stranded RNA linked by a loop, and containing one or more additional sequences of double-stranded RNA including one or more bulges (e.g., mispaired or unpaired base pairs). As used herein, the term “miRNA” includes not only endogenous miRNAs but also exogenous or heterologous miRNAs. In some embodiments, “miRNA” may be referred to as pri-miRNA or pre-miRNA. Pri-miRNA transcripts are produced during the processing of miRNAs. Pri-miRNAs are processed by Drosha-DGCR8, and pre-miRNAs are produced by excising one or more sequences such that a pre-miRNA remains, comprising a 5' facile region, guide strand, loop region, non-guide strand and 3' facile region, or a pre-miRNA comprising a 5' facile region, non-guide strand, loop region, guide strand and 3' facile region. Next, pre-miRNA is transported to the cytoplasm and processed by a dicer to produce siRNA containing a guide strand and a non-guide (or passenger) strand. The guide strand is then utilized by the RISC complex to induce gene silencing, for example, by recognizing a target RNA sequence complementary to the guide strand. Further explanations of miRNA can be found, for example, in the international publication pamphlet 2008 / 150897. Recognition of target sequences by miRNA is primarily determined by pairing between the target sequence and the miRNA seed sequence, for example, nucleotides 1-8 (from 5' to 3') of the guide strand (e.g., Boudreau, R. Let al. (2013) Nucleic Acids Res. 41:e9).
[0080] In pri / pre-miRNA structures, complementary base pairing (e.g., Watson-Crick base pairing) partially forms a guide-to-non-guide interface in the double helix. However, in some embodiments, this complementary base pairing does not extend across the entire double helix. In some embodiments, a bulge may be present at one or more nucleotide positions at the interface. As used herein, the term "bulge" may refer to a region of non-complementary nucleic acid in the double helix that is opposite the opposing nucleic acid. In some embodiments, a bulge is formed when regions of complementary nucleic acids bind to each other, while a region of the central non-complementary region does not. In some embodiments, a bulge is formed when the two strands of nucleic acid located between the two complementary regions are of different lengths. As described below, a bulge may contain one or more nucleotides.
[0081] During miRNA processing, the miRNA is cleaved at a cleavage site adjacent to the guide-non-guide interface, thereby releasing the siRNA duplex of the guide-non-guide strand. In some embodiments, the miRNA contains a bulge on the sense or antisense strand adjacent to the cleavage site. In other words, in some embodiments, the miRNA contains a bulge on the guide or non-guide strand adjacent to the seed sequence.
[0082] In some embodiments, the miRNA includes a bulge on the guide strand opposite the 5' cleavage site of the mature non-guide strand. In some embodiments, the miRNA includes a bulge opposite the 5' nucleotide of the non-guide strand. In some embodiments, the miRNA includes a bulge on the sense strand opposite the 3' cleavage site of the mature guide strand. In some embodiments, the miRNA includes a bulge opposite the 3' nucleotide of the guide strand.
[0083] The safety of RNAi-based therapies can be hampered by the ability of small inhibitory RNAs (siRNAs) to bind to unintended mRNAs and reduce their expression (an effect known as off-target gene silencing). Off-target effects primarily occur when the seed region (nucleotides 2-8 of the small RNA) pairs with sequences within the 3'-UTR of unintended mRNAs, inducing translational repression and destabilization of these transcripts. RNAi with reduced off-target effects can be designed by substituting bases in the guide and non-guide sequences, for example, by generating CpG motifs. Potential substitutions that could result in significantly reduced off-target scores can be evaluated using the SiSPOTR algorithm, a specificity-focused siRNA design algorithm that identifies candidate sequences with minimal off-target potential and strong silencing ability (Boudreau et al, Nucleic Acids Res. 2013 Jan;41(1)e9). A reduced SiSPOTR score suggests that the sequence has fewer potential human off-targets compared to the parent RNAi molecule. In some embodiments of the present invention, the RNAi is modified to reduce off-target gene silencing.
[0084] In some embodiments, the first and second strands are linked by an RNA (e.g., an RNA linker) that can form a loop structure. As is commonly known in the art, RNA loop structures (e.g., stem-loops or hairpins) are formed when an RNA molecule contains two RNA sequences whose base pairs are separated by RNA sequences that do not base-pair together. For example, if sequences A and C are complementary or partially complementary so that they base-pair together, but the bases of sequence B do not base-pair together, a loop structure can be formed in RNA molecules A, B, and C.
[0085] In some embodiments, the RNA capable of forming a loop structure contains 4 to 50 nucleotides. In certain embodiments, the RNA capable of forming a loop structure contains 13 nucleotides. In some embodiments, the number of nucleotides in the RNA capable of forming a loop is 4 to 50 nucleotides or any integer between them. In some embodiments, 0 to 50% of the loop may be complementary to another part of the loop. As used herein, the term “loop structure” refers to a sequence that joins two complementary strands of nucleic acid. In some embodiments, 1 to 3 nucleotides of the loop structure may be adjacent to the complementary strand of nucleic acid and complementary to 1 to 3 nucleotides of the distal part of the loop structure. For example, the 3 nucleotides at the 5' end of the loop structure may be complementary to the 3 nucleotides at the 3' end of the loop structure.
[0086] In some embodiments, the nucleic acids encoding RNAi of this disclosure include heterologous miRNA scaffolds. In some embodiments, the use of heterologous miRNA scaffolds is used to regulate miRNA expression, for example, to increase or decrease miRNA expression. Any miRNA scaffold known in the art can be used. In some embodiments, the miRNA scaffold is derived from the miR-155 scaffold (see, e.g., Lagos-Quintana, M. et al. (2002) Curr. Biol. 12:735-9 and Invitrogen® BLOCK-iT® Pol II miR RNAi Expression Vector Kit, Life Technologies, Thermo Fisher Scientific; Waltham, MA) or the mirGE scaffold (International Publication No. 2014 / 016817).
[0087] Treatment methods for myotonic dystrophy type 1 (DM-1) Myotonic dystrophy type 1 (DM1) is a monogenic, autosomal dominant, progressive disorder caused by an expansion of CTG repeats (greater than 50) at the DMPK locus (myotonic dystrophy protein kinase). DMPK with the repeats is transcribed into mRNA, which forms hairpins and binds to RNA-binding proteins, sequestering them from their normal functions. This results in the appearance of nuclear foci, mis-splicing, and ultimately myotonia. DM1 mainly affects skeletal, cardiac, and smooth muscle, leading to significant physical, cognitive, and kinematic dysfunctions as well as physical disabilities.
[0088] In some aspects, the present invention provides methods and compositions for treating mammalian myotonic dystrophy type 1 (DM1) comprising administering to a mammal a pharmaceutical composition of the present disclosure (e.g., a pharmaceutical composition comprising the rAAV particles of the present disclosure). In some aspects, the present invention provides methods and compositions for inhibiting the expression of DMPK in a mammal having DM-1 comprising administering to a mammal a pharmaceutical composition of the present disclosure (e.g., a pharmaceutical composition comprising the rAAV particles of the present disclosure). In some aspects, the present invention provides methods and compositions for inhibiting the accumulation of DMPK in the cells of a mammal having DM1 comprising administering to a mammal a pharmaceutical composition of the present disclosure (e.g., a pharmaceutical composition comprising the rAAV particles of the present disclosure). In some aspects, the present invention provides methods and compositions for alleviating the symptoms of DM1 comprising administering to the muscle brain of a mammal an effective amount of rAAV particles comprising a vector encoding the RNAi of the present disclosure.
[0089] In some aspects, the present invention provides an RNAi for targeting DMPK mRNA in a mammal having DM1. In some embodiments, the RNAi comprises a first strand comprising a first nucleic acid comprising the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) and a second strand comprising a second nucleic acid comprising the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2). The RNAi described herein (e.g., as part of an rAAV vector) can be utilized particularly for the treatment of DM1.
[0090] In some embodiments, the RNAi is small interfering RNA (siRNA), microRNA (miRNA) or short hairpin RNA (shRNA). Small interfering RNA, i.e., interfering RNA (siRNA), is known in the art as a double-stranded RNA molecule having a length of about 19 to 25 (e.g., 19 to 23) base pairs that induces RNAi in cells. miRNA is typically smaller than siRNA and can have multiple targets and functions for suppressing translation, degrading mRNA, and in some cases endonucleolytically cleaving mRNA. Short hairpin RNA (shRNA) is known in the art as an RNA molecule containing about 19 to 25 (e.g., 19 to 23) base pairs of double-stranded RNA linked by a short loop (e.g., about 4 to 11 nucleotides) that induces RNAi intracellularly.
[0091] In some embodiments, the miRNA comprises a guide sequence that is about 90% identical to SEQ ID NO: 1. In some embodiments, the miRNA comprises a guide sequence that is identical to SEQ ID NO: 1 at any one of about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.
[0092] In some embodiments, the miRNA comprises a non-guide sequence (passenger strand) that is about 90% identical to SEQ ID NO: 2. In some embodiments, the miRNA comprises a non-guide sequence that is identical to SEQ ID NO: 2 at any one of about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.
[0093] In some embodiments, the first and second strands are linked by RNA capable of forming a loop structure. As is commonly known in the art, RNA loop structures (e.g., stem-loops or hairpins) are formed when an RNA molecule contains two RNA sequences whose base pairs are separated by RNA sequences that do not base-pair together. For example, if sequences A and C are complementary or partially complementary so that they base-pair together, but the bases of sequence B do not base-pair together, a loop structure can be formed in RNA molecules A, B, and C.
[0094] In some embodiments, the RNA capable of forming a loop structure contains 4 to 50 nucleotides. In certain embodiments, the RNA capable of forming a loop structure contains 13 nucleotides. In certain embodiments, the RNA capable of forming a loop structure contains the nucleotide sequence GUUUUGGCCACUGACUGAC (SEQ ID NO: 3). In some embodiments, the vector genome contains a nucleotide sequence that is identical to the sequence of SEQ ID NO: 3 by at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
[0095] In some embodiments, the present invention provides a method for administering RNAi to a mammal (e.g., a mammal having DM1) comprising a first strand containing a first nucleic acid having the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) and a second strand containing a second nucleic acid having the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2). In some embodiments, the recombinant viral particle comprises the RNAi. In some embodiments, the recombinant viral particle is an AAV particle that capsidates an rAAV vector, and the rAAV vector encodes the RNAi.
[0096] In some embodiments, rAAV particles are delivered by systemic injection of rAAV particles into mammals. In some embodiments, systemic injection is intravenous, intra-arterial, intramuscular, intraperitoneal, intradermal, or subcutaneous, intra-CSF, or intrathecal (IT) administration.
[0097] In some embodiments, the present invention provides a method for treating mammalian DM1, comprising administering a pharmaceutical composition of the present disclosure to a mammal. In some embodiments, the present invention provides a method for inhibiting the accumulation of intracellular DMPK in a mammal having DM1, comprising administering a pharmaceutical composition of the present disclosure to a mammal. In some embodiments, the present invention provides a method for inhibiting the expression of DMPK in a mammal having DM1, comprising administering a pharmaceutical composition of the present disclosure to a mammal. In some embodiments, the DMPK is mutant DMPK (e.g., DMPK containing more than 37 or more than 50 CTG repeats).
[0098] In some embodiments, the present invention provides a method for treating a human having DM1 by administering an effective amount of a pharmaceutical composition comprising an rAAV vector encoding the RNAi of the present disclosure in order to suppress the activity of mutant DMPK. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.
[0099] In some embodiments, the method involves administering an effective amount of a pharmaceutical composition comprising an rAAV vector encoding the RNAi of the Disclosure in order to suppress the activity of mutant DMPK. In some embodiments, the viral titer of the rAAV particles is at least about 5 × 10⁶ 12 , 6×10 12 , 7×10 12 , 8×10 12 , 9×10 12 , 10×10 12 , 11×10 12 , 15×10 12 , 20×10 12 , 25×10 12 , 30×10 12 or 50 x 10 12It is either genome copies / mL. In some embodiments, the viral titer of the rAAV particles is approximately 5 × 10⁶ 12 ~6×10 12 , 6×10 12 ~7×10 12 , 7×10 12 ~8×10 12 , 8×10 12 ~9×10 12 , 9×10 12 ~10×10 12 , 10×10 12 ~11×10 12 , 11×10 12 ~15×10 12 , 15×10 12 ~20×10 12 , 20×10 12 ~25×10 12 , 25×10 12 ~30×10 12 , 30×10 12 ~50×10 12 or 50 x 10 12 ~100×10 12 It is either genome copies / mL. In some embodiments, the viral titer of the rAAV particles is approximately 5 × 10⁶ 12 ~10×10 12 , 10×10 12 ~25×10 12 or 25 × 10 12 ~50×10 12 It is either genome copies / mL. In some embodiments, the viral titer of the rAAV particles is at least about 5 × 10⁶ 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , 10×10 9 , 11×10 9 , 15×10 9 , 20×10 9 , 25×10 9 , 30×10 9 or 50 x 10 9 It is either transduction units / mL. In some embodiments, the viral titer of the rAAV particles is approximately 5 × 10⁻¹⁶. 9 ~6×109 , 6×10 9 ~7×10 9 , 7×10 9 ~8×10 9 , 8×10 9 ~9×10 9 , 9×10 9 ~10×10 9 , 10×10 9 ~11×10 9 , 11×10 9 ~15×10 9 , 15×10 9 ~20×10 9 , 20×10 9 ~25×10 9 , 25×10 9 ~30×10 9 , 30×10 9 ~50×10 9 or 50×10 9 ~100×10 9 are any of the transduction units / mL. In some embodiments, the viral titer of the rAAV particles is about 5×10 9 ~10×10 9 , 10×10 9 ~15×10 9 , 15×10 9 ~25×10 9 or 25×10 9 ~50×10 9 are any of the transduction units / mL. In some embodiments, the viral titer of the rAAV particles is at least about 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , 9×10 10 , 10×10 10 , 11×10 10 , 15×10 10 , 20×10 10 , 25×10 10 , 30×10 10 , 40×10 10 or 50×10 10 are any of the infectious units / mL. In some embodiments, the viral titer of the rAAV particles is at least about 5×10 10 ~6×10 10, 6×10 10 ~7×10 10 , 7×10 10 ~8×10 10 , 8×10 10 ~9×10 10 , 9×10 10 ~10×10 10 , 10×10 10 ~11×10 10 , 11×10 10 ~15×10 10 , 15×10 10 ~20×10 10 , 20×10 10 ~25×10 10 , 25×10 10 ~30×10 10 , 30×10 10 ~40×10 10 , 40×10 10 ~50×10 10 or 50 x 10 10 ~100×10 10 It is either infectious units / mL. In some embodiments, the viral titer of the rAAV particles is at least about 5 × 10⁶ 10 ~10×10 10 , 10×10 10 ~15×10 10 , 15×10 10 ~25×10 10 or 25 × 10 10 ~50×10 10 It is either infectious units / mL or one of the following:
[0100] In some embodiments, the dose concentration of rAAV particles administered to an individual is approximately 1 × 10⁻⁶. 8 ~Approx. 2×10 13 It is either genome copies / mL. In some embodiments, the dose concentration of rAAV particles administered to an individual is approximately 1 × 10⁻⁶. 8 ~Approx. 5×10 8 , about 5×10 8 ~About 10×10 8 , about 10×10 8 ~About 20×10 8 , about 20×10 8 ~Approx. 30×10 8 , about 30×10 8~About 40×10 8 , about 40×10 8 ~About 50×10 8 Or approximately 50 x 10 8 ~About 100×10 8 It is either genome copies / mL. In some embodiments, the dose concentration of rAAV particles administered to an individual is approximately 1 × 10⁻⁶. 9 ~Approx. 5×10 9 , about 5×10 9 ~About 10×10 9 , about 10×10 9 ~About 20×10 9 , about 20×10 9 ~Approx. 30×10 9 , about 30×10 9 ~About 40×10 9 , about 40×10 9 ~About 50×10 9 Or approximately 50 x 10 9 ~About 100×10 9 It is either genome copies / mL. In some embodiments, the dose concentration of rAAV particles administered to an individual is approximately 1 × 10⁻⁶. 10 ~Approx. 5×10 10 , about 5×10 10 ~About 10×10 10 , about 10×10 10 ~About 20×10 10 , about 20×10 10 ~Approx. 30×10 10 , about 30×10 10 ~About 40×10 10 , about 40×10 10 ~About 50×10 10 Or approximately 50 x 10 10 ~About 100×10 10 It is either genome copies / mL. In some embodiments, the dose concentration of rAAV particles administered to an individual is approximately 1 × 10⁻⁶. 11 ~Approx. 5×10 11 , about 5×10 11 ~About 10×10 11 , about 10×10 11 ~About 20×10 11 , about 20×10 11 ~Approx. 30×10 11 , about 30×10 11 ~About 40×1011 , about 40×10 11 ~About 50×10 11 Or approximately 50 x 10 11 ~About 100×10 11 It is either genome copies / mL. In some embodiments, the dose concentration of rAAV particles administered to an individual is approximately 1 × 10⁻⁶. 12 ~Approx. 5×10 12 , about 5×10 12 ~About 10×10 12 , about 10×10 12 ~About 20×10 12 , about 20×10 12 ~Approx. 30×10 12 , about 30×10 12 ~About 40×10 12 , about 40×10 12 ~About 50×10 12 Or approximately 50 x 10 12 ~About 100×10 12 It is either genome copies / mL. In some embodiments, the dose concentration of rAAV particles administered to an individual is approximately 1 × 10⁻⁶. 13 ~Approx. 2×10 13 It is either genome copies / mL. In some embodiments, the dose concentration of rAAV particles administered to an individual is approximately 1 × 10⁻⁶. 8 , about 5×10 8 , about 1×10 9 , about 5×10 9 , about 1×10 10 , about 5×10 10 , about 1×10 11 , about 5×10 11 , about 1×10 12 , about 5×10 12 , about 1×10 13 Or approximately 2 × 10 13 The value is genome copies / mL. In some embodiments, the dose concentration of rAAV particles administered to an individual is approximately 5 × 10⁻⁶. 12 The value is genome copies / mL. In some embodiments, the dose concentration of rAAV particles administered to an individual is approximately 1 × 10⁻⁶. 13 The value is genome copies / mL. In some embodiments, the dose concentration of rAAV particles administered to an individual is approximately 2 × 10⁻⁶. 13 This is genome copies / mL.
[0101] In some embodiments, the dose of rAAV particles administered to an individual is at least about 1 × 10⁻⁶ 8 ~Approx. 2×10 14 This is either genome copies / kg of body weight. In some embodiments, the dose of rAAV particles administered to an individual is approximately 1 × 10⁶ 8 ~Approx. 2×10 14 This is either genome copies / kg of body weight. In some embodiments, the dose of rAAV particles administered to an individual is approximately 1 × 10⁶ 8 ~Approx. 1×10 14 , 5×10 8 ~Approx. 1×10 14 , 1 x 10 9 ~Approx. 1×10 14 , 5×10 9 ~Approx. 1×10 14 , 1 x 10 10 ~Approx. 1×10 14 , 5×10 10 ~Approx. 1×10 14 , 1 x 10 11 ~Approx. 1×10 14 , 5×10 11 ~Approx. 1×10 14 , 1 x 10 12 ~Approx. 1×10 14 , 5×10 12 ~Approx. 1×10 14 , 1 x 10 13 ~Approx. 1×10 14 , 5×10 13 ~Approx. 1×10 14 , 1 x 10 8 ~Approx. 5×10 13 , 5×10 8 ~Approx. 5×10 13 , 1 x 10 9 ~Approx. 5×10 13 , 5×10 9 ~Approx. 5×10 13 , 1 x 10 10 ~Approx. 5×10 13 , 5×10 10 ~Approx. 5×10 13 , 1 x 10 11 ~Approx. 5×10 13 , 5×10 11 ~Approx. 5×10 13 , 1 x 1012 ~Approx. 5×10 13 , 5×10 12 ~Approx. 5×10 13 , 1 x 10 13 ~Approx. 5×10 13 , 1 x 10 8 ~Approx. 1×10 13 , 5×10 8 ~Approx. 1×10 13 , 1 x 10 9 ~Approx. 1×10 13 , 5×10 9 ~Approx. 1×10 13 , 1 x 10 10 ~Approx. 1×10 13 , 5×10 10 ~Approx. 1×10 13 , 1 x 10 11 ~Approx. 1×10 13 , 5×10 11 ~Approx. 1×10 13 , 1 x 10 12 ~Approx. 1×10 13 , 5×10 12 ~Approx. 1×10 13 , 1 x 10 8 ~Approx. 5×10 12 , 5×10 8 ~Approx. 5×10 12 , 1 x 10 9 ~Approx. 5×10 12 , 5×10 9 ~Approx. 5×10 12 , 1 x 10 10 ~Approx. 5×10 12 , 5×10 10 ~Approx. 5×10 12 , 1 x 10 11 ~Approx. 5×10 12 , 5×10 11 ~Approx. 5×10 12 , 1 x 10 12 ~Approx. 5×10 12 , 1 x 10 8 ~Approx. 1×10 12 , 5×10 8 ~Approx. 1×10 12 , 1 x 10 9 ~Approx. 1×10 12 , 5×10 9 ~Approx. 1×10 12 , 1 x 10 10 ~Approx. 1×10 12 , 5×1010 ~Approx. 1×10 12 , 1 x 10 11 ~Approx. 1×10 12 , 5×10 11 ~Approx. 1×10 12 , 1 x 10 8 ~Approx. 5×10 11 , 5×10 8 ~Approx. 5×10 11 , 1 x 10 9 ~Approx. 5×10 11 , 5×10 9 ~Approx. 5×10 11 , 1 x 10 10 ~Approx. 5×10 11 , 5×10 10 ~Approx. 5×10 11 , 1 x 10 11 ~Approx. 5×10 11 , 1 x 10 8 ~Approx. 1×10 11 , 5×10 8 ~Approx. 1×10 11 , 1 x 10 9 ~Approx. 1×10 11 , 5×10 9 ~Approx. 1×10 11 , 1 x 10 10 ~Approx. 1×10 11 , 5×10 10 ~Approx. 1×10 11 , 1 x 10 8 ~Approx. 5×10 10 , 5×10 8 ~Approx. 5×10 10 , 1 x 10 9 ~Approx. 5×10 10 , 5×10 9 ~Approx. 5×10 10 , 1 x 10 10 ~Approx. 5×10 10 , 1 x 10 8 ~Approx. 1×10 10 , 5×10 8 ~Approx. 1×10 10 , 1 x 10 9 ~Approx. 1×10 10 , 5×10 9 ~Approx. 1×10 10 , 1 x 10 8 ~Approx. 5×10 9 , 5×10 8 ~Approx. 5×10 9 , 1 x 109 ~Approx. 5×10 9 , 1 x 10 8 ~Approx. 1×10 9 , 5×10 8 ~Approx. 1×10 9 or 1 × 10 8 ~Approx. 5×10 8 It is between gc / kg body weight. In some embodiments, the dose of rAAV particles administered to an individual is about 1 × 10⁻⁶ 9 , about 5×10 9 , about 1×10 10 , about 5×10 10 , about 1×10 11 , about 5×10 11 , about 1×10 12 , about 5×10 12 , about 1×10 13 , about 5×10 13 , about 1×10 14 Or approximately 2 × 10 14 The value is genome copies / kg of body weight. In some embodiments, the dose of rAAV particles administered to an individual is approximately 5 × 10⁶ 13 The value is genome copies / kg of body weight. In some embodiments, the dose of rAAV particles administered to an individual is approximately 1 × 10⁻⁶. 14 The value is genome copies / kg of body weight. In some embodiments, the dose of rAAV particles administered to an individual is approximately 2 × 10⁻⁶. 14 This is expressed as genome copies per kg of body weight.
[0102] In some embodiments, the total amount of rAAV particles administered to an individual is at least about 1 × 10⁻⁶. 9 ~Approx. 2×10 14 This is either genome copies / kg of body weight. In some embodiments, the total amount of rAAV particles administered to an individual is approximately 1 × 10⁻⁶. 9 ~Approx. 2×10 14This is either genome copies / kg of body weight. In some embodiments of the present invention, the volume of the composition injected into the striatum is any one of 10 μl, 25 μl, 50 μl, 75 μl, 100 μl, 200 μl, 300 μl, 400 μl, 500 μl, 600 μl, 700 μl, 800 μl, 900 μl, 1 mL, 5 mL, 10 mL, 25 mL, 50 mL, 75 mL, or more than 100 mL, or any amount in between.
[0103] The compositions of the present invention (e.g., rAAV particles comprising a vector encoding the RNAi of this disclosure) can be used alone or in combination with one or more additional therapeutic agents to treat DM1. The interval between sequential doses may be at least minutes, hours, or days (or less).
[0104] In some embodiments, RNAi for treating DM1 is administered in combination with an immunosuppressant, for example, to suppress the immune response to the RNAi. In some embodiments, the immunosuppressant is administered before the administration of the RNAi. In some embodiments, the immunosuppressant is administered simultaneously with the administration of the RNAi. In some embodiments, the immunosuppressant is administered after the administration of the RNAi. In some embodiments, the immunosuppressant is administered after, during, or after the administration of the RNAi in any combination.
[0105] In some embodiments, rAAV particles for treating DM1 are administered in combination with an immunosuppressant, for example, to suppress the immune response to the rAAV particles and / or the transgene product of the rAAV particles. In some embodiments, the immunosuppressant is administered before the administration of the rAAV particles. In some embodiments, the immunosuppressant is administered simultaneously with the administration of the rAAV particles. In some embodiments, the immunosuppressant is administered after the administration of the rAAV particles. In some embodiments, the immunosuppressant is administered after, during, or after the administration of the rAAV particles in any combination.
[0106] In some embodiments, the present invention provides the use of any effective amount of any of the RNAi described herein in the manufacture of a pharmaceutical for treating myotonic dystrophy type 1 (DM1) in mammals requiring it. In some embodiments, the present invention provides the use of any effective amount of any of the RNAi described herein in the manufacture of a pharmaceutical for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in mammals having DM-1 requiring it. In some embodiments, the present invention provides the use of any effective amount of any of the RNAi described herein in the manufacture of a pharmaceutical for inhibiting the accumulation of intracellular DMPK RNA in mammals having DM-1 requiring it.
[0107] In some embodiments, the present invention provides the use of any effective amount of any of the RNAi described herein for treating myotonic dystrophy type 1 (DM1) in mammals requiring it. In some embodiments, the present invention provides the use of any of the RNAi described herein for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in mammals having DM-1 requiring it. In some embodiments, the present invention provides the use of any of the RNAi described herein for inhibiting the accumulation of intracellular DMPK RNA in mammals having DM-1 requiring it.
[0108] In some embodiments, the present invention provides RNAi described herein for treating myotonic dystrophy type 1 (DM1) in mammals requiring it. In some embodiments, the present invention provides any of the RNAi described herein for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in mammals having DM-1 requiring it. In some embodiments, the present invention provides any of the RNAi described herein for inhibiting the accumulation of intracellular DMPK RNA in mammals having DM-1 requiring it.
[0109] In some embodiments, the present invention provides the use of any effective amount of any of the viral particles described herein (e.g., AAV particles) in the manufacture of a pharmaceutical for treating myotonic dystrophy type 1 (DM1) in mammals requiring it. In some embodiments, the present invention provides the use of any of the viral particles described herein (e.g., AAV particles) in the manufacture of a pharmaceutical for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in mammals having DM-1 requiring it. In some embodiments, the present invention provides the use of any of the viral particles described herein (e.g., AAV particles) in the manufacture of a pharmaceutical for inhibiting the accumulation of DMPK RNA in cells of mammals having DM-1 requiring it.
[0110] In some embodiments, the present invention provides the use of any effective amount of any of the viral particles described herein (e.g., AAV particles) for treating myotonic dystrophy type 1 (DM1) in mammals requiring it. In some embodiments, the present invention provides the use of any of the viral particles described herein (e.g., AAV particles) for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in mammals having DM-1 requiring it. In some embodiments, the present invention provides the use of any of the viral particles described herein (e.g., AAV particles) for inhibiting the accumulation of DMPK RNA in cells of mammals having DM-1 requiring it.
[0111] In some embodiments, the present invention provides a viral particle (e.g., an AAV particle) described herein for treating myotonic dystrophy type 1 (DM1) in a mammal that needs it. In some embodiments, the present invention provides any one of the viral particles (e.g., AAV particles) described herein for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 that needs it. In some embodiments, the present invention provides any one of the viral particles (e.g., AAV particles) described herein for inhibiting the accumulation of DMPK RNA in cells of a mammal having DM-1 that needs it.
[0112] In some embodiments, the present invention provides the use of an effective amount of any one of the compositions described herein in the manufacture of a medicament for treating myotonic dystrophy type 1 (DM1) in a mammal that needs it. In some embodiments, the present invention provides the use of an effective amount of any one of the compositions described herein in the manufacture of a medicament for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 that needs it. In some embodiments, the present invention provides the use of an effective amount of any one of the compositions described herein in the manufacture of a medicament for inhibiting the accumulation of DMPK RNA in cells of a mammal having DM-1 that needs it.
[0113] In some embodiments, the present invention provides the use of an effective amount of any one of the compositions described herein for treating myotonic dystrophy type 1 (DM1) in a mammal that needs it. In some embodiments, the present invention provides the use of an effective amount of any one of the compositions described herein for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 that needs it. In some embodiments, the present invention provides the use of an effective amount of any one of the compositions described herein for inhibiting the accumulation of DMPK RNA in cells of a mammal having DM-1 that needs it.
[0114] In some embodiments, the present invention provides compositions described herein for treating myotonic dystrophy type 1 (DM1) in mammals requiring it. In some embodiments, the present invention provides any of the compositions described herein for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in mammals having DM-1 requiring it. In some embodiments, the present invention provides any of the compositions described herein for inhibiting the accumulation of intracellular DMPK RNA in mammals having DM-1 requiring it.
[0115] RNAi expression constructs and vectors The present invention provides expression constructs, vectors, and rAAV particles for expressing RNAi as described herein.
[0116] In some embodiments, the nucleic acids encoding RNAi of this disclosure include a heterologous miRNA scaffold. In some embodiments, the use of a heterologous miRNA scaffold is used to regulate miRNA expression, for example, to increase or decrease miRNA expression. Any miRNA scaffold known in the art can be used. In some embodiments, the miRNA scaffold is derived from the miR-155 scaffold (see, e.g., Lagos-Quintana, M. et al. (2002) Curr. Biol. 12:735-9 and Invitrogen® BLOCK-iT® Pol II miR RNAi Expression Vector Kit, Life Technologies, Thermo Fisher Scientific; Waltham, MA) or the mirGE scaffold (International Publication No. 2014 / 016817). In some embodiments, the nucleic acids encoding RNAi of this disclosure include a miRNA scaffold. In some embodiments, the miRNA scaffold is shown in Sequence ID No. 11. In some embodiments, the miRNA scaffold includes a nucleic acid sequence having 80%, 85%, 90%, 95%, or more than 99% identity with the nucleic acid sequence of SEQ ID NO: 11.
[0117] In some embodiments, RNAi targets RNA encoding a polypeptide associated with DM1 (e.g., mutant DMPK). While not theoretically bound, it is conceivable that RNAi could be used to reduce or eliminate the expression and / or activity of polypeptides whose gain-of-function is associated with DM1 (e.g., mutant DMPK).
[0118] In some embodiments, the transgene (for example, the RNAi encoding the present disclosure) is operably ligated to a promoter. Examples of promoters include the cytomegalovirus (CMV) earliest promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, Simianvirus 40 (SV40) promoter and CK6 promoter, transthyretin promoter (TTR), TK promoter, tetracycline response promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter, cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG promoter, Niwa et al., Gene, 1991, 108(2):193-9), and elongation factor 1-alpha promoter (EFl-alpha) promoter (Kimet al., Gene, 1990, 91(2):217-23 and Guo et al., Gene Examples include, but are not limited to, Ther., 1996, 3(9):802-10). In some embodiments, the promoter comprises a cytomegalovirus enhancer ligated to a human β-glucuronidase promoter or a chicken β-actin (CBA) promoter. The promoter may be constitutive, inducible, or repressive.
[0119] Inducible promoters allow for the regulation of gene expression, which can be regulated by the presence of exogenously supplied compounds, environmental factors such as temperature, or specific physiological conditions (e.g., acute phase, specific cell differentiation state, or only replicating cells). Examples of inductive promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (International Publication No. 98 / 10088), the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline inhibitory system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), and the tetracycline induction system (Gossen et al., Science, 268:1766-1769 (1995), Harvey et al. See also al., Curr. Opin. Chem. Biol., 2:512-518 (1998), RU486-inducible systems (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)) and rapamycin-inducible systems (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Further types of inducible promoters that may be useful in this regard are those regulated by specific physiological conditions, such as temperature, acute phase, specific differentiation states of cells, or only replicating cells.
[0120] In some embodiments, the regulatory sequence confers tissue-specific gene expression capability. In some cases, the tissue-specific regulatory sequence binds to a tissue-specific transcription factor that induces transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the promoter is a desmin promoter. In some embodiments, the promoter is a human desmin promoter (e.g., -228 to +75 of the human desmin gene, e.g., SEQ ID NO: 23). In some embodiments, the promoter is a modified desmin promoter. In some embodiments, the desmin promoter includes a desmin promoter element important for high-level expression in muscle cells (Li and Paulin, et al. 1991. Journal of Biol Chem.). In some embodiments, the desmin promoter includes at least one copy of a Byrne desmin enhancer (e.g., SEQ ID NO: 21). In some embodiments, the desmin promoter includes at least one copy of a Paulin desmin enhancer (-973 to -693) (e.g., SEQ ID NO: 22). In some embodiments, the desmin promoter includes one copy of a Byrne desmin enhancer and one copy of a Paulin desmin enhancer (-973 to -693). In some embodiments, the desmin promoter includes one copy of a Byrne desmin enhancer, one copy of a Paulin desmin enhancer (-973 to -693), and a promoter of the human desmin gene (-228 to +75).
[0121] In some embodiments, the present invention provides an expression cassette (for example, an expression cassette for expressing a transgene (for example, a therapeutic transgene) in muscle cells), the expression cassette comprising a modified desmin promoter, the desmin promoter comprising one or more enhancer elements and a promoter of the human desmin gene. In some embodiments, the desmin promoter comprises two enhancer elements and a promoter of the human desmin gene. In some embodiments, the desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21, and in some embodiments, the desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21, and one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the desmin promoter includes one or more enhancer elements containing nucleotide sequences having at least about 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the desmin promoter includes one or more enhancer elements containing nucleotide sequences having at least about 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the desmin promoter includes one or more enhancer elements containing nucleotide sequences having at least about 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence of SEQ ID NO: 21, and one or more enhancer elements contain nucleotide sequences having at least about 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence of SEQ ID NO: 22.
[0122] In some embodiments, the expression cassette containing the modified desmin promoter further includes an intron. In some embodiments, the intron is a rabbit β-globin intron. In some embodiments, the intron contains the nucleotide sequence of SEQ ID NO: 13. In some embodiments, the intron contains a nucleotide sequence having at least about 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence of SEQ ID NO: 13. In some embodiments, the nucleic acid encoding a transgene (e.g., a therapeutic transgene) is embedded in the intron. In some embodiments, the intron includes a 5' arm and a 3' arm, the 5' arm located on the 5' side of the nucleic acid encoding the transgene, and the 3' arm located on the 3' side of the nucleic acid encoding the transgene. In some embodiments, the 5' arm of the intron contains a nucleic acid having the sequence of SEQ ID NO: 14. In some embodiments, the 5' arm of the intron contains a nucleic acid having at least about 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence of SEQ ID NO: 14. In some embodiments, the 3' arm of the intron contains a nucleic acid having the sequence of SEQ ID NO: 15. In some embodiments, the 3' arm of the intron contains a nucleic acid having a sequence that is at least about 80%, 85%, 90%, 95%, or 99% identical to the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the 5' arm of the intron contains a nucleic acid having the sequence of SEQ ID NO: 14, and the 3' arm of the intron contains a nucleic acid having the sequence of SEQ ID NO: 15. In some embodiments, the 5' arm of the intron contains a nucleic acid having a sequence that is at least about 80%, 85%, 90%, 95%, or 99% identical to the nucleotide sequence of SEQ ID NO: 14, and the 3' arm of the intron contains a nucleic acid having a sequence that is at least about 80%, 85%, 90%, 95%, or 99% identical to the nucleotide sequence of SEQ ID NO: 15.
[0123] In some embodiments, the expression cassette containing the modified desmin promoter further includes a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA. In some embodiments, the polyadenylation signal is a minimal bovine growth hormone polyadenylation signal. In some embodiments, the bovine growth hormone polyadenylation signal includes a nucleic acid having the sequence of SEQ ID NO: 16. In some embodiments, the bovine growth hormone polyadenylation signal includes a nucleic acid having a sequence having at least about 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence of SEQ ID NO: 16.
[0124] In some embodiments, the present invention provides an expression cassette comprising a modified desmin promoter for expressing a transgene (e.g., a therapeutic transgene) in muscle cells. In some embodiments, the transgene encodes a polypeptide (e.g., a therapeutic polypeptide). In some embodiments, the transgene encodes a nucleic acid (e.g., a therapeutic nucleic acid). In some embodiments, the transgene encodes RNAi. In some embodiments, the transgene encodes siRNA, shRNA, or miRNA.
[0125] In some embodiments, the present invention provides a modified desmin promoter comprising one or more enhancer elements and a promoter of the human desmin gene. In some embodiments, the desmin promoter comprises two enhancer elements and a promoter of the human desmin gene. In some embodiments, the desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21, and in some embodiments, the desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21, and one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence having at least about 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the desmin promoter includes one or more enhancer elements containing nucleotide sequences having at least about 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the desmin promoter includes one or more enhancer elements containing nucleotide sequences having at least about 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence of SEQ ID NO: 21, and one or more enhancer elements containing nucleotide sequences having at least about 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence of SEQ ID NO: 22.
[0126] In some aspects, the present invention provides rAAV particles comprising a recombinant self-complementary genome (e.g., a self-complementary rAAV vector). Methods of using AAV virus particles comprising a self-complementary vector genome and self-complementary AAV genomes are described in U.S. Patents Nos. 6,596,535, 7,125,717, 7,465,583, 7,785,888, 7,790,154, 7,846,729, 8,093,054 and 8,361,457 and Wang Z., et al., (2003) Gene Ther 10:2105-2111, each of which is incorporated herein by reference in whole. rAAVs containing a self-complementary genome rapidly form a double-stranded DNA molecule due to their partially complementary sequences (e.g., complementary coding and non-coding strands of heterologous nucleic acids). In some embodiments, the vector comprises a first nucleic acid sequence encoding a heterologous nucleic acid and a second nucleic acid sequence encoding a complement of the nucleic acid, where the first nucleic acid sequence can form intra-strand base pairs with the second nucleic acid sequence along most or all of its length.
[0127] In some embodiments, a first heterologous nucleic acid sequence encoding RNAi and a second heterologous nucleic acid sequence encoding RNAi complements are linked by a mutant ITR (e.g., the ITR on the right). In some embodiments, the ITR is a polynucleotide sequence 5'- [ka] The mutant ITR contains a deletion in the D region, which includes a terminal dissociation sequence. As a result, when replicating the AAV viral genome, the viral genome is not cleaved at the mutant ITR by the rep protein, and thus, a recombinant viral genome is packaged into the viral capsid from 5' to 3', including: the AAV ITR, a first heterologous polynucleotide sequence containing a regulatory sequence, the mutant AAV ITR, a second heterologous polynucleotide in the opposite direction to the first heterologous polynucleotide, and a third AAVITR.
[0128] rAAV particles and methods for producing rAAV particles The present invention provides rAAV particles containing RNAi as disclosed herein. In some embodiments, the present invention provides a method for delivering RNAi using recombinant viral particles to treat DM1. In some embodiments, the rAAV particle comprises a sequence encoding the RNAi of the present disclosure flanked by one or two ITRs. The nucleic acid is capsid-formed within the AAV particle. The AAV particle also comprises a capsid protein. In some embodiments, the nucleic acid comprises a control sequence including a transcription start sequence and a termination sequence, which are components to which the coding sequence of interest (e.g., the nucleic acid encoding the RNAi of the present disclosure) is operatively linked in the transcription direction, thereby forming an expression cassette. The expression cassette is flanked by at least one functional AAV ITR sequence at its 5' and 3' ends. "Functional AAV ITR sequence" means that the ITR sequence functions as intended for the rescue, replication, and packaging of AAV virions. See Davidson et al., PNAS, 2000, 97(7)3428-32, Passini et al., J. Virol., 2003, 77(12):7034-40, and Pechan et al., Gene Ther., 2009, 16:10-16, all of which are incorporated herein by reference in their entirety. To carry out some aspects of the present invention, the recombinant vector contains at least the AAV sequence essential for capsid formation and all the physical structures for infection by rAAV. The AAV ITR for use in the vector of the present invention does not need to have a wild-type nucleotide sequence (as described, for example, Kotin, Hum. Gene Ther., 1994, 5:793-801), but may be modified by nucleotide insertion, deletion or substitution, or may be derived from one of several AAV serotypes. Currently, more than 40 AAV serotypes are known, and new serotypes and variants of existing serotypes continue to be identified. See Gao et al., PNAS, 2002, 99(18):11854-6, Gao et al., PNAS, 2003, 100(10):6081-6, and Bossis et al., J. Virol., 2003, 77(12):6799-810.The use of any AAV serotype is considered to be within the scope of the present invention. In some embodiments, the rAAV vector is a vector derived from an AAV serotype, and for example, but not limited to, AAV ITRs include ITRs of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAVrh74, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serotypes. In some embodiments, the nucleic acid in the AAV includes ITRs such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serotype ITRs. In some embodiments, the nucleic acid in the AAV further encodes RNAi as described herein. For example, the nucleic acid in the AAV may include at least one ITR of any AAV serotype assumed herein and may further encode RNAi comprising one strand containing a guide region and another strand containing a non-guide region. In one embodiment, the nucleic acid in AAV may contain at least one ITR of any AAV serotype and may further encode an RNAi comprising a first strand containing a first nucleic acid containing the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) or a sequence having 80%, 85%, 90%, or 95% identity with SEQ ID NO: 1, and a second strand containing a second nucleic acid containing the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2) or a sequence having 80%, 85%, 90%, or 95% identity with SEQ ID NO: 2.
[0129] In some embodiments, the nucleic acid in the AAV comprises a nucleic acid encoding the following from 5' to 3': an ITR (e.g., AAV2 ITR), a promoter, a nucleic acid encoding RNAi as disclosed herein, a polyadenylation signal, and an AAV ITR (e.g., AAV2 ITR). In some embodiments, the nucleic acid in the AAV comprises a nucleic acid encoding RNAi comprising a first strand containing a first nucleic acid having sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) or a sequence having 80%, 85%, 90%, or 95% identity with SEQ ID NO: 1, and a second strand containing a second nucleic acid having sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2) or a sequence having 80%, 85%, 90%, or 95% identity with SEQ ID NO: 2, a polyadenylation signal, and an AAV ITR (e.g., AAV2 ITR). In some embodiments, the nucleic acids in the AAV include, from 5' to 3', nucleic acids encoding the following: an ITR (e.g., AAV2 ITR), a desmin promoter, a nucleic acid encoding RNAi as disclosed herein, a polyadenylation signal (e.g., poly(A) of bovine growth hormone), and an AAV ITR (e.g., AAV2 ITR). In some embodiments, the nucleic acids in the AAV include, from 5' to 3', nucleic acids encoding the following: an ITR (e.g., AAV2 ITR), a desmin promoter, an intron (e.g., a chimeric intron), a nucleic acid encoding RNAi, a first strand containing a first nucleic acid having sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) or a sequence having 80%, 85%, 90%, or 95% identity with SEQ ID NO: 1, and a second strand containing a second nucleic acid having sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2) or a sequence having 80%, 85%, 90%, or 95% identity with SEQ ID NO: 2, a polyadenylation signal (e.g., poly-A of bovine growth hormone), and all or a functional portion thereof of the AAV ITR (e.g., AAV2 ITR). In some embodiments, the first and second strands form a double helix.In some embodiments, the first strand is linked to the second strand by a linker. In some embodiments, the linker includes the nucleic acid sequence of SEQ ID NO: 3 or a sequence having 80%, 85%, 90%, or 95% identity with SEQ ID NO: 3.
[0130] In some embodiments, the nucleic acids in AAV include nucleic acids encoding the following from 5' to 3': ITR (e.g., AAV2) RNAi encoding nucleic acid comprising a first strand containing a first nucleic acid containing sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) or a sequence having 80%, 85%, 90%, or 95% identity with SEQ ID NO: 1, and a second strand containing a second nucleic acid containing sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2) or a sequence having 80%, 85%, 90%, or 95% identity with SEQ ID NO: 2, a 3' arm of an intron (e.g., rabbit β-globin intron), a polyadenylation signal (e.g., poly-A of bovine growth hormone), a stuffer sequence (e.g., all or part of human α-1-antitrypsin (AAT) stuffer sequence), and AAV All or any functional part of an ITR (e.g., AAV2 ITR).
[0131] In some embodiments, the nucleic acid in the AAV includes, from 5' to 3', a nucleic acid encoding the following: an ITR (e.g., AAV2 ITR), a desmin promoter, a nucleic acid encoding RNAi, a first strand containing a first nucleic acid containing the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2) or a sequence having 80%, 85%, 90%, or 95% identity with SEQ ID NO: 2, and a second strand containing a second nucleic acid containing the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 1) or a sequence having 80%, 85%, 90%, or 95% identity with SEQ ID NO: 1, a polyadenylation signal (e.g., poly-A of bovine growth hormone), and an AAV ITR (e.g., AAV2 ITR). In some embodiments, the first and second strands form a double helix. In some embodiments, the first strand is linked to the second strand by a linker. In some embodiments, the linker contains the nucleic acid sequence SEQ ID NO: 6.
[0132] In some embodiments, the nucleic acid in the AAV includes, from 5' to 3', a nucleic acid encoding the following: an ITR (e.g., AAV2 ITR), a stuffer sequence (e.g., all or part of the human α-1-antitrypsin (AAT) stuffer sequence), a desmin promoter, a 5' arm of an intron (e.g., a rabbit β-globin intron), a nucleic acid encoding RNAi comprising a first strand containing a first nucleic acid with sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2) and a second strand containing a second nucleic acid with sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1), a 3' arm of an intron (e.g., a rabbit β-globin intron), a polyadenylation signal (e.g., poly-A of bovine growth hormone), a stuffer sequence (e.g., all or part of the human α-1-antitrypsin (AAT) stuffer sequence), and all or a functional portion thereof of the AAV ITR (e.g., AAV2 ITR).
[0133] In some embodiments, the vector may contain (one or more) stuffer nucleic acids. In some embodiments, the stuffer nucleic acid may contain a sequence encoding a reporter polypeptide. As will be understood by those skilled in the art, the stuffer nucleic acid may be located in various regions within the vector and may consist of a contiguous sequence within the vector (e.g., a single stuffer nucleic acid at a single position) or multiple sequences (e.g., two or more stuffer nucleic acids at two or more positions (e.g., two positions, three positions, etc.)). In some embodiments, the stuffer nucleic acid may be located downstream of the RNAi sequence. In embodiments, the stuffer nucleic acid may be located upstream of the RNAi sequence (e.g., between the promoter and the nucleic acid encoding the RNAi). Similarly, as will be understood by those skilled in the art, various nucleic acids may be used as stuffer nucleic acids. In some embodiments, the stuffer nucleic acid may contain all or part of a human alpha-1-antitrypsin (AAT) stuffer sequence or a C16 P1 chromosome 16 P1 clone (human C16) stuffer sequence. In some embodiments, the stuffer sequence may contain all or part of a gene. For example, the stuffer sequence includes a portion of the human AAT sequence. Those skilled in the art will recognize that various parts of a gene (e.g., the human AAT sequence) can be used as stuffer fragments. For example, a stuffer fragment may originate from the 5' end of a gene, the 3' end of a gene, the middle of a gene, a non-coding portion of a gene (e.g., an intron), a coding region of a gene (e.g., an exon), or a mixture of non-coding and coding portions of a gene. Those skilled in the art will also recognize that all or part of a stuffer sequence can be used as stuffer fragments. In some embodiments, the vector includes a 5' stuffer sequence containing the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence having about 80%, 85%, 90%, 95%, or more than 99% identity with the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the vector includes a 3' stuffer sequence containing the nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence having about 80%, 85%, 90%, 95%, or more than 99% identity with the nucleotide sequence of SEQ ID NO: 19.In some embodiments, the vector includes a 5' stuffer sequence containing the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence having approximately 80%, 85%, 90%, 95%, or more than 99% identity with the nucleotide sequence of SEQ ID NO: 18, and a 3' stuffer sequence containing the nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence having approximately 80%, 85%, 90%, 95%, or more than 99% identity with the nucleotide sequence of SEQ ID NO: 19.
[0134] In further embodiments, the rAAV particles comprise a capsid protein containing the AAVrh74 capsid protein or a variant thereof. In some embodiments, the AAVrh74 capsid is a variant-type capsid. In some embodiments, the AAVrh74 variant capsid protein retains the ability to form an AAV capsid. In some embodiments, the AAVrh74 variant capsid is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and at least 100% identical to the wild-type AAVrh74 capsid protein. In some embodiments, the AAVrh74 variant capsid includes a substitution at amino acid position N502. In some embodiments, the substitution at amino acid position N502 is isoleucine(I). In some embodiments, the AAVrh74 variant capsid protein includes a substitution at amino acid position W505. In some embodiments, the substitution at amino acid position W505 is arginine (R).
[0135] Different AAV serotypes are used to optimize the transduction of specific target cells or to target specific cell types within specific target tissues (e.g., diseased tissue, e.g., muscle tissue). rAAV particles may contain viral proteins and viral nucleic acids of the same or mixed serotype. For example, in some embodiments, rAAV particles may contain the AAVrh74 capsid protein or a variant thereof and at least one ITR of a different AAV serotype. In some embodiments, rAAV particles may contain the AAVrh74 capsid protein or a variant thereof and at least one AAV2 ITR. In some embodiments, rAAV particles may contain the AAVrh74N502I capsid protein and at least one AAV2 ITR. In some embodiments, rAAV particles may contain the AAVrhW505R capsid protein and at least one AAV2 ITR.
[0136] In some embodiments, the present invention provides viral particles containing recombinant self-complementary genomes. Methods of using rAAV particles containing self-complementary genomes and self-complementary AAV genomes are described in U.S. Patents Nos. 6,596,535, 7,125,717, 7,465,583, 7,785,888, 7,790,154, 7,846,729, 8,093,054 and 8,361,457 and Wang Z., et al., (2003) Gene Ther 10:2105-2111, each of which is incorporated herein by reference in whole. rAAVs containing self-complementary genomes rapidly form double-stranded DNA molecules due to their partially complementary sequences (e.g., complementary coding and non-coding strands of the transgene). In some embodiments, the present invention provides rAAV particles comprising an AAV genome, the rAAV genome comprising a first heterogeneous polynucleotide sequence (e.g., RNAi as disclosed) and a second heterogeneous polynucleotide sequence (e.g., the antisense strand of RNAi as disclosed), wherein the first heterogeneous polynucleotide sequence can form intra-chain base pairs with the second polynucleotide sequence along most or all of its length. In some embodiments, the first heterogeneous polynucleotide sequence and the second heterogeneous polynucleotide sequence are linked by a sequence that facilitates intra-chain base pairing, such as a hairpin DNA structure. Hairpin structures are known, for example, in the art of miRNA molecules or siRNA molecules. In some embodiments, the first heterogeneous polynucleotide sequence and the second heterogeneous polynucleotide sequence are linked by a mutant ITR (e.g., a right ITR). In some embodiments, the ITR is a polynucleotide sequence 5'- [ka] The mutant ITR includes a deletion in the D region containing a terminal dissociation sequence. As a result, when replicating the AAV viral genome, the viral genome is not cleaved at the mutant ITR by the rep protein, and thus, a recombinant viral genome comprising the following is packaged into the viral capsid from 5' to 3': AAV ITR, a first heterologous polynucleotide sequence containing a regulatory sequence, the mutant AAV ITR, a second heterologous polynucleotide in the opposite direction to the first heterologous polynucleotide, and a third AAVITR. In some embodiments, the present invention provides an AAV viral particle comprising a recombinant viral genome comprising a functional AAV2 ITR, a first polynucleotide sequence encoding the RNAi of the present disclosure, a mutant AAV2 ITR containing a deletion in the D region and lacking a functional terminal dissociation sequence, a second polynucleotide sequence containing a complementary sequence to the RNAi encoding the RNAi of the present disclosure, the first polynucleotide sequence, and a functional AAV2 ITR.
[0137] rAAV particles can be produced using methods known in the art. See, for example, U.S. Patents 6,566,118, 6,989,264, and 6,995,006. In practice of the present invention, host cells for producing rAAV particles include mammalian cells, insect cells, plant cells, microorganisms, and yeasts. The host cell may be a host cell in which the AAV vector genome is stably maintained, or a packaging cell in which the rep and cap genes of AAV are stably maintained within the producer cell. Exemplary packaging and producer cells are derived from 293 cells, A549 cells, or HeLa cells. The AAV vector is purified and formulated using standard techniques known in the art.
[0138] Methods known in the art for producing rAAV vectors include, but are not limited to, transfection, production of stable expression strains, and infectious hybrid virus production systems including adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al., (1997) J. Virology 71(11):8780-8789) and baculovirus-AAV hybrids. All rAAV production cultures for producing rAAV virus particles require: 1) suitable host cells, including, for example, human cell lines such as HeLa cells, A549 cells, or 293 cells, or insect cell lines such as SF-9 in the case of baculovirus production systems; 2) suitable helper virus functions provided by a plasmid construct that provides helper function, such as wild-type or mutant adenovirus (e.g., temperature-sensitive adenovirus); herpesvirus; baculovirus; 3) AAV rep and cap genes and gene products; 4) nucleic acids (e.g., therapeutic nucleic acids) adjacent to at least one AAV ITR sequence; and 5) appropriate culture media and culture components to support rAAV production. In some embodiments, the AAV rep and cap gene products may be from any AAV serotype. Generally, although not essential, the AAV rep gene product is of the same serotype as the ITR of the rAAV vector genome, insofar as the rep gene product can function to replicate and package the rAAV genome. Suitable media known in the art may be used for the preparation of rAAV vectors. These media include, but are not limited to, modified Eagle medium (MEM), Dulbecco's modified Eagle medium (DMEM), custom formulations such as those described in U.S. Patent No. 6,566,118, and media produced by Hyclone Laboratories and JRH, such as Sf-900 II SFM medium as described in U.S. Patent No. 6,723,551, each of which is incorporated herein by reference in whole, particularly with respect to custom media formulations used to produce recombinant AAV vectors. In some embodiments, the AAV helper function is provided by adenovirus or HSV.In some embodiments, the AAV helper function is provided by a baculovirus, and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cell).
[0139] In some embodiments, rAAV particles may be produced by a triple transfection method, for example, an exemplary triple transfection method provided below. Briefly, a plasmid containing the rep gene and the capsid gene may be transfected with a helper adenovirus plasmid into a cell line (e.g., HEK-293 cells) (e.g., using the calcium phosphate method), the virus may be collected and optionally purified. Thus, in some embodiments, rAAV particles are produced by triple transfection into a host cell of nucleic acids encoding the rAAV vector, nucleic acids encoding AAV rep and cap, and nucleic acids encoding AAV helper virus function, the transfection of this nucleic acid into a host cell generating a host cell capable of producing rAAV particles.
[0140] In some embodiments, rAAV particles can be produced by producer cell line methods, e.g., exemplary producer cell line methods provided below (see also those mentioned in Martin et al., (2013) Human Gene Therapy Methods 24:253-269). Briefly, a cell line (e.g., HeLa cell line) can be stably transfected with a plasmid containing a rep gene, a capsid gene, and a promoter-heterogeneous nucleic acid sequence. Cell lines can be screened to select lead clones for rAAV production, which can then be deployed in a production bioreactor and infected with an adenovirus (e.g., wild-type adenovirus) as a helper to initiate rAAV production. The virus can then be recovered, the adenovirus inactivated and / or removed (e.g., by heat), and the rAAV particles can be purified. Therefore, in some embodiments, rAAV particles were produced by a cell line containing one or more nucleic acids encoding the rAAV vector, nucleic acids encoding AAV rep and cap, and nucleic acids encoding AAV helper virus function.
[0141] In some embodiments, a method is provided for producing any rAAV particles as disclosed herein, comprising (a) culturing a host cell under conditions for the production of rAAV particles, the host cell comprising (i) one or more AAV packaging genes, each of which encodes an AAV replica and / or capsid-forming protein, (ii) an rAAV probe vector comprising a nucleic acid encoding an RNAi of the Disclosure as described herein, adjacent to at least one AAV ITR, and (iii) an AAV helper function, and (b) recovering the rAAV particles produced by the host cell. In some embodiments, the RNAi comprises the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the at least one AAV ITR is selected from the group consisting of AAV ITRs, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, AAVrh74 N502I, AAVrh74 W505R, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serotype ITR. In some embodiments, the capsid-forming protein is selected from the group consisting of AAVrh74 or its variants, such as AAVrh74 N502I or AAVrh74 W505R. In some embodiments, the capsid-forming protein is the AAVrh74 protein. In some embodiments, the encapsulating protein is a variant of the AAVrh74 protein. In some embodiments, the capsid-forming protein is the AAVrh74N502I protein. In some embodiments, the capsid-forming protein is the AAVrh74W505R protein. In some embodiments, the variant AAVrh74 capsid protein retains the ability to form AAV capsids. In some embodiments, the rAAV particle comprises the AAVrh74 N502I capsid, a recombinant genome including the AAV2 ITR, and a nucleic acid encoding the RNAi of this disclosure.In some embodiments, the rAAV particles comprise an AAVrh74 W505R capsid, a recombinant genome including an AAV2 ITR, and a nucleic acid encoding the RNAi of this disclosure. In further embodiments, the rAAV particles are purified. As used herein, the term “purification” includes the preparation of rAAV particles lacking at least some of other components that are naturally present in the rAAV particles or that may be present where they were first prepared. Thus, for example, isolated rAAV particles may be prepared using a purification technique that can concentrate a source mixture, such as a culture lysate or a production culture supernatant. Concentration can be measured in various ways, for example, by the proportion of DNase-resistant particles (DRPs) or genome copies (gc) present in the solution or by infectivity, or it can be measured in relation to a second potentially interfering substance present in the source mixture, such as a production culture contaminant or an in-process contaminant including helper viruses, culture medium components, etc.
[0142] Pharmaceutical compositions comprising rAAV particles containing a transgene encoding the RNAi of this disclosure and a pharmaceutically acceptable carrier are also provided herein. The pharmaceutical compositions may be suitable for any of the administration methods described herein. Pharmaceutical compositions of rAAV particles containing the nucleic acid encoding the RNAi of this disclosure can be delivered systemically. For example, recombinant viral particles containing the nucleic acid encoding the RNAi of this disclosure can be administered intravenously, intra-arterially, subcutaneously, or intraperitoneally.
[0143] In some embodiments, a pharmaceutical composition comprising recombinant viral particles containing a transgene encoding the RNAi described herein and a pharmaceutically acceptable carrier is suitable for administration to humans. Such carriers are well known in the art (see, for example, Remington's Pharmaceutical Sciences, 15th edition, pp. 1035-1038 and 1570-1580). In some embodiments, a pharmaceutical composition comprising the rAAV described herein and a pharmaceutically acceptable carrier is suitable for systemic injection into mammals.
[0144] Such pharmaceutically acceptable carriers may be sterile solutions such as water and oil, e.g., of petroleum, animal, plant, or synthetic origin, e.g., peanut oil, soybean oil, mineral oil. Physiological saline and aqueous dextrose solutions, polyethylene glycol (PEG), and aqueous glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. Pharmaceutical compositions may further contain additional components, such as preservatives, buffers, isotonic agents, antioxidants and stabilizers, nonionic wetting agents or clarifiers, viscosity enhancers, etc. The pharmaceutical compositions described herein may be packaged in single unit doses or multiple doses. The compositions are generally formulated as sterile and substantially isotonic solutions.
[0145] Products and kits Kits or products used in the methods described herein are also provided. In some embodiments, the kit comprises the composition described herein (e.g., rAAV particles of the disclosure comprising nucleic acids encoding the RNAi of the disclosure) in suitable packaging. Suitable packaging for the composition described herein is known in the art and includes, for example, vials (such as sealed vials), containers, ampoules, bottles, jars, and flexible packaging (e.g., sealed Mylar bags or plastic bags). These products may be further sterilized and / or sealed.
[0146] The present invention also provides kits comprising the compositions described herein, which may further include instructions on how to use the compositions, such as the uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, such as other buffers, diluents, filters, needles, syringes, and accompanying documentation including instructions for carrying out any of the methods described herein. For example, in some embodiments, the kit comprises a composition of recombinant viral particles comprising a transgene encoding the RNAi of the present disclosure for delivering an effective amount of rAAV particles to a mammal, a pharmaceutically acceptable carrier suitable for injection into a mammal, and accompanying documentation including one or more of the following: buffers, diluents, filters, needles, syringes, and instructions for making an injection into a mammal. In some embodiments, a kit comprising instructions for treating DM-1 with rAAV particles is described herein. In some embodiments, a kit comprising instructions for using rAAV particles according to any one of the methods described herein is described herein.
[0147] Exemplary Embodiments The present invention includes the exemplary embodiments listed below. 1. Recombinant adeno-associated virus (rAAV) particles, a) RNAi comprising a first strand and a second strand, i) The first and second chains form a double helix, ii) The first strand includes a guide region, the guide region includes nucleic acids having sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) or a sequence having approximately 90% identity with sequence SEQ ID NO: 1, and iii) The second strand contains RNAi, including a non-guide region, b) AAV capsids containing an amino acid sequence that is approximately 90% identical to the wild-type AAVrh74 capsid and Recombinant adeno-associated virus (rAAV) particles containing this virus.
[0148] 2. The rAAV particle according to Embodiment 1, wherein the non-guide region contains a nucleic acid having sequence 5'ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2) or a sequence having approximately 90% identity with sequence SEQ ID NO: 2.
[0149] 3. An rAAV particle according to Embodiment 1 or 2, wherein the first strand comprises a nucleic acid having the sequence of SEQ ID NO: 1, and the non-guide region comprises a nucleic acid having the sequence of SEQ ID NO: 2.
[0150] 4. The rAAV particle according to any one of embodiments 1 to 3, wherein the first and second strands are linked by an RNA linker capable of forming a loop structure.
[0151] 5. The RNA linker is an rAAV particle according to Embodiment 4, containing approximately 4 to approximately 50 nucleotides.
[0152] 6. The loop structure comprises approximately 4 to approximately 20 nucleotides, as described in Embodiment 4 or 5 of the rAAV particle.
[0153] 7. The rAAV particle according to any one of Embodiments 4 to 6, wherein the loop structure comprises a nucleic acid having the sequence of SEQ ID NO: 3 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 3.
[0154] 8. The rAAV particle according to any one of Embodiments 4 to 7, wherein the RNAi comprises a second strand, an RNA linker, and a first strand, from 5' to 3'.
[0155] 9. The rAAV particle according to any one of Embodiments 4 to 7, wherein the RNAi comprises a first strand, an RNA linker, and a second strand, from 5' to 3'.
[0156] 10. The rAAV particle according to any one of Embodiments 1 to 8, wherein the RNAi comprises a nucleic acid having the sequence of SEQ ID NO: 7 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 7.
[0157] 11. An rAAV particle according to any one of Embodiments 1 to 10, which is a small inhibitory RNA (siRNA), microRNA (miRNA), or small hairpin RNA (shRNA).
[0158] 12. rAAV particles according to any one of embodiments 1 to 11, further comprising a scaffold.
[0159] 13. The scaffold is an rAAV particle according to Embodiment 12, comprising all or part of the nucleic acid of Sequence ID No. 11.
[0160] 14. The miRNA is embedded within the scaffold, as described in Embodiment 13, in the rAAV particle.
[0161] 15. The rAAV particle according to Embodiment 14, wherein the scaffold has a 5' arm located on the 5' side of the nucleic acid encoding the RNAi and a 3' arm located on the 3' side of the nucleic acid encoding the RNAi.
[0162] 16. The scaffold is a miR-155 scaffold, and the rAAV particles are as described in any one of embodiments 12 to 15.
[0163] 17. The rAAV particle according to any one of Embodiments 12 to 16, wherein the miR-155 scaffold comprises a nucleic acid located at the 5' end of the RNAi, and having approximately 90% identity with sequence number 9 or sequence number 9.
[0164] 18. The rAAV particle according to any one of Embodiments 12 to 17, wherein the miR-155 scaffold comprises a nucleic acid located at the 3' end of the RNAi, having approximately 90% identity with sequence number 10 or sequence number 10.
[0165] 19. RNAi is an rAAV particle according to any one of Embodiments 1 to 18, which targets RNA encoding a polypeptide associated with myotonic dystrophy type 1 (DM1).
[0166] 20. The polypeptide is myotonic dystrophy protein kinase (DMPK) in the rAAV particles according to Embodiment 19.
[0167] 21. DMPK is an rAAV particle according to Embodiment 20, comprising a mutation related to DM 1.
[0168] 22. The rAAV particle according to Embodiment 20 or 21, wherein the gene encoding DMPK contains five or more CTG trinucleotide repeats.
[0169] 23. An expression cassette comprising a nucleic acid sequence encoding an RNAi as described in any one of Embodiments 1 to 22.
[0170] 24. An expression cassette according to Embodiment 23, wherein the nucleic acid encoding RNAi is operably ligated to a promoter.
[0171] 25. The expression cassette according to Embodiment 24, wherein the promoter is a muscle-specific promoter.
[0172] 26. The expression cassette according to Embodiment 24 or 25, wherein the promoter is the desmin promoter or a variant thereof.
[0173] 27. The desmin promoter is an expression cassette according to Embodiment 26, comprising one or more enhancer elements and a promoter of the human desmin gene.
[0174] 28. The desmin promoter is an expression cassette according to Embodiment 26 or 27, comprising two enhancer elements and a promoter of the human desmin gene.
[0175] 29. The desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements, according to any one of embodiments 26 to 28.
[0176] 30. An expression cassette according to any one of embodiments 26 to 29, wherein the desmin promoter comprises one or more enhancer elements containing the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO: 21 and / or one or more enhancer elements containing the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO: 22.
[0177] 31. An expression cassette according to any one of embodiments 26 to 30, wherein the desmin promoter comprises the nucleotide sequence of SEQ ID NO: 12 or a sequence having approximately 90% identity with the nucleotide sequence of SEQ ID NO: 12.
[0178] 32. An expression cassette according to any one of embodiments 23 to 31, further comprising an intron.
[0179] 33. The expression cassette according to Embodiment 32, wherein the intron is a rabbit β-globin intron.
[0180] 34. An expression cassette according to Embodiment 32 or 33, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 13 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 13.
[0181] 35. An expression cassette according to any one of embodiments 32 to 34, wherein the nucleic acid encoding RNAi is embedded in an intron.
[0182] 36. The expression cassette according to Embodiment 35, wherein the intron comprises a 5' arm and a 3' arm, the 5' arm located on the 5' side of the nucleic acid encoding the RNAi, and the 3' arm located on the 3' side of the nucleic acid encoding the RNAi.
[0183] 37. The expression cassette according to Embodiment 36, wherein the 5' arm of the intron contains the nucleotide sequence of SEQ ID NO: 14 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 14.
[0184] 38. An expression cassette according to Embodiment 36 or 37, wherein the 3' arm of the intron includes the nucleotide sequence of SEQ ID NO: 15 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 15.
[0185] 39. An expression cassette according to any one of embodiments 23 to 38, further comprising a polyadenylation signal.
[0186] 40. The expression cassette according to Embodiment 39, wherein the polyadenylation signal is the bovine growth hormone polyadenylation signal, the SV40 polyadenylation signal, or HSV TK pA.
[0187] 41. The polyadenylation signal is a minimal bovine growth hormone polyadenylation signal in the expression cassette according to Embodiment 40.
[0188] 42. The bovine growth hormone polyadenylation signal comprises the nucleotide sequence of SEQ ID NO: 16 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 16, according to any one of Embodiments 39 to 41.
[0189] 43. An expression cassette according to any one of embodiments 23 to 42, comprising the nucleotide sequence of SEQ ID NO: 17 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 17.
[0190] 44. An expression cassette comprising a modified desmin promoter, wherein the modified desmin promoter comprises one or more enhancer elements and a promoter of the human desmin gene.
[0191] 45. The modified desmin promoter is an expression cassette according to Embodiment 44, comprising two enhancer elements and a promoter of the human desmin gene.
[0192] 46. The modified desmin promoter is an expression cassette according to Embodiment 44 or 45, comprising one or more Byrne enhancer elements and / or one or more Paulin enhancer elements.
[0193] 47. The modified desmin promoter comprises one or more enhancer elements including the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having approximately 90% identity with the sequence of SEQ ID NO: 21 and / or one or more enhancer elements including the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having approximately 90% identity with the sequence of SEQ ID NO: 22, according to any one of embodiments 44 to 46.
[0194] 48. An expression cassette according to any one of embodiments 44 to 47, wherein the desmin promoter comprises the nucleotide sequence of SEQ ID NO: 12 or a sequence having approximately 90% identity with the nucleotide sequence of SEQ ID NO: 12.
[0195] 49. An expression cassette according to any one of embodiments 44 to 48, further comprising an intron.
[0196] 50. The expression cassette according to Embodiment 49, wherein the intron is a rabbit β-globin intron.
[0197] 51. An expression cassette according to Embodiment 49 or 50, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 13 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 13.
[0198] 52. An expression cassette according to any one of embodiments 44 to 51, wherein the nucleic acid encoding the introduced gene is embedded in an intron.
[0199] 53. The expression cassette according to Embodiment 52, wherein the intron comprises a 5' arm and a 3' arm, the 5' arm located on the 5' side of the nucleic acid encoding the transgene, and the 3' arm located on the 3' side of the nucleic acid encoding the transgene.
[0200] 54. The expression cassette according to Embodiment 53, wherein the 5' arm of the intron contains the nucleotide sequence of SEQ ID NO: 14 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 14.
[0201] 55. An expression cassette according to Embodiment 53 or 54, wherein the 3' arm of the intron includes the nucleotide sequence of SEQ ID NO: 15 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 15.
[0202] 56. An expression cassette according to any one of embodiments 44 to 55, further comprising a polyadenylation signal.
[0203] 57. The expression cassette according to Embodiment 56, wherein the polyadenylation signal is the bovine growth hormone polyadenylation signal, the SV40 polyadenylation signal, or HSV TK pA.
[0204] 58. The polyadenylation signal is a minimal bovine growth hormone polyadenylation signal, as described in Embodiment 57 of the expression cassette.
[0205] 59. The bovine growth hormone polyadenylation signal comprises the nucleotide sequence of SEQ ID NO: 16 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 16, according to any one of embodiments 56 to 58.
[0206] 60. An expression cassette according to any one of embodiments 44 to 59, wherein the introduced gene encodes a polypeptide or nucleic acid.
[0207] 61. The introduced gene is an expression cassette according to any one of embodiments 44 to 60, encoding RNAi.
[0208] 62. A vector comprising an expression cassette as described in any one of embodiments 23 to 61.
[0209] 63. The vector according to Embodiment 62, wherein the expression cassette is adjacent to one or more Staffor nucleic acid sequences.
[0210] 64. The vector according to Embodiment 63, wherein one or more Stuffer nucleic acid sequences are derived from the human SerpinA1 gene.
[0211] 65. The vector according to embodiment 63 or 64, wherein the Stuffer nucleic acid sequence located at the 5' end of the expression cassette is derived from the human SerpinA1 gene.
[0212] 66. The vector according to any one of embodiments 63 to 65, wherein the stuffer sequence located at the 5' end of the expression cassette includes the nucleotide sequence of SEQ ID NO: 18 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 18.
[0213] 67. The vector according to any one of embodiments 63 to 66, wherein the Stuffer nucleic acid sequence located at the 3' end of the expression cassette is derived from the human SerpinA1 gene.
[0214] 68. The vector according to any one of embodiments 63 to 67, wherein the stuffer sequence located at the 3' end of the expression cassette includes the nucleotide sequence of SEQ ID NO: 19 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 19.
[0215] 69. A recombinant adeno-associated virus (rAAV) vector, as described in any one of embodiments 62 to 68.
[0216] 70. The rAAV vector according to Embodiment 69, wherein the expression cassette is adjacent to one or more AAV inverted terminal repeat (ITR) sequences.
[0217] 71. The rAAV vector according to Embodiment 70, wherein the expression cassette is adjacent to two AAV ITRs.
[0218] 72. The rAAV vector according to Embodiment 70 or 71, wherein the AAV ITR is an ITR of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV serotype.
