Pharmaceutical composition containing multiple suppressor transfer RNAs
A customized mix of suppressor transfer RNAs addresses the challenge of diverse genetic mutation patterns in nonsense mutations by enabling a single composition to treat multiple patients, enhancing treatment efficacy and reducing regulatory burdens.
Patent Information
- Application Number
- JP2025564039
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-05-02
- Filing Date
- 2024-04-29
- Publication Date
- 2026-05-12
AI Technical Summary
Existing gene therapy approaches for treating diseases caused by nonsense mutations are limited in their ability to effectively treat patients with diverse genetic mutation patterns, often requiring multiple compositions and lengthy regulatory approval processes.
A pharmaceutical composition comprising a tailored mix of at least five different suppressor transfer RNAs, each targeting specific premature termination codons (PTCs) and amino acids, allowing for customized treatment of patients with varying PTC patterns, potentially treated with a single approved composition.
This approach enables broad treatment of various PTC-related diseases with a single composition, reducing the need for multiple approvals and facilitating personalized treatment strategies.
Smart Images

Figure 2026514595000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to a pharmaceutical composition comprising a plurality of suppressor transfer RNAs and a synthetic DNA construct comprising nucleic acids encoding a plurality of suppressor transfer RNAs. Furthermore, the present invention relates to a pharmaceutical composition comprising one or more synthetic DNA constructs encoding suppressor tRNAs that can be used, for example, to deliver a plurality of transfer RNAs to cells, such as human cells. [Background technology]
[0002] Transfer ribonucleic acid (tRNA) is an essential component of the protein synthesis machinery in living cells, as it is necessary for translating the nucleotide sequence of messenger RNA (mRNA) into the amino acid sequence of a protein. Natural tRNA contains an amino acid-binding stem that can covalently bind to amino acids and an anticodon loop containing a base triplet called an "anticodon," which can non-covalently bind to the corresponding base triplet called a "codon" on mRNA. Proteins are synthesized by assembling the amino acids carried by tRNA, using the codon sequence on mRNA as a template, with the help of a multicomponent system that includes ribosomes and several coenzymes.
[0003] Transfer RNA has recently attracted increasing interest as a drug for therapeutic purposes, for example, as part of gene therapy to treat conditions associated with nonsense mutations, i.e., mutations in which a sense codon encoding one of 20 amino acids specified in the genetic code is altered to a premature termination codon (PTC) in the gene sequence (Non-Patent Literature 1; Non-Patent Literature 2; Non-Patent Literature 3). For example, Lueck et al., 2016 (Non-Patent Literature 4; Non-Patent Literature 5), describe how codon-edited tRNA can convert the in-frame stop codon of the CFTR gene to a native amino acid in order to restore the full-length wild-type protein.
[0004] Compared to mRNA, tRNA molecules are significantly more stable and, on average, 10 times shorter, thus mitigating the problem of introduction into target tissues. This has led to attempts to use tRNA in gene therapy to prevent the formation of terminally cleaved proteins from mRNA with immature stop codons and instead introduce appropriate amino acids (see, for example, Non-Patent Document 6; Patent Document 1; Patent Document 2). Patent Documents 3 and 4 describe synthetic tRNAs with extended anticodon loops that can be used, for example, as suppressor tRNAs for genetic diseases associated with frameshift mutations. Patent Document 5 discloses engineered tRNA molecules and vectors encoding engineered suppressor tRNA molecules that recognize and read through disease-causing immature stop codons. The use of tRNA in gene therapy, for example, in gene therapy for diseases associated with the presence of immature stop codons (PTCs), is also described, in particular, in Patent Documents 6, 7, 8, 5, and 9.
[0005] For example, the symptoms of diseases such as cystic fibrosis, which are caused by or associated with nonsense mutations (PTCs) in protein-coding genes resulting in protein deficiencies or dysfunctions, are often very similar, but the genetic signatures of such diseases can be extremely diverse. Each patient may have a unique underlying genetic mutation pattern, with one or more different PTCs, even while exhibiting the same disease phenotype. However, it is desirable to have a single agent for treating at least several patients or a larger patient population who have the same or similar disease phenotype but different PTC mutations or PTC mutation patterns, or who have similar underlying genetic mutations but in different genes associated with other diseases. Patent Document 10 proposes the use of a single expression vector or pharmaceutical composition containing first, second, and / or third suppressor tRNAs. [Prior art documents] [Patent Documents]
[0006] [Patent Document 1] U.S. Patent Application Publication No. 2003 / 0224479(A1) [Patent Document 2] U.S. Patent No. 6964859 [Patent Document 3] International Publication No. 2017 / 121863(A1) Pamphlet [Patent Document 4] International Publication No. 2020 / 208169(A1) Brochure [Patent Document 5] International Publication No. 2021 / 113218(A1) Brochure [Patent Document 6] International Publication No. 2020 / 069194(A1) Pamphlet [Patent Document 7] International Publication No. 2021 / 211762(A2) Brochure [Patent Document 8] International Publication No. 2021 / 087401(A1) brochure [Patent Document 9] U.S. Patent Application Publication No. 2020 / 291401(A1) [Patent Document 10] International Publication No. 2022 / 235861(A1) brochure [Non-patent literature]
[0007] [Non-Patent Document 1] Ai-Ming Yu, Young Hee Choi and Mei-Juan Tu, RNA Drugs and RNA Targets for Small Molecules: Principles, Progress, and Challenges, Pharmacological Reviews, 2020, 72 (4) 862-898; DOI: 10.1124 / pr.120.019554 [Non-Patent Document 2] Porter, JJ, Heil, CS, Lueck, JD, Therapeutic promise of engineered nonsense suppressor tRNAs, WIREs RNA. 2021; 12:e1641, DOI: 10.1002 / wrna.1641 [Non-Patent Document 3] Albers S, Beckert B, Matthies MC, Mandava CS, Schuster R, Seuring C, Riedner M, Sanyal S, Torda AE, Wilson DN, Ignatova Z., Repurposing tRNAs for nonsense suppression. Nat Commun. 2021 Jun 22;12(1):3850. doi: 10.1038 / s41467-021-24076-x.PMID: 34158503) [Non-Patent Document 4] Lueck et al. 2016 (Lueck, JD, Infield, DT, Mackey, AL, Pope, RM, McCray, PB, Ahern, CA. Engineered tRNA suppression of a CFTR nonsense mutation, bioRxiv 088690; doi: 10.1101 / 088690 [Non-Patent Document 5] Lueck JD, Yoon JS, Perales-Puchalt A, Mackey AL, Infield DT, Behlke MA, Pope MR, Weiner DB, Skach WR, McCray PB Jr, Ahern CA. Engineered transfer RNAs for suppression of premature termination codons. Nat Commun. 2019 Feb 18;10(1):822. doi: 10.1038 / s41467-019-08329-4 [Non-Patent Document 6] Koukuntla, R., 2009, Suppressor tRNA mediated gene therapy, Graduate Theses and Dissertations, 10920, Iowa State University, http: / / lib.dr.iastate.edu / etd / 10920 [Non-Patent Document 7] Mitra S., Das P., Samadder A., Das S., Betai R., Chakrabarti J., 2015, Eukaryotic tRNAs fingerprint invertebrates vis-a-vis vertebrates, Journal of Biomolecular Structure and Dynamics, doi: 10.1080 / 07391102.2014.990925 [Non-Patent Document 8] Fujikura, K. Premature termination codons in modern human genomes. Sci Rep 6, 22468 (2016). https: / / doi.org / 10.1038 / srep22468 [Non-Patent Document 9] Bulcha, JT, Wang, Y., Ma, H. et al. Viral vector platforms within the gene therapy landscape. Sig Transduct Target Ther 6, 53, 2021, doi: 10.1038 / s41392-021-00487-6 [Non-Patent Document 10] Kotterman, MA, Chalberg, TW, Schaffer, DV, 2015, Viral Vectors for Gene Therapy: Translational and Clinical Outlook, Annu. Rev. Biomed. Eng. 2015. 17:63-89, 10.1146 / annurev-bioeng-071813-104938 [Non-Patent Document 11] Albers, S., et al. Repurposing tRNAs for nonsense suppression, Nature Comm 12, 3850 (2021) [Non-Patent Document 12] Sprinzl M, Horn C, Brown M, Ioudovitch A, Steinberg S. Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. 1998;26(1):148-53 [Overview of the project] [Problems that the invention aims to solve]
[0008] The object of the present invention is to improve the means and possibilities of gene therapy for diseases induced or mediated by nonsense mutations in genes, using transfer RNA. In particular, the object of the present invention is to enable the treatment of as many patients as possible who have the same disease phenotype but different underlying genotypic nonsense mutation patterns. [Means for solving the problem]
[0009] To solve this problem, the present invention, in its first embodiment, provides at least five different suppressor transfer RNAs, where, a) At least one of the suppressor transfer RNAs can form a base pair with the UGA stop codon, at least one of the suppressor transfer RNAs can form a base pair with the UAA stop codon, and at least one of the suppressor transfer RNAs can form a base pair with the UAG stop codon; b) The suppressor transfer RNA is not present in the composition in equal amounts. The present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier.
[0010] In the first aspect described above, the present invention provides a pharmaceutical composition that can be used to treat various patients diagnosed with or having at least one nonsense mutation associated with nonsense mutations (PTCs). The composition comprises at least five types of suppressor transfer RNAs, three of which are configured to suppress three possible PTCs (UGA, UAG, UAA) in the mutated target gene. The suppressor transfer RNAs present in the pharmaceutical composition of the present invention differ from one another in terms of homogeneous amino acids and / or target PTCs; that is, each suppressor transfer RNA in the pharmaceutical composition has a unique combination of homogeneous amino acids and target PTC, and is distinguishable from other suppressor transfer RNAs in the composition. At least one of these suppressor transfer RNAs is present in the pharmaceutical composition in an effective amount. A pharmaceutically acceptable carrier can be any carrier suitable for the pharmaceutical purpose. Examples of simple carriers include buffer solutions or saline solutions.
[0011] The pharmaceutical compositions of the present invention can be tailored to a patient's disease and specific PTC pattern, in that the type and proportion of suppressor tRNA can be specifically adapted. For example, with the pharmaceutical compositions of the present invention, approval procedures for numerous different compositions are not required. It is sufficient to seek approval only for a composition containing the maximum therapeutic dose of each suppressor transfer RNA to be administered. Furthermore, it is even possible to conduct clinical trials and seek approval for a single composition containing the maximum therapeutic dose of all suppressor transfer RNA, which can be administered to treat all or at least several diseases and patients. It also facilitates the manufacture and design of customized pharmaceutical compositions, i.e., pharmaceutical compositions customized in relation to the disease and / or patient's PTC pattern. Customization may include the selection of suppressor transfer RNA with respect to target PTCs and homogeneous amino acids, as well as the appropriate formulation of suppressor transfer RNA according to the disease and / or patient's PTC pattern.
[0012] To our surprise, we have found that, for example, all or at least almost all known nonsense mutations and therefore a wide range of PTC-related diseases can be treated with just three different pharmaceutical suppressor-tRNA compositions (suppressor-tRNA "cocktails"). These suppressor-tRNA compositions differ in their composition of suppressor-tRNAs, and therefore each suppressor-tRNA is present in only one of these pharmaceutical suppressor-tRNA compositions. Each pharmaceutical suppressor-tRNA composition preferably contains up to six suppressor-tRNAs selected from a total of 19 suppressor-transfer RNAs (see below). [Brief explanation of the drawing]
[0013] [Figure 1] A schematic diagram of the generalized "consensus" tRNA structure and its numbering according to the tRNA numbering rules. [Figure 2] A schematic diagram of an embodiment of the synthetic DNA construct according to the present invention. [Figure 3A] Cell viability of cells treated with various tRNA cocktail concentrations. Cell viability assay of cells treated with various tRNA cocktail concentrations. Cells were seeded in each well at 1 × 10⁴ cells / well, and different concentrations of tRNA were added (ng / 10⁴ cells). tRNA-Arg-UGA, tRNA-Ser-UAG; tRNA-Ser-UAA, tRNA-Gln-UAA, and tRNA-Cys-UGA were mixed at equimolar concentrations. Cell viability was expressed as a percentage of the viability of untreated cells, with the viability of untreated cells set at 100%. [Figure 3B] Readthrough efficiency of cells treated with various tRNA cocktail concentrations. Cells were seeded at 1 × 10⁴ cells / well, and various concentrations of tRNA were added to each well (ng / 10⁴ cells). tRNA-Arg-UGA, tRNA-Ser-UAG; tRNA-Ser-UAA, tRNA-Gln-UAA, and tRNA-Cys-UGA were mixed at equimolar concentrations. Readthrough activity was expressed as a percentage of the cell's wild-type luciferase (WT-Luc) activity, which was set to 100%. [Figure 4A] Readthrough efficiency of cells treated with sup-tRNA. Readthrough efficiency of cells treated with various tRNA cocktails containing suppressor-tRNA embodiments at different concentrations in each cocktail (numbers below the plot). Cells were seeded at 1 × 10⁴ cells / well, and various concentrations of tRNA were added to each well (ng / 10⁴ cells). Readthrough activity is expressed as a percentage of the cell's wild-type luciferase (WT-Luc) activity, which is set to 100%. [Figure 4B] Readthrough efficiency of cells treated with sup-tRNA. Readthrough efficiency of cells treated with a tRNA combination containing mismatch tRNA and suppressor tRNA at the lowest concentrations specified in this embodiment (Figure 4A). Cells were seeded at 1 × 10⁴ cells / well, and various wild-type tRNAs were added to each well (ng / 10⁴ cells). Readthrough activity is expressed as a percentage with the cell's wild-type luciferase (WT-Luc) activity set to 100%. 0 represents a negative control reaction without tRNA. [Modes for carrying out the invention]
[0014] The terms “DNA construct” or “synthetic DNA construct” refer to artificially designed DNA segments that can be used, for example, to incorporate genetic material into target tissues or cells. The terms “vector,” “synthetic vector,” or “synthetic gene delivery vehicle (GDV)” refer to any means for delivering nucleic acids, such as coding nucleic acids, along with regulatory elements such as promoter sequences (promoters) and termination signals (terminators) into living cells. Many viral and non-viral vectors are known. Examples include plasmids, viruses, cationic liposomes, nanoparticles, or polymers.
[0015] Regarding the term "nucleic acid encoding transfer RNA," the terms "transfer RNA gene" or "tRNA gene" can also be used synonymously.
[0016] The term "encodes" with respect to the nucleotide sequence of a tRNA gene means that the nucleotide sequence is transcribed into tRNA or a portion of tRNA. Direct references to tRNA encoded by the DNA constructs of the present invention, such as references to structural parts of mature tRNA, e.g., the D arm, anticodon arm, T arm, or acceptor stem, are understood to refer to the region of the tRNA gene in the nucleic acid that encodes those structural parts, unless otherwise explicitly stated or clearly discernible from the context. Accordingly, an expression that the encoded tRNA contains, for example, a T arm of a particular sequence whose sequence is represented as DNA (with nucleotides A, C, G, and T), is understood to refer to a sequence within the tRNA gene that encodes the corresponding structure, which appears in the mature tRNA transcribed from the tRNA gene, but where T is replaced by U and, in some cases, may have modified nucleotides.
[0017] The terms "transfer ribonucleic acid," "transfer RNA," or "tRNA" refer to RNA molecules, typically 73 to 90 nucleotides long, that mediate the translation of the nucleotide sequence of messenger RNA into the amino acid sequence of a protein. tRNA can covalently bind to a specific amino acid at the 3'CCA tail of its acceptor stem and base-pair with the typical 3-nucleotide sequence (codon) of messenger RNA via an anticodon, typically 3-nucleotide, located in the anticodon loop of the anticodon arm. Some anticodons can pair with multiple codons through a phenomenon known as fluctuating base pairing. The secondary "cloverleaf" structure of tRNA includes an acceptor stem that binds to an amino acid and three arms ("D arm," "T arm," and "anticodon arm") that end in a loop (D loop, T loop (TψC loop), anticodon loop), i.e., a section with an unpaired nucleotide. The terms “D stem,” “T stem” (or “TψC stem”), and “anticodon stem” (also known as “AC stem”) refer to the portion of the D arm, T arm, and anticodon arm that contains paired nucleotides, respectively. Aminoacyl-tRNA synthetase adds specific amino acids to tRNA (aminoacylation). Each tRNA contains a distinctly different anticodon triplet sequence that can form base pairs with one or more codons encoding amino acids. By convention, tRNA nucleotides are often numbered from 1 to 76, starting from the 5'-phosphate terminus, based on a “consensus” tRNA molecule consisting of 76 nucleotides, regardless of the actual number of nucleotides in the tRNA, and this is not always 76nt in length due to variable parts such as the tRNA’s D loop or variable loop (see Figure 1). Following this convention, nucleotide positions 34–36 of native tRNA refer to the three nucleotides of the anticodon, and positions 74–76 refer to the terminal CCA tail.Extra nucleotides can be numbered in the D arm by adding an alphabet to the number of the preceding nucleotide that is part of the consensus tRNA, such as 20a, 20b, etc., according to convention, or by numbering the nucleotide independently and adding a leading letter, as in the case of variable loops, such as e11, e12, etc. (see, for example, Non-Patent Document 12). Hereafter, tRNA-specific numbering will also be referred to as "tRNA numbering rules" or "transfer RNA numbering rules".
[0018] The term "tRNA body" refers to the portion of tRNA located outside the anticodon loop.
[0019] The term "intron" refers to a polynucleotide sequence within a nucleic acid that is present in the genome and in the first nucleic acid product transcribed from the genomic nucleic acid, but is not included in the final nucleic acid product. For example, in the case of a protein gene, an intron is a non-coding polynucleotide sequence that separates coding polynucleotide sequences (exons) and is cut out from the premRNA transcribed from the protein gene in a process called "splicing." For example, in the case of transfer RNA, the term intron refers to a polynucleotide sequence that is cut out (spliced) from the pretRNA transcribed from the tRNA gene.
[0020] The term "intronic tRNA" refers to tRNA whose precursor (pre-tRNA) contains introns that are spliced from the pre-tRNA when the pre-tRNA is processed into the final (mature) tRNA. The term "non-intronic tRNA" refers to tRNA that does not contain introns and is produced from pre-tRNA that does not undergo splicing. The terms "intronic tRNA" and "non-intronic tRNA" encompass both pre-tRNA and mature tRNA.
[0021] As used herein, the term "tDNA" refers to a DNA sequence that encodes tRNA, and more particularly to a DNA sequence having a tRNA sequence in which the uracil nucleotide (U) of tRNA is replaced by a thymine nucleotide (T).
[0022] The terms "engineered transfer ribonucleic acid" or "synthetic tRNA" refer to tRNA or non-natural tRNA that has been modified by chemical or molecular biological methods. The terms "engineered" and "synthetic" are used synonymously here. An example is tRNA that, under natural conditions, is aminoacylated with an amino acid, but possesses an anticodon that pairs with a stop codon rather than the anticodon of the corresponding amino acid.
[0023] The term "codon" refers to a nucleotide triplet, or sequence of three DNA or RNA nucleotides, that corresponds to a specific amino acid or stop signal during protein synthesis. A list of codons (at the mRNA level) and the amino acids they encode is provided below. Amino Acids Three-letter codes One-letter codes Codons Alanine Ala A GCU, GCC, GCA, GCG Arginine Arg R CGU, CGC, CGA, CGG, AGA, AGG Asparagine Asn N AAU, AAC Aspartic acid (Asp D GAU, GAC) Cysteine (Cys C UGU, UGC) Glutamine Gln Q CAA, CAG Glutamic acid (Glu E, GAA, GAG) Glycine (Gly G GGU, GGC, GGA, GGG) Histidine His H CAU, CAC Isoleucine Ile I AUU, AUC, AUA Leucine (Leu L, UUA, UUG, CUU, CUC, CUA, CUG) Lysine K AAA, AAG Methionine Met M AUG Phenylalanine Phe F UUU, UUC Proline Pro P CCU, CCC, CCA, CCG Serin Ser S UCU, UCC, UCA, UCG, AGU, AGC Threonine Thr T ACU, ACC, ACA, ACG Tryptophan Trp W UGG Tyrosine Tyr Y UAU, UAC Valin Val V GUU, GUC, GUA, GUG Start:AUG Ending: UAA, UGA, UAG, abbreviation "X"
[0024] As used herein, the term "sense codon" refers to a codon that codes for an amino acid. The terms "stop codon" or "nonsense codon" refer to a codon in the genetic code, or nucleotide triplet, that does not code for one of the 20 amino acids commonly found in proteins, but instead transmits a signal for the termination of messenger RNA translation.
[0025] The term “5' leader sequence,” as used herein, refers to the “upstream” of the 5' end of the tRNA gene, for example, the sequence of nucleotides located approximately 100 nt upstream of the 5' end of the coding sequence of mature tRNA, including the nucleotide sequence that functions as the binding site for the transcription factor TFIIIB. The term “5' leader sequence” specifically refers to the sequence of nucleotides including or consisting of the 5'-100 to -1 positions from the transcription start site of the tRNA gene. “Mature tRNA” refers to fully processed, functional tRNA. The terms “extragenetic leader sequence,” “5' untranslated region (5'UTR),” or “extragenetic pol III binding sequence” may also be used herein.
[0026] The terms "A-box" and "B-box" refer to intra-gene regions, i.e., sequence motifs of the tRNA gene containing the nucleotide sequence to which the RNA polymerase III transcription factor TFIIIC binds. These boxes can also be considered as part of the tRNA promoter (the so-called type 2 promoter) or promoter elements. The approximately 10-14 nucleotide sequence that forms the A-box (Non-Patent Literature 7) is located in the region of the tRNA gene encoding part of the D-arm, and the approximately 11 nucleotide sequence that forms the B-box (Non-Patent Literature 7) is located in the region of the tRNA gene encoding part of the T-loop. The 11nt consensus sequence of the B-box has been shown by Mitra et al., 2015 (see above) to be the RGTTCRANNCY spanning nucleotides N52-N62 of mature tRNA. Numbering relating to the tRNA gene or a part thereof, such as the A-box and B-box, refers to nucleotide numbering within mature tRNA according to the tRNA numbering rules (see below).
[0027] A "frameshift mutation" refers to an extra-frame insertion or deletion of a number of nucleotides that is not divisible by 3 (collectively called an "indel"). This disrupts the decoding of nucleotide sequences, which progress in units of 3 nucleotide bases. A "-1 frameshift mutation" refers to a case where a deletion of one nucleotide shifts the reading frame by one nucleotide, and the first nucleotide of the next codon is read as part of the codon from which the nucleotide was deleted. A deletion of one nucleotide from an upstream codon along with several triplets (i.e., deletions of 4, 7, 10 nucleotides, etc.) is also considered a -1 frameshift. The term "+1 frameshift mutation" refers to an insertion of one nucleotide into a triplet or a deletion of two nucleotides. In either case, the reading frame shifts by one nucleotide, and the nucleotide of the upstream codon is read as part of the downstream codon. The insertion of one nucleotide along with several triplets (3n+1 nucleotides, where n is an integer, i.e., insertions of 4, 7, 10 nucleotides, etc.) or the deletion of two nucleotides from an upstream codon along with several triplets (i.e., deletions of 5, 8, 11 nucleotides, etc.) are also considered a +1 frameshift.
[0028] The term "anticodon" refers to a sequence of typically three nucleotides in tRNA that forms a base pair (non-covalent bond) with the three bases (nucleotides) of a codon on mRNA. In natural tRNA, a standard three-nucleotide anticodon is typically represented by nucleotides at positions 34, 35, and 36. Anticodons can also contain modified nucleotides. The term "four-nucleotide anticodon" or "four-base anticodon" refers to an anticodon having four consecutive nucleotides (bases) that pair with four consecutive bases on mRNA. The term "quadraplet nucleotide anticodon" or "quadraplet anticodon" is sometimes used to refer to a "four-nucleotide anticodon." The term "five-nucleotide anticodon" or "five-base anticodon" refers to an anticodon having five consecutive nucleotides (bases) that bind to (form a base pair) with five consecutive bases on mRNA. The term "quintiplet nucleotide anticodon" or "quintiplet anticodon" is sometimes used to refer to a "five-nucleotide anticodon." The term "stop anticodon" refers to an anticodon that binds to one of the stop codons.
[0029] The term "anticodon arm" refers to a portion of tRNA containing the anticodon. The anticodon arm typically consists of a stem portion ("anticodon stem") consisting of 5 base pairs (positions 27-31 and 39-43) and a loop portion ("anticodon loop"), which is a continuous sequence of unpaired nucleotides attached to the anticodon stem. The anticodon arm occupies positions 27-43, and the position numbering follows the transfer RNA numbering rules.
[0030] The "anticodon loop" refers to the unpaired nucleotides in the anticodon arm containing the anticodon. Natural tRNA typically has seven nucleotides in the anticodon loop, three of which pair with the mRNA codon.
[0031] The term "extended anticodon loop" refers to an anticodon loop in which the number of nucleotides within the loop is greater than that of natural tRNA. An extended anticodon loop may contain more than, for example, 7 nucleotides, such as 8, 9, or 10 nucleotides. In particular, the term refers to an anticodon loop containing more than three consecutive nucleotides, such as 4, 5, or 6 nucleotides, which can form base pairs with the corresponding number of consecutive nucleotides in the mRNA.
[0032] The term "anticodon stem" refers to the paired nucleotides of an anticodon arm that has an anticodon loop.
[0033] The term "T-arm" refers to a portion of tRNA that consists of a stem portion ("T-stem") and a loop portion between the acceptor stem and the variable loop ("T-loop"). The T-arm occupies positions 49–65, and the position numbering follows the transfer RNA numbering rules. The T-stem typically consists of five nucleotide pairs (occupying positions 49–53 and 61–65).
[0034] The term "T-stem" (or "TψC" stem) refers to a paired nucleotide with a T-loop, i.e., an unpaired T-arm.
[0035] The term "D-arm" refers to the tRNA portion composed of a stem ("D-stem"), i.e., the paired nucleotides of the D-arm, and a D-loop, i.e., the unpaired nucleotides of the D-arm between the acceptor stem and the anticodon arm. The D-arm occupies positions 10-25, and the position numbering follows the transfer RNA numbering rules.
[0036] The term "variable loop" refers to the tRNA loop located between the anticodon arm and the T arm. The number of nucleotides constituting the variable loop varies considerably depending on the tRNA. Therefore, the variable loop can be quite short, even absent, or quite large, for example, forming a helix. The term "variable arm" is sometimes used synonymously with the term "variable loop." The use of the term "variable loop" does not exclude the existence of a "stem" portion within the variable loop, i.e., a stretch of consecutive nucleotides in the variable loop that forms base pairs with the other consecutive nucleotides in the variable loop. The variable loop occupies positions 44-48, and the position numbering follows the transfer RNA numbering rules. Note that the variable loop may have a considerable number of additionally numbered nucleotides (see Figure 1).
[0037] The term "acceptor stem" refers to the site where an amino acid binds to tRNA. Acceptor stems are often formed from seven base pairs.
[0038] The terms “codon-base triplet” or “anticodon-base triplet,” as used herein, refer to a sequence of three consecutive nucleotides that form a codon or anticodon. Synonyms may also be used, such as “3-nucleotide codon” (also “3-base codon”) or “3-nucleotide anticodon” (also “3-base anticodon”), or their abbreviations, such as “3nt codon” or “3nt anticodon”.
[0039] The term "base pair" refers to a pair of bases bonded by a hydrogen bond, or the formation of such a pair of bases. The term "Watson-Crick base pair" is also sometimes used for such base pairs. One base in a base pair is usually a purine, and the other is usually a pyrimidine. In RNA, for example, adenine and uracil can form a base pair, and guanine and cytosine can form a base pair. In DNA, thymine usually forms a base pair with adenine instead of uracil. However, the formation of other base pairs ("fluctuation base pairs") is also possible and is included in this term, including, for example, guanine-uracil (GU), hypoxanthine-uracil (IU), hypoxanthine-adenine (IA), and hypoxanthine-cytosine (IC) base pairs. The term "can form a base pair" refers to the ability of a nucleotide or nucleotide sequence to hybridize with a complementary nucleotide or nucleotide sequence, i.e., to form a hydrogen bond-stabilizing structure with the corresponding (complementary) nucleotide or nucleotide sequence. Base pairing can occur intramolecularly, for example, within a single-stranded nucleic acid (e.g., tRNA), or intermolecularly, i.e., between different nucleic acid molecules. The expression "suppressor transfer RNA can base pair with a stop codon" means that suppressor transfer RNA can bind to a stop codon via its anticodon.
[0040] In this specification, the term "base," when used in terms such as "base A, C, G, or U" or "base A, C, G, or T," encompasses or is synonymous with the term "nucleotide," unless otherwise specified by the context.
[0041] The abbreviations used herein to represent bases or nucleotides are as follows, in accordance with the IUPAC nucleotide code and standard ST.26 (version 1.5): IUPAC nucleotide codes bases Adenine C Cytosine G Guanine T (or U) Thymine (or Uracil in RNA) RA or G YC or T / U SG or C WA or T / U KG or T / U MA or C BC or G or T / U DA or G or T / U HA or C or T / U VA, C, or G N is any base . or - gap
[0042] The term "PTC" refers to an immature termination codon. This is a mutation introduced into a coding nucleic acid sequence by a nonsense mutation, in which a sense codon that codes for one of the 20 protein-producing amino acids defined by the standard genetic code is changed to a chain termination codon. Therefore, this term refers to an immature termination signal in the translation of the genetic code contained in mRNA. The terms "immature termination codon" ("PSC") or "nonsense mutation" are sometimes used synonymously with immature termination codon, PTC. This term is not limited to nonsense mutations of codons, i.e., PTCs resulting from mutations in nucleotides within a codon, but also includes frameshift mutations, i.e., PTCs resulting from the deletion or insertion of one or more nucleotides.
[0043] The terms "frameshift suppression" or "frameshift rescue" refer to mechanisms that mask the effects of frameshift mutations and restore, at least partially, the wild-type phenotype.
[0044] The terms "nonsense suppression," "nonsense mutation suppression," "PTC suppression," or "PTC rescue" refer to mechanisms that mask the effects of nonsense mutations and restore mRNA translation and, at least partially, the wild-type phenotype.
[0045] The term "tRNA sequestration" refers to the irreversible binding of tRNA to tRNA synthetase, where tRNA binds to tRNA synthetase but is not released from tRNA synthetase, or is essentially not released.
[0046] A "suppressor tRNA" (also abbreviated as "sup-tRNA") is a tRNA that alters the reading of messenger RNA in a given translation system so that, for example, a frameshift mutation or a nonsense mutation is "suppressed," the effects of the frameshift mutation or nonsense mutation are masked, and the wild-type phenotype is restored at least partially. Examples of suppressor tRNAs include those that have amino acids and can base-pair with the PTC of mRNA, or, for example, in the case of tRNAs with an extended anticodon loop and a 4-base, 5-base, or 6-base anticodon, tRNAs that can base-pair with a section on mRNA having two consecutive codons, one or both of which are mutated, or a section having a first codon and a second consecutive codon, one of which is complete and the other has an insertion or deletion. In this way, the translation system can modify the reading frame in the case of a frameshift mutation, or read through the PTC in the case of a nonsense mutation.
[0047] The term "closely related congeneral suppressor tRNA" refers to suppressor tRNAs that pair with the same PTC at their anticodon but possess a different congeneral amino acid. The term "possessing a congeneral amino acid" in relation to suppressor tRNAs should not be interpreted as a restriction that the suppressor tRNA actually holds (carries) that congeneral amino acid, but also includes suppressor tRNAs that are structurally configured to be recognized by aminoacyl-tRNA synthetases (aaRSs) that carry that congeneral amino acid to tRNA under appropriate conditions, for example, in living cells.
[0048] The term "targeted PTC," or the expression that a suppressor tRNA binds to or targets a PTC, refers to the ability of a suppressor tRNA to bind to a specific PTC via its anticodon, i.e., a PTC having a sequence complementary to the anticodon, or at least a PTC that allows the suppressor tRNA's anticodon to form sufficient Watson-Crick base pairs for binding to the PTC. A "targeted PTC" refers to a PTC that is recovered with the help of a suppressor tRNA, i.e., a PTC that is read-through. A "suppressor tRNA that targets a PTC" refers to a suppressor tRNA that facilitates the read-through of a PTC during translation.
[0049] The terms “PTC pattern,” “PTC signature,” “nonsense mutation pattern,” or “nonsense mutation signature” refer to the distribution pattern of PTCs in a given gene or disease, particularly the location or combination of locations of PTCs.
[0050] The terms “nonsense mutation-related disease,” “PTC-induced or mediated disease,” or “PTC-related disease” refer to a disease or condition based on at least one nonsense mutation or frameshift mutation that results in a PTC in a gene. Examples of such diseases include cystic fibrosis, Duchenne muscular dystrophy, hemophilia A, spinal muscular atrophy, Hurler syndrome, and beta-thalassemia.
[0051] The term "decoding activity" in relation to tRNA refers to the property or ability of transfer RNA to be used by the cell's translation machinery as an amino acid donor for protein production. Under physiological conditions, tRNA has "decoding activity" if it is loaded with congener amino acids and the loaded tRNA (aminoacyl-tRNA) is subsequently incorporated into a protein. The decoding activity of a first tRNA for a given amino acid can be compared to the decoding activity of a second tRNA for the same amino acid, for example, by comparing the proportion of the amino acid from the first or second tRNA that is incorporated into the protein. The terms "salvage activity," "suppression activity," "suppression efficiency," or "readthrough activity" refer to the decoding activity or efficiency of suppressor tRNAs, such as frameshift suppressors or nonsense suppressor tRNAs, in particular tRNAs designed to decode immature stop codons of mRNA into amino acids, so that the translation of mRNA into the corresponding protein is not interrupted in an immature state.
[0052] The term "the tRNA encoded by the DNA construct of the present invention still performs its function in the translation machinery of a living cell" refers to the tRNA transcribed from the tRNA gene having decoding activity. In the case of suppressor tRNA, this term refers to the tRNA having greater rescue activity than its spontaneous (stochastic) rescue activity in a given cellular environment.
[0053] The term "aminoacylation" refers to the enzymatic reaction of loading amino acids onto tRNA. Aminoacyl-tRNA synthetase (aaRS) catalyzes the esterification of specific congeneral amino acids or their precursors onto congeneral tRNAs to form aminoacyl-tRNA. Therefore, the term "aminoacyl-tRNA" refers to tRNA to which amino acids have been bound. Each aminoacyl-tRNA synthetase is highly specific to a given amino acid, and multiple tRNAs may exist for the same amino acid, but there is only one aminoacyl-tRNA synthetase for each of the 20 protein-producing amino acids. The terms "loading" or "carrying" are sometimes used synonymously with "aminoacylation."
[0054] The term "expression" refers to the conversion of genetic information into functional products, such as proteins or nucleic acids, such as functional RNA (e.g., transfer RNA). This term encompasses not only the biosynthesis of genetically-based proteins, such as enzymes, including the formation of mRNA based on a DNA template, but also the synthesis of functional RNA molecules, such as tRNA, as well as previous processes such as transcription or splicing, i.e., the formation of mRNA based on a DNA template. With regard to the production of mature tRNA in cells from tRNA genes, the term "transcription" is sometimes used synonymously with "expression," particularly in terms of increasing or decreasing production, and therefore encompasses not only the synthesis of the initial RNA product (i.e., pre-tRNA) but also the processing from the initial RNA product to the final RNA product (i.e., mature tRNA). The terms "expression intensity" or "expression level" refer to the amount of product synthesized from a DNA template. The term "high expression" refers to a high expression level, i.e., an expression level higher than the average expression level observed for a given molecular species, such as tRNA. The term "low expression" refers to a low expression level, i.e., an expression level lower than the average expression level observed for a given molecular species, such as tRNA. The terms "high expression" or "low expression" may also refer to expression levels related to the expression level of a first tRNA, which is contained in a construct or composition and under the control of a first regulatory element, compared to the expression level of a second tRNA, which is contained in the construct or composition and under the control of a second regulatory element.
[0055] With respect to suppressor tRNA or DNA constructs containing nucleic acids encoding suppressor tRNA, the term “effective amount” refers to the amount of suppressor tRNA in a pharmaceutical formulation or composition, or the amount of suppressor tRNA produced intracellularly from the DNA construct, that is sufficient to produce the desired result, for example, increased formation of functional proteins, such as enzymes, compared to protein production in the absence of suppressor tRNA or the DNA construct.
[0056] The term "one, more, or all of the sup-tRNAs in the composition" refers to one or more sup-tRNAs present in the composition. For example, in a composition containing five or fewer sup-tRNAs, this refers to one, two, three, four, or all five sup-tRNAs in the composition. For example, in a composition containing six or fewer sup-tRNAs, this refers to one, two, three, four, five, or all six sup-tRNAs in the composition. Similarly, with respect to other entities (e.g., multiple nucleic acids encoding sup-tRNAs), the term "one, more, or all" refers to one or more of these entities (e.g., one, two, three, four, five, or six nucleic acids, where applicable).
[0057] A "pharmaceutically acceptable carrier" refers to a carrier that is suitable for the preparation of pharmaceutical compositions and is generally non-toxic and biologically safe, particularly for veterinary and / or human pharmaceutical use. Examples of simple carriers include buffer solutions or saline solutions. Other examples include nanoparticles such as liposomes, lipid nanoparticles (LNPs), or exosomes.
[0058] The term "pharmaceutically acceptable excipients" refers to any substance other than the active pharmaceutical ingredient (API) intentionally included in a pharmaceutical composition. Excipients are, but preferably, pharmacologically inactive and non-toxic substances. Excipients may be included in a pharmaceutical composition to protect, support, or enhance the stability, bioavailability, or patient acceptability of the API or the pharmaceutical composition; to assist in the processing of the API during manufacturing; to aid in the efficacy and / or delivery of the pharmaceutical composition; or to maintain the integrity of the pharmaceutical composition during storage. Examples include plasticizers, adjuvants, anti-fouling agents, binders, disintegrants, flow enhancers, lubricants, humectants, buffers, adhesives, thickeners, preservatives, coatings, fillers, diluents, flavoring agents, colorants, and sweeteners.
[0059] In a preferred embodiment of the pharmaceutical composition according to the present invention, at least five types of suppressor transfer RNAs are tRNA-Arg-UR1 R 2 、 tRNA-Ser-UR 1 R 2 、 tRNA-Gln-UR 1 R 2 、 tRNA-Cys-UR 1 R 2 、 tRNA-Glu-UR 1 R 2 、 tRNA-Gly-UR 1 R 2 、 tRNA-Tyr-UR 1 R 2 、 tRNA-Lys-UR 1 R 2 、 tRNA-Trp-UR 1 R 2 、 and tRNA-Leu-UR 1 R 2 selected from the group of suppressor transfer RNAs consisting of, where R 1 and R 2 are independently A or G, provided that R 1 and R 2 are not both G, and preferably selected from the group of suppressor transfer RNAs consisting of tRNA-Arg-UGA, tRNA-Ser-UAG, tRNA-Ser-UAA, tRNA-Ser-UGA, tRNA-Gln-UAA, tRNA-Gln-UAG, tRNA-Cys-UGA, tRNA-Glu-UAG, tRNA-Glu-UAA, tRNA-Gly-UGA, tRNA-Tyr-UAG, tRNA-Tyr-UAA, tRNA-Lys-UAA, tRNA-Lys-UAG, tRNA-Trp-UGA, tRNA-Trp-UAG, tRNA-Leu-UGA, tRNA-Leu-UAA, and tRNA-Leu-UAG.
[0060] The above notation of the suppressor tRNA follows the tRNA-aa-PTC ("aa" = cognate amino acid) system and indicates the cognate amino acid and the target PTC. UR 1 R 2This is one of the stop codons UGA, UAG, or UAA. Note that, although each suppressor tRNA naturally holds the corresponding anticodon in its anticodon loop, for clarity, the codon (at the mRNA level to which each tRNA pairs with its anticodon) is shown rather than the corresponding anticodon.
[0061] A group of suppressor transfer RNAs selected for the pharmaceutical composition according to the present invention consists of suppressor transfer RNAs having the following 10 amino acids as congener amino acids: tryptophan (Trp), tyrosine (Tyr), cysteine (Cys), glutamic acid (Glu), lysine (Lys), glutamine (Gln), serine (Ser), leucine (Leu), arginine (Arg), and glycine (Gly). The listed amino acids are particularly susceptible to PTC conversion. Each suppressor transfer RNA has an anticodon configured to bind to one of the stop codons UGA, UAG, or UAA.
[0062] The pharmaceutical composition of the present invention may contain two or more suppressor transfer RNAs that form base pairs with the same stop codon, i.e., have the same anticodon. However, preferably, the pharmaceutical composition of the present invention contains up to three suppressor transfer RNAs that form base pairs with the same stop codon in order to minimize the effect of incorrect amino acid incorporation. However, if the composition contains two or more suppressor transfer RNAs that form base pairs with the same stop codon, the suppressor transfer RNAs that form base pairs with the same stop codon will have different homologous amino acids. Furthermore, if the pharmaceutical composition of the present invention contains two or more suppressor transfer RNAs that have the same anticodon, these suppressor transfer RNAs preferably have a tRNA body or part thereof derived solely from non-homogeneous tRNA to reduce interference with reading the same PTC. Such non-homogeneous tRNAs are, for example, tRNAs (see below) whose body or part thereof is, for example, a naturally occurring non-homogeneous tRNA that may or may not be modified. This means that although the pharmaceutical composition has the same anticodon, it does not contain two types of tRNAs whose main body or part of the main body is derived from a naturally occurring closely related congeneral tRNA that, if it has a natural anticodon, could potentially bind to the same sense codon. For example, tRNA that targets a specific PTC and pairs with the AGA codon. Arg The main body or a part of the main body, or tRNA modified as shown below. Arg The first suppressor tRNA, which includes the main body or a part of the main body, is a tRNA that pairs with the AGU codon. Ser It should not be combined with suppressor tRNAs that contain the (arbitrarily modified) main body or a part of the main body.
[0063] Furthermore, if two or three types of suppressor tRNAs that form the same stop codon and base pair, i.e., have the same anticodon, are present in the pharmaceutical composition of the present invention, it is preferable that these suppressor tRNAs are present in different proportions, preferably in proportions that reflect the PTC signature of the disease-related gene.
[0064] In a particularly preferred embodiment of the pharmaceutical composition of the present invention, the pharmaceutical composition comprises five or six types of suppressor transfer RNAs, more preferably five or fewer types of suppressor transfer RNAs. A particularly preferred pharmaceutical composition of the present invention comprises the following suppressor tRNAs: a) tRNA-Arg-UGA, tRNA-Ser-UAG, tRNA-Ser-UAA, tRNA-Gln-UAA, and tRNA-Cys-UGA; or b) tRNA-Glu-UAG, tRNA-Glu-UAA, tRNA-Ser-UGA, tRNA-Gly-UGA, tRNA-Tyr-UAG, and tRNA-Lys-UAA; or c) tRNA-Trp-UGA, tRNA-Trp-UAG, tRNA-Gln-UAG, tRNA-Lys-UAG, and tRNA-Tyr-UAA.
[0065] The three compositions described above (a) to (c) each contain five (a and c) or six (b) different suppressor tRNAs, preferably five or fewer or six or fewer suppressor tRNAs. Note that one of the three suppressor tRNAs in each composition is not present in the other two compositions. The suppressor tRNAs in each composition differ in their combination of homologous amino acids and PTCs.
[0066] In a more preferred embodiment of the pharmaceutical composition according to the present invention, the proportion of each suppressor transfer RNA in the composition is adjusted so that a first suppressor transfer RNA configured to suppress the most frequent PTC is present in the largest proportion in the composition, in accordance with the frequency of PTC mutations in a given target gene, and second, third, fourth, and subsequent suppressor transfer RNAs configured to suppress less frequent PTCs are present in the composition in correspondingly lower proportions, depending on the frequency of the target PTC in the target gene. In this embodiment, the proportion of suppressor transfer RNA in the pharmaceutical composition is determined based on the PTC pattern of the specific disease treated by the pharmaceutical composition, preferably based on the PTC pattern observed in the patient being treated. The PTC pattern can be determined by determining the frequency of PTCs in a given disease and / or patient. Such patterns are known in the prior art or can be determined using conventional experiments.
[0067] Pharmaceutical compositions can be adapted, for example, to specific diseases and / or patients in terms of the type and proportion of suppressor transfer RNA present in the composition. Targeting target PTCs, i.e., PTCs that are typically or frequently present in a particular disease and / or in a particular patient, the suppressor transfer RNA present in the composition is present in a higher proportion than PTCs that are known to be absent or rarely present in each of those diseases or patients. Particularly preferably, the proportion of suppressor transfer RNA present in the composition is individually adapted to the PTC pattern of a given disease or patient being treated.
[0068] Preferably, the proportion of suppressor transfer RNA present in a composition targeting a PTC in a target gene at a relatively high frequency, preferably at least 0.5%, more preferably at least 1%, 2%, 3%, 4%, or 5%, as determined for the disease and / or patient as known in the Art (see, for example, Non-Patent Document 8), is 95% by weight of the total suppressor transfer RNA present in the composition. For example, if a PTC-related disease is known to have a PTC pattern of three PTCs in which high frequency is present, the composition is configured to contain three sup-tRNAs targeting the three PTCs in a proportion of 95% or more, for example, 60% of the first sup-tRNA, 25% of the second sup-tRNA, and 15% of the third sup-tRNA. Other (e.g., two or three) sup-tRNAs are present in amounts such that their total proportion is 5% by weight or less. As another example, sup-tRNAs targeting frequently occurring PTCs may make up 95% or more of the composition, while other sup-tRNAs may make up 5% or less in total.
[0069] The total amount of sup-tRNA present in the pharmaceutical composition of the present invention is adjusted to obtain maximum efficiency with no toxicity or low toxicity. For example, the pharmaceutical composition of the present invention is 10 4 A maximum of 250 ng per cell, preferably 10 4 Cells may contain up to 240, 230, 220, 210, 205, or 200 ng of sup-tRNA (see below).
[0070] Any sup-tRNA in the pharmaceutical composition may be a natural tRNA or an engineered tRNA, for example, a microbiologically engineered tRNA. Preferably, the tRNA is engineered in such a way that it has, for example, a modified anticodon, such as an anticodon that forms a base pair with a stop codon in mRNA, or a modified D arm, anticodon arm, T arm, or acceptor stem.
[0071] A portion of the sup-tRNA present in the pharmaceutical composition of the present invention, for example, one type, two types, three types, or all of them, is sequence H 54 U 55 C 56 G 57 A 58 N 59 U 60 Preferably U 54 U 55 C 56 G 57 A 58 N 59 U 60 A B-box can contain the following: the index represents the nucleotide position in the transfer RNA, and the position numbering follows the transfer RNA numbering rules. N represents any nucleotide (A, C, G, or T), and H represents A, C, or T. Naturally, U is replaced by T in the corresponding DNA sequence, for example, in a DNA construct containing the encoded tRNA. Nucleotides 54-60 are located within the T-arm of mature tRNA, forming a T-loop. tRNA containing a B-box with the above sequence is transcribed more strongly than tRNA lacking such a B-box. The tRNA can be natural or synthetic (manipulated) transfer RNA.
[0072] In preferred embodiments of the pharmaceutical compositions of the present invention, one, more, or all of the sup-tRNAs may be structurally modified in such a way that the tRNA has a structurally modified D arm, anticodon arm, variable loop, and / or T arm. "Structurally modified" means that the mature tRNA has a modified anticodon arm and / or variable loop and / or T arm and / or D arm, i.e., it has a different stem or loop nucleotide sequence from, for example, the D arm and / or anticodon arm and / or variable loop and / or T arm of a comparable native tRNA. "Comparable" tRNA is a tRNA that is aminoacylated by the same aminoacyl-tRNA synthetase. Particularly preferably, the encoding tRNA, in its mature form, includes a D arm, anticodon arm, and / or variable loop, and / or T arm that are not present in native tRNA.
[0073] One, more, or all of the anticodon arms of the sup-tRNAs in the composition may have, for example, one of the following general structures having a modified stem portion. 5'-GCAGG-AC-Loop-CCUGU-3' 5'-UUGGG-AC-Loop-CUCAA-3' 5'-UUGGA-AC-Loop-UUCAA-3' 5'-AUGGU-AC-Loop-ACCAU-3' 5'-GCGGA-AC-Loop-UCCGC-3' 5'-GCGGU-AC-loop-ACCGC-3' 5'-GGCGG-AC-loop-CCGCC-3' 5'-GGCGC-AC-loop-GCGCC-3' 5'-UUGGG-AC-Loop-CCCAA-3' 5'-CUGGA-AC-Loop-UCCAG-3' 5'-CCGGA-AC-Loop-UCCGG-3' 5'-GCUGC-AC-Loop-GCAGU-3'
[0074] In preferred embodiments of the pharmaceutical composition of the present invention, one, more, or all of the sup-tRNAs include, for example, one anticodon (AC) arm from the following sequences. GCAGGNN NNN NNCCUGU (Sequence ID 1) UUGGGNN NNN NNCUCAA (Sequence ID 2) UUGGANN NNN NNUUCAA (Sequence ID 3) AUGGUNN NNN NNACCAU (Sequence ID 4) GCGGANN NNN NNUCCGC (Sequence ID 5) GCGGUNN NNN NNACCGC (SEQ ID NO: 6) GGCGGNN NNN NNCCGCC (Sequence ID 7) GGCGCNN NNN NNGCGCC (Sequence No. 8) The underlined N represents a stop anticodon. N = A, C, G, or U, or any modified base.
[0075] In a further preferred embodiment of the pharmaceutical composition of the present invention, one, more, or all of the sup-tRNAs include, for example, one anticodon (AC) arm from the following sequences. GCAGGCU NNN AACCUGU (Sequence ID 9) UUGGGCU NNN AACUCAA (Sequence ID 10) UUGGACU NNN AAUUCAA (Sequence ID 11) AUGGUCU NNN AAACCAU (Sequence ID 12) GCGGACU NNN AAUCCGC (Sequence ID 13) GCGGUCU NNN AAACCGC (Sequence ID 14) GGCGGCU NNNAACCGCC (Sequence ID 15) GGCGCCU NNN AAGCGCC (Sequence ID 16) The underlined N represents a stop anticodon. N = A, C, G, or U, or any modified base.
[0076] In a further preferred embodiment of the pharmaceutical composition of the present invention, one, more, or all of the sup-tRNAs include a variable loop (V-loop) having one of the following sequences, either in combination with one of the AC arms described above, or alone, i.e., without being combined with one of the AC arms described above. UGGGGUUUCCCC (Sequence ID 17) AGGGGAAACCCC (Sequence No. 18)
[0077] In a further preferred embodiment of the pharmaceutical composition of the present invention, one, more or all of the sup-tRNAs of the composition include a T-arm having the following general sequence, either in combination with one of the above AC arms and / or in combination with one of the above V-loops, or alone, i.e., without being combined with one of the above AC arms and / or without being combined with one of the above V-loops. GCGGG-T-Loop-CCCGU ACGGG-T-Loop-CCCGU GUAGG-T-Loop-CCCAU GUCGG-T-Loop-CCCGU GGCGG-T-Loop-CCGGU GCAGG-T-Loop-CCCGU GCCGG-T-Loop-CCGGU
[0078] Preferably, the T-loop (positions 54-60 according to the tRNA numbering rules) has the sequence HUCGANU (where H is A, C, or U), i.e., CUCGANU, AUCGANU, or UUCGANU, more preferably UUCGANU, for example UUCGAAU or UUCGAGU, preferably UUCGAGU.
[0079] In preferred embodiments of the pharmaceutical composition of the present invention, one, more, or all of the sup-tRNAs in the composition include, for example, one T-arm from the following sequences. GCGGGUUCGAAUCCCGU (Sequence ID 19) ACGGGUUCGAAUCCCGU (Sequence No. 20) GCGGGUUCGAGUCCCGU (Sequence No. 21) ACGGGUUCGAGUCCCGU (Sequence No. 22) GUAGGUUCGAGUCCCAU (Sequence No. 23) GUCGGUUCGAGUCCGAU (Sequence No. 24) GCCGGUUCGAGUCCGGU (Sequence No. 25) GCAGGUUCGAGUCCCGU (Sequence No. 26) GCCGGUUCGAGUCCGGU (Sequence No. 27) The loop portion is shown in italics. The T-arm has a stem of 5 base pairs.
[0080] In a further preferred embodiment of the pharmaceutical composition of the present invention, one, more or all of the sup-tRNAs of the present invention include, in combination with one of the above AC arms and / or in combination with one of the above V loops and / or in combination with one of the above T arms, or alone, i.e., without combination with one of the above AC arms and / or without combination with one of the above V loops and / or without combination with one of the above T arms, an acceptor stem having the following general sequence. 5'-GGCUCUG-rest tRNA-CAGAGUC-3' 5'-GGCCGUG-rest tRNA-CAGCGUC-3' 5'-GGCGCGG-rest tRNA-CGGCGUC-3'
[0081] The term "rest tRNA" refers to the portion of tRNA between the 5' and 3' ends of the acceptor stem, including the D arm, V loop, and T arm.
[0082] With respect to tRNA or a portion of tRNA, and particularly in the sequences of Sequence IDs 1-27 mentioned above, all of the uracil nucleotides (U) described herein are represented as T (thymine) nucleotides in the ST.26 sequence listing.
[0083] As described above, for any given sup-tRNA in the pharmaceutical composition of the present invention, the anticodon arm, or at least the anticodon stem, V-loop, T-arm, or at least the T-stem, and the acceptor stem can be selected independently of the anticodon arm / stem, V-loop, T-arm / stem, and acceptor stem described above. Therefore, the sup-tRNA may include only one of the anticodon arm / stem, V-loop, T-arm / stem, or acceptor stem described above, for example, only the anticodon arm having the sequence of SEQ ID NO: 10, or any combination thereof, for example, an anticodon arm having the sequence of SEQ ID NO: 15 and a T-arm having the sequence of SEQ ID NO: 203, or an anticodon arm having the sequence of SEQ ID NO: 10 and an acceptor stem as described above.
[0084] In a preferred embodiment, the pharmaceutical composition of the present invention is a) Anticodon arms and / or sequences having or containing one of sequence numbers 1 to 16 b) A variable loop and / or having one of the sequences of sequence numbers 17-18. c) T-arms and / or having one of the sequences of sequence numbers 19-27. d) Acceptor stem having the structure 5'-GGCUCUG-rest tRNA-CAGAGUC-3' or 5'-GGCGCUG-rest tRNA-CAGCGUC-3' The pharmaceutical composition comprises at least one tRNA, preferably at least two, three, four, or five tRNAs. Particularly preferably, all tRNAs in the pharmaceutical composition have an anticodon arm and / or a variable loop and / or T-arm selected from one of the above sequences.
[0085] Those skilled in the art are aware that tRNAs are aminoacylated with specific amino acids by specific aminoacyl-tRNA synthetases (aaRS), and that aaRS can recognize its homologous tRNAs via a unique identity element located in the acceptor stem and / or anticodon loop of the tRNA. To include in the DNA construct of the present invention a tRNA gene of a tRNA that, in its mature form, is loaded with its homologous amino acids in vivo, those skilled in the art design a unique identity element appropriate for the encoded tRNA.
[0086] The pharmaceutical composition of the present invention may contain any pharmaceutically acceptable excipient.
[0087] In a second embodiment, