Therapeutic compounds for inhibiting and reducing the expression of cell surface proteins
Therapeutic compounds targeting cell surface proteins through internalization and API release effectively inhibit and reduce protein activity and expression, addressing the limitations of current cancer and diabetes treatments.
Patent Information
- Application Number
- JP2025556595
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-03-28
- Filing Date
- 2024-03-27
- Publication Date
- 2026-04-23
AI Technical Summary
Existing treatments for cancer and diabetes lack effective methods to inhibit the activity and expression of specific cell surface proteins, which are crucial for disease progression.
Therapeutic compounds are developed as conjugates that bind to cell surface proteins, are internalized by cells, and release active pharmaceutical ingredients (APIs) to inhibit protein activity and reduce protein expression, utilizing linkers and APIs like siRNA or microRNAs to target proteins such as PD-1, CD38, HER2, and glucose transporters.
The compounds achieve a dual inhibition effect, synergistically reducing protein activity and expression, providing therapeutic benefits for cancer and diabetes by specifically targeting and altering cellular functions.
Smart Images

Figure 2026513237000001_ABST
Abstract
Description
Technical Field
[0001] Cross - Reference to Related Applications This application claims priority based on U.S. Provisional Application No. 63 / 492,612, filed on March 28, 2023, the disclosure of which is incorporated herein by reference in its entirety.
[0002] Technical Field The present invention relates to compounds useful for treating cancer and diabetes, and more particularly, to compounds configured to bind to and inhibit cell - surface proteins and to reduce the expression of cell - surface proteins after internalization of the compound by cells.
Summary of the Invention
Means for Solving the Problems
[0003] Summary of Embodiments Embodiments of the present invention are therapeutic compounds that are conjugates configured to bind to a second protein expressed on the surface of a target cell, the conjugate comprising a first protein coupled to an API, the conjugate being configured to bind to the second protein expressed on the surface of the target cell in a manner that inhibits the activity of the second protein, the conjugate being further configured to be internalized by the target cell when it binds to the second protein expressed on the surface of the target cell, the API being configured to be released from the conjugate after the conjugate has been internalized by the target cell, the API being further configured to reduce the expression of the second protein expressed on the surface of the target cell after being released from the conjugate, thereby further inhibiting the activity of the second protein, such that the conjugate and the API synergistically inhibit the activity of the second protein, providing a therapeutic compound.
[0004] The API may be coupled to the first protein by a linker, and the linker may be a cleavable linker.
[0005] In some embodiments, the second protein consists of a sequence selected from the group comprising SEQ ID NOs: 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 35, 36, 37, and 38. The API may be selected from the group comprising siRNA, antisense oligonucleotides, and microRNAs.
[0006] In some embodiments, the second protein is PD-1 (SEQ ID NO: 18), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 1, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In other embodiments, the API is a microRNA, the microRNA consists of a nucleic acid sequence, the nucleic acid sequence is at least 95% identical to SEQ ID NO: 39. In some embodiments, the microRNA consists of 39. In yet another embodiment, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 1. In some embodiments, the first protein is selected from the group consisting of an anti-PD-1 antibody and its antigen-binding fragment. In other embodiments, the first protein is a PD-1 binding peptide consisting of an amino acid sequence, the amino acid sequence being at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NOs. 40 and SEQ ID NOs. 41. The PD-1 binding peptide may consist of an amino acid sequence selected from the group consisting of SEQ ID NOs. 40 and SEQ ID NOs. 41.
[0007] In some embodiments, the second protein is CD38 (SEQ ID NO: 19), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 2, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In other embodiments, the API is a microRNA, the microRNA consists of a nucleic acid sequence, the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 42-44. In some embodiments, the microRNA consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 42-44. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 2. In some embodiments, the first protein is selected from the group consisting of an anti-CD38 antibody and its antigen-binding fragment. In other embodiments, the first protein is a CD38-binding peptide consisting of an amino acid sequence, the amino acid sequence being at least 90% identical to SEQ ID NO: 45. The CD38-binding peptide may consist of SEQ ID NO: 45.
[0008] In some embodiments, the second protein is HER2 (SEQ ID NO: 20), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 3, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. The API may be a microRNA, the microRNA consisting of a nucleic acid sequence, the nucleic acid sequence being at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 73-78. In some embodiments, the microRNA consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 73-78. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 3. In some embodiments, the first protein is selected from the group consisting of an anti-HER2 antibody and its antigen-binding fragment. In other embodiments, the first protein is a HER2-binding peptide consisting of an amino acid sequence, the amino acid sequence being at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NOs. 46-59. The HER2-binding peptide may consist of an amino acid sequence selected from the group consisting of SEQ ID NOs. 46-59.
[0009] In yet another embodiment, the second protein is PD-L1 isoform A (SEQ ID NO: 21), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, where (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 4, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In yet another embodiment, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 4. In some embodiments, the first protein is selected from the group consisting of an anti-PD-L1 isoform A antibody and its antigen-binding fragment.
[0010] In other embodiments, the second protein is PD-L1 isoform C (SEQ ID NO: 22), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, where (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 5, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In some embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 5. In some embodiments, the first protein is selected from the group consisting of an anti-PD-L1 isoform C antibody and its antigen-binding fragment.
[0011] The API may be a microRNA, which consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. In some embodiments, the microRNA consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. In other embodiments, the first protein is a PD-L1 binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NOs: 60-65. The PD-L1 binding peptide may consist of an amino acid sequence selected from the group consisting of SEQ ID NOs: 60-65.
[0012] One embodiment provides a method for treating cancer in a mammalian subject requiring treatment, comprising administering a therapeutically effective amount of a therapeutic compound to the mammalian subject. The mammalian subject may be a human.
[0013] In other embodiments, the second protein is IL4R isoform A (SEQ ID NO: 23), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 6, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 6. In some embodiments, the first protein is selected from the group consisting of an anti-IL4R isoform A antibody and its antigen-binding fragment.
[0014] In some embodiments, the second protein is IL4R isoform C (SEQ ID NO: 24), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, where (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 7, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 7. In some embodiments, the first protein is selected from the group consisting of an anti-IL4R isoform C antibody and its antigen-binding fragment.
[0015] The API may be a microRNA, which consists of a nucleic acid sequence, the nucleic acid sequence being at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs. 94 and 98. In some embodiments, the microRNA consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs. 94 and 98. In other embodiments, the first protein is an IL4R-binding peptide consisting of amino acids that are at least 90% identical to SEQ ID NO. 66. The IL4R-binding peptide may consist of SEQ ID NO. 66.
[0016] In some embodiments, the second protein is IL6R isoform 1 (SEQ ID NO: 25), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 8, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 8. In some embodiments, the first protein is selected from the group consisting of an anti-IL6R isoform 1 antibody and its antigen-binding fragment.
[0017] In other embodiments, the second protein is IL6R isoform 2 (SEQ ID NO: 26), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, where (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 9, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 9. In some embodiments, the first protein is selected from the group consisting of an anti-IL6R isoform 2 antibody and its antigen-binding fragment.
[0018] In yet another embodiment, the second protein is IL6R isoform 3 (SEQ ID NO: 27), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, where (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 10, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In yet another embodiment, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 10. In some embodiments, the first protein is selected from the group consisting of an anti-IL6R isoform 3 antibody and its antigen-binding fragment.
[0019] In some embodiments, the second protein is IL6R isoform 4 (SEQ ID NO: 29), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, where (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 28, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 28. In some embodiments, the first protein is selected from the group consisting of an anti-IL6R isoform 4 antibody and its antigen-binding fragment.
[0020] In other embodiments, the second protein is IL6R isoform 5 (SEQ ID NO: 31), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, where (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 30, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 30. In some embodiments, the first protein is selected from the group consisting of an anti-IL6R isoform 5 antibody and its antigen-binding fragment.
[0021] The first protein may be an IL6R-binding peptide consisting of amino acids that are at least 90% identical to those of SEQ ID NO: 67. The IL6R-binding peptide may consist of SEQ ID NO: 67.
[0022] In some embodiments, the second protein is TNFR1 (SEQ ID NO: 32), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 11, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In other embodiments, the API is a microRNA, the microRNA consists of a nucleic acid sequence, the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 99-102. In some embodiments, the microRNA consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 99-102. In yet another embodiment, the API is an antisense oligonucleotide, which is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 11. In some embodiments, the first protein is selected from the group consisting of an anti-TNFR1 antibody and its antigen-binding fragment. In another embodiment, the first protein is a TNFR1-binding peptide consisting of an amino acid sequence, which is at least 90% identical to SEQ ID NO: 68. The TNFR1-binding peptide may consist of SEQ ID NO: 68.
[0023] In some embodiments, the second protein is TNFR2 (SEQ ID NO: 35), the API is an siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, where (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 14, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 14. In some embodiments, the first protein is selected from the group consisting of an anti-TNFR2 antibody and its antigen-binding fragment. In other embodiments, the first protein is a TNFR1-binding peptide consisting of an amino acid sequence, the amino acid sequence being at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NOs. 69-72. The TNFR2-binding peptide may consist of an amino acid sequence selected from the group consisting of SEQ ID NOs. 69-72.
[0024] One embodiment provides a method for reducing inflammation in a mammalian subject requiring reduction of inflammation, comprising administering a therapeutically effective amount of a therapeutic compound to the mammalian subject. The mammalian subject may be a human.
[0025] Another embodiment of the present invention is a therapeutic compound: a conjugate configured to bind to a sodium-dependent glucose cotransporter expressed on the surface of a target cell, the conjugate comprising a conjugate comprising glucose coupled to an API, the conjugate being configured to bind to the sodium-dependent glucose cotransporter such that it crosses the membrane of the target cell and is transported into the target cell, the API being configured to be released from the conjugate after crossing the membrane of the target cell and being transported into the target cell, and the API being further configured to reduce the expression of the sodium-dependent glucose cotransporter expressed on the surface of the target cell after being released from the conjugate. The API can be coupled to glucose by a linker, and the linker can be a cleavable linker. In some embodiments, the API is selected from the group consisting of siRNA and antisense oligonucleotides.
[0026] In some embodiments, the sodium-dependent glucose cotransporter is SGLT1 isoform 1 (SEQ ID NO: 36), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand is 19-29 nucleotides in length and is complementary to consecutive nucleotides of SEQ ID NO: 15, (b) the sense RNA strand is 19-29 nucleotides in length and is complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region 14-29 nucleotides in length and a 3' overhang region 0-5 nucleotides in length. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15-25 nucleotides in length, and is complementary to at least 15 consecutive nucleotides of SEQ ID NO: 15.
[0027] In some embodiments, the sodium-dependent glucose cotransporter is the SGLT1 isoform 2 (SEQ ID NO: 37), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand is 19 to 29 nucleotides in length and is complementary to consecutive nucleotides of SEQ ID NO: 16, (b) the sense RNA strand is 19 to 29 nucleotides in length and is complementary to 14 to 29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region 14 to 29 nucleotides in length and a 3' overhang region 0 to 5 nucleotides in length. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides in length, and is complementary to at least 15 consecutive nucleotides of SEQ ID NO: 16.
[0028] In some embodiments, the sodium-dependent glucose cotransporter is SGLT2 (SEQ ID NO: 38), the API is siRNA, the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand is 19 to 29 nucleotides in length and is complementary to consecutive nucleotides of SEQ ID NO: 17, (b) the sense RNA strand is 19 to 29 nucleotides in length and is complementary to 14 to 29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region 14 to 29 nucleotides in length and a 3' overhang region 0 to 5 nucleotides in length. In other embodiments, the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides in length, and is complementary to at least 15 consecutive nucleotides of SEQ ID NO: 17.
[0029] One embodiment provides a method of treating diabetes in a mammalian subject that requires treatment for diabetes, the method comprising administering a therapeutically effective amount of a therapeutic compound. The mammalian subject can be a human.
[0030] According to another embodiment, a pharmaceutical composition comprising a therapeutic compound and a pharmaceutically acceptable carrier.
[0031] Brief explanation of the drawing The aforementioned features of the embodiment will be more readily understood by referring to the following detailed description, which is made with reference to the attached drawings. [Brief explanation of the drawing]
[0032] [Figure 1] Figure 1 shows SDS-PAGE gels and agarose gels demonstrating the production of correctly sized PD-L1-binding peptide-siRNA conjugates according to embodiments of the present invention.
[0033] [Figure 2] Figure 2 shows microscopic images demonstrating the binding of Cy5.5-labeled PD-L1-binding peptide-siRNA conjugate to PD-L1 on the cell surface of CT26.CL25 cells, as demonstrated by significant Cy5.5 fluorescence (second from the left) on cells incubated with Cy5.5-labeled PD-L1-binding peptide-siRNA conjugate according to embodiments of the present invention. Untreated CT26.CL25 cells (left), CT26.CL25 cells pretreated with an anti-PD-L1 antibody before incubation with Cy5.5-labeled PD-L1-binding peptide-siRNA (second from the right), and CT26.CL25 cells incubated only with unconjugated Cy5.5-labeled siRNA (right) showed little to no Cy5.5 fluorescence, indicating that the Cy5.5-labeled PD-L1-binding peptide-siRNA conjugate specifically binds to PD-L1 on the cell surface via its PD-L1-binding peptide. Nuclei stained with Hoechst 33342 (blue) and Cy5.5 fluorescence (red).
[0034] [Figure 3]Figure 3 shows microscopic images demonstrating that Cy5.5-labeled PD-L1-binding peptide-siRNA conjugates are internally transported by CT26.CL25 cells to a significantly greater extent than unconjugated Cy5.5-labeled siRNA 9, 18, and 24 hours after treatment with Cy5.5-labeled PD-L1-binding peptide-siRNA or unconjugated Cy5.5-labeled siRNA, according to embodiments of the present invention.
[0035] [Figure 4] Figure 4 shows microscopic images demonstrating that Cy5.5-labeled PD-L1-binding peptide-siRNA conjugates are internally transported by B16F10 cells to a significantly greater extent than unconjugated Cy5.5-labeled siRNA 18 and 24 hours after treatment with Cy5.5-labeled PD-L1-binding peptide-siRNA or unconjugated Cy5.5-labeled siRNA, according to embodiments of the present invention. Nuclei stained with Hoechst 33342 (blue) and Cy5.5 fluorescence (red).
[0036] [Figure 5] Figure 5 shows a bar graph of qRT-PCR results illustrating a significant decrease in relative PD-L1 expression in CT26.CL25 cells treated with a Cy5.5-labeled PD-L1-binding peptide-siRNA conjugate according to an embodiment of the present invention, compared to untreated CT26.CL25 cells.
[0037] [Figure 6] Figure 6 shows a bar graph illustrating that, according to embodiments of the present invention, pretreatment of 4T1 cells with a Cy5.5-labeled PD-L1-binding peptide-siRNA conjugate significantly reduces the subsequent binding of APC-labeled anti-PD-L1 antibody compared to pretreatment of 4T1 cells with a non-conjugated PD-L1-binding protein.
[0038] [Figure 7]Figure 7 shows a bar graph of Western blot results demonstrating a significant reduction in relative PD-L1 protein expression in Cy5.5-labeled PD-L1-binding peptide-siRNA conjugate-treated CT26.CL25 cells compared to siRNA conjugate-treated and untreated CT26.CL25 cells according to embodiments of the present invention.
[0039] [Figure 8] Figure 8 shows microscopic images demonstrating the binding of EGFR-binding peptide-siRNA conjugates to EGFR on the cell surface of A549 cells, as demonstrated by significant YOYO-1 staining on cells incubated with YOYO-1-stained EGFR-binding peptide-siRNA conjugates according to embodiments of the present invention. Untreated cells and cells treated with non-conjugated YOYO-1-stained EGFR siRNA do not show YOYO-1 staining.
[0040] [Figure 9] Figure 9 shows a bar graph of qRT-PCR results demonstrating a significant reduction in relative EGFR expression in EGFR-binding peptide-siRNA conjugate-treated A549 cells compared to untreated cells and cells treated with non-conjugate EGFR siRNA, according to embodiments of the present invention.
[0041] [Figure 10] Figure 10 shows a bar graph of Western blot results demonstrating a significant reduction in relative EGFR expression in EGFR-binding peptide-siRNA conjugate-treated A549 cells compared to untreated cells and cells treated with non-conjugate EGFR siRNA, according to embodiments of the present invention. [Modes for carrying out the invention]
[0042] Detailed description of specific embodiments Definitions. As used herein and in the appended claims, unless otherwise required by context, the following terms shall have the meanings set forth below.
[0043] The terms “a,” “an,” and “the,” and similar references used in the context describing the present invention (particularly in the context of the claims), should be construed to encompass both singular and plural unless otherwise specifically indicated herein or unless otherwise clearly contradicted by the context. The enumeration of value ranges herein is intended merely as a convenient way to refer individually to each distinct value that falls within that range. Unless otherwise indicated herein, each individual value is incorporated herein as if it were individually enumerated herein. No language herein should be construed to indicate an unclaimed element essential to the practice of the present invention.
[0044] A "group" must include at least one member.
[0045] The therapeutic compounds described herein are conjugates containing a “warhead” coupled to an active pharmaceutical ingredient (“API”). The warhead may be a protein or small molecule that binds to a specific protein expressed on the cell surface. For example, PD-1 binding peptide (SEQ ID NO: 40) may be a warhead in a conjugate containing PD-1 binding peptide (SEQ ID NO: 40) coupled to an API. PD-1 binding peptide (SEQ ID NO: 40) binds to PD-1 expressed on the cell surface. Similarly, glucose may be a warhead in a conjugate containing glucose coupled to an API. Glucose binds to a sodium-dependent glucose cotransporter expressed on the cell surface.
[0046] "Target cells" are cells that express a protein on their cell surface to which the therapeutic compound binds, and the expression of this protein on the target cell's cell surface is reduced after binding and subsequent internal transfer of the therapeutic compound by the target cell.
[0047] "Active pharmaceutical ingredient," "API," etc., according to embodiments of the present invention, refer to the non-warhead and non-linker portions of a biologically active therapeutic compound. Suitable active pharmaceutical ingredients ("APIs") include, but are not limited to, nucleic acid molecules such as siRNA, miRNA, antisense oligonucleotides, and their derivatives, and nucleic acid molecules containing modified nucleotides, skeletons, sugars, and / or bases.
[0048] Where used herein with respect to nucleic acid sequences, “complementarity” refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid sequence through Watson-Crick base pairing or fluctuation base pairing. The complementarity percentage indicates the percentage of nucleotides in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with nucleotides of a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, and 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementarity). “Fully complementary,” etc., means that every consecutive nucleotide of a nucleic acid sequence forms hydrogen bonds with the same number of consecutive nucleotides of a second nucleic acid sequence (i.e., the nucleic acid sequence has 100% complementarity). When used herein without further limitation, “complementary” means that consecutive nucleotides of a nucleic acid sequence have a complementarity percentage with consecutive nucleotides of a second nucleic acid sequence selected from the group consisting of 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%. For example, a nucleic acid sequence that is 19 nucleotides long and complementary to 14 nucleotides of a second nucleic acid sequence means that 14 consecutive nucleotides of the nucleic acid sequence have a complementarity percentage with consecutive nucleotides of a second nucleic acid sequence selected from the group consisting of 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% complementarity. A nucleic acid sequence that is 19 nucleotides long and complementary to at least 15 consecutive nucleotides in a second nucleic acid sequence means that the consecutive nucleotides of the nucleic acid sequence have a complementarity percentage with at least 15 consecutive nucleotides of two nucleic acid sequences selected from the group consisting of complementarity percentages of 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%.
[0049] The term "antibody" typically refers to an immunoglobulin molecule composed of two identical polypeptide chain pairs, each pair having one "heavy" (H) chain and one "light" (L) chain. Human light chains are classified as kappa (κ) and lambda (λ). Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, defining antibody isotypes as IgM, IgD, IgG, IgA, and IgE, respectively. Each heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region. The heavy chain constant region of IgD, IgG, and IgA consists of three domains: CH1, CH2, and CH3, while the heavy chain constant region of IgM and IgE consists of four domains: CH1, CH2, CH3, and CH4. Each light chain consists of a light chain variable region (VL) and a light chain constant region. The light chain constant region consists of one domain: CL. The constant region of an antibody can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells). The VH and VL regions can be further subdivided into hypervariable regions called complementarity-determining regions (CDRs), which are flanked by more conserved regions called framework regions (FRs). Each VH and VL consists of three CDRs and four FRs arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions (VH / VL) of each heavy / light chain pair typically form the antigen-binding site of the antibody. The term "antibody" is not limited by any particular method of antibody production. Examples include monoclonal antibodies, recombinant antibodies, and polyclonal antibodies.
[0050] The term "human antibody" refers to an antibody consisting solely of the amino acid sequence of a human immunoglobulin sequence. Human antibodies may contain mouse carbohydrate chains if produced in mice, mouse cells, or hybridomas derived from mouse cells. Human antibodies can be prepared by various methods known in the art.
[0051] The term "humanized antibody" refers to an antibody that contains some or all of the CDRs derived from a non-human animal antibody, where the antibody framework and constant region contain amino acid residues derived from the human antibody sequence. Humanized antibodies are typically produced by transplanting a CDR from a mouse antibody into a human framework sequence, followed by reverse substitution of specific human framework residues for the corresponding mouse residues from the source antibody. The term "humanized antibody" also refers to a non-human antibody in which one or more epitopes with a high tendency to constitute human T cell and / or B cell epitopes have been removed, typically in one or more variable regions, for the purpose of reducing immunogenicity. The amino acid sequences of epitopes can be removed completely or partially. However, typically, the amino acid sequence is modified by substituting one or more amino acids constituting the epitope with one or more other amino acids, thereby changing the amino acid sequence to one that does not constitute a human T cell and / or B cell epitope. The amino acids are sometimes substituted with amino acids present at the corresponding position(s) of the corresponding human variable heavy chain or variable light chain.
[0052] An antibody "antigen-binding fragment" refers to a fragment of an antibody that binds to an antigen, containing the constant and variable domains of both the heavy and light chains of the antibody. Examples of antigen-binding fragments include Fab fragments and F(ab')2 fragments.
[0053] "Therapeutic dose" means the amount of therapeutic compound or composition sufficient to produce the desired biological effect. This effect may be the reduction and / or alleviation of signs, symptoms, or causes of a disease, or any other desired change in the biological system. The appropriate "therapeutic dose" in any individual case can be determined by those skilled in the art using routine experiments.
[0054] The term "pharmaceutically acceptable carrier" refers to solvents, carriers, diluents, etc., commonly used for administering pharmaceutical compounds.
[0055] When used in reference to two sequences, the term “identical” means that, when the two sequences are aligned, the monomer units of one sequence exactly match those of the other sequence. Two sequences that are exactly the same share 100% identity and are referred to as 100% identical. The monomer units of a protein / peptide sequence are amino acid residues, and the monomer units of a nucleic acid sequence are nucleotides. Similarly, a sequence that is 90% identical to a second sequence means that, when the two sequences are aligned, 90% of the monomer units of the sequence exactly match those of the second sequence. For example, a protein having a first amino acid sequence that is 90% identical to a second amino acid sequence of 20 amino acid residues means that when the first sequence is aligned to the second sequence, the first sequence differs from the second sequence by only two amino acid residues. Sequence identity and sequence alignment are well known to those skilled in the art.
[0056] One-two punch
[0057] Certain cell surface proteins are known to play a role in the proliferation of various forms of cancer. Examples of these cell surface proteins include programmed cell death protein 1 ("PD-1"), programmed cell death ligand 1 ("PD-L1"), differentiation cluster 38 ("CD38"), and human epidermal growth factor receptor 2 ("HER2"). By binding one or more of these proteins to the surface of cancer cells and inhibiting their function, cancer cell proliferation can be suppressed or eliminated.
[0058] Other cell surface proteins, such as the interleukin-4 receptor ("IL4R"), interleukin-6 receptor ("IL6R"), tumor necrosis factor receptor 1 ("TNFR1"), and tumor necrosis factor receptor 2 ("TNFR2"), play a role in inflammation. By binding to and inhibiting 1 or more IL4R, IL6R, TNFR1, and TNFR2, inflammation in a target can be reduced or eliminated.
[0059] Finally, cell surface proteins such as sodium-dependent glucose cotransporter protein 1 ("SGLT-1") and sodium-dependent glucose cotransporter protein 2 ("SGLT-2") offer promising targets for treating diabetes. By binding to and inhibiting SGLT-1 and SGLT-2, one or more of them, glucose uptake by the intestines (i.e., cells expressing SGLT-1) or the renal tubular system (i.e., cells expressing SGLT-2) is induced, which may be useful in treating diabetes in the target population.
[0060] Here, the inventors describe a novel therapeutic compound useful for treating various conditions such as cancer, inflammation, and diabetes, comprising a conjugate having a warhead (for example, a peptide configured to bind to cell surface proteins on the surface of cancer cells) coupled to an API configured as follows: (1) it binds to cell surface proteins expressed on the surface of cells, thereby inhibiting the activity of the cell surface proteins; and (2) it is internally transported by cancer cells, thereby delivering the API to the cancer cells, and the API is released from the conjugate after internal transport by the cells, reducing the expression of the cell surface proteins. The inventors have named this dual effect of a conjugate, which inhibits the activity of cell surface proteins upon binding and reduces the expression of cell surface proteins after internal transport of the conjugate, the "one-two punch." In some embodiments, the therapeutic compounds disclosed herein may be administered to a subject to produce a one-two punch effect, thereby inhibiting the activity of cell surface proteins selected from the group consisting of PD-1, PD-L1, CD38, HER2, IL4R, IL6R, TNFR1, and TNFR2.
[0061] Table 1 provides “warhead” peptides that bind to indicated cell surface proteins according to embodiments of the present invention. These warhead peptides can be coupled to an API to form a conjugate configured to deliver a one-two punch to target cells.
[0062] [Table 1]
[0063] PD-1
[0064] Programmed cell death protein 1 (PD-1) is a type of immune checkpoint protein that modulates the activity of the immune system. It is expressed on the surface of immune cells, including T cells and B cells, and plays a crucial role in maintaining immune tolerance by inhibiting the activation and proliferation of immune cells.
[0065] However, PD-1 has also been found to be upregulated in cancer cells, leading to immune evasion and a reduced immune response against cancer cells. This allows cancer cells to evade detection and attack by the immune system, resulting in cancer growth and progression. Studies have shown that targeting PD-1 with monoclonal antibodies such as pembrolizumab and nivolumab can enhance the immune response against cancer cells and improve outcomes for certain cancer types, including melanoma, non-small cell lung cancer, and renal cell carcinoma. Chen, L., & Mellman, I. (2014). Nature, 541(7637), 321-330 and Balar, AV & Weber, JS. (2017) PD-1 and PD-L1 antibodies in cancer: current status and future directions, Cancer Immunol Immunother., 66(5):551-564.
[0066] CD38
[0067] CD38 is a transmembrane protein expressed on the surface of various immune cells, including T cells, B cells, and myeloid cells, as well as on certain cancer cells. It is involved in various immune and signaling pathways, including the regulation of calcium levels, enzyme activation, and the modulation of immune responses.
[0068] CD38 has been identified as a potential therapeutic target in cancer because it is often overexpressed on the surface of cancer cells, particularly in lymphoma, multiple myeloma, and acute myeloid leukemia. Overexpression of CD38 on cancer cells is associated with a poorer prognosis and resistance to chemotherapy. In addition to its expression on cancer cells, CD38 is also involved in the immune response to cancer. CD38-expressing immune cells, such as T cells, play a role in the recognition and destruction of cancer cells. Several studies have shown the potential of targeting CD38 in cancer treatment. For example, monoclonal antibodies targeting CD38 have shown promising results in the treatment of multiple myeloma, and small molecule inhibitors of CD38 have shown potential in the treatment of lymphoma and leukemia. Wang, X & Li, G. (2016). CD38: A multifunctional protein in cancer and immunity. Frontiers in Oncology, 6, 114 and Chen, W. & Chen, J. (2017). CD38: A potential target for cancer immunotherapy. Cancer Letters, 390, 191-199.
[0069] HER2
[0070] HER2, also known as human epidermal growth factor receptor 2, is a protein expressed on the surface of cells in the human body. It is a member of the epidermal growth factor receptor (EGFR) family and is involved in regulating cell proliferation and survival. The terms "HER2" and "EGFR" are used interchangeably and synonymously herein; for example, EGFR-binding peptides are HER2-binding peptides.
[0071] HER2 is often overexpressed in certain types of cancer, including breast, ovarian, gastric, and pancreatic cancers. HER2 overexpression can lead to uncontrolled proliferation of cancer cells, resulting in aggressive and treatment-resistant tumors. HER2 overexpression in cancer cells has been identified as a significant driver of tumor progression and is associated with poor prognosis. For example, in breast cancer, HER2 overexpression is found in approximately 20% of cases and is associated with a more aggressive form of the disease and a higher risk of recurrence.
[0072] Therapies targeting HER2 have been developed and shown to be effective in treating HER2-positive cancers. These therapies include monoclonal antibodies such as trastuzumab and pertuzumab, which bind to HER2 and inhibit its signal transduction, and small molecule tyrosine kinase inhibitors such as lapatinib and neratinib, which block HER2 activity. (Tan, M., Yu, D. (2007) "Molecular mechanisms of erbB2-mediated breast cancer chemoresistance". Breast Cancer Chemosensitivity. Advances in Experimental Medicine and Biology. Vol.608.pp.119-29 and Vranic, S. et al. (2021) "Targeting HER2 expression in cancer: New drugs and new indications". Bosnian Journal of Basic Medical Sciences. 21(1):1-4.)
[0073] PD-L1
[0074] Programmed cell death ligand 1 (PD-L1) is a protein expressed on the surface of certain cells, including cancer cells. It belongs to the immune checkpoint family of proteins that regulate the activity of the immune system. PD-L1 can bind to a receptor called PD-1, which is expressed on the surface of immune cells called T cells. When PD-L1 and PD-1 bind together, they inhibit the activity of T cells, which can help prevent the immune system from attacking normal cells. However, cancer cells can exploit this inhibitory pathway by expressing high levels of PD-L1, which helps cancer cells evade the immune system and continue to grow and spread.
[0075] In recent years, PD-L1 has emerged as a target for cancer immunotherapy. PD-L1 inhibitors are a class of drugs that block the interaction between PD-L1 and PD-1, allowing the immune system to attack cancer cells. These drugs have shown promising results in several cancer types, including lung cancer, bladder cancer, and kidney cancer. Balar, AV & Weber, JS. (2017) PD-1 and PD-L1 antibodies in cancer: current status and future directions, Cancer Immunol Immunother., 66(5):551-564.
[0076] IL-4R
[0077] The interleukin-4 receptor (IL-4R) is a transmembrane protein that plays a crucial role in the immune system. It is expressed on various immune cells, including T helper cells, B cells, and macrophages, and is activated by the cytokine interleukin-4 (IL-4). IL-4 is an important cytokine involved in the immune response to infection and inflammation. It is primarily produced by T helper 2 (Th2) cells and promotes the differentiation of immune cells into Th2 cells, and is involved in antibody production as well as the activation of eosinophils and mast cells.
[0078] IL-4R activation leads to downstream signaling pathways that regulate the activation and function of immune cells. It has been shown to promote the production of anti-inflammatory cytokines such as IL-10 and inhibit the production of pro-inflammatory cytokines such as IL-1 and TNF-α. Furthermore, IL-4R activation has been shown to play a role in the development and maintenance of allergic inflammation that leads to atopic dermatitis and asthma. Allergic inflammation is characterized by the activation of Th2 cells, as well as the production of IL-4 and IL-13, which leads to the activation of eosinophils and the release of histamine from mast cells (Nelms, K. et al. (1999) Annu. Rev. Immunol., 17:701-38).
[0079] IL-6R
[0080] The IL-6 receptor (IL-6R) is a protein expressed on the surface of cells that is responsible for the binding and activation of interleukin-6 (IL-6). When IL-6 binds to IL-6R, it activates intracellular signaling pathways, leading to the production of various proteins, including those involved in inflammation. IL-6 is a cytokine that plays a crucial role in the immune system, particularly in inflammatory responses. It is produced by various immune cells, including T cells, B cells, and monocytes, and is involved in a wide range of immune processes, including inflammation, hematopoiesis, and immune cell activation.
[0081] One of the main functions of IL-6 in inflammation is the activation of T cells and B cells. It also activates neutrophils and monocytes, which are important in the early stages of inflammation, as well as macrophages, which play a crucial role in resolving inflammation (Kaur, S. et al. (2020) Bioorg Med Chem 28(5):115327).
[0082] TNFR1 / TNFR2
[0083] Two receptors have been identified that mediate interactions with TNF: tumor necrosis factor receptor 1 (TNFR1), also known as CD120a and p55 (with a molecular weight of 55 kDa), and tumor necrosis factor receptor 2 (TNFR2), also known as CD120b and p75 (with a molecular weight of 75 kDa)
[29] . TNFR1 and TNFR2 are not specific to TNF and also interact with lymphotoxin α (LTα, formerly known as TNFβ). LTα is a TNF-related cytokine that is activated by similar stimuli as those that activate TNF, is produced primarily in a soluble form by lymphoid cells, and can be combined with LTβ, which interacts with another different receptor, LTβR
[30] .
[0084] TNFR1 and TNFR2 are located on the cell membrane or in a soluble form after TACE activation, their cytoplasmic domains are unrelated, and their intracellular signaling pathways are independent. TNFR1 is involved in cytotoxicity, while TNFR2 plays a role in both cytotoxicity and proliferation [31, 32]. The exact mechanism by which TACE is involved in the shedding of TNFR1 and TNFR2 remains unclear.
[0085] TNFR1 and TNFR2 are single type I transmembrane proteins characterized by having several cysteine-rich domains (CRDs) in their extracellular domains. Soluble forms of TNFR1 and TNFR2 have also been described, arising from alternative splicing or shedding. Soluble TNF receptor mutants inhibit TNF by competing with cellular receptor species for TNF binding, but also possibly by acting as dominant-negative molecules. In fact, the N-terminal CRD of TNFR1 and TNFR2 does not directly participate in ligand binding but mediates inactive self-assembly in the absence of ligand. Therefore, this portion of the TNF receptor is called the pre-ligand-binding assembly domain (PLAD) and appears to be a prerequisite for ligand binding and subsequent formation of the active receptor complex. Thus, soluble TNF receptor molecules may also act as TNF inhibitors by forming an inactive complex with the cellular TNF receptor via PLAD-PLAD interactions, but this issue is still unclear. Front.Cell Dev.Biol.,29 May 2019(doi.org / 10.3389 / fcell.2019.00091)and Int J Mol Sci.2021 Jun;22(11):5461.(doi:10.3390 / ijms22115461).
[0086] Furthermore, the inventors describe a novel therapeutic compound useful for treating diabetes, comprising a conjugate having glucose as a warhead coupled to an API. The conjugate is configured to bind to a sodium-dependent glucose cotransporter expressed on the surface of cells, and as a result, is transported across the membrane of target cells into the target cells. Upon transport across the membrane, the API reduces the expression of the sodium-dependent glucose cotransporter.
[0087] SGLT1 / SGLT2
[0088] Examples of sodium-dependent glucose cotransporters include sodium-glucose cotransporter 1 ("SGLT1") and sodium-glucose cotransporter 2 ("SGLT2"). SGLT1 and SGLT2 are expressed on the surface of specific cells in the proximal tubules of the small intestine and nephrons.
[0089] Glucose can be transported across the cell membrane by binding to a sodium-dependent glucose cotransporter expressed on the cell surface, the sodium-dependent glucose cotransporter being selected from the group consisting of SGLT1 isoform 1 (SEQ ID NO: 36), SGLT1 isoform 2 (SEQ ID NO: 37), and SGLT2 (SEQ ID NO: 38). Glucose can be used as a "warhead" when coupled to an API to form a conjugate configured to be transported across the membrane of a cell expressing a sodium-dependent glucose cotransporter selected from the group consisting of SGLT1 isoform 1 (SEQ ID NO: 36), SGLT1 isoform 2 (SEQ ID NO: 37), and SGLT2 (SEQ ID NO: 38).
[0090] Linker
[0091] In some embodiments, the therapeutic compounds described herein include a warhead coupled to an API by a linker. Suitable linkers include, but are not limited to, cleavable linkers such as hydrazone linkers, imine linkers, oxime linkers, carbonate linkers, acetal linkers, orthoester linkers, silyl ether linkers, disulfide linkers, trioxolane linkers, beta-glucuronide linkers, beta-galactoside linkers, pyrophosphate linkers, phosphoramide linkers, aryl sulfate linkers, heptamethin cyanine linkers, nitrobenzyl linkers, arylboronic acid linkers, boronate linkers, thioether linkers, maleimidocaproyl-containing linkers, enzymatically cleavable peptide linkers, and para-aminobenzylcarbamate-containing linkers, as well as non-cleavable linkers such as polyethylene glycol.
[0092] The conjugates described herein can be prepared via linkers using coupling reactions such as bis(vinylsulfonyl)piperazine-disulfide coupling, N-methyl-N-phenylvinylsulfonamide-cysteine coupling, platinum(II) compound-histidine coupling, and tetrazine-trans-cyclooctene coupling. Suitable linkers and coupling reactions are known to those skilled in the art. For example, see Su et al. Acta Pharmaceutica Sinica B (2021), ISSN 2211-3835; Pan et al. Med Res Rev. 40:2682-2713 (2020); Khongorzulet al. Mol Cancer Res 18:3-19 (2020); Bargh et al. Chem Soc Rev 48:4361-4374 (2019); and Smith et al. Pharm Res 32:3526-3540 (2015), each of which is incorporated herein by reference in its entirety.
[0093] Various enzymatic peptide linkers, such as those described below, can be used to prepare the conjugates described herein according to embodiments of the present invention. These linkers contain amino acid residues and are cleaved by specific intracellular enzymes, such as lysosomal degrading enzymes. For example, see Kong et al., J Biol Chem 290:7160-7168 (2015); Poreba FEBS J 287:1936-1969 (2020); and Singh et al., Current Medicinal Chemistry 15(18) (2008), whose entirety is incorporated herein by reference. Exemplary peptide linkers suitable for use according to embodiments of the present invention are described below.
[0094] For example, a dipeptide linker consists of two amino acid residues that function as a recognition motif for cleavage by the enzyme cathepsin B, which cleaves the amide bond between the carbonyl and amino groups following the second amino acid residue. Examples of dipeptide linkers cleaved by cathepsin B include Phe-Arg, Phe-Cit, Phe-Lys, Ala-Arg, Ala-Cit, Val-Ala, Val-Arg, Val-Lys, Val-Cit, and Arg-Arg. Cathepsin B similarly recognizes and cleaves the tetrapeptide linkers Gly-Phe-Leu-Gly (SEQ ID NO: 105) and Ala-Leu-Ala-Leu (SEQ ID NO: 106) following the fourth amino acid residue.
[0095] Furthermore, the tripeptide linker Ala-Ala-Asn is cleaved by the enzyme legmine after the last amino acid residue. The tetrapeptide linkers Lys-Ala-Gly-Gly (SEQ ID NO: 107), Leu-Arg-Gly-Gly (SEQ ID NO: 108), and Arg-Lys-Arg-Arg (SEQ ID NO: 109) are cleaved by papain-like protease enzymes.
[0096] The peptide linkers Arg-Arg-X, Ala-Leu-X, Gly-Leu-Phe-Gly-X (SEQ ID NO: 110), Gly-Phe-Leu-Gly-X (SEQ ID NO: 111), and Ala-Leu-Ala-Leu-X (SEQ ID NO: 112) are cleaved by the enzymes cathepsins B, H, and L, where X is any amino acid. Cathepsins B, H, and L are responsible for lysosomal degradation of proteins.
[0097] The peptide linkers Phe-Ala-Ala-Phe(NO2)-Phe-Val-Leu-OM4P-X (SEQ ID NO 113) and Bz-Arg-Gly-Phe-Phe-Pro-4mβNA (SEQ ID NO 114) are cleaved by the enzyme cathepsin D.
[0098] Serum plasminogen activator is produced in many tumor cells. Plasminogen is converted to plasmin, and therefore tumor cells produce high levels of plasmin. This plasmin is rapidly degraded in the plasma, so tissues away from the tumor are not exposed to plasmin. Plasmin is responsible for fibrinolysis and degradation of plasma proteins and cleaves the peptide linkers D-Val-Leu-Lys-X, D-Ala-Phe-Lys-X, and D-Ala-Trp-Lys-X, where X is any amino acid.
[0099] Tissue plasminogen activator (tPA) and urokinase (uPA) are responsible for activating plasmin formation and can cleave the peptide linker Gly-Gly-Gly-Arg-Arg-Arg-Val-X (SEQ ID NO: 115), where X is any amino acid.
[0100] The prostate-specific antigen is involved in the liquefaction of semen and cleaves the peptide linker morpholinocarbonyl-His-Ser-Ser-Lys-Leu-Gln-Leu-X (SEQ ID NO: 116), where X is any amino acid.
[0101] Matrix metalloproteinases (MMP-2 and MM-9) are responsible for the degradation of the extracellular matrix and collagen, cleaving the peptide linkers Ac-Pro-Leu-Gln-Leu-X (SEQ ID NO: 117) and Gly-Pro-Leu-Gly-Ile-Ala-Gly-Gln-X (SEQ ID NO: 118), where X is any amino acid.
[0102] APIs and therapeutic compounds coupled thereto
[0103] siRNA
[0104] According to some embodiments, the API may be a small interfering RNA ("siRNA"). siRNA is a double-stranded RNA molecule that can reduce the expression of a particular gene by causing the degradation of the mRNA transcript(s) of a gene(s) that share partial complementarity with the strand of the double-stranded siRNA molecule. The process of reducing gene expression using siRNA is called RNA interference ("RNAi"). See U.S. Patents 7,056,704, 7,078,196, and 8,372,968, which are incorporated herein by reference in their entirety.
[0105] The transcripts encoding cell surface proteins shown in Table 2 are targets for the use of siRNA as an API to reduce the expression of cell surface proteins expressed via RNAi.
[0106] [Table 2]
[0107] According to several embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein comprising (i) a PD-1 binding peptide comprising an amino acid sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 40 and SEQ ID NOs: 41, and (ii) an anti-PD-1 antibody or its antigen-binding fragment coupled to an API, selected from the group consisting of an siRNA, where the API is an siRNA and the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, wherein (a) the antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NOs: 1, (b) the sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides and a 3' overhang region of 0 to 5 nucleotides. In some embodiments, the PD-1 binding peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 40 and SEQ ID NOs: 41. The anti-PD-1 antibody and its antigen-binding fragment may be humanized. Methods for treating cancer in mammalian subjects requiring such treatment are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. The mammalian subject may be human. In some embodiments, the cancer is selected from the group consisting of melanoma, non-small cell lung cancer, and renal cell carcinoma.
[0108] In other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group consisting of (i) a CD38-binding peptide having an amino acid sequence at least 90% identical to SEQ ID NO: 45, and (ii) an anti-CD38 antibody or its antigen-binding fragment coupled to an API, wherein the API is siRNA and the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand being 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 2, (b) the sense RNA strand being 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule having a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In some embodiments, the CD38-binding peptide is SEQ ID NO: 45. The anti-CD38 antibody and its antigen-binding fragment may be humanized. Methods for treating cancer in mammalian subjects requiring such treatment are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. The mammalian subject may be human. In some embodiments, the cancer is selected from the group consisting of lymphoma, multiple myeloma, and acute myeloid leukemia.
[0109] According to several embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein comprising (i) a HER2-binding peptide comprising an amino acid sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 46-59, and (ii) an anti-HER2 antibody or its antigen-binding fragment coupled to an API, selected from the group consisting of an siRNA, where the API is an siRNA and the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, wherein (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 3, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In some embodiments, the HER2-binding peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 46-59. The anti-HER2 antibody and its antigen-binding fragment may be humanized. A method for treating cancer in a mammalian subject requiring such treatment is also provided, the method comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. The mammalian subject may be human. In some embodiments, the cancer is selected from the group consisting of breast cancer, ovarian cancer, gastric cancer, and pancreatic cancer.
[0110] According to several embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein comprising (i) a PD-L1 binding peptide comprising an amino acid sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs. 60 to 65, (ii) an anti-PD-L1 isoform A antibody or its antigen-binding fragment, and (iii) an anti-PD-L1 isoform C antibody or its antigen-binding fragment coupled to an API, wherein the API is siRNA and the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, wherein (a) the antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO. 4, (b) the sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides and a 3' overhang region of 0 to 5 nucleotides. In some embodiments, the PD-L1 binding peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs. 60-65. The anti-PD-L1 isoform A antibody and its antigen-binding fragment may be humanized. The anti-PD-L1 isoform C antibody and its antigen-binding fragment may also be humanized. Methods for treating cancer in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. The mammalian subject may be human. In some embodiments, the cancer is selected from the group consisting of lung cancer, bladder cancer, and kidney cancer.
[0111] According to other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group consisting of (i) an IL4R-binding peptide having an amino acid sequence at least 90% identical to SEQ ID NO: 66, (ii) an anti-IL4R isoform A antibody or its antigen-binding fragment, and (iii) an anti-IL4R isoform C antibody or its antigen-binding fragment coupled to an API, wherein the API is siRNA and the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand being 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 7, (b) the sense RNA strand being 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule having a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In some embodiments, the IL4R-binding peptide is 66. The anti-IL4R isoform A antibody and its antigen-binding fragment may be humanized. The anti-IL4R isoform C antibody and its antigen-binding fragment may also be humanized. A method for reducing inflammation in a mammalian subject in need is also provided, the method comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. The mammalian subject may be human.
[0112] According to several embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein comprising: (i) an IL6R-binding peptide having an amino acid sequence at least 90% identical to SEQ ID NO: 67; (ii) an anti-IL6R isoform 1 antibody or its antigen-binding fragment; (iii) an anti-IL6R isoform 2 antibody or its antigen-binding fragment; (iv) an anti-IL6R isoform 3 antibody or its antigen-binding fragment; (v) an anti-IL6R isoform 4 antibody or its antigen-binding fragment; and (vi) an anti-IL6R isoform 5 antibody or its antigen-binding fragment. Selected from the group and coupled to an API, the API being an siRNA, the siRNA being a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, where (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 8, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In some embodiments, the IL6R-binding peptide consists of 67. Anti-IL6R isoform 1 antibody and its antigen-binding fragment, anti-IL6R isoform 2 antibody and its antigen-binding fragment, anti-IL6R isoform 3 antibody and its antigen-binding fragment, anti-IL6R isoform 4 antibody and its antigen-binding fragment, and anti-IL6R isoform 5 antibody and its antigen-binding fragment can be humanized. A method for reducing inflammation in mammalian subjects requiring it is also provided, the method comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. The mammalian subject may be a human.
[0113] According to several embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group consisting of (i) a TNFR1-binding peptide having an amino acid sequence at least 90% identical to SEQ ID NO: 68, and (ii) an anti-TNFR1 antibody or its antigen-binding fragment coupled to an API, wherein the API is siRNA and the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand being 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 11, (b) the sense RNA strand being 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule having a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In some embodiments, the TNFR1-binding peptide is 68. The anti-TNFR1 antibody and its antigen-binding fragment may be humanized. A method for reducing inflammation in mammalian subjects requiring it is also provided, the method comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. The mammalian subject may be a human.
[0114] According to other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein comprising (i) a TNFR2-binding peptide comprising an amino acid sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs. 69-72, and (ii) an anti-TNFR2 antibody or its antigen-binding fragment coupled to an API, selected from the group consisting of an siRNA, where the API is an siRNA and the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, wherein (a) the antisense RNA strand is 19-29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 14, (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand, and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. In some embodiments, the TNFR2-binding peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs. 69-72. The anti-TNFR2 antibody and its antigen-binding fragment may be humanized. A method for reducing inflammation in mammalian subjects requiring it is also provided, the method comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. The mammalian subject may be a human.
[0115] According to several embodiments, the therapeutic compound of the present invention comprises glucose coupled to an API, the API being an siRNA, and the siRNA being a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand: (a) the antisense RNA strand is 19-29 nucleotides long and complementary to nucleotides, which are a sequence of nucleic acid sequences selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17; (b) the sense RNA strand is 19-29 nucleotides long and complementary to 14-29 nucleotides from the antisense RNA strand; and (c) the double-stranded RNA molecule has a double-stranded region of 14-29 nucleotides and a 3' overhang region of 0-5 nucleotides. A method for treating diabetes in a mammalian subject requiring it is also provided, the method comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. The mammalian subject may be a human.
[0116] Antisense oligonucleotides
[0117] According to some embodiments, the API may be an antisense oligonucleotide ("ASO"). An antisense oligonucleotide is a single-stranded nucleic acid that is complementary to the messenger mRNA that codes for the protein it hybridizes with, thereby blocking its translation into the protein.
[0118] According to several embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein comprising (i) a PD-1 binding peptide comprising an amino acid sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 40 and SEQ ID NOs: 41, and (ii) an anti-PD-1 antibody or its antigen-binding fragment coupled to an API, wherein the API is an antisense oligonucleotide 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 1. In some embodiments, the PD-1 binding peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 40 and SEQ ID NOs: 41. The anti-PD-1 antibody and its antigen-binding fragment may be humanized. Methods for treating cancer in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. In some embodiments, the cancer is selected from the group consisting of melanoma, non-small cell lung cancer, and renal cell carcinoma.
[0119] According to other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group consisting of (i) a CD38-binding peptide having an amino acid sequence at least 90% identical to SEQ ID NO: 45, and (ii) an anti-CD38 antibody or its antigen-binding fragment coupled to an API, wherein the API is an antisense oligonucleotide 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 2. In some embodiments, the CD38-binding peptide is SEQ ID NO: 45. The anti-CD38 antibody and its antigen-binding fragment may be humanized. Methods for treating cancer in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. In some embodiments, the cancer is selected from the group consisting of lymphoma, multiple myeloma, and acute myeloid leukemia.
[0120] According to several embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein comprising (i) a HER2-binding peptide comprising an amino acid sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 46-59, and (ii) an anti-HER2 antibody or its antigen-binding fragment coupled to an API, wherein the API is an antisense oligonucleotide 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 3. In some embodiments, the HER2-binding peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 46-59. The anti-HER2 antibody and its antigen-binding fragment may be humanized. Methods for treating cancer in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. In some embodiments, the cancer is selected from the group consisting of breast cancer, ovarian cancer, gastric cancer, and pancreatic cancer.
[0121] According to other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein comprising (i) a PD-L1 binding peptide comprising an amino acid sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs. 60-65, (ii) an anti-PD-L1 isoform A antibody or its antigen-binding fragment, and (iii) an anti-PD-L1 isoform C antibody or its antigen-binding fragment coupled to an API, wherein the API is an antisense oligonucleotide 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 4. In some embodiments, the PD-L1 binding peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs. 60-65. The anti-PD-L1 isoform A antibody and its antigen-binding fragment may be humanized. The anti-PD-L1 isoform C antibody and its antigen-binding fragment may be humanized. A method for treating cancer in a mammalian subject requiring it is also provided, the method comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. In some embodiments, the cancer is selected from the group consisting of lung cancer, bladder cancer, and kidney cancer.
[0122] According to several embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group consisting of (i) an IL4R-binding peptide having an amino acid sequence at least 90% identical to SEQ ID NO: 66, (ii) an anti-IL4R isoform A antibody or its antigen-binding fragment, and (iii) an anti-IL4R isoform C antibody or its antigen-binding fragment coupled to an API, wherein the API is an antisense oligonucleotide 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 7. In some embodiments, the IL4R-binding peptide consists of 66. The anti-IL4R isoform A antibody and its antigen-binding fragment may be humanized. The anti-IL4R isoform C antibody and its antigen-binding fragment may be humanized. Methods for reducing inflammation in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject.
[0123] According to other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group consisting of (i) an IL6R-binding peptide having an amino acid sequence at least 90% identical to SEQ ID NO: 67, (ii) an anti-IL6R isoform 1 antibody or its antigen-binding fragment, (iii) an anti-IL6R isoform 2 antibody or its antigen-binding fragment, (iv) an anti-IL6R isoform 3 antibody or its antigen-binding fragment, (v) an anti-IL6R isoform 4 antibody or its antigen-binding fragment, and (vi) an anti-IL6R isoform 5 antibody or its antigen-binding fragment, and coupled to an API, the API being an antisense oligonucleotide 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 8. In some embodiments, the IL6R-binding peptide consists of 67. Anti-IL6R isoform 1 antibody and its antigen-binding fragment, anti-IL6R isoform 2 antibody and its antigen-binding fragment, anti-IL6R isoform 3 antibody and its antigen-binding fragment, anti-IL6R isoform 4 antibody and its antigen-binding fragment, and anti-IL6R isoform 5 antibody and its antigen-binding fragment can be humanized. Methods for reducing inflammation in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject.
[0124] According to several embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group consisting of (i) a TNFR1-binding peptide having an amino acid sequence at least 90% identical to SEQ ID NO: 68, and (ii) an anti-TNFR1 antibody or its antigen-binding fragment coupled to an API, wherein the API is an antisense oligonucleotide 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 11. In some embodiments, the TNFR1-binding peptide consists of SEQ ID NO: 68. The anti-TNFR1 antibody and its antigen-binding fragment may be humanized. Methods for reducing inflammation in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject.
[0125] According to other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein comprising (i) a TNFR2-binding peptide comprising an amino acid sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs. 69-72, and (ii) an anti-TNFR2 antibody or its antigen-binding fragment coupled to an API, wherein the API is an antisense oligonucleotide 15-25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 14. In some embodiments, the TNFR2-binding peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs. 69-72. The anti-TNFR2 antibody and its antigen-binding fragment may be humanized. Methods for reducing inflammation in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject.
[0126] According to several embodiments, the therapeutic compound of the present invention comprises glucose coupled to an API, the API being an antisense oligonucleotide 15 to 25 nucleotides long, complementary to nucleotides which are at least 15 sequences of nucleic acid sequences selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17. A method for treating diabetes in a mammalian subject requiring it is also provided, the method comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject.
[0127] microRNA ("miRNA")
[0128] According to some embodiments, the API can be a miRNA. A miRNA is transcribed as a single-stranded RNA precursor with a stem-loop structure, and subsequently processed in the cytosol by a Dicer enzyme as a pre-miRNA, producing one or more mature miRNAs. Typically, two mature miRNA products are produced from a miRNA molecule: a 5p RNA molecule (named so because it is processed from the 5' arm of a double helix that forms the stem of the miRNA) and a 3p RNA molecule (named so because it is processed from the 3' arm of a double helix that forms the stem of the miRNA). The 5p and 3p molecules can base-pair each other to form a double helix, and each molecule can function in the cell through their complementarity to mRNA, and may actually perform distinct functions. Mature miRNAs are thought to have regulatory roles, including RNA silencing and post-transcriptional regulation of gene expression.
[0129] Table 3 below lists microRNAs that reduce the expression of the indicated cell surface proteins.
[0130] [Table 3]
[0131] According to several embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group consisting of (i) a PD-1 binding peptide comprising an amino acid sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 40 and SEQ ID NOs: 41, and (ii) an anti-PD-1 antibody or its antigen-binding fragment coupled to an API, wherein the API is a microRNA comprising a nucleic acid sequence at least 95% identical to SEQ ID NOs: 39. In some embodiments, the PD-1 binding peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 40 and SEQ ID NOs: 41. The anti-PD-1 antibody and its antigen-binding fragment may be humanized. In some embodiments, the microRNA comprises SEQ ID NOs: 39. Methods for treating cancer in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. In some embodiments, the cancer is selected from the group consisting of melanoma, non-small cell lung cancer, and renal cell carcinoma.
[0132] According to other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group comprising (i) a CD38-binding peptide having an amino acid sequence at least 90% identical to SEQ ID NO: 45, and (ii) an anti-CD38 antibody or its antigen-binding fragment coupled to an API, wherein the API is a microRNA having a nucleic acid sequence at least 95% identical to an icloRNA sequence selected from the group comprising SEQ ID NOs: 42-44. In some embodiments, the CD38-binding peptide is SEQ ID NO: 45. The anti-CD38 antibody and its antigen-binding fragment may be humanized. In some embodiments, the microRNA consists of a nucleic acid sequence selected from the group comprising SEQ ID NOs: 42-44. Methods for treating cancer in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. In some embodiments, the cancer is selected from the group comprising lymphoma, multiple myeloma, and acute myeloid leukemia.
[0133] According to other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group comprising (i) a HER2-binding peptide comprising an amino acid sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 46-59, and (ii) an anti-HER2 antibody or its antigen-binding fragment coupled to an API, wherein the API is a microRNA comprising a nucleic acid sequence at least 95% identical to an icloRNA sequence selected from the group consisting of SEQ ID NOs: 73-78. In some embodiments, the HER2-binding peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 46-59. The anti-HER2 antibody and its antigen-binding fragment may be humanized. In some embodiments, the microRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 73-78. Methods for treating cancer in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. In some embodiments, the cancer is selected from the group consisting of breast cancer, ovarian cancer, gastric cancer, and pancreatic cancer.
[0134] In other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group consisting of (i) a PD-L1 binding peptide comprising an amino acid sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 60-65, (ii) an anti-PD-L1 isoform A antibody or its antigen-binding fragment, and (iii) an anti-PD-L1 isoform C antibody or its antigen-binding fragment coupled to an API, wherein the API is a microRNA comprising a nucleic acid sequence at least 95% identical to an icloRNA sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. In some embodiments, the PD-L1 binding peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 60-65. The anti-PD-L1 isoform A antibody and its antigen-binding fragment may be humanized. The anti-PD-L1 isoform C antibody and its antigen-binding fragment may be humanized. In some embodiments, the microRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. Methods for treating cancer in mammalian subjects requiring such treatment are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject. In some embodiments, the cancer is selected from the group consisting of lung cancer, bladder cancer, and kidney cancer.
[0135] According to other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group comprising (i) an IL4R-binding peptide having an amino acid sequence at least 90% identical to SEQ ID NO: 66, (ii) an anti-IL4R isoform A antibody or its antigen-binding fragment, and (iii) an anti-IL4R isoform A antibody or its antigen-binding fragment coupled to an API, wherein the API is a microRNA having a nucleic acid sequence at least 95% identical to an icloRNA sequence selected from the group comprising SEQ ID NO: 94 and SEQ ID NO: 98. In some embodiments, the IL4R-binding peptide is SEQ ID NO: 66. The anti-IL4R isoform A antibody and its antigen-binding fragment may be humanized. The anti-IL4R isoform C antibody and its antigen-binding fragment may be humanized. In some embodiments, the microRNA consists of a nucleic acid sequence selected from the group comprising SEQ ID NO: 94 and SEQ ID NO: 98. Methods for reducing inflammation in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject.
[0136] According to other embodiments, the therapeutic compound of the present invention comprises a first protein, the first protein being selected from the group comprising (i) a TNFR1-binding peptide having an amino acid sequence at least 90% identical to SEQ ID NO: 68, and (ii) an anti-TNFR1 antibody or its antigen-binding fragment coupled to an API, wherein the API is a microRNA having a nucleic acid sequence at least 95% identical to an icloRNA sequence selected from the group comprising SEQ ID NOs: 99-102. In some embodiments, the TNFR1-binding peptide is SEQ ID NO: 68. The anti-TNFR1 antibody and its antigen-binding fragment may be humanized. In some embodiments, the microRNA consists of a nucleic acid sequence selected from the group comprising SEQ ID NOs: 99-102. Methods for reducing inflammation in mammalian subjects requiring it are also provided, the methods comprising administering a therapeutically effective amount of the therapeutic compound to the mammalian subject.
[0137] Pharmaceutical composition and administration method
[0138] The therapeutic compounds described herein can be formulated into pharmaceutical compositions using methods available in the art and methods disclosed herein. Any of the therapeutic compounds disclosed herein can be provided in a suitable pharmaceutical composition and administered by a suitable route of administration.
[0139] The methods provided herein include administering a pharmaceutical composition containing at least one therapeutic compound described herein, either alone or in combination with one or more suitable pharmaceutically acceptable carriers, such as diluents or adjuvants.
[0140] In clinical practice, the therapeutic compounds provided herein may be administered by any conventional route, particularly orally, parenterally, rectally, or by inhalation (e.g., in the form of an aerosol).
[0141] For oral administration, liquid compositions may be pharmaceutically acceptable suspensions, emulsions, syrups, and elixirs containing an inert diluent such as water or liquid paraffin. These compositions may also contain substances other than diluents, such as wetting products, sweetening products, or flavoring products.
[0142] Compositions for parenteral administration may be emulsions or sterile solutions. Propylene glycol, polyethylene glycol, vegetable oils, especially olive oil, or organic esters for injection, such as ethyl oleate, may be used as solvents or vehicles. These compositions may also contain adjuvants, particularly wetting agents, isotonic agents, emulsifiers, dispersants, and stabilizers. Sterilization can be carried out by several methods, for example, using bacteriological filters or by radiation.
[0143] In certain embodiments, the compositions provided herein are pharmaceutical compositions or single-unit dosage forms. The pharmaceutical compositions and single-unit dosage forms provided herein comprise a prophylactic or therapeutically effective amount of the therapeutic compound provided herein, and typically one or more pharmaceutically acceptable carriers or excipients. In specific embodiments, the term “pharmaceutically acceptable” in this context means approved by a federal or state regulatory agency, or listed in the United States Pharmacopeia or other generally recognized pharmacopoeia for use in animals, more specifically in humans. The term “carrier” includes diluents, adjuvants (e.g., Freund’s adjuvants (complete and incomplete)), excipients, or vehicles administered with the therapeutic agent. Such pharmaceutical carriers may be sterile liquids such as water. When the pharmaceutical composition is administered intravenously, water can be used as a carrier. Saline solutions and aqueous solutions of dextrose and glycerol can also be used as liquid carriers, particularly for injections. Examples of suitable pharmaceutical carriers are described in “Remington’s Pharmaceutical Sciences” by E.W. Martin.
[0144] Typical pharmaceutical compositions and dosage forms contain one or more excipients. Suitable excipients are well known to those skilled in the art of pharmaceuticals, and non-limiting examples of suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, wheat flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, and ethanol. Whether a particular excipient is suitable for incorporation into a pharmaceutical composition or dosage form depends on various factors well known in the art, including but not limited to the method by which the dosage form is administered to the target and the specific active ingredient in the dosage form. Compositions or single-unit dosage forms may also contain small amounts of wetting or emulsifying agents or pH buffers, if desired.
[0145] Further, we provide pharmaceutical compositions and dosage forms comprising one or more compounds that reduce the rate at which the active ingredient degrades. Such compounds, referred to herein as “stabilizers,” include, but are not limited to, antioxidants such as ascorbic acid, pH buffers, or salt buffers.
[0146] Pharmaceutical compositions and single-unit dosage forms can take the form of solutions, suspensions, emulsions, etc. The formulation must be suitable for the mode of administration. In certain embodiments, the pharmaceutical composition or single-unit dosage form is sterile and suitable for administration to mammalian subjects.
[0147] Pharmaceutical compositions are formulated to be compatible with their intended route of administration. Examples of routes of administration include, but are not limited to, parenteral administration, such as intravenous, intradermal, subcutaneous, intramuscular, subcutaneous, oral, buccal, sublingual, inhalation, intranasal, transdermal, topical, transmucosal, intratumoral, synovial, and rectal administration. In certain embodiments, the composition is formulated according to routine procedures as a pharmaceutical composition suitable for intravenous, subcutaneous, intramuscular, oral, intranasal, or topical administration to humans. In one embodiment, the pharmaceutical composition is formulated according to routine procedures for subcutaneous administration to humans. Typically, the composition for intravenous administration is a solution in a sterile isotonic aqueous buffer. If necessary, the composition may also contain a solubilizer and a local anesthetic such as lignocaine to relieve pain at the injection site.
[0148] In certain embodiments, parenteral dosage forms are provided. Parenteral dosage forms can be administered to a subject by a variety of routes, including but not limited to subcutaneous, intravenous (including bolus injection), intramuscular, and intra-arterial. Since these administrations typically bypass the subject's natural defenses against contaminants, parenteral dosage forms are typically sterile or can be sterilized before administration to the subject. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dried products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions.
[0149] Suitable vehicles that can be used to provide parenteral dosage forms are well known to those skilled in the art. Examples include, but are not limited to, water for injection (USP); aqueous vehicles such as sodium chloride injection, Ringer's solution injection, dextrose injection, dextrose and sodium chloride injection, and lactated Ringer's solution injection; and, but are not limited to, water-miscible vehicles such as ethyl alcohol, polyethylene glycol, and polypropylene glycol.
[0150] Compounds that increase the solubility of one or more of the active ingredients disclosed herein can also be incorporated into parenteral dosage forms.
[0151] Example 1: Construction of a PD-L1-binding peptide-siRNA conjugate
[0152] PD-L1-binding peptide-siRNA conjugates were prepared using azide and DBCO click chemistry. Azide-functionalized PD-L1-binding peptide (SEQ ID NO: 60) ((azidoacetic acid)-NYSKPTDRQYHF) and anti-PD-L1 siRNA (having a dibenzocyclooctin (DBCO)-functionalized sense strand (SEQ ID NO: 12) (GACUCAAGAUGGAACCUGAdTdT-[DBCO]) and a Cy5.5-labeled antisense strand (SEQ ID NO: 13) (dTdTCUGAGUUCUACCUUGGACU-Cy5.5)) were mixed in a 2:1 molar ratio. 10 μl of 100 μM Cy5.5-labeled siRNA was mixed with 2 nmol of azide-functionalized PD-L1-binding peptide in RNAse-free water to a total volume of 10.33 μl, and incubated in a thermomixer at 1100 rpm for 2 hours at 37°C.
[0153] Following incubation, conjugation was confirmed via a 3% TBE agarose gel (visualized using SYBR-safe) and a 16% SDS PAGE gel (stained with ethidium bromide). As shown in Figure 1, this reaction yielded the desired PD-L1-binding peptide-siRNA conjugate.
[0154] Example 2: The PD-L1-binding peptide-siRNA conjugate specifically binds to PD-L1.
[0155] The inventors tested whether the PD-L1-binding peptide-siRNA conjugate of Example 1 could specifically bind to PD-L1 expressed by CT26.CL25 cells by incubating the PD-L1-binding peptide-siRNA conjugate of Example 1 with CT26.CL25 cells that were either pre-treated with an anti-PD-L1 antibody or not. As a control, CT26.CL25 cells were incubated with the unconjugated anti-PD-L1 siRNA of Example 1.
[0156] Here, 2 ml of CT26.CL25 cells (5 × 10) 6Cells (1 / ml) were seeded into each of the four dishes. 24 hours after seeding, and 1 hour before treatment with the conjugate of Example 1, one dish was pre-treated with 1 ml of anti-PD-L1 antibody (InVivoMAb anti-mouse PD-L1, BioXCell catalog number BE0101) at a concentration of 1 mg / ml. After incubation with the antibody, the pre-treated cells were incubated with 1 ml (200 nM) of the conjugate of Example 1 at 4°C for 30 minutes. Simultaneously, an untreated dish was incubated in the same manner as the conjugate of Example 1, and another untreated dish was incubated in the same manner as the unconjugated anti-PD-L1 siRNA of Example 1.
[0157] Next, the cells were fixed with 4% paraformaldehyde (PFA) for 10 minutes, followed by two washes with DPBS. Then, the nuclei were stained using Hoechst 33342 (blue in Figure 2), and the cells were examined for Cy5.5 fluorescence (red in Figure 2).
[0158] As shown in Figure 2, untreated cells do not show Cy5.5 fluorescence, but cells treated only with the conjugate from Example 1 ("Pep-siRNA") show significant Cy5.5 fluorescence. However, cells pretreated with the conjugate from Example 1, and cells treated only with the unconjugated Cy5.5-labeled siRNA from Example 1, show very low levels of Cy5.5 fluorescence.
[0159] These results demonstrate that the conjugate in Example 1 specifically binds to PD-L1 on CT26.CL25 cells, and that this binding can be blocked by an anti-PD-L1 antibody. Furthermore, these results suggest that the binding is due to the PD-L1 binding peptide in the conjugate, rather than to siRNA.
[0160] Example 3: The PD-L1-binding peptide-siRNA conjugate undergoes internal translocation after binding to PD-L1.
[0161] CT26.CL25 cells were incubated with either the PD-L1-binding peptide-siRNA conjugate from Example 1 or the unconjugated Cy5.5-labeled siRNA from Example 1, as described in Example 2. After incubation for 9, 18, and 24 hours, the cells were fixed with 4% paraformaldehyde (PFA) for 10 minutes and washed twice with DPBS.
[0162] B16F10 cells were also incubated with either the PD-L1-binding peptide-siRNA conjugate from Example 1 or the unconjugated Cy5.5-labeled siRNA from Example 1, and similarly fixed after 18 and 24 hours of incubation.
[0163] The nuclei were stained with Hoechst 33342 (blue in Figures 3 and 4), and the cells were examined for Cy5.5 fluorescence (red in Figures 3 and 4).
[0164] As shown in the figures, specifically Figures 3 and 4, CT26.CL25 and B16F10 cells treated with the conjugate of Example 1 internally transported the conjugate, and the amount of internal transport increased with increasing incubation time. In contrast, CT26.CL25 and B16F10 cells treated with unconjugated Cy5.5-labeled siRNA showed significantly less Cy5.5 fluorescence and much less siRNA internal transport.
[0165] Example 4: PD-L1-binding peptide-siRNA conjugate silences PD-L1 mRNA and PD-L1 protein expression.
[0166] CT26.CL25 cells were incubated with the PD-L1-binding peptide-siRNA conjugate from Example 1, as described in Example 2. After 24 hours, RNA was extracted from the cells using the Qiagen RNeasy Plus kit according to the manufacturer's protocol. RNA was also extracted from untreated CT26.CL25 cells.
[0167] After RNA extraction, cDNA was prepared using oligodT(20mer) (SEQ ID NO: 127) and the Bioneer RT-PCR kit.
[0168] qRT-PCR was also performed on the extracted RNA using SYBR-green from Enzynomics. Six qRT-PCR reactions were performed for each sample.
[0169] GAPDH expression was used as a control. The following primers were used for both qRT-PCR and RT-PCR of GAPDH and PD-L1 (shown in the gel in Figure 5): a. GAPDH:CCACCCAGAAGACTGTGGAT (SEQ ID NO: 33) and CACATTGGGGGTAGGAACAC (SEQ ID NO: 34). b. PD-L1: GCTCCAAAGGACTTGTACGTG (SEQ ID NO: 103) and TGATCTGAAGGGCAGCATTTC (SEQ ID NO: 104).
[0170] For the gel used to analyze the RT-PCR products, a 1% TBE gel was used to visualize the RT-PCR bands. The RT-PCR procedure was as follows: initial denaturation at 95°C for 5 minutes, denaturation at 95°C for 10 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 15 seconds, and final extension at 72°C for 30 seconds (GAPDH for 20 cycles, PD-L1 for 30 cycles).
[0171] As seen in the gel in Figure 5, cells treated with the conjugate from Example 1 showed less PD-L1 mRNA expression compared to untreated control cells, as evidenced by a fainter RT-PCR cDNA band. No difference in band intensity was observed for the GAPDH RT-PCR product.
[0172] Furthermore, the qRT-PCR results shown in Figure 5 demonstrate a significant reduction in PD-L1 expression in conjugate-treated cells compared to untreated cells, indicating that the conjugate from Example 1 can silence PD-L1 RNA expression in CT26.CL25 cells after internal translocation.
[0173] Finally, as shown in Figure 7, CT6.CL25 cells treated with the conjugate (Pep-siR) of Example 1 express less PD-L1 protein than untreated CT6.CL25 cells and CT6.CL25 cells treated with only the siRNA (siR) of the conjugate of Example 1, as measured by Western blotting.
[0174] Example 5: Treatment with a PD-L1-binding peptide-siRNA conjugate reduces anti-PD-L1 antibody binding to 4T1 cells more effectively than treatment with the PD-L1-binding peptide alone.
[0175] 2 ml of 4T1 cells (a breast cancer cell line derived from mammary gland tissue of the mouse BALB / c strain) were divided into 2.5 × 10⁶ cells. 6 Cells were seeded in each well of a 6-well plate at a concentration of cells / ml. After 24 hours, cells were treated with either 1 ml (500 pmol / ml) of the PD-L1 binding peptide-siRNA conjugate from Example 1 or 1 ml (500 pmol / ml) of the unconjugated PD-L1 binding protein (SEQ ID NO: 60) ((azidoacetate)-NYSKPTDRQYHF), and incubated at 37°C for 48 hours. Untreated cells were used as a control.
[0176] After incubation, cells were detached from the plate using TE. Then, the cells were washed, and each treatment group and control were treated with 10 units of DPBS. 5 The cells were resuspended at a concentration of cells / ml.
[0177] Next, each group of cells was treated with allophycocyanin (APC)-labeled anti-PD-L1 mouse monoclonal antibody (BioLegend catalog number 124312). For each treatment group, 10 μl of a 1:500 dilution of APC-labeled anti-PD-L1 antibody was added to 100 μl of resuspended cells, and the cells were incubated at 4°C for 30 minutes in 110 μl.
[0178] After incubation, the cells were centrifuged and resuspended twice in [amount of medium] to wash away unbound antibodies.
[0179] Next, each cell group and the control were analyzed using fluorescence-activated cell sorting (638 nm laser, channel 660 / 10 nm). The results are shown in Figure 6. As can be seen from the figure, treatment of 4T1 cells with PD-L1-binding peptide reduces subsequent binding of APC-labeled antibody compared to the untreated control, and treatment with PD-L1-binding protein blocks PD-L1 on the cell surface and / or reduces the amount of PD-L1 on the cell surface via receptor-mediated endocytosis.
[0180] On the other hand, treatment with a PD-L1-binding peptide-siRNA conjugate significantly reduced subsequent APC-labeled antibody binding compared to both the untreated control and the PD-L1-binding protein-treated group. The difference in the percentage of APC-labeled antibody binding strongly suggests that, apart from blocking PD-L1 on the cell surface and / or reducing the amount of PD-L1 on the cell surface by receptor-mediated endocytosis, the conjugate also silences PD-L1 expression through RNA interference.
[0181] Example 6: Construction of an EGFR-binding peptide-siRNA conjugate
[0182] An EGFR-binding peptide-siRNA conjugate was prepared in the same manner as described in Example 1. An azide-functionalized EGFR-binding peptide ((azidoacetic acid)-YHWYGYTPQNVI (SEQ ID NO: 119)) and an anti-EGFRsiRNA (having a dibenzocyclooctin (DBCO)-functionalized sense strand (SEQ ID NO: 120) (AUAGGCAUUGGUGAAUUUAAAGAdCdA-[DBCO]) and an antisense strand (SEQ ID NO: 121) (UGUCUUUAAAUUCACCAAUGCCUAUGC)) were mixed in a 2:1 molar ratio. 10 μl of siRNA at a concentration of 100 μM was mixed with 2 nmol of azide-functionalized EGFR-binding peptide in RNAse-free water to a total volume of 10.33 μl, and incubated in a thermomixer at 1100 rpm for 2 hours at 37°C.
[0183] After incubation, conjugation was confirmed via 3% TBE agarose gel (visualized using SYBR-safe) and 16% SDS PAGE gel (stained with ethidium bromide).
[0184] Example 7: EGFR-binding peptide-siRNA conjugate that specifically binds to EGFR
[0185] The inventors tested whether the EGFR-binding peptide-siRNA conjugate of Example 6 could specifically bind to EGFR expressed by A549 cells by incubating the EGFR-binding peptide-siRNA conjugate of Example 6 with A549 cells. As a control, A549 cells were incubated with the unconjugated anti-EGFR siRNA of Example 6.
[0186] A549 cells were treated with either the EGFR-binding peptide conjugate siRNA of Example 6 or the unconjugate EGFR siRNA of Example 6, each stained with the nucleic acid staining dye YOYO-1, at a concentration of 200 nM.
[0187] After 30 minutes, the cells were fixed with 4% paraformaldehyde (PFA) for 10 minutes, followed by two washes with DPBS. The nuclei were then stained using Hoechst 33342, and the cells were tested for YOYO-1 staining.
[0188] As shown in Figure 8, untreated cells (control) and cells treated with siRNA alone (siRNA) do not show YOYO-1 staining, whereas cells treated with the conjugate of Example 6 (Pep-siR) show significant YOYO-1 staining.
[0189] These results demonstrate that the conjugate in Example 6 specifically binds to EGFR in A549 cells.
[0190] Example 8: EGFR-binding peptide-siRNA conjugate silences EGFR mRNA and EGFR protein expression.
[0191] A549 cells were incubated with the EGFR-binding peptide-siRNA conjugate from Example 6, similar to the method used for the PD-L1-binding peptide-siRNA conjugate in Example 2. After 24 hours, RNA was extracted from the cells using the Qiagen RNeasy Plus kit according to the manufacturer's protocol. RNA was also extracted from untreated A549 cells.
[0192] After RNA extraction, cDNA was prepared using oligodT(20mer) (SEQ ID NO: 127) and the Bioneer RT-PCR kit.
[0193] qRT-PCR was also performed on the extracted RNA using SYBR-green from Enzynomics. Six qRT-PCR reactions were performed for each sample.
[0194] GAPDH expression was used as a control. The following primers were used for both qRT-PCR and RT-PCR of GAPDH and EGFR: a. GAPDH:CCACCCAGAAGACTGTGGAT (SEQ ID NO: 33) and CACATTGGGGGTAGGAACAC (SEQ ID NO: 34). b.EGFR:TCCCTCAGCCACCCATATGTAC (Sequence ID 122) and GTCTCGGGCCATTTTGGAGAATCC (Sequence ID 123).
[0195] Relative expression was determined by gel electrophoresis. For the gel used to analyze the RT-PCR products, a 1% TBE gel was used to visualize the RT-PCR bands. The RT-PCR procedure was as follows: initial denaturation at 95°C for 5 minutes, denaturation at 95°C for 10 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 15 seconds, and final extension at 72°C for 30 seconds (GAPDH: 20 cycles, PD-L1: 30 cycles).
[0196] As shown in the qRT-PCR bar graph in Figure 9, cells treated with the conjugate of Example 6 expressed less EGFR mRNA than untreated cells and cells treated with non-conjugated EGFR siRNA, demonstrating that the conjugate of Example 6 silences EGFR RNA expression in A549 cells.
[0197] Furthermore, as shown in Figure 10, when determined by Western blotting, A549 cells treated with the conjugate of Example 6 (Pep-siR) express less EGFR protein than untreated A549 cells and A549 cells treated only with the siRNA (siR) of the conjugate of Example 6.
[0198] Various embodiments of the present invention may be characterized by potential claims enumerated in subsequent paragraphs (and before the actual claims provided at the end of this application). These potential claims form part of the description of this application. The subject matter of the following potential claims may be presented as actual claims in subsequent proceedings, including this application or any application claiming priority based on this application. The inclusion of such potential claims should not be interpreted as meaning that the actual claims do not cover the subject matter of the potential claims. Accordingly, a decision not to present these potential claims in subsequent proceedings should not be interpreted as an offering of the subject matter to the public.
[0199] While not limiting, potentially patentable subject matter (marked with the letter "P" to avoid confusion with the actual claims presented below) includes: P1. A therapeutic compound: A conjugate configured to bind to a second protein expressed on the surface of a target cell, wherein the conjugate comprises a conjugate containing a first protein coupled to an API, The conjugate is configured to bind to the second protein expressed on the surface of the target cell in a manner that inhibits the activity of the second protein. The conjugate is further configured to be internally transported by the target cell once it binds to the second protein expressed on the surface of the target cell. The API is configured to be released from the conjugate after the conjugate has been internally transported by the target cell. The API is further configured to reduce the expression of the second protein expressed on the surface of the target cell after it has been released from the conjugate, thereby further inhibiting the activity of the second protein. As a result, the conjugate and the API synergistically inhibit the activity of the second protein, thereby providing a therapeutic compound. P2. The therapeutic compound according to the potential claim P1, wherein the API is coupled to the first protein by a linker. P3. The therapeutic compound according to the potential claim P2, wherein the linker is a cleavable linker. P4. The therapeutic compound according to any one of the preceding potential claims, wherein the second protein comprises a sequence selected from the group consisting of SEQ ID NOs: 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 35, 36, 37, and 38. P5. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 35, 36, 37, and 38. P6. The therapeutic compound according to any one of the preceding potential claims, wherein the API is selected from the group consisting of siRNA, antisense oligonucleotides, and microRNAs. P7. The second protein is PD-1 (SEQ ID NO: 18), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 1, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P8. The second protein consists of a second protein amino acid sequence that is at least 90% identical to PD-1 (SEQ ID NO: 18), the API is an siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 1, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P9. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is PD-1 (SEQ ID NO: 18), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to SEQ ID NO: 39. P10. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is PD-1 (SEQ ID NO: 18), the API is a microRNA, and the microRNA is SEQ ID NO: 39. P11. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to PD-1 (SEQ ID NO: 18), the API is a microRNA, the microRNA comprises a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to SEQ ID NO: 39. P12. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein consists of a second protein amino acid sequence that is at least 90% identical to PD-1 (SEQ ID NO: 18), the API is a microRNA, and the microRNA consists of SEQ ID NO: 39. P13. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is PD-1 (SEQ ID NO: 18), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 1. P14. The therapeutic compound according to any one of the potential claims P1-3 and P7-13, wherein the first protein is selected from the group consisting of an anti-PD-1 antibody and its antigen-binding fragment. P15. The therapeutic compound according to any one of the potential claims P1-3 and P7-13, wherein the first protein is a PD-1 binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NOs: 40 and SEQ ID NOs: 41. P16. The therapeutic compound according to any one of the potential claims P1-3 and P7-13, wherein the first protein is a PD-1 binding peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 40 and SEQ ID NOs: 41. P17. The second protein is CD38 (SEQ ID NO: 19), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 2, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P18. The second protein consists of a second protein amino acid sequence that is at least 90% identical to CD38 (SEQ ID NO: 19), the API is an siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 2, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P19. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is CD38 (SEQ ID NO: 19), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 42 to 44. P20. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to CD38 (SEQ ID NO: 19), the API is a microRNA, the microRNA comprises a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 42 to 44. P21. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is CD38 (SEQ ID NO: 19), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 42 to 44. P22. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein consists of a second protein amino acid sequence that is at least 90% identical to CD38 (SEQ ID NO: 19), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 42 to 44. P23. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is CD38 (SEQ ID NO: 19), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 2. P24. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to CD38 (SEQ ID NO: 19), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 2. P25. The therapeutic compound according to any one of the potential claims P1-3 and P17-24, wherein the first protein is selected from the group consisting of an anti-CD38 antibody and its antigen-binding fragment. P26. The therapeutic compound according to any one of the potential claims P1-3 and P17-24, wherein the first protein is a CD38-binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to SEQ ID NO: 45. P27. The therapeutic compound according to any one of the potential claims P1-3 and P17-24, wherein the first protein is a CD38-binding peptide consisting of SEQ ID NO: 45. P28. The second protein is HER2 (SEQ ID NO: 20), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 3, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P29. The second protein consists of a second protein amino acid sequence that is at least 90% identical to HER2 (SEQ ID NO: 20), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 3, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P30. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is HER2 (SEQ ID NO: 20), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 73 to 78. P31. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein consists of a second protein amino acid sequence that is at least 90% identical to HER2 (SEQ ID NO: 20), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 73 to 78. P32. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is HER2 (SEQ ID NO: 20), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 73 to 78. P33. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein consists of a second protein amino acid sequence that is at least 90% identical to HER2 (SEQ ID NO: 20), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 73 to 78. P34. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is HER2 (SEQ ID NO: 20), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 3. P35. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein consists of a second protein amino acid sequence that is at least 90% identical to HER2 (SEQ ID NO: 20), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 3. P36. The therapeutic compound according to any one of the potential claims P1-3 and P28-35, wherein the first protein is selected from the group consisting of an anti-HER2 antibody and its antigen-binding fragment. P37. The therapeutic compound according to any one of the potential claims P1-3 and P28-35, wherein the first protein is a HER2-binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NOs: 46-59. P38. The therapeutic compound according to any one of the potential claims P1-3 and P28-35, wherein the first protein is a HER2-binding peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs. 46-59. P39. The second protein is PD-L1 isoform A (SEQ ID NO: 21), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 4, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P40. The second protein consists of a second protein amino acid sequence that is at least 90% identical to PD-L1 isoform A (SEQ ID NO: 21), the API is an siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 4, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P41. The second protein is PD-L1 isoform C (SEQ ID NO: 22), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 5, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P42. The second protein consists of a second protein amino acid sequence that is at least 90% identical to PD-L1 isoform C (SEQ ID NO: 22), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 5, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P43. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is PD-L1 isoform A (SEQ ID NO: 21), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. P44. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to PD-L1 isoform A (SEQ ID NO: 21), the API is a microRNA, the microRNA comprises a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. P45. The therapeutic compound according to any one of the potential claims P1 to 3, wherein the second protein is PD-L1 isoform A (SEQ ID NO: 21), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. P46. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to PD-L1 isoform A (SEQ ID NO: 21), and the API is a microRNA comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. P47. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is PD-L1 isoform C (SEQ ID NO: 22), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. P48. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to PD-L1 isoform C (SEQ ID NO: 22), the API is a microRNA, the microRNA comprises a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. P49. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is PD-L1 isoform C (SEQ ID NO: 22), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. P50. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein consists of a second protein amino acid sequence that is at least 90% identical to PD-L1 isoform C (SEQ ID NO: 22), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97. P51. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is PD-L1 isoform A (SEQ ID NO: 21), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 4. P52. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to PD-L1 isoform A (SEQ ID NO: 21), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 4. P53. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is PD-L1 isoform C (SEQ ID NO: 22), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 5. P54. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to PD-L1 isoform C (SEQ ID NO: 22), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 5. P55. The therapeutic compound according to any one of the potential claims P1-3, P39, P40, P43, P44, P45, P46, P51, and P52, wherein the first protein is selected from the group consisting of an anti-PD-L1 isoform A antibody and its antigen-binding fragment. P56. The therapeutic compound according to any one of the potential claims P1-3, P41, P42, P47, P48, P49, P50, P53, and P54, wherein the first protein is selected from the group consisting of an anti-PD-L1 isoform C antibody and its antigen-binding fragment. P57. The therapeutic compound according to any one of the potential claims P1-3 and P39-53, wherein the first protein is a PD-L1 binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NOs. 60-65. P58. The therapeutic compound according to any one of the potential claims P1-3 and P39-53, wherein the first protein is a PD-L1 binding peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs. 60-65. P59. The second protein is IL4R isoform A (SEQ ID NO: 23), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 6, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P60. The second protein consists of a second protein amino acid sequence that is at least 90% identical to IL4R isoform A (SEQ ID NO: 23), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 6, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P61. The second protein is IL4R isoform C (SEQ ID NO: 24), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 7, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P62. The second protein consists of a second protein amino acid sequence that is at least 90% identical to IL4R isoform C (SEQ ID NO: 24), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 7, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P63. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is IL4R isoform A (SEQ ID NO: 23), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 94 and 98. P64. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to IL4R isoform A (SEQ ID NO: 23), the API is a microRNA, the microRNA comprises a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 94 and 98. P65. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is IL4R isoform A (SEQ ID NO: 23), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 94 and 98. P66. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein consists of a second protein amino acid sequence that is at least 90% identical to IL4R isoform A (SEQ ID NO: 23), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 94 and 98. P67. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is IL4R isoform C (SEQ ID NO: 24), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 94 and 98. P68. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to IL4R isoform C (SEQ ID NO: 24), the API is a microRNA, the microRNA comprises a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 94 and 98. P69. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is IL4R isoform C (SEQ ID NO: 24), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 94 and 98. P70. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein consists of a second protein amino acid sequence that is at least 90% identical to IL4R isoform C (SEQ ID NO: 24), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 94 and 98. P71. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is IL4R isoform A (SEQ ID NO: 23), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 6. P72. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to IL4R isoform A (SEQ ID NO: 23), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 6. P73. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is IL4R isoform C (SEQ ID NO: 24), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 7. P74. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to IL4R isoform C (SEQ ID NO: 24), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 7. P75. The therapeutic compound according to any one of the potential claims P1-3, P59, P60, P63, P64, P65, P66, P71, and P72, wherein the first protein is selected from the group consisting of an anti-IL4R isoform A antibody and its antigen-binding fragment. P76. The therapeutic compound according to any one of the potential claims P1-3, P61, P62, P67, P68, P69, P70, P73, and P74, wherein the first protein is selected from the group consisting of an anti-IL4R isoform C antibody and its antigen-binding fragment. P77. The therapeutic compound according to any one of the potential claims P1-3 and P59-74, wherein the first protein is an IL4R-binding peptide having an amino acid sequence that is at least 90% identical to SEQ ID NO: 66. P78. The therapeutic compound according to any one of the potential claims P1-3 and P59-74, wherein the first protein is an IL4R-binding peptide consisting of SEQ ID NO: 66. P79. The second protein is IL6R isoform 1 (SEQ ID NO: 25), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 8, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P80. The second protein consists of a second protein amino acid sequence that is at least 90% identical to IL6R isoform 1 (SEQ ID NO: 25), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 8, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P81. The second protein is IL6R isoform 2 (SEQ ID NO: 26), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 9, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P82. The second protein consists of a second protein amino acid sequence that is at least 90% identical to IL6R isoform 2 (SEQ ID NO: 26), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 9, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P83. The second protein is IL6R isoform 3 (SEQ ID NO: 27), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 10, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P84. The second protein consists of a second protein amino acid sequence that is at least 90% identical to IL6R isoform 3 (SEQ ID NO: 27), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 10, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P85. The second protein is IL6R isoform 4 (SEQ ID NO: 29), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the sequence of nucleotides in SEQ ID NO: 28, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P86. The second protein consists of a second protein amino acid sequence that is at least 90% identical to IL6R isoform 4 (SEQ ID NO: 29), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the sequence of nucleotides in SEQ ID NO: 28, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P87. The second protein is IL6R isoform 5 (SEQ ID NO: 31), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 30, (b) The sense RNA strand is 19 to 29 nucleotides in length and is complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The double-stranded RNA molecule has a double-stranded region 14 to 29 nucleotides in length and a 3' overhang region 0 to 5 nucleotides in length, and is a therapeutic compound according to any one of the potential claims P1 to P3. P88. The second protein consists of a second protein amino acid sequence that is at least 90% identical to IL6R isoform 5 (SEQ ID NO: 31), the API is siRNA, and the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) The antisense RNA strand is 19 to 29 nucleotides in length and is complementary to consecutive nucleotides of SEQ ID NO: 30, (b) The sense RNA strand is 19 to 29 nucleotides in length and is complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The double-stranded RNA molecule has a double-stranded region 14 to 29 nucleotides in length and a 3' overhang region 0 to 5 nucleotides in length, and is a therapeutic compound according to any one of the potential claims P1 to P3. P89. The second protein is IL6R isoform 1 (SEQ ID NO: 25), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides in length and is complementary to at least 15 consecutive nucleotides of SEQ ID NO: 8, and is a therapeutic compound according to any one of the potential claims P1 to P3. P90. The second protein consists of a second protein amino acid sequence that is at least 90% identical to IL6R isoform 1 (SEQ ID NO: 25), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides in length and is complementary to at least 15 consecutive nucleotides of SEQ ID NO: 8, and is a therapeutic compound according to any one of the potential claims P1 to P3. P91. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is IL6R isoform 2 (SEQ ID NO: 26), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 9. P92. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to IL6R isoform 2 (SEQ ID NO: 26), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 9. P93. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is IL6R isoform 3 (SEQ ID NO: 27), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 10. P94. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to IL6R isoform 3 (SEQ ID NO: 27), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 10. P95. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is IL6R isoform 4 (SEQ ID NO: 29), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 28. P96. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to IL6R isoform 4 (SEQ ID NO: 29), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 28. P97. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is IL6R isoform 5 (SEQ ID NO: 31), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 30. P98. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to IL6R isoform 5 (SEQ ID NO: 31), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 30. P99. The therapeutic compound according to any one of the potential claims P1-3, P79-80, and P89-90, wherein the first protein is selected from the group consisting of an anti-IL6R isoform 1 antibody and its antigen-binding fragment. P100. The therapeutic compound according to any one of the potential claims P1-3, P81-82, and P91-92, wherein the first protein is selected from the group consisting of an anti-IL6R isoform 2 antibody and its antigen-binding fragment. P101. The therapeutic compound according to any one of the potential claims P1-3, P83-84, and P93-94, wherein the first protein is selected from the group consisting of an anti-IL6R isoform 3 antibody and its antigen-binding fragment. P102. The therapeutic compound according to any one of the potential claims P1-3, P85-86, and P95-96, wherein the first protein is selected from the group consisting of an anti-IL6R isoform 4 antibody and its antigen-binding fragment. P103. The therapeutic compound according to any one of the potential claims P1-3, P87-88, and P97-98, wherein the first protein is selected from the group consisting of an anti-IL6R isoform 5 antibody and its antigen-binding fragment. P104. The therapeutic compound according to any one of the potential claims P1-3 and P79-98, wherein the first protein is an IL6R-binding peptide having an amino acid sequence that is at least 90% identical to SEQ ID NO: 67. P105. The therapeutic compound according to any one of the potential claims P1-3 and P79-98, wherein the first protein is an IL6R-binding peptide consisting of SEQ ID NO: 67. P106. The second protein is TNFR1 (SEQ ID NO: 32), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 11, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P107. The second protein consists of a second protein amino acid sequence that is at least 90% identical to TNFR1 (SEQ ID NO: 32), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 11, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P108. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is TNFR1 (SEQ ID NO: 32), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 99 to 102. P109. A therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to TNFR1 (SEQ ID NO: 32), the API is a microRNA, the microRNA comprises a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 99 to 102. P110. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is TNFR1 (SEQ ID NO: 32), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 99 to 102. P111. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein consists of a second protein amino acid sequence that is at least 90% identical to TNFR1 (SEQ ID NO: 32), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 99 to 102. P112. The therapeutic compound according to any one of potential claims P1 to P3, wherein the second protein is TNFR1 (SEQ ID NO: 32), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides in length, and is complementary to at least 15 consecutive nucleotides of SEQ ID NO: 11. P113. The therapeutic compound according to any one of potential claims P1 to P3, wherein the second protein consists of a second protein amino acid sequence that is at least 90% identical to TNFR1 (SEQ ID NO: 32), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides in length, and is complementary to at least 15 consecutive nucleotides of SEQ ID NO: 11. P114. The therapeutic compound according to any one of potential claims P1 to P3 and P68 to P71, wherein the first protein is selected from the group consisting of an anti-TNFR1 antibody and an antigen-binding fragment thereof. P115. The therapeutic compound according to any one of potential claims P1 to P3 and P106 to P113, wherein the first protein is a TNFR1-binding peptide consisting of an amino acid sequence that is at least 90% identical to SEQ ID NO: 68. P116. The therapeutic compound according to any one of potential claims P1 to P3 and P106 to P113, wherein the first protein is a TNFR1-binding peptide consisting of SEQ ID NO: 68. P117. The second protein is TNFR2 (SEQ ID NO: 35), the API is siRNA, and the siRNA is a double-stranded RNA molecule comprising an antisense RNA strand and a sense RNA strand, (a) the antisense RNA strand is 19 to 29 nucleotides in length and is complementary to consecutive nucleotides of SEQ ID NO: 14, (b) the sense RNA strand is 19 to 29 nucleotides in length and is complementary to 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P118. The second protein consists of a second protein amino acid sequence that is at least 90% identical to TNFR2 (SEQ ID NO: 35), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the sequence of nucleotides in SEQ ID NO: 14, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P1 to P3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P119. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein is TNFR2 (SEQ ID NO: 35), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 14. P120. The therapeutic compound according to any one of the potential claims P1 to P3, wherein the second protein comprises a second protein amino acid sequence that is at least 90% identical to TNFR2 (SEQ ID NO: 35), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 14. P121. The therapeutic compound according to any one of the potential claims P1-3 and P117-120, wherein the first protein is selected from the group consisting of an anti-TNFR2 antibody and its antigen-binding fragment. P122. The therapeutic compound according to any one of the potential claims P1-3 and P117-120, wherein the first protein is a TNFR2-binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NOs. 69-72. P123. The therapeutic compound according to any one of the potential claims P1-3 and P117-120, wherein the first protein is a TNFR2-binding peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs. 69-72. P124. A therapeutic compound: A conjugate configured to bind to a sodium-dependent glucose cotransporter expressed on the surface of a target cell, wherein the conjugate comprises a conjugate containing glucose coupled to an API, The conjugate is configured to bind to the sodium-dependent glucose cotransporter so as to cross the membrane of the target cell and be transported into the target cell. The API is configured to cross the membrane of the target cell, be transported into the target cell, and then be released from the conjugate. A therapeutic compound wherein the API is further configured to reduce the expression of the sodium-dependent glucose cotransporter expressed on the surface of the target cell after the API is released from the conjugate. P125. The therapeutic compound according to the potential claim P124, wherein the API is coupled to the glucose by a linker. P126. The therapeutic compound according to the potential claim P125, wherein the linker is a cleavable linker. P127. The therapeutic compound according to any one of the potential claims P124 to P126, wherein the API is selected from the group consisting of siRNA and antisense oligonucleotides. P128. The sodium-dependent glucose cotransporter is SGLT1 isoform 1 (SEQ ID NO: 36), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the sequence of nucleotides in SEQ ID NO: 15, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P124 to P126, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P129. The sodium-dependent glucose cotransporter has an amino acid sequence that is at least 90% identical to SGLT1 isoform 1 (SEQ ID NO: 36), the API is an siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the sequence of nucleotides in SEQ ID NO: 15, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P124 to P126, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P130. The therapeutic compound according to any one of the potential claims P124 to P126, wherein the sodium-dependent glucose cotransporter is SGLT1 isoform 1 (SEQ ID NO: 36), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 15. P131. The therapeutic compound according to any one of the potential claims P124 to P126, wherein the sodium-dependent glucose cotransporter has an amino acid sequence that is at least 90% identical to SGLT1 isoform 1 (SEQ ID NO: 36), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 15. P132. The sodium-dependent glucose cotransporter is SGLT1 isoform 2 (SEQ ID NO: 37), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the sequence of nucleotides in SEQ ID NO: 16, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P124 to P126, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P133. The sodium-dependent glucose cotransporter has an amino acid sequence that is at least 90% identical to SGLT1 isoform 2 (SEQ ID NO: 37), the API is an siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the sequence of nucleotides in SEQ ID NO: 16, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P124 to P126, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P134. The therapeutic compound according to any one of the potential claims P124 to P126, wherein the sodium-dependent glucose cotransporter is SGLT1 isoform 2 (SEQ ID NO: 37), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 16. P135. The therapeutic compound according to any one of the potential claims P124 to P126, wherein the sodium-dependent glucose cotransporter has an amino acid sequence that is at least 90% identical to SGLT1 isoform 2 (SEQ ID NO: 37), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 16. P136. The sodium-dependent glucose cotransporter is SGLT2 (SEQ ID NO: 38), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the sequence of nucleotides in SEQ ID NO: 17, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P124 to P126, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P137. The sodium-dependent glucose cotransporter has an amino acid sequence that is at least 90% identical to SGLT2 (SEQ ID NO: 38), the API is an siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the sequence of nucleotides in SEQ ID NO: 17, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to 14 to 29 nucleotides from the antisense RNA strand, (c) The therapeutic compound according to any one of the potential claims P124 to P126, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length. P138. The therapeutic compound according to any one of the potential claims P124 to P126, wherein the sodium-dependent glucose cotransporter is SGLT2 (SEQ ID NO: 38), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 17. P139. The therapeutic compound according to any one of the potential claims P124 to P126, wherein the sodium-dependent glucose cotransporter has an amino acid sequence that is at least 90% identical to SGLT2 (SEQ ID NO: 38), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO: 17. P140. A method for treating cancer in a mammalian subject requiring treatment for cancer, comprising administering to the mammalian subject a therapeutically effective amount of a potential therapeutic compound described in any one of claims P1 to P58. P141. A method for reducing inflammation in a mammalian subject requiring reduction of inflammation, comprising administering to the mammalian subject a therapeutically effective amount of a therapeutic compound described in any one of the potential claims P59 to P123. P142. A method for treating diabetes in a mammalian subject requiring treatment for diabetes, comprising administering to the mammalian subject a therapeutically effective amount of a therapeutic compound described in any one of the potential claims P124 to P139. P143. The method according to any one of the potential claims P140 to P142, wherein the mammal subject is a human. P144. A pharmaceutical composition comprising a therapeutic compound according to any one of the potential claims P1 to P139 and a pharmaceutically acceptable carrier.
[0200] Publications (including patent publications), websites, company names, books, manuals, articles, and scientific literature referenced herein are incorporated herein by reference in whole to the same extent that they establish knowledge available to those skilled in the art and are each incorporated by reference specifically and individually. Any inconsistency between any reference cited herein and any particular teaching herein shall be resolved for the sake of the latter.
[0201] The embodiments of the present invention described above are intended to be illustrative only. Numerous variations and modifications will be apparent to those skilled in the art. All such variations and modifications are intended to fall within the scope of the present invention as defined in the appended claims.
Claims
1. A therapeutic compound: A conjugate configured to bind to a second protein expressed on the surface of a target cell, wherein the conjugate comprises a conjugate containing a first protein coupled to an API, The conjugate is configured to bind to the second protein expressed on the surface of the target cell in a manner that inhibits the activity of the second protein. The conjugate is further configured to be internally transported by the target cell once it binds to the second protein expressed on the surface of the target cell. The API is configured to be released from the conjugate after the conjugate has been internally transported by the target cell. The API is further configured to reduce the expression of the second protein expressed on the surface of the target cell after it has been released from the conjugate, thereby further inhibiting the activity of the second protein. As a result, the conjugate and the API synergistically inhibit the activity of the second protein in a therapeutic compound.
2. The therapeutic compound according to claim 1, wherein the API is coupled to the first protein by a linker.
3. The therapeutic compound according to claim 2, wherein the linker is a cleavable linker.
4. The therapeutic compound according to any one of the preceding claims, wherein the second protein comprises a sequence selected from the group consisting of SEQ ID NOs: 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 35, 36, 37, and 38.
5. The therapeutic compound according to any one of the preceding claims, wherein the API is selected from the group consisting of siRNA, antisense oligonucleotides, and microRNAs.
6. The second protein is PD-1 (SEQ ID NO: 18), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 1, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
7. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is PD-1 (SEQ ID NO: 18), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to SEQ ID NO:
39.
8. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is PD-1 (SEQ ID NO: 18), the API is a microRNA, and the microRNA is SEQ ID NO:
39.
9. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is PD-1 (SEQ ID NO: 18), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
1.
10. The therapeutic compound according to any one of claims 1 to 3 and 6 to 9, wherein the first protein is selected from the group consisting of an anti-PD-1 antibody and its antigen-binding fragment.
11. The therapeutic compound according to any one of claims 1 to 3 and 6 to 9, wherein the first protein is a PD-1 binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NO: 40 and SEQ ID NO:
41.
12. The therapeutic compound according to any one of claims 1 to 3 and 6 to 9, wherein the first protein is a PD-1 binding peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 40 and SEQ ID NO:
41.
13. The second protein is CD38 (SEQ ID NO: 19), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of Sequence ID No. 2, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
14. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is CD38 (SEQ ID NO: 19), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 42 to 44.
15. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is CD38 (sequence number 19), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of sequence numbers 42 to 44.
16. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is CD38 (SEQ ID NO: 19), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
2.
17. The therapeutic compound according to any one of claims 1 to 3 and 13 to 16, wherein the first protein is selected from the group consisting of an anti-CD38 antibody and its antigen-binding fragment.
18. The therapeutic compound according to any one of claims 1 to 3 and 13 to 16, wherein the first protein is a CD38-binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to that of SEQ ID NO:
45.
19. The therapeutic compound according to any one of claims 1 to 3 and 13 to 16, wherein the first protein is a CD38-binding peptide consisting of SEQ ID NO:
45.
20. The second protein is HER2 (SEQ ID NO: 20), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 3, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
21. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is HER2 (SEQ ID NO: 20), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 73 to 78.
22. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is HER2 (SEQ ID NO: 20), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 73 to 78.
23. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is HER2 (SEQ ID NO: 20), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
3.
24. The therapeutic compound according to any one of claims 1 to 3 and 20 to 23, wherein the first protein is selected from the group consisting of an anti-HER2 antibody and its antigen-binding fragment.
25. The therapeutic compound according to any one of claims 1 to 3 and 20 to 23, wherein the first protein is a HER2-binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NOs: 46 to 59.
26. The therapeutic compound according to any one of claims 1 to 3 and 20 to 23, wherein the first protein is a HER2-binding peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 46 to 59.
27. The second protein is PD-L1 isoform A (SEQ ID NO: 21), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 4, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
28. The second protein is PD-L1 isoform C (SEQ ID NO: 22), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 5, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
29. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is PD-L1 isoform A (SEQ ID NO: 21), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97.
30. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is PD-L1 isoform A (SEQ ID NO: 21), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97.
31. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is PD-L1 isoform C (SEQ ID NO: 22), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97.
32. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is PD-L1 isoform C (SEQ ID NO: 22), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 39, 79-96, and 97.
33. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is PD-L1 isoform A (SEQ ID NO: 21), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
4.
34. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is PD-L1 isoform C (SEQ ID NO: 22), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
5.
35. The therapeutic compound according to any one of claims 1 to 3, 27, 29, 30, and 33, wherein the first protein is selected from the group consisting of an anti-PD-L1 isoform A antibody and its antigen-binding fragment.
36. The therapeutic compound according to any one of claims 1 to 3, 28, 31, 32, and 34, wherein the first protein is selected from the group consisting of an anti-PD-L1 isoform C antibody and its antigen-binding fragment.
37. The therapeutic compound according to any one of claims 1 to 3, 27, 28, 29, 30, 31, 32, 33, and 34, wherein the first protein is a PD-L1 binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NOs. 60 to 65.
38. The therapeutic compound according to any one of claims 1 to 3, 27, 28, 29, 30, 31, 32, 33, and 34, wherein the first protein is a PD-L1 binding peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs. 60 to 65.
39. The second protein is IL4R isoform A (SEQ ID NO: 23), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 6, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
40. The second protein is IL4R isoform C (SEQ ID NO: 24), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 7, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
41. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is IL4R isoform A (SEQ ID NO: 23), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 94 and 98.
42. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is IL4R isoform A (SEQ ID NO: 23), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 94 and 98.
43. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is IL4R isoform C (SEQ ID NO: 24), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 94 and 98.
44. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is IL4R isoform C (SEQ ID NO: 24), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 94 and 98.
45. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is IL4R isoform A (SEQ ID NO: 23), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
6.
46. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is IL4R isoform C (SEQ ID NO: 24), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
7.
47. The therapeutic compound according to any one of claims 1 to 3, 39, 41, 42, and 45, wherein the first protein is selected from the group consisting of an anti-IL4R isoform A antibody and its antigen-binding fragment.
48. The therapeutic compound according to any one of claims 1 to 3, 40, 43, 44, and 46, wherein the first protein is selected from the group consisting of an anti-IL4R isoform C antibody and its antigen-binding fragment.
49. The therapeutic compound according to any one of claims 1 to 3, 39, 40, 41, 42, 43, 44, 45, and 46, wherein the first protein is an IL4R-binding peptide having an amino acid sequence that is at least 90% identical to SEQ ID NO:
66.
50. The therapeutic compound according to any one of claims 1 to 3, 39, 40, 41, 42, 43, 44, 45, and 46, wherein the first protein is an IL4R-binding peptide comprising SEQ ID NO:
66.
51. The second protein is IL6R isoform 1 (SEQ ID NO: 25), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 8, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
52. The second protein is IL6R isoform 2 (SEQ ID NO: 26), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 9, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
53. The second protein is IL6R isoform 3 (SEQ ID NO: 27), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 10, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
54. The second protein is IL6R isoform 4 (SEQ ID NO: 29), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 28, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
55. The second protein is IL6R isoform 5 (SEQ ID NO: 31), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 30, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
56. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is IL6R isoform 1 (SEQ ID NO: 25), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
8.
57. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is IL6R isoform 2 (SEQ ID NO: 26), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
9.
58. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is IL6R isoform 3 (SEQ ID NO: 27), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
10.
59. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is IL6R isoform 4 (SEQ ID NO: 29), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
28.
60. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is IL6R isoform 5 (SEQ ID NO: 31), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
30.
61. The therapeutic compound according to any one of claims 1 to 3, 51, and 56, wherein the first protein is selected from the group consisting of an anti-IL6R isoform 1 antibody and its antigen-binding fragment.
62. The therapeutic compound according to any one of claims 1 to 3, 52, and 57, wherein the first protein is selected from the group consisting of an anti-IL6R isoform 2 antibody and its antigen-binding fragment.
63. The therapeutic compound according to any one of claims 1 to 3, 53, and 58, wherein the first protein is selected from the group consisting of an anti-IL6R isoform 3 antibody and its antigen-binding fragment.
64. The therapeutic compound according to any one of claims 1 to 3, 54, and 59, wherein the first protein is selected from the group consisting of an anti-IL6R isoform 4 antibody and its antigen-binding fragment.
65. The therapeutic compound according to any one of claims 1 to 3, 55, and 60, wherein the first protein is selected from the group consisting of an anti-IL6R isoform 5 antibody and its antigen-binding fragment.
66. The therapeutic compound according to any one of claims 1 to 3, 51, 52, 53, 54, 55, 56, 57, 58, 59, and 60, wherein the first protein is an IL6R-binding peptide having an amino acid sequence that is at least 90% identical to SEQ ID NO:
67.
67. The therapeutic compound according to any one of claims 1 to 3, 51, 52, 53, 54, 55, 56, 57, 58, 59, and 60, wherein the first protein is an IL6R-binding peptide consisting of SEQ ID NO:
67.
68. The second protein is TNFR1 (SEQ ID NO: 32), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 11, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
69. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is TNFR1 (SEQ ID NO: 32), the API is a microRNA, the microRNA consists of a nucleic acid sequence, and the nucleic acid sequence is at least 95% identical to a microRNA sequence selected from the group consisting of SEQ ID NOs: 99 to 102.
70. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is TNFR1 (SEQ ID NO: 32), and the API is a microRNA consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 99 to 102.
71. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is TNFR1 (SEQ ID NO: 32), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
11.
72. The therapeutic compound according to any one of claims 1 to 3 and 68 to 71, wherein the first protein is selected from the group consisting of an anti-TNFR1 antibody and its antigen-binding fragment.
73. The therapeutic compound according to any one of claims 1 to 3 and 68 to 71, wherein the first protein is a TNFR1-binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to SEQ ID NO:
68.
74. The therapeutic compound according to any one of claims 1 to 3 and 68 to 71, wherein the first protein is a TNFR1-binding peptide consisting of SEQ ID NO:
68.
75. The second protein is TNFR2 (SEQ ID NO: 35), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 14, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 1 to 3, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
76. The therapeutic compound according to any one of claims 1 to 3, wherein the second protein is TNFR2 (SEQ ID NO: 35), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
14.
77. The therapeutic compound according to any one of claims 1 to 3, 75, and 76, wherein the first protein is selected from the group consisting of an anti-TNFR2 antibody and its antigen-binding fragment.
78. The therapeutic compound according to any one of claims 1 to 3, 75, and 76, wherein the first protein is a TNFR2-binding peptide consisting of an amino acid sequence, and the amino acid sequence is at least 90% identical to a peptide sequence selected from the group consisting of SEQ ID NOs: 69 to 72.
79. The therapeutic compound according to any one of claims 1 to 3, 75, and 76, wherein the first protein is a TNFR2-binding peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs. 69 to 72.
80. A therapeutic compound: A conjugate configured to bind to a sodium-dependent glucose cotransporter expressed on the surface of a target cell, wherein the conjugate comprises a conjugate containing glucose coupled to an API, The conjugate is configured to bind to the sodium-dependent glucose cotransporter so as to cross the membrane of the target cell and be transported into the target cell. The API is configured to cross the membrane of the target cell, be transported into the target cell, and then be released from the conjugate. A therapeutic compound wherein the API is further configured to reduce the expression of the sodium-dependent glucose cotransporter expressed on the surface of the target cell after the API is released from the conjugate.
81. The therapeutic compound according to claim 80, wherein the API is coupled to the glucose by a linker.
82. The therapeutic compound according to claim 81, wherein the linker is a cleavable linker.
83. The therapeutic compound according to any one of claims 80 to 82, wherein the API is selected from the group consisting of siRNA and antisense oligonucleotides.
84. The sodium-dependent glucose cotransporter is SGLT1 isoform 1 (SEQ ID NO: 36), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 15, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 80 to 82, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
85. The therapeutic compound according to any one of claims 80 to 82, wherein the sodium-dependent glucose cotransporter is SGLT1 isoform 1 (SEQ ID NO: 36), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
15.
86. The sodium-dependent glucose cotransporter is SGLT1 isoform 2 (SEQ ID NO: 37), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 16, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 80 to 82, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
87. The therapeutic compound according to any one of claims 80 to 82, wherein the sodium-dependent glucose cotransporter is SGLT1 isoform 2 (SEQ ID NO: 37), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
16.
88. The sodium-dependent glucose cotransporter is SGLT2 (SEQ ID NO: 38), the API is siRNA, and the siRNA is a double-stranded RNA molecule containing an antisense RNA strand and a sense RNA strand. (a) The antisense RNA strand is 19 to 29 nucleotides long and complementary to the consecutive nucleotides of SEQ ID NO: 17, (b) The sense RNA strand is 19 to 29 nucleotides long and complementary to the 14 to 29 nucleotides from the antisense RNA strand. (c) The therapeutic compound according to any one of claims 80 to 82, wherein the double-stranded RNA molecule has a double-stranded region of 14 to 29 nucleotides in length and a 3' overhang region of 0 to 5 nucleotides in length.
89. The therapeutic compound according to any one of claims 80 to 82, wherein the sodium-dependent glucose cotransporter is SGLT2 (SEQ ID NO: 38), the API is an antisense oligonucleotide, the antisense oligonucleotide is 15 to 25 nucleotides long and complementary to at least 15 consecutive nucleotides of SEQ ID NO:
17.
90. A method for treating cancer in a mammalian subject requiring treatment for cancer, comprising administering a therapeutically effective amount of a therapeutic compound according to any one of claims 1 to 38 to the mammalian subject.
91. A method for reducing inflammation in a mammalian subject requiring reduction of inflammation, comprising administering a therapeutically effective amount of a therapeutic compound according to any one of claims 39 to 79 to the mammalian subject.
92. A method for treating diabetes in a mammalian subject requiring treatment for diabetes, comprising administering a therapeutically effective amount of a therapeutic compound according to any one of claims 80 to 89 to the mammalian subject.
93. The method according to any one of claims 90 to 92, wherein the mammal subject is a human.
94. A pharmaceutical composition comprising a therapeutic compound according to any one of claims 1 to 89 and a pharmaceutically acceptable carrier.