[0219] 73. The rAAV vector according to any one of embodiments 70 to 72, wherein the AAV ITR is an AAV2 ITR.
[0220] 74. An rAAV vector according to any one of embodiments 69 to 73, comprising the nucleotide sequence of SEQ ID NO: 20 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 20.
[0221] 75. An rAAV vector according to any one of embodiments 69 to 74, which is a self-complementary rAAV vector.
[0222] 76. Cells comprising an expression cassette according to any one of embodiments 23 to 61, a vector according to any one of embodiments 62 to 68, or an rAAV vector according to any one of embodiments 69 to 75.
[0223] 77. The rAAV particle according to any one of Embodiments 1 to 22, wherein the AAV capsid comprises an amino acid sequence including an amino acid substitution at position 502.
[0224] The rAAV particle according to Embodiment 77, wherein the amino acid substitution at position 78.502 is isoleucine(I).
[0225] 79. rAAV particles according to Embodiment 77 or 78, comprising a capsid of the AAVrh74 N502I serotype.
[0226] 80. The rAAV particle according to Embodiment 77 or 78, wherein the ITR is AAV2 ITR and the capsid of the rAAV particle is the capsid of AAVrh74 N502I serotype.
[0227] 81. The rAAV particle according to any one of Embodiments 1 to 22, wherein the AAV capsid comprises an amino acid sequence including an amino acid substitution at position 505.
[0228] The rAAV particle according to Embodiment 81, wherein the amino acid substitution at position 82.505 is arginine(R).
[0229] 83. rAAV particles according to any one of Embodiments 1 to 22, comprising a capsid of the AAVrh74 W505R serotype.
[0230] 84. The rAAV particle according to Embodiment 83, wherein the ITR is AAV2 ITR, and the capsid of the rAAV particle is the capsid of the AAVrh74 W505R serotype.
[0231] 85. rAAV particles comprising an rAAV vector and a capsid, wherein the rAAV vector comprises the following nucleic acids from 5' to 3': AAV2 ITR, nucleic acid encoding a Stuffer nucleic acid sequence derived from the human serpin A1 gene, Byrne desmin enhancer element, Paulin desmin enhancer element, desmin promoter, 5' arm of rabbit β-globin intron, 5' miR155 scaffold sequence, and DMPK. 204 miRNA guide sequence, miR155 terminal loop sequence, DMPK 204 The rAAV particle contains a miRNA passenger sequence, a 3' miR155 scaffold sequence, a 3' arm of a rabbit β-globin intron, a minimal bovine growth hormone polyadenylation sequence, a nucleic acid encoding a human serpin A1 gene-derived Stuffer nucleic acid sequence, and an AAV2 ITR, with the capsid being the AAVrh74 N502I capsid.
[0232] 86. rAAV particles containing an rAAV vector, the rAAV vector comprising, from 5' to 3', the following nucleic acids: an AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 43; a nucleic acid encoding a human serpinA1 gene-derived Stuffer nucleic acid sequence containing the polynucleotide sequence of SEQ ID NO: 18; a Byrne desmin enhancer element containing the polynucleotide sequence of SEQ ID NO: 21; a Paulin desmin enhancer element containing the polynucleotide sequence of SEQ ID NO: 22; a desmin promoter containing the polynucleotide sequence of SEQ ID NO: 23; a 5' arm of a rabbit β-globin intron containing the polynucleotide sequence of SEQ ID NO: 14; a 5' miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 40; and a DMPK containing the polynucleotide sequence of SEQ ID NO: 4. 204 The miRNA guide sequence, the miR155 terminal loop sequence containing the polynucleotide sequence of SEQ ID NO: 6, and the DMPK containing the polynucleotide sequence of SEQ ID NO: 5. 204 rAAV particles comprising a miRNA passenger sequence, a 3' miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 41, a 3' arm of a rabbit β-globin intron containing the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylated sequence containing the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a human serpinA1 gene-derived stuffer nucleic acid sequence containing the polynucleotide sequence of SEQ ID NO: 19, and an AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 49, wherein the capsid is the AAVrh74 N502I capsid.
[0233] 87. The rAAV particle according to Embodiment 85 or 86, comprising a capsid protein containing the amino acid sequence of SEQ ID NO: 50.
[0234] 88. rAAV particles comprising an rAAV vector and a capsid, wherein the rAAV vector comprises the following nucleic acids from 5' to 3': AAV2 ITR, nucleic acid encoding a staffer nucleic acid sequence derived from the human serpin A1 gene, Byrne desmin enhancer element, Paulin desmin enhancer element, desmin promoter, 5' arm of rabbit β-globin intron, 5' miR155 scaffold sequence, and DMPK. 204 miRNA guide sequence, miR155 terminal loop sequence, DMPK 204 rAAV particles contain a miRNA passenger sequence, a 3' miR155 scaffold sequence, a 3' arm of a rabbit β-globin intron, a minimal bovine growth hormone polyadenylated sequence, a nucleic acid encoding a human serpin A1 gene-derived Stuffer nucleic acid sequence, and an AAV2 ITR, with the capsid being the AAVrh74 W505R capsid.
[0235] 89. rAAV particles containing an rAAV vector, wherein the rAAV vector comprises, from 5' to 3', the following nucleic acids: an AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 43; a nucleic acid encoding a human serpinA1 gene-derived Stuffer nucleic acid sequence containing the polynucleotide sequence of SEQ ID NO: 18; a Byrne desmin enhancer element containing the polynucleotide sequence of SEQ ID NO: 21; a Paulin desmin enhancer element containing the polynucleotide sequence of SEQ ID NO: 22; a desmin promoter containing the polynucleotide sequence of SEQ ID NO: 23; a 5' arm of a rabbit β-globin intron containing the polynucleotide sequence of SEQ ID NO: 14; a 5' miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 40; and a DMPK containing the polynucleotide sequence of SEQ ID NO: 4. 204 The miRNA guide sequence, the miR155 terminal loop sequence containing the polynucleotide sequence of SEQ ID NO: 6, and the DMPK containing the polynucleotide sequence of SEQ ID NO: 5. 204rAAV particles comprising a miRNA passenger sequence, a 3' miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 41, a 3' arm of a rabbit β-globin intron containing the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylated sequence containing the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a human serpinA1 gene-derived stuffer nucleic acid sequence containing the polynucleotide sequence of SEQ ID NO: 19, and an AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 49, wherein the capsid is the AAVrh74 W505R capsid.
[0236] 90. The rAAV particle according to Embodiment 88 or 89, comprising a capsid protein containing the amino acid sequence of SEQ ID NO: 52.
[0237] 91. A composition comprising rAAV particles according to any one of claims 1 to 22 and 77 to 90.
[0238] 92. A pharmaceutical composition comprising rAAV particles according to any one of claims 1 to 22 and 77 to 90.
[0239] 93. The composition according to embodiment 91 or 92, further comprising a pharmaceutically acceptable carrier.
[0240] 94. A kit comprising rAAV particles as described in any one of Embodiments 1 to 22 and 77 to 90.
[0241] 95. A kit comprising rAAV particles according to any one of claims 1 to 22 and 77 to 90.
[0242] 96. A kit comprising the composition described in any one of embodiments 91 to 93.
[0243] 97. A kit according to any one of embodiments 94 to 96, further including instructions for use.
[0244] 98. A method for treating myotonic dystrophy type 1 (DM1) in a mammal in need, comprising administering an effective amount of rAAV particles described in any one of Embodiments 1 to 22 and 77 to 90 to the mammal.
[0245] 99. A method for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 requiring the administration of an effective amount of rAAV particles described in any one of Embodiments 1 to 22 and 77 to 90 to the mammal.
[0246] 100. A method for inhibiting the accumulation of intracellular DMPK RNA in a mammal having DM-1 requiring it, comprising administering an effective amount of RNAi described in any one of Embodiments 1 to 22 and 77 to 90 to the mammal.
[0247] 101. A method for treating myotonic dystrophy type 1 (DM1) in a mammal in need, comprising administering an effective amount of rAAV particles according to any one of claims 1 to 22 and 77 to 90 to the mammal.
[0248] 102. A method for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 that requires such inhibition, comprising administering an effective amount of rAAV particles according to any one of claims 1 to 22 and 77 to 90 to the mammal.
[0249] 103. A method for inhibiting the accumulation of DMPK RNA in mammalian cells having DM-1, which is required thereto, comprising administering an effective amount of rAAV particles according to any one of claims 1 to 22 and 77 to 90 to a mammal.
[0250] 104. The effective dose of virus particles or rAAV particles is approximately 1 × 10⁻⁶ 8 ~Approx. 2×10 13 The method according to any one of embodiments 100 to 104, wherein the dose is genome copies / mL.
[0251] 105. The dosage is approximately 5 x 10 12 The method according to Embodiment 104, wherein the genome copy / mL is
[0252] 106. The dosage is approximately 1 x 10 13 The method according to Embodiment 104, wherein the genome copy / mL is
[0253] 107. The dosage is approximately 2 x 10 13 The method according to Embodiment 104, wherein the genome copy / mL is
[0254] 108. The effective dose of virus particles or rAAV particles is approximately 1 × 10⁻⁶ 8 ~Approx. 2×10 14 The method according to any one of embodiments 101 to 103, wherein the dose is genome copies / kg of body weight.
[0255] 109. The dosage is approximately 5 x 10 13 The method according to embodiment 108, wherein the genome copy is per kg of body weight.
[0256] 110. The dosage is approximately 1 x 10 14 The method according to embodiment 108, wherein the genome copy is per kg of body weight.
[0257] 111. The dosage is approximately 2 x 10 14 The method according to embodiment 108, wherein the genome copy is per kg of body weight.
[0258] 112. A method for treating myotonic dystrophy type 1 (DM1) in a mammal requiring it, comprising administering an effective amount of the composition described in any one of embodiments 91 to 93 to the mammal.
[0259] 113. A method for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 requiring the treatment, comprising administering an effective amount of the composition described in any one of Embodiments 91 to 93 to the mammal.
[0260] 114. A method for inhibiting the accumulation of intracellular DMPK RNA in a mammal having DM-1, comprising administering an effective amount of a composition described in any one of Embodiments 91 to 93 to the mammal.
[0261] 115. The method according to any one of Embodiments 98 to 100, wherein the RNAi is administered in combination with an immunosuppressant, the immunosuppressant being administered before, simultaneously with, and / or after, the administration of the RNAi.
[0262] 116. The method according to any one of Embodiments 101 to 103, wherein viral particles or rAAV particles are administered in combination with an immunosuppressant, the immunosuppressant being administered before, simultaneously with, and / or after, the administration of viral particles or rAAV particles.
[0263] 117. The method according to any one of Embodiments 112 to 114, wherein the composition is administered in combination with an immunosuppressant, the immunosuppressant being administered before, simultaneously with, and / or after, the administration of the composition. [Examples]
[0264] The subject matter of this disclosure will be better understood by referring to the following examples, which are provided as illustrations of the present invention and are not intended to limit it.
[0265] Example 1: amiR-DMPK 204 Generation of expression cassettes To identify candidates exhibiting high activity in muscle and low activity in the liver, a series of nine transcriptional promoters (S1-S9) were rationally designed. The promoter panel was screened in primary human myoblasts and Huh7 hepatocellular carcinoma cells to represent muscle and liver, respectively. The newly designed promoters were compared with the ubiquitous CAG promoter and a previously published promoter sequence panel exhibiting high activity in muscle cells: namely, the synthetic MH promoter consisting of four muscle-specific transcription factor binding sites (TFBSs), the chimeric MHCK7 promoter consisting of a core promoter fragment of the chicken skeletal muscle α-actin gene, the α-MCK enhancer with an enhancer from the mouse α-myosin heavy chain, and the synthetic promoter sk-CRM4 / Des, which combines the MCK promoter, a skeletal muscle-specific cis-regulatory module, a desmin promoter, and an MVM intron. For screening, cells were transfected with plasmids containing the luciferase gene under the control of the target promoter. After 48 hours, relative luciferase activity was measured in myoblasts (Figure 16A) and Huh7 cells (Figure 16B). Apart from the CAG promoter, which drove high expression throughout the body, the S6 promoter induced the highest expression in muscle cells compared to all other newly designed promoters. Expression from the S6 promoter in the liver was relatively low. Thus, the S6 promoter was selected as the AAV expression construct.
[0266] A microRNA designed to target the DMPK gene (amiR-DMPK) 204 A single-stranded AAV viral vector encoding ) was generated (Figure 1A). The construct was designed so that the amiR-DMPK204 microRNA was embedded in the optimized microRNA backbone miR155 (BLOCK-iT, Thermofisher catalog numbers K4935-00, K4936-00, K4937-00, K4938-00), and from then on it is referred to as "miR155 amiR-DMPK 204 " or "amiR155-DMPK 204 " miR155 amiR-DMPK 204This was positioned adjacent to the rabbit β-globin intron sequence and under the control of a hybrid muscle promoter (nDes, "S6" promoter).
[0267] An nDesmin promoter containing Byrne desmin enhancer, one copy of Paulin desmin enhancer (-973 to -693), and the human desmin gene promoter (-228 to +75) was synthesized by conventional oligonucleotide synthesis (Genscript, USA).
[0268] The bovine growth hormone polyadenylated sequence is amiR-DMPK 204 The microRNA was positioned at the 3' end of an intron adjacent to it (minBGHpA). A filler sequence ("stuffer") was included. The entire gene cassette is adjacent to a wild-type AAV serotype 2 inverted terminal repeat (ITR) sequence for DNA rescue and replication and for packaging into an AAV capsid. The sequence was manipulated to be placed into an ITR plasmid used to generate a vector for in vivo efficacy testing.
[0269] 5' and 3' ITR sequences The ITR sequence was a 145 bp wild-type AAV2 sequence. The 3' ITR (downstream of the expression cassette) was flip-oriented (GenBank: LQ493091.1). The 5' ITR (upstream of the expression cassette) was flop-oriented (145 bp) (Miller et al., 2004, Nature Genetics 36.7(2004); 767-773). Sequence accuracy was confirmed by Sanger sequencing.
[0270] nDes promoter The nDes promoter was constructed using desmin promoter elements described in the literature (see Li and Paulin, et al. 1991, J Biol Chem. 266.10:6562-6570). The nDes promoter contains one copy of the Byrne desmin enhancer, one copy of the Paulin desmin enhancer (-973 to -693), and the human desmin gene promoter (-228 to +75).
[0271] 5' and 3' arms of rabbit β-globin introns Since intron expression of miRNA is known to enhance target knockdown, this intron is expressed in amiR-DMPK 204 It was used adjacent to the cassette.
[0272] amiR-DMPK including miR155 scaffolding 204 (miR155-amiRDMPK 204 ) Endogenous miRNAs are hairpin-like secondary structures found in many primary RNA transcripts (pri-miRNAs). In the nucleus, the microprocessor Drosha / DGCR8 complex binds to and cleaves the base stem of the pri-miRNA, releasing the stem-loop precursor miRNA (pre-miRNA). The pre-miRNA is then expelled from the nucleus, and the loop is cleaved by Dicer / TRBP to form a mature RNA double helix. The guide strand, also known as the target strand, separates from the passenger strand and is loaded onto the Argonaut protein of the RNA-Induced Silencing Complex (RISC). This Argonaut protein then targets a complementary mRNA transcript for degradation or translational repression.
[0273] amiR-DMPK 204 The sequence has been identified as a target for DM1 therapy: amiR-DMPK 204 The target sequence is located upstream of the "CUG" repeat sequence within the 3'UTR of the DMPK nucleotide sequence. Therefore, amiR-DMPK 204It can suppress both wild-type and mutant DMPK transcripts.
[0274] In addition, amiR-DMPK 204 The target region is conserved in non-human primates (NHP-cynomolgus macaques) and humans, allowing for preclinical evaluation of DMPK knockdown in NHP (Figure 11). amiR-DMPK 204 Evaluation of the microRNA showed that the miR155 scaffold provides efficient guide processing while minimizing passenger strand processing, thus reducing the possibility of off-target effects (see Example 2 below).
[0275] The final construct selected for development is the amiR-DMPK, which includes the miR155 scaffolding. 204 (amiR155-DMPK 204 The guide strand targets DMPK mRNA for degradation when processed. The manipulated pre-miRNA sequence structure is based on the mouse miR-155 sequence (Lagos-Quintana et al., 2002, Current Biology, 12:9, 735-739). The 5' and 3' faciest regions derived from the miR-155 transcript were inserted into the vector while preserving the miR-155 structure as much as possible. The stem-loop structure was optimized, and the two-nucleotide internal loop resulted in a higher knockdown rate than the five-nucleotide / three-nucleotide internal loop found in the natural miR-155 molecule (Source: BLOCK-iT (trademark) Pol II miR RNAi expression vector (Invitrogen)). In relation to the AAV capsid, the vector is nDes-miR155-amiR-DMPK 204 It was shown to have potent in vivo activity in the DM1 DMSXL mouse model (see Example 4 below).
[0276] minBGH PolyA To enable mRNA transcription termination and polyadenylation, a minimal 186bp BGH poly-A site is incorporated into amiR-DMPK.204 It was inserted downstream of the array.
[0277] Stuffer array derived from A1AT intron The gene cassette was raised to the packaging limit of the rAAV vector using a stuffer sequence derived from intron sequence 4 of the α1-antitrypsin gene.
[0278] nDes-miR155-amiR-DMPK 204 ITR plasmid containing cassette (nDes-miR155-amiR-DMPK) 204 Cloning of ) We designed the nDes-miR155-amiR-DMPK204-minBGH polyA cassette, which is an expression construct of a 1938 bp ITR-ITR sequence. 204 -minBGH polyA cassettes were cloned. The synthesized nDes-miR155-amiR-DMPK204-minBGH polyA contained the 5'Nco1 site and the 3'Sph1 site for cloning into an ITR plasmid (Figure 1B). Briefly, the synthesized nDes-miR155-amiR-DMPK 204 Plasmids containing the -minBGH polyA sequence were digested with NcoI and SphI, and a 1.9kB fragment was gel-purified. ITR plasmids were digested with NcoI and SphI, dephosphorylated using calf alkaline phosphatase (New England Biolabs, catalog number M0290), and an 8.2kB vector backbone fragment was gel-purified. The digested 1.9kB fragment containing the expression cassette was ligated with the digested ITR plasmid to obtain the plasmid ITR-nDes-miR155-amiR-DMPK 204 It generated.
[0279] Small-scale production of rAAV vectors ITR-nDes-miR155-amiR-DMPK 204To confirm plasmid packaging, a small-scale packaging assay was performed in HEK293 cells. Small-scale production was carried out using the AAV rep / cap plasmid. Figure 1C shows the amount of vector produced per HEK293 cell compared to a standard EGFP plasmid gene cassette.
[0280] amiR-DMPK 204 To determine the potential of amiR-DMPK to modify the DM1 phenotype, we silenced human DMPK transcripts in skeletal myoblast cultures derived from DM1 patients and examined their ability to correct splicing abnormalities. Extension of the CTG at the 3'UTR of the DMPK gene causes the hairpin structure of DMPK mRNA to aggregate as an insoluble ribonuclear foci, sequestering several RNA-binding proteins. The resulting redistribution of essential splicing factors such as muscleblind-like 1 (MBNL1) leads to missplicing of downstream effectors involved in muscle tissue differentiation. 204 Treatment of DM1 patient cells with this method induced over 50% silencing and splicing modification of DMPK mRNA, as measured by exon 7 inclusions of MBNL1.
[0281] Example 2: miR155-amiRDMPK 204 Expression modifies the DM1 phenotype in vitro. miR155-amiRDMPK induced by the nDes promoter 204 Construct expression was tested in two in vitro models of DM1. Immortalized human myotubes of DM1 were transduced with an AAV2 vector containing DMPK-targeting artificial miRNA under the control of the nDes promoter. DMPK amiRNA (Figure 17A) and DMPK mRNA (Figure 17B) were measured by PCR. As expected, DMPK amiRNA was detectable only in treated cells, and DMPK levels were reduced by 65% compared to untreated cells (untreated = 1 ± 0.04, treated = 0.34 ± 0.018, mean ± SD, p < 0.0001, two-sided unpaired t-test).
[0282] One of the characteristics of DM1 is the presence of nuclear RNA focus. Extension of the CUG repeat in the 3'-UTR of DMPK mRNA leads to nuclear retention of mRNA, where it captures important RNA-binding proteins, including musclevide-like protein 1 (MBNL1), which binds to mRNA and regulates pre-mRNA splicing for mRNA localization. Furthermore, the presence of mutant DMPK transcripts is thought to lead to increased phosphorylation and stabilization of CELF1 (CUG RNA-binding protein and embryo-lethal abnormal visual RNA-binding protein 3-like factor 1), which also functions in regulating alternative splicing and RNA stability. Fluorescence in situ hybridization (FISH) was used to quantify the percentage of cells presenting nuclear focus and the focus / nucleus count in treated and untreated DM1 human myotubes (Figures 17C-17D). nDes-miR155-amiR-DMPK 204 Treatment with [method name] reduced the percentage of cells containing foci by 60% (untreated = 74.36% ± 9.3, treated = 15.36% ± 4.2, MEAN ± SEM, p = 0.0044, unpaired two-sided t-test) (Figure 17E). Furthermore, compared to untreated cells, treated cells had significantly fewer foci per cell (untreated = 1.55 ± 0.08, treated = 0.15 ± 0.03, MEAN ± SEM, p < 0.0001, unpaired two-sided t-test) (Figure 17F).
[0283] Example 3: miR155 amiR-DMPK 204 Processing amiR-DMPK 204 The compound nDes-miR155-amiR-DMPK was packaged into an AAV capsid, and the efficacy of DMPK knockdown, passenger chain activity, and processing pattern were analyzed in vivo. 204The construct containing the CTG repeat was packaged into an AAV. This vector was intravenously injected into a DMSXL adult humanized DM1 mouse model expressing human DMPK containing over 1,000 CTG repeats. After 8 weeks, the animals were euthanized, and multiple tissues were collected to measure the efficacy of DMPK knockdown, with cardiac tissue selected to measure passenger chain activity and processing patterns.
[0284] RT-PCR analysis revealed that amiR-DMPK was detected in multiple muscle tissues. 204 Strong expression of amiR-DMPK was observed, with even higher expression observed in the heart (Figure 2B). 204 Along with the expression of nDesmin, RT-PCR analysis revealed strong suppression of DMPK in the heart, with average suppression of over 70% and approximately 30% in different skeletal muscles (Figure 2C). In cardiac tissue, DMPK expression was less than 50% compared to TBP (TATA-binding protein) expression. Notably, DSMXL mice expressing low levels of DMPK compared to TBP (approximately 50%, shown as a dotted line in Figure 2C) did not exhibit a clear DM1 phenotype. Interestingly, the nDesmin promoter showed strong activity in cardiac tissue, although higher transduction was observed in the liver (Figure 2A), and similar levels in skeletal muscle (Figure 2B). This suggests that expression is mainly limited to cardiac and skeletal muscle that develops DM1 lesions.
[0285] amiR-DMPK 204 To evaluate the processing of mature amiR-DMPK, NGS for low molecular weight transcriptome analysis was performed. 204 Cardiac tissue was analyzed to determine the length and arrangement composition of the guide and passenger chains.
[0286] amiR-DMPK 204 The passenger chain was not generated by the processing of amiR-DMPK. 204The miR155 was processed and exclusively became the guide chain (over 99%) in mouse cardiomyocytes, but in many cases, longer chains were generated than those predicted from the miRBase database (Table 1). Processing of miR155 resulted in mature lengths of 22-26 nt in most cases, but it was precisely processed at the 5' end (Table 1). miR155 amiR-DMPK 204 The sequence distribution of different guide chain lengths (nt) mapped to the expected amiR-DMPK was calculated as a percentage (read %). 204 The guide strand is underlined, and the seed sequence is shown in bold. The asterisk indicates amiR-DMPK. 204 This shows the reads corresponding to the predicted length of the guide chain.
[0287] [Table 1]
[0288] Overall, the passenger chain contains amiR-DMPK, which includes miR155. 204 It was not detected (guide percentage is over 99%). Therefore, since the miR155 miRNA scaffold has been well validated for RNAi, we selected miR155 as the lead for preclinical trials.
[0289] Example 4: miR155-amiRDMPK in transgenic mice 204 Dose-dependent inhibition of human DMPK by systemic injection of AAV encoding [specific compound]. To determine the most effective dose, we investigated the delivery of three distinct doses of myotropic AAV (International Publication No. 2019 / 207132) capsids, including amiR-DMPK with the miR155 scaffold. 204 (amiR155-DMPK 204 The AAV encoding the expression cassette of ) was evaluated in a dose-escalation study. Eight-week-old DMSXL mice carrying a human DMPK transgene containing more than 1,000 repeats of CTG extension were subjected to doses of 5.0 × 10⁶, corresponding to low, medium, and high doses. 11Vector genome (vg) / kg, 5 × 10⁻⁶ 12 vg / kg, 1.0 × 10 13 The mice were intravenously injected with vg / kg of AAV. Clinical symptoms such as body weight, survival rate, myotonia, and cardiac function were analyzed in the mice 8 weeks after AAV injection. The mice were euthanized 8 weeks after gene transfer, and DMPK suppression and splicing modification were measured. miR155-amiRDMPK 204 The expression level was measured using small RNA TaqMan, and the mRNA input level was normalized to u6 nuclear small RNA.
[0290] amiR155-DMPK 204 Dose-dependent observation of its expression (Figure 3A) revealed a dose-dependent decrease in total DMPK expression in multiple tissues (Figure 3B). Overall, approximately 10 copies / U6 of amiR155-DMPK were observed. 204 This amount has been observed to be sufficient to reduce cardiac and diaphragmatic DMPK by more than 50%, and this amount may be sufficient to treat DM1 patients.
[0291] A cohort of DMSXL mice was created using a 9x10 13 miR155-DMPK at doses of vg / kg 204 Treatment with a single dose significantly silenced the expression of artificial miRNAs in skeletal and cardiac muscle, as well as DMPK mRNA in the heart, TA, diaphragm, and gastrocnemius muscle, but not in the liver, confirming the muscle specificity of the platform at higher doses (Figure 18).
[0292] Nuclear RNA foci in the hearts of treated mice were measured by in-situ hybridization. Foci often existed as large clumps, and therefore the linear size of each clump in positive cells was measured. miR155-amiRDMPK 204 Treatment with [method / method] significantly reduced the size of the focus (untreated = 7 ± 0.32 μm, treated = 2.7 ± 0.08 μm, mean ± SEM, p < 0.0001, one-way ANOVA, Figure 19).
[0293] Next, we investigated the suppression of DMPK in specific DM1 phenotypes, such as splicing abnormalities. To determine whether the treatment could improve the splicing phenotype in mice, we collected the heart and tibialis anterior muscle (TA) and performed RNA-Seq analysis on wild-type, buffer-negative control, and treated mice (as described in Shen et al. (2014) Proc Natl Acad Sci 111(51):E5593-E5601; Park et al. (2013) Methods Mol Biol 1038:171-9; Shen et al. (2012) Nucleic Acids Res 40(8):e61). Overall changes in alternative splicing events were observed in the heart and TA, indicating molecular changes due to disease and treatment. Among the genes altered in the heart of DMSXL mice were Ldb3, Mbnl2, and Spag9 (Figure 20). Abnormal splicing of Ldb3, which results in the inclusion of exon 11 in LIM domain-binding 3 (Ldb3) transcripts, has been demonstrated as a DM1-specific phenotype arising from the sequestration of the RNA splicing mechanism by CUG repeat RNA (Yamashita et al. 2014. Neurobiol Dis. 69:200-5). Medium or high doses of AAV nDes-miR155-amiR-DMPK 204 In mice treated with amiR155-DMPK, a significant decrease in Ldb3 transcripts containing exon 11 inclusions was observed in the gastrocnemius muscle. 204 It was confirmed that splicing abnormalities in treated muscles were effectively corrected (Figure 4). The persistence of fetal isoforms of these genes has also been previously shown to contribute to the pathogenesis of DM1. In TA, a series of different but overlapping alternative splicing events were altered when comparing wild-type mice and DMSXL mice. In particular, three genes, DNAseI, Tnnt3, and Zbtb49, showed significant splicing rescue in the treated group (Figure 20). For these transcripts, there were no significant differences between wild-type mice and DMSXL-treated mice in either the heart or TA, suggesting that normal splicing is restored after treatment.
[0294] In addition to these molecular modifications, the efficacy of AAV nDes-miR155-amiR-DMPK204 was then measured in terms of the physiological and functional symptoms of the disease.
[0295] To determine whether the treatment could improve survival and reduce weight loss, DMSXL mice were treated with three different doses of AAV nDes-miR155-amiR-DMPK204, and survival and body weight were observed. After 8 weeks of treatment with medium and high doses, improvements in body weight and survival were observed. In contrast, no improvement was observed with low doses or with equilibrium salt solution (BSS) controls (Figures 5A and 5B).
[0296] Next, the effectiveness of AAV nDes-miR155-amiR-DMPK204 was measured from the perspective of functional symptoms of diseases such as myotonia and cardiac abnormalities. Electromyography (EMG) measurements were used to assess the effectiveness of AAV nDes-miR155-amiR-DMPK204. 204 It was revealed that myotonia was significantly reduced in mice treated with [the drug] (Table 2). In particular, after treatment, only 7.6% of animals treated with a medium dose developed myotonia. In contrast, more than 50% of mice in the control group (treated with BSS) or the low-dose group developed persistent myotonia (score 1).
[0297] [Table 2]
[0298] Myotonic discharges were graded on a four-point scale: 0: No myotonicity, 1: Occasional myotonic discharges in less than 50% of needle insertions, 2: Myotonic discharges in more than 50% of needle insertions, 3: Myotonic discharges with almost every insertion.
[0299] The number of Grade 0 events and Grade 1-3 events were recorded for each treatment group (wild-type, solvent control in DMSXL mice, and amiR155-DMPK in DMSXL mice). 204The results were compared after a single intravenous administration (Figure 21). As expected, the score for all wild-type mice was 0 in all three muscle groups analyzed. In DMSXL mice treated with the solvent, grade 0 events recorded in all three muscles analyzed were significantly reduced (gastrocnemius: grade 0: WT=30, DMSXL solvent=1; grades 1-3: WT=0, DMSXL solvent=9; Fischer's exact test, Bonferroni-form adjusted p-value <0.0001; quadriceps femoris: grade 0: WT=30, DMSXL solvent=2; grades 1-3: WT=0, DMSXL solvent=8; Fischer's exact test, Bonferroni-form adjusted p-value <0.0001; TA: grade 0: WT=30, DMSXL solvent=7; grades 1-3: WT=0, DMSXL solvent=3; Fischer's exact test, Bonferroni-form adjusted p-value = 0.036). However, treatment at both doses did not significantly improve the gastrocnemius muscle tone phenotype compared to the solvent group, but showed a positive trend towards improvement in the other two muscles (Gastrocnemius: DMSXL 9 X10¹³, Grade 0=9, Grade 1-3=3, Fischer's exact test, Bonferroni-Holm adjusted p-value=0.0041, DMSXL 1.8 X10¹⁴, Grade 0=15, Grade 1-3=6, Fischer's exact test, Bonferroni-Holm adjusted p-value=0.0041, Quadriceps femoris: DMSXL 9 X10¹³, Grade 0=9, Grade 1-3=3, Fischer's exact test, Bonferroni-Holm adjusted p-value=0.059, DMSXL 1.8 X1014, Grade 0=13, Grades 1-3=8, Fisher's exact test, Bonferroni-Holm adjusted p-value=0.059, TA:DMSXL 9 X1013, Grade 0=12, Grades 1-3=0, Fisher's exact test, Bonferroni-Holm adjusted p-value=0.155, DMSXL 1.8 X1014, Grade 0=19, Grades 1-3=2 (Fisher's exact test, Bonferroni-Holm adjusted p-value=0.295). miR155-DMPK 204To investigate whether treatment with AAV capsids containing constructs could correct this abnormality, electromyography was used to measure the grade of muscle tone events in the gastrocnemius, quadriceps femoris, and TA muscles. Wild-type mice did not show muscle tone events in any of the muscles analyzed, but the majority of DMSXL-untreated mice showed grade 1–2 muscle tone events, and the majority of treated mice showed grade 0–1 muscle tone events (Figure 21).
[0300] Another clinical feature of this disease is abnormal cardiac function. Conductive abnormalities are found in up to 75% of adult DM1 patients, and cardiac arrhythmias are a major cause of death. Cardiac function in DMSXL mice, along with skeletal muscle function, was also observed using surface echocardiography after 8 weeks of treatment. AAV nDes-miR155-amiR-DMPK 204 This resulted in improved cardiac output compared to the BSS treatment control group. A significant improvement in cardiac output was observed in the moderate-dose group (5e12vg / kg) 8 weeks after treatment (Figure 6).
[0301] Echocardiographic analysis of the DSMXL heart revealed that this mouse had aortic stenosis compared to its wild-type littermates (Figure 22, p<0.001, one-way ANOVA). However, 9×10 13 amiR-DMPK vg / kg 204 Treatment with [the drug] significantly increased the aortic diameter (p<0.05). There was no significant difference between the treated DMSXL mice and wild-type mice (Figure 22A). Furthermore, DMSXL mice had reduced ascending aortic blood flow velocity (cardiac output deficit, Figure 22B) compared to wild-type mice (p<0.0001), and this abnormality was also improved by treatment (p<0.001).
[0302] Example 5: AAVrh74N502I capsid improves muscle transduction and reduces hepatic transduction. Experiments were conducted to verify the transduction efficiency of AAV capsids containing the AAVrh74N502I VP1 capsid protein (SEQ ID NO: 50) in various tissues of non-human primates. A schematic of the experiment is shown in Figure 7A. Non-human primates were each subjected to 1 × 10⁶ transduction with eGFP expression cassettes. 13The animals were intravenously treated with either vg / kg of AAV9, AAVrh74, or AAVrh74N502I capsid. Twenty-one days after treatment, the animals were sacrificed, and eGFP expression levels were measured in the tibialis anterior (TA), biceps femoris, quadriceps femoris, heart, and liver.
[0303] Capsids containing the AAVrh74N502I capsid protein improved muscle transduction and reduced hepatic transduction in non-human primates compared to control capsids (Figures 7B-7E) (Figure 7F) (Table 3).
[0304] [Table 3]
[0305] Example 6: AAVrh74N502I nDes-miR155-amiR-DMPK in DMSXL mouse model 204 Evaluation of target binding To determine the most effective dose, we investigated the delivery of two distinct doses of AAVrh74N502I capsid, including miR155 scaffolding and amiR-DMPK. 204 (miR155-amiR-DMPK 204 The AAV encoding the expression cassette of ) was evaluated in a dose escalation study. Eight-week-old DMSXL mice were given 9 × 10⁶ doses corresponding to low and high doses. 13 Vector genome (vg) / kg and 1.8 × 10⁻⁶ 14 The drug was administered intravenously at a dose of vg / kg. Eight weeks after gene transfer, the mice were euthanized to suppress DMPK and amiR-DMPK. 204 The expression level was measured using small RNA TaqMan, and the mRNA input level was normalized to u6 nuclear small RNA.
[0306] amiR-DMPK 204 When the expression of amiR-DMPK was observed in a dose-dependent manner (Figure 8A), a dose-dependent decrease in total DMPK expression was observed in multiple tissues (Figure 8B). Overall, approximately 10 copies / U6 of amiR-DMPK were observed. 204It has been observed that this is sufficient to reduce cardiac and diaphragmatic DMPK by more than 50%, and this amount may be sufficient to treat DM1 patients.
[0307] Ultimately, in relation to the myotropic capsid AAVrh74N502I (SEQ ID NO: 50), the lead vector nDes-miR155-amiR-DMPK 204 It was shown to have potent in vitro activity in cardiomyocytes derived from DM1 iPSCs (Figure 9).
[0308] Example 7: AAVrh74N502I nDes-miR155-amiR-DMPK in transcriptome 204 Evaluation amiR-DMPK 204 To determine whether the treatment by CBA miR155-amiR-DMPK has any significant impact on the transcriptome, genome-wide RNA sequencing (RNA-seq) was performed to determine the CBA miR155-amiR-DMPK 204 By transfecting the HEK293 cell line with the plasmid, amiR-DMPK 204 Treatment with amiR-DMPK was compared to treatment with CTL3 (scrambled miRNA). The observed changes in non-DMPK gene expression were compared to amiR-DMPK. 204 To assess whether the off-target effects were due to the amiR-DMPK204 overexpression, we evaluated whether seed complementarity was enriched in significantly downregulated targets. Using a significant threshold of a 5% false discovery rate (FDR), four differentially expressed genes containing TTCGAC seed complements were found in the 3'UTR: OPN4 (12.5x), DMPK (1.7x), KRTAP21-2 (1.7x), and C8ORF44-SGK3 (1.7x) (Table 4). At a 1% FDR, only OPN4 (12.5x) and DMPK (1.7x) showed differential expression (Figure 10). As expected, DMPK was one of the most affected mRNA levels (44% silencing). Overall, minimal off-target effects were observed after overexpression of amiR-DMPK204 in HEK293 cells.
[0309] [Table 4]
[0310] Example 8: AAVrh74N502I nDes-miR155-amiR-DMPK in non-human primates 204 Dose-finding study to investigate the in vivo distribution and activity of [the substance]. AAVrh74MN502I nDes-miR155-amiR-DMPK 204 To determine its in vivo distribution and activity, a single intravenous (IV) dose was administered to cynomolgus monkeys. The study period was 12 weeks after the single injection.
[0311] A total of 16 cynomolgus monkeys (8 males, 8 females, 24-48 months old) received an intravenous (IV) dose once on day 1 of the study. The doses are shown in Table 5 below. The animals were classified into four different categories based on dose level (vg / kg) (2 males and 2 females in each group): Preparation buffer (Group 1), 5 × 10⁻⁶ 13 vg / kg (2nd group), 1×10 14 vg / kg (Group 3) and 2 × 10 14 vg / kg (Group 4). After 12 weeks, the animals were slaughtered and tissue samples were taken for analysis.
[0312] [Table 5]
[0313] To extract RNA and DNA, the collected tissue was mechanically homogenized, and the samples were analyzed by digital PCR (dPCR).
[0314] In some muscle and non-muscle tissues, AAVrh74N502I nDes-miR155-amiR-DMPK 204The dose-dependent in vivo distribution and activity of the virus were demonstrated. Several skeletal muscle tissues (tibialis anterior (TA), gastrocnemius, quadriceps femoris, biceps femoris, soleus, extensor digitorum longus (EDL), diaphragm), as well as myocardial and liver tissues, were analyzed. Viral genome copies were found in all examined tissues, and the copy number / cell in each tissue was dose-dependent (Figure 12). amiR-DMPK expression (Figure 13) and DMPK downregulation (Figure 14) were also dose-dependent in various muscle, cardiac, and liver tissues. The dose-dependent reduction in DMPK expression was found to be up to 90% compared to the control group. All doses examined in animals were found to be safe and well-tolerated in animals.
[0315] Example 9: amiR-DMPK 204b Rescue of splicing abnormalities after treatment by DMPK-mediated splicing abnormalities are a molecular characteristic of DM1 tissue. amiR-DMPK 204 To investigate whether the treatment affects these splicing abnormalities, we performed targeted splicing analysis focusing on 36 genes using both RNA sequencing (RNA-seq) and a nanostring platform (Tanner et al. 2021. Nucleic Acids Res. 49(4):2240-2254. doi:10.1093 / nar / gkab022).
[0316] The data between the two platforms were equivalent. AAV2-nDesmin-nDES-miR155-DMPK was used to immortalize human DM1 myotubes. 204 Transduction was performed and compared with both untreated DM1 myotubes and healthy control myotubes. Of the 36 genes, 25 showed statistically significant changes in their splicing before treatment. Of the 25 genes (MBNL1, SOS1, PKM, zTTN, GOLGA4, CLASP1), 6 showed significant recovery in treated cells compared to untreated cells (Figure 15). Overall, the data showed that amiR-DMPK 204 Treatment of human myotubes with this method has been shown to at least partially rescue splicing abnormalities caused by DMPK mutations.
[0317] Example 10: 2 × 10 14 AAVrh74N502I nDes-miR155-amiR-DMPK up to vg / kg 204 It showed good tolerability in non-human primates. AAVrh74N502I nDes-miR155-amiR-DMPK 204 Tissue sections from animals treated with the AAV construct were evaluated for their tolerance. All animals in the study were monitored at each stage of their life cycle, including detailed cage-side observations, body weight, food consumption, and vital signs.
[0318] No macroscopic observations related to the test sample were observed. 1 × 10 14 One male and 2 × 10⁶ individuals were administered vg / kg. 14 Minimal individual hepatocyte necrosis related to the test substance was observed in the liver of one female animal administered vg / kg (Table 6). Mild test substance-related clinical chemical effects were characterized by minimal to mild increases in aspartate aminotransferase (AST), alanine aminotransferase (ALT), and glutamate dehydrogenase (GDH) activity, ≥1 × 10⁻⁶. 14 This was identified in animals administered a single dose (Table 7). The increase in enzyme was observed only at the initial time point, completely reversing to baseline values by day 43, and 2 × 10⁻⁶. 14 Except for minimal individual hepatocyte necrosis in one female treated with vg / kg, there were no correlative microscopic liver findings in the affected animals. 5×10 13 No liver effects were observed in animals administered vg / kg. No effects on hematological or coagulation parameters related to the test substance were observed at any dose level. These changes were considered non-harmful because they were generally small in magnitude, had minimal severity and incidence, and / or were not dose-related.
[0319] [Table 6]
[0320] [Table 7]
[0321] [Table 8]
[0322] array All polypeptide sequences are presented N-terminus to C-terminus unless otherwise specified. All nucleic acid sequences are presented 5' to 3' unless otherwise specified. Byrne Desmin Enhancer Sequence [ka] Source: Li and Paulin,et.al.1991.“High level desmin expression depends on a muscle-specific enhancer.”Journal of Biol Chem.266.10:6562-6570. The regulatory region of the desmin gene locus (DES-LCR) in Homo sapiens on chromosome 2 (NCBI reference sequence: NG_046330.1) The Byrne enhancer sequence corresponds to reference sequence 17767-18125. Paulin Desmin Enhancer Sequence [ka] Source: Li and Paulin,et.al.1991.“High level desmin expression depends on a muscle-specific enhancer.”Journal of Biol Chem.266.10:6562-6570. The regulatory region of the desmin gene locus (DES-LCR) in Homo sapiens on chromosome 2 (NCBI reference sequence: NG_046330.1) The Paulin enhancer sequence corresponds to reference sequence 17787-18063. Paulin desmin promoter sequence (-228 to +75) [ka] There is one base pair that differs from the published sequence (C instead of A, indicated in bold and underlined). Source: Li and Paulin,et.al.1991.“High level desmin expression depends on a muscle-specific enhancer.”Journal of Biol Chem.266.10:6562-6570. The regulatory region of the desmin gene locus (DES-LCR) in Homo sapiens on chromosome 2 (NCBI reference sequence: NG_046330.1) The Paulin promoter sequence corresponds to reference sequence 18535-18844. Complete nDes promoter sequence [ka] Source: Li and Paulin,et.al.1991.“High level desmin expression depends on a muscle-specific enhancer.”Journal of Biol Chem.266.10:6562-6570. Rabbit β-globin introns [ka] 5' arm of rabbit β-globin intron [ka] Source: European rabbit (Oryctolagus cuninculus) hemoglobin, β (HBB2) gene ID 100009084 The sequence of the present invention has additional CATGs (shown in bold and underlined) that are not present in gene ID 100009084. 3' arm of rabbit β-globin intron [ka] Source: European rabbit (Oryctolagus cuninculus) hemoglobin, β (HBB2) gene ID 100009084 The sequence of the present invention has two T residues (shown in bold and underlined above) instead of the two C residues of gene ID 100009084. miR155-DMPK 204 array: 5'miR155 adjacent sequence RNA sequence CUGGAGGCUUGCUGAAGGCUGUAUGCU (Sequence ID 9) DNA sequence CTGGAGGCTTGCTGAAGGCTGTATGCT (Sequence No. 40) Source: BLOCK-iT (trademark) Pol II miR RNAi expression vector kit, catalog number K493500 The manipulated pre-miRNA sequence structure is based on the mouse miR-155 sequence (Lagos-Quintana et al., 2002, Current Biology, 12:9, 735-739). amiR-DMPK 204 Guide-DNA AGTCGAAGACAGTTCTAGGGT(Sequence ID 4) miR155 terminal loop-DNA GTTTTGGCCACTGACTGAC (Sequence ID 6) Source: BLOCK-iT (trademark) Pol II miR RNAi expression vector kit, catalog number K493500 The manipulated pre-miRNA sequence structure is based on the mouse miR-155 sequence (Lagos-Quintana et al., 2002, Current Biology, 12:9, 735-739). amiR-DMPK 204 Passenger-DNA ACCCTAGATGTCTTCGATT(Sequence ID 5) amiR-DMPK 204 Guide-RNA-miR155 terminal loop-amiR-DMPK 204 Passenger RNA AGUCGAAGACAGUUCUAGGGUUGUUUUGGCCACUGACUGACACCCUAGAUGUCUUCGAUU (Sequence ID 7) amiR-DMPK 204 Guide-DNA-miR155 terminal loop-amiR-DMPK 204 Passenger-DNA AGTCGAAGACAGTTCTAGGGTTGTTTTGGCCACTGACTGACACCCTAGATGTCTTCGATT (Sequence No. 8) 3'miR155 adjacent sequence RNA sequence GACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 10) DNA sequence GACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC (SEQ ID NO: 41) Source: BLOCK-iT (trademark) Pol II miR RNAi expression vector kit, catalog number K493500 The manipulated pre-miRNA sequence structure is based on the mouse miR-155 sequence (Lagos-Quintana et al., 2002, Current Biology, 12:9, 735-739). miR155 RNA CUGGAGGCUUGCUGAAGGCUGUAUGCUGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 11) DNA CTGGAGGCTTGCTGAAGGCTGTATGCTGACACAAGGCCTGTTACTAGCACTCACATGGARACAAATGGCC (SEQ ID NO: 42) Total miR155-DMPK 204 Double-stranded RNA [ka] Total miR155-DMPK 204 Double-stranded DNA sequence [ka] Minimal BGHpA sequence [ka] Source: mRNA of bovine growth hormone 1 (GH1) from Bos taurus (NCBI reference sequence NM_180996.1) 1138bp A1AT intron stuffer sequence (upstream of the expression cassette) [ka] Source: Plasmid DC 969 (SerpinA1=A1AT) chromosome 14 NG_008290.1 398bp A1AT intron stuffer sequence (downstream of the expression cassette) [ka] Source: Plasmid DC 969 (SerpinA1=A1AT) chromosome 14 NG_008290.1 ITR-nDes-miR155-amiR-DMPK 204 -BGHpA-Stuffer-ITR(3739bp) [ka] [ka]
[0323] [Table 9]
[0324] Sequence of the synthesized nDes-miR155-204 fragment: [ka] nDes-miR155-204 promoter for poly(A) [ka] Amino acid sequence of AAVrh74N502I [ka] Nucleotide sequence encoding the AAVrh74 N502I capsid [ka] Amino acid sequence of AAVrh74W505R [ka] Nucleotide sequence encoding AAVrh74W505R [ka]
Claims
1. Recombinant adeno-associated virus (rAAV) particles, a) RNAi comprising a first strand and a second strand, i) The first chain and the second chain form a double helix, ii) The first strand includes a guide region, the guide region includes nucleic acid having sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 1, and iii) The second strand includes a non-guide region, RNAi and b) AAV capsids containing an amino acid sequence that is approximately 90% identical to the wild-type AAVrh74 capsid and Recombinant adeno-associated virus (rAAV) particles containing this virus.
2. The rAAV particle according to claim 1, wherein the non-guide region comprises a nucleic acid having sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2) or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
2.
3. The rAAV particle according to claim 1 or 2, wherein the first chain comprises a nucleic acid having the sequence of SEQ ID NO: 1, and the non-guide region comprises a nucleic acid having the sequence of SEQ ID NO:
2.
4. The rAAV particle according to any one of claims 1 to 3, wherein the first strand and the second strand are linked by an RNA linker capable of forming a loop structure.
5. The rAAV particle according to claim 4, wherein the RNA linker contains about 4 to about 50 nucleotides.
6. The rAAV particle according to claim 4 or 5, wherein the loop structure comprises about 4 to about 20 nucleotides.
7. The rAAV particle according to any one of claims 4 to 6, wherein the loop structure comprises a nucleic acid having the sequence of sequence number 3 or a sequence having about 90% identity with the sequence of sequence number 3.
8. The rAAV particle according to any one of claims 4 to 7, wherein the RNAi comprises the second strand, the RNA linker, and the first strand from 5' to 3'.
9. The rAAV particle according to any one of claims 4 to 7, wherein the RNAi comprises the first strand, the RNA linker, and the second strand from 5' to 3'.
10. The rAAV particle according to any one of claims 1 to 8, wherein the RNAi comprises a nucleic acid having the sequence of sequence number 7 or a sequence having about 90% identity with the sequence of sequence number 7.
11. The rAAV particle according to any one of claims 1 to 10, wherein the RNAi is a small molecule inhibitory RNA (siRNA), a microRNA (miRNA), or a small molecule hairpin RNA (shRNA).
12. The rAAV particle according to any one of claims 1 to 11, wherein the RNAi further comprises a scaffold.
13. The scaffold comprises all or part of the nucleic acid of sequence number 11, as described in claim 12.
14. The rAAV particle according to claim 13, wherein the miRNA is embedded within the scaffold.
15. The rAAV particle according to claim 14, wherein the scaffold has a 5' arm located on the 5' side of the nucleic acid encoding the RNAi and a 3' arm located on the 3' side of the nucleic acid encoding the RNAi.
16. The scaffold is a miR-155 scaffold, according to any one of claims 12 to 15, the rAAV particle.
17. The rAAV particle according to any one of claims 12 to 16, wherein the miR-155 scaffold comprises a nucleic acid located at the 5' end of the RNAi, having approximately 90% identity with sequence number 9 or sequence number 9.
18. The rAAV particle according to any one of claims 12 to 17, wherein the miR-155 scaffold comprises a nucleic acid located at the 3' end of the RNAi, having approximately 90% identity with sequence number 10 or sequence number 10.
19. The rAAV particle according to any one of claims 1 to 18, wherein the RNAi targets RNA encoding a polypeptide associated with myotonic dystrophy type 1 (DM1).
20. The rAAV particle according to claim 19, wherein the polypeptide is myotonic dystrophy protein kinase (DMPK).
21. The rAAV particle according to claim 20, wherein the DMPK comprises a mutation related to DM-1.
22. The rAAV particle according to claim 20 or 21, wherein the gene encoding DMPK comprises five or more CTG trinucleotide repeats.
23. An expression cassette comprising a nucleic acid sequence encoding an RNAi according to any one of claims 1 to 22.
24. The expression cassette according to claim 23, wherein the nucleic acid encoding the RNAi is operably linked to a promoter.
25. The expression cassette according to claim 24, wherein the promoter is a muscle-specific promoter.
26. The expression cassette according to claim 24 or 25, wherein the promoter is a desmin promoter or a variant thereof.
27. The expression cassette according to claim 26, wherein the desmin promoter comprises one or more enhancer elements and a promoter of the human desmin gene.
28. The expression cassette according to claim 26 or 27, wherein the desmin promoter comprises two enhancer elements and a promoter of the human desmin gene.
29. The expression cassette according to any one of claims 26 to 28, wherein the desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements.
30. The expression cassette according to any one of claims 26 to 29, wherein the desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO: 21 and / or one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO:
22.
31. The expression cassette according to any one of claims 26 to 30, wherein the desmin promoter includes the nucleotide sequence of SEQ ID NO: 12 or a sequence having about 90% identity with the nucleotide sequence of SEQ ID NO:
12.
32. An expression cassette according to any one of claims 23 to 31, further comprising an intron.
33. The expression cassette according to claim 32, wherein the intron is a rabbit β-globin intron.
34. The expression cassette according to claim 32 or 33, wherein the intron includes the nucleotide sequence of SEQ ID NO: 13 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
13.
35. The expression cassette according to any one of claims 32 to 34, wherein the nucleic acid encoding the RNAi is embedded in the intron.
36. The expression cassette according to claim 35, wherein the intron includes a 5' arm and a 3' arm, the 5' arm being located on the 5' side of the nucleic acid encoding the RNAi, and the 3' arm being located on the 3' side of the nucleic acid encoding the RNAi.
37. The expression cassette according to claim 36, wherein the 5' arm of the intron includes the nucleotide sequence of SEQ ID NO: 14 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
14.
38. The expression cassette according to claim 36 or 37, wherein the 3' arm of the intron includes the nucleotide sequence of SEQ ID NO: 15 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
15.
39. An expression cassette according to any one of claims 23 to 38, further comprising a polyadenylation signal.
40. The expression cassette according to claim 39, wherein the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA.
41. The expression cassette according to claim 40, wherein the polyadenylation signal is a minimal bovine growth hormone polyadenylation signal.
42. The expression cassette according to any one of claims 39 to 41, wherein the bovine growth hormone polyadenylation signal comprises the nucleotide sequence of SEQ ID NO: 16 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
16.
43. An expression cassette according to any one of claims 23 to 42, comprising the nucleotide sequence of SEQ ID NO: 17 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
17.
44. An expression cassette comprising a modified desmin promoter, wherein the modified desmin promoter comprises one or more enhancer elements and a promoter of the human desmin gene.
45. The expression cassette according to claim 44, wherein the modified desmin promoter comprises two enhancer elements and a promoter of the human desmin gene.
46. The expression cassette according to claim 44 or 45, wherein the modified desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements.
47. The expression cassette according to any one of claims 44 to 46, wherein the modified desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO: 21 and / or one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO:
22.
48. The expression cassette according to any one of claims 44 to 47, wherein the desmin promoter includes the nucleotide sequence of SEQ ID NO: 12 or a sequence having about 90% identity with the nucleotide sequence of SEQ ID NO:
12.
49. An expression cassette according to any one of claims 44 to 48, further comprising an intron.
50. The expression cassette according to claim 49, wherein the intron is a rabbit β-globin intron.
51. The expression cassette according to claim 49 or 50, wherein the intron includes the nucleotide sequence of SEQ ID NO: 13 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
13.
52. The expression cassette according to any one of claims 44 to 51, wherein the nucleic acid encoding the introduced gene is embedded in the intron.
53. The expression cassette according to claim 52, wherein the intron includes a 5' arm and a 3' arm, the 5' arm being located on the 5' side of the nucleic acid encoding the transgene, and the 3' arm being located on the 3' side of the nucleic acid encoding the transgene.
54. The expression cassette according to claim 53, wherein the 5' arm of the intron includes the nucleotide sequence of SEQ ID NO: 14 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
14.
55. The expression cassette according to claim 53 or 54, wherein the 3' arm of the intron includes the nucleotide sequence of SEQ ID NO: 15 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
15.
56. An expression cassette according to any one of claims 44 to 55, further comprising a polyadenylation signal.
57. The expression cassette according to claim 56, wherein the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA.
58. The expression cassette according to claim 57, wherein the polyadenylation signal is a minimal bovine growth hormone polyadenylation signal.
59. The expression cassette according to any one of claims 56 to 58, wherein the bovine growth hormone polyadenylation signal comprises the nucleotide sequence of SEQ ID NO: 16 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
16.
60. The expression cassette according to any one of claims 44 to 59, wherein the introduced gene encodes a polypeptide or nucleic acid.
61. The expression cassette according to any one of claims 44 to 60, wherein the introduced gene encodes RNAi.
62. A vector comprising an expression cassette according to any one of claims 23 to 61.
63. The vector according to claim 62, wherein the expression cassette is adjacent to one or more Staffor nucleic acid sequences.
64. The vector according to claim 63, wherein the one or more Stuffer nucleic acid sequences are derived from the human Serpin A1 gene.
65. The vector according to claim 63 or 64, wherein the Stuffer nucleic acid sequence located at the 5' end of the expression cassette is derived from the human Serpin A1 gene.
66. The vector according to any one of claims 63 to 65, wherein the stuffer sequence located at the 5' end of the expression cassette includes the nucleotide sequence of SEQ ID NO: 18 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
18.
67. The vector according to any one of claims 63 to 66, wherein the Stuffer nucleic acid sequence located at the 3' end of the expression cassette is derived from the human Serpin A1 gene.
68. The vector according to any one of claims 63 to 67, wherein the stuffer sequence located at the 3' end of the expression cassette includes the nucleotide sequence of SEQ ID NO: 19 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
19.
69. The vector according to any one of claims 62 to 68, which is a recombinant adeno-associated virus (rAAV) vector.
70. The rAAV vector according to claim 69, wherein the expression cassette is adjacent to one or more AAV inverted terminal repeats (ITRs).
71. The rAAV vector according to claim 70, wherein the expression cassette is adjacent to two AAV ITRs.
72. The rAAV vector according to claim 70 or 71, wherein the AAV ITR is an ITR of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV serotype.
73. The rAAV vector according to any one of claims 70 to 72, wherein the AAV ITR is an AAV2 ITR.
74. The rAAV vector according to any one of claims 69 to 73, comprising the nucleotide sequence of SEQ ID NO: 20 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:
20.
75. The rAAV vector according to any one of claims 69 to 74, which is a self-complementary rAAV vector.
76. A cell comprising an expression cassette according to any one of claims 23 to 61, a vector according to any one of claims 62 to 68, or an rAAV vector according to any one of claims 69 to 75.
77. The rAAV particle according to any one of claims 1 to 22, wherein the AAV capsid comprises an amino acid sequence including an amino acid substitution at position 502.
78. The rAAV particle according to claim 77, wherein the amino acid substitution at position 502 is isoleucine (I).
79. rAAV particles according to claim 77 or 78, comprising a capsid of AAVrh74 N502I serotype.
80. The rAAV particle according to the claim, wherein the ITR is AAV2 ITR, and the capsid of the rAAV particle is the capsid of the AAVrh74 N502I serotype.
81. The rAAV particle according to any one of claims 1 to 22, wherein the AAV capsid comprises an amino acid sequence including an amino acid substitution at position 505.
82. The rAAV particle according to claim 81, wherein the amino acid substitution at position 505 is arginine (R).
83. rAAV particles according to any one of claims 1 to 22, comprising a capsid of the AAVrh74 W505R serotype.
84. The rAAV particle according to claim 83, wherein the ITR is AAV2 ITR, and the capsid of the rAAV particle is the capsid of the AAVrh74 W505R serotype.
85. rAAV particles comprising an rAAV vector and a capsid, wherein the rAAV vector has the following nucleic acids from 5' to 3': AAV2 ITR and, A nucleic acid encoding the Staffor nucleic acid sequence derived from the human serpinA1 gene, Byrne Desmin Enhancer Element, Paulin Desmin Enhancer Element, Desmin promoter and, The 5' arm of the rabbit β-globin intron, 5'miR155 scaffolding arrangement, DMPK 204 miRNA guide sequence and miR155 terminal loop sequence, DMPK 204 miRNA passenger sequence and 3'miR155 scaffolding arrangement, The 3' arm of the rabbit β-globin intron, Minimal bovine growth hormone polyadenylated sequences, A nucleic acid encoding the Staffor nucleic acid sequence derived from the human serpinA1 gene, AAV2 ITR and rAAV particles comprising, wherein the capsid is AAVrh74 N502I capsid.
86. rAAV particles containing an rAAV vector, wherein the rAAV vector has the following nucleic acids from 5' to 3': AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 43, A nucleic acid encoding a Staffor nucleic acid sequence derived from the human serpinA1 gene, which includes the polynucleotide sequence of sequence number 18, A Byrne desmin enhancer element containing the polynucleotide sequence of sequence number 21, A Paulin desmin enhancer element containing the polynucleotide sequence of sequence number 22, A desmin promoter containing the polynucleotide sequence of SEQ ID NO: 23, The 5' arm of the rabbit β-globin intron, containing the polynucleotide sequence of sequence number 14, A 5'miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 40, DMPK containing the polynucleotide sequence of Sequence ID No. 4 204 miRNA guide sequence and The miR155 terminal loop sequence containing the polynucleotide sequence of SEQ ID NO: 6, DMPK containing the polynucleotide sequence of Sequence ID No. 5 204 miRNA passenger sequence and A 3'miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 41, The 3' arm of the rabbit β-globin intron contains the polynucleotide sequence of sequence number 15, A minimal bovine growth hormone polyadenylated sequence containing the polynucleotide sequence of SEQ ID NO: 16, A nucleic acid encoding a Staffor nucleic acid sequence derived from the human serpinA1 gene, which includes the polynucleotide sequence of sequence number 19, AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 49 and The capsid is the AAVrh74 N502I capsid, which is an rAAV particle.
87. The rAAV particle according to claim 85 or 86, wherein the AAVrh74 N502I capsid comprises a capsid protein having the amino acid sequence of SEQ ID NO:
50.
88. rAAV particles comprising an rAAV vector and a capsid, wherein the rAAV vector comprises the following nucleic acids from 5' to 3': AAV2 ITR, nucleic acid encoding a Staffor nucleic acid sequence derived from the human serpin A1 gene, Byrne desmin enhancer element, Paulin desmin enhancer element, desmin promoter, 5' arm of rabbit β-globin intron, 5' miR155 scaffold sequence, and DMPK. 204 miRNA guide sequence, miR155 terminal loop sequence, DMPK 204 rAAV particles comprising a miRNA passenger sequence, a 3'miR155 scaffold sequence, a 3' arm of a rabbit β-globin intron, a minimal bovine growth hormone polyadenylated sequence, a nucleic acid encoding a staffer nucleic acid sequence derived from the human serpin A1 gene, and an AAV2 ITR, wherein the capsid is the AAVrh74 W505R capsid.
89. rAAV particles containing an rAAV vector, wherein the rAAV vector comprises, from 5' to 3', the following nucleic acids: an AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 43; a nucleic acid encoding a human serpin A1 gene-derived Stuffer nucleic acid sequence containing the polynucleotide sequence of SEQ ID NO: 18; a Byrne desmin enhancer element containing the polynucleotide sequence of SEQ ID NO: 21; a Paulin desmin enhancer element containing the polynucleotide sequence of SEQ ID NO: 22; a desmin promoter containing the polynucleotide sequence of SEQ ID NO: 23; a 5' arm of a rabbit β-globin intron containing the polynucleotide sequence of SEQ ID NO: 14; a 5' miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 40; and a DMPK containing the polynucleotide sequence of SEQ ID NO:
4. 204 DMPK containing the miRNA guide sequence, the miR155 terminal loop sequence including the polynucleotide sequence of SEQ ID NO: 6, and the polynucleotide sequence of SEQ ID NO:
5. 204 rAAV particles comprising an AAV2 ITR containing a miRNA passenger sequence, a 3'miR155 scaffold sequence including the polynucleotide sequence of SEQ ID NO: 41, a 3' arm of a rabbit β-globin intron including the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylated sequence including the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a staffer nucleic acid sequence derived from the human serpinA1 gene including the polynucleotide sequence of SEQ ID NO: 19, and the polynucleotide sequence of SEQ ID NO: 49, wherein the capsid is the AAVrh74 W505R capsid.
90. The rAAV particle according to claim 88 or 89, wherein the AAVrh74 W505R capsid comprises a capsid protein having the amino acid sequence of Sequence ID No.
52.
91. A composition comprising rAAV particles according to any one of claims 1 to 22 or 77 to 90.
92. A pharmaceutical composition comprising rAAV particles according to any one of claims 1 to 22 or 77 to 90.
93. The composition according to claim 91 or 92, further comprising a pharmaceutically acceptable carrier.
94. A kit comprising rAAV particles according to any one of claims 1 to 22 or 77 to 90.
95. A kit comprising rAAV particles according to any one of claims 1 to 22 or 77 to 90.
96. A kit comprising the composition according to any one of claims 91 to 93.
97. The kit according to any one of claims 94 to 96, further comprising instructions for use.
98. A method for treating myotonic dystrophy type 1 (DM1) in a mammal in need, comprising administering an effective amount of rAAV particles according to any one of claims 1 to 22 or 77 to 90 to the mammal.
99. A method for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 that requires such inhibition, comprising administering an effective amount of rAAV particles according to any one of claims 1 to 22 or 77 to 90 to the mammal.
100. A method for inhibiting the accumulation of DMPK RNA in mammalian cells having DM-1, which requires such inhibition, comprising administering an effective amount of the RNAi described in any one of claims 1 to 22 or 77 to 90 to the mammal.
101. A method for treating myotonic dystrophy type 1 (DM1) in a mammal in need, comprising administering an effective amount of rAAV particles according to any one of claims 1 to 22 or 77 to 90 to the mammal.
102. A method for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 that requires such inhibition, comprising administering an effective amount of rAAV particles according to any one of claims 1 to 22 or 77 to 90 to the mammal.
103. A method for inhibiting the accumulation of DMPK RNA in mammalian cells having DM-1, which requires such inhibition, comprising administering an effective amount of rAAV particles according to any one of claims 1 to 22 or 77 to 90 to the mammal.
104. The effective amount of the rAAV particles is about 1×10 8 to about 2×10 13 genome copies / mL of dosage, and the method according to any one of claims 100 to 103.
105. The aforementioned dosage is approximately 5 × 10 12 The method according to claim 104, wherein the genome copy / mL is
106. The aforementioned dose is approximately 1 × 10 13 The method according to claim 104, wherein the genome copy / mL is
107. The aforementioned dose is approximately 2 × 10 13 The method according to claim 104, wherein the genome copy / mL is
108. The effective amount of the rAAV particles is about 1 × 10 8 ~Approx. 2×10 14 The method according to any one of claims 101 to 103, wherein the dose is genome copies / kg of body weight.
109. The aforementioned dosage is approximately 5 × 10 13 The method according to claim 108, wherein the genome copy is per kg of body weight.
110. The aforementioned dose is approximately 1 × 10 14 The method according to claim 108, wherein the genome copy is per kg of body weight.
111. The aforementioned dose is approximately 2 × 10 14 The method according to claim 108, wherein the genome copy is per kg of body weight.
112. A method for treating myotonic dystrophy type 1 (DM1) in a mammal in need thereof, comprising administering an effective amount of the composition according to any one of claims 91 to 93 to the mammal.
113. A method for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 that requires such inhibition, comprising administering an effective amount of the composition according to any one of claims 91 to 93 to the mammal.
114. A method for inhibiting the accumulation of DMPK RNA in mammalian cells having DM-1, which require such inhibition, comprising administering an effective amount of the composition according to any one of claims 91 to 93 to the mammal.
115. The method according to any one of claims 98 to 100, wherein the RNAi is administered in combination with an immunosuppressant, and the immunosuppressant is administered before, simultaneously with, and / or after the administration of the RNAi.
116. The method according to any one of claims 101 to 103, wherein the virus particles or the rAAV particles are administered in combination with an immunosuppressant, the immunosuppressant being administered before, simultaneously with, and / or after the administration of the virus particles or the rAAV particles.
117. The method according to any one of claims 112 to 114, wherein the composition is administered in combination with an immunosuppressant, the immunosuppressant being administered before, simultaneously with, and / or after the administration of the composition.
118. The method according to any one of claims 98 to 117, comprising administration of rAAV particles according to any one of claims 1 to 22 or 77 to 90, an expression cassette according to any one of claims 23 to 61, a vector according to any one of claim 75, a composition according to any one of claims 91 to 93, or a kit according to any one of claims 94 to 97, wherein splicing of the gene transcript is measured after administration.
119. The method according to claim 118, wherein the splicing of the gene transcript is a measure of treatment effectiveness.
120. The method according to claim 118 or 119, wherein the splicing of the gene transcript is about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, and about 100% compared to equivalent healthy tissue.
121. The method according to claim 118 or 119, wherein the measured gene transcript comprises one or more genes selected from MBNL1, SOS1, PKM, zTTN, GOGLA4, CLASP1, LDB3, MBNL2, SPAG9, DNAseI, TNNT3, and ZBTB49.
122. Recombinant adeno-associated virus (rAAV) particles comprising an rAAV vector and a capsid, wherein the rAAV vector has the following nucleic acids arranged from 5' to 3': AAV2 ITR and, A nucleic acid encoding the Staffor nucleic acid sequence derived from the human serpinA1 gene, Byrne Desmin Enhancer Element, Paulin Desmin Enhancer Element, Desmin promoter and, The 5' arm of the rabbit β-globin intron, 5'miR155 scaffolding arrangement, DMPK 204 miRNA guide sequence and miR155 terminal loop sequence, DMPK 204 miRNA passenger sequence and 3'miR155 scaffolding arrangement, The 3' arm of the rabbit β-globin intron, Minimal bovine growth hormone polyadenylated sequences, A nucleic acid encoding the Staffor nucleic acid sequence derived from the human serpinA1 gene, AAV2 ITR and Recombinant adeno-associated virus (rAAV) particles comprising a capsid protein containing the amino acid sequence of SEQ ID NO: 50, wherein the capsid contains a recombinant adeno-associated virus (rAAV) particle.
123. Recombinant adeno-associated virus (rAAV) particles comprising an rAAV vector and a capsid, wherein the rAAV vector has the following nucleic acids arranged from 5' to 3': AAV2 ITR and, A nucleic acid encoding the Staffor nucleic acid sequence derived from the human serpinA1 gene, Byrne Desmin Enhancer Element, Paulin Desmin Enhancer Element, Desmin promoter and, The 5' arm of the rabbit β-globin intron, 5'miR155 scaffolding arrangement, DMPK 204 miRNA guide sequence and miR155 terminal loop sequence, DMPK 204 miRNA passenger sequence and 3'miR155 scaffolding arrangement, The 3' arm of the rabbit β-globin intron, Minimal bovine growth hormone polyadenylated sequences, A nucleic acid encoding the Staffor nucleic acid sequence derived from the human serpinA1 gene, AAV2 ITR and Recombinant adeno-associated virus (rAAV) particles comprising a capsid protein containing the amino acid sequence of SEQ ID NO: 52, wherein the capsid contains a recombinant adeno-associated virus (rAAV) particle.
124. rAAV particles containing an rAAV vector, wherein the rAAV vector has the following nucleic acids from 5' to 3': AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 43, A nucleic acid encoding a Staffor nucleic acid sequence derived from the human serpinA1 gene, which includes the polynucleotide sequence of sequence number 18, A Byrne desmin enhancer element containing the polynucleotide sequence of sequence number 21, A Paulin desmin enhancer element containing the polynucleotide sequence of sequence number 22, A desmin promoter containing the polynucleotide sequence of SEQ ID NO: 23, The 5' arm of the rabbit β-globin intron, containing the polynucleotide sequence of sequence number 14, A 5'miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 40, DMPK containing the polynucleotide sequence of Sequence ID No. 4 204 miRNA guide sequence and The miR155 terminal loop sequence containing the polynucleotide sequence of SEQ ID NO: 6, DMPK containing the polynucleotide sequence of Sequence ID No. 5 204 miRNA passenger sequence and A 3'miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 41, The 3' arm of the rabbit β-globin intron contains the polynucleotide sequence of sequence number 15, A minimal bovine growth hormone polyadenylated sequence containing the polynucleotide sequence of SEQ ID NO: 16, A nucleic acid encoding a Staffor nucleic acid sequence derived from the human serpinA1 gene, which includes the polynucleotide sequence of sequence number 19, AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 49 and The rAAV particle contains a capsid protein with the amino acid sequence of SEQ ID NO:
50.
125. rAAV particles containing an rAAV vector, wherein the rAAV vector has the following nucleic acids from 5' to 3': AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 43, A nucleic acid encoding a Staffor nucleic acid sequence derived from the human serpinA1 gene, which includes the polynucleotide sequence of sequence number 18, A Byrne desmin enhancer element containing the polynucleotide sequence of sequence number 21, A Paulin desmin enhancer element containing the polynucleotide sequence of sequence number 22, A desmin promoter containing the polynucleotide sequence of SEQ ID NO: 23, The 5' arm of the rabbit β-globin intron, containing the polynucleotide sequence of sequence number 14, A 5'miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 40, DMPK containing the polynucleotide sequence of Sequence ID No. 4 204 miRNA guide sequence and The miR155 terminal loop sequence containing the polynucleotide sequence of SEQ ID NO: 6, DMPK containing the polynucleotide sequence of Sequence ID No. 5 204 miRNA passenger sequence and A 3'miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 41, The 3' arm of the rabbit β-globin intron contains the polynucleotide sequence of sequence number 15, A minimal bovine growth hormone polyadenylated sequence containing the polynucleotide sequence of SEQ ID NO: 16, A nucleic acid encoding a Staffor nucleic acid sequence derived from the human serpinA1 gene, which includes the polynucleotide sequence of sequence number 19, AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 49 and The rAAV particle contains a capsid protein containing the amino acid sequence of SEQ ID NO: 52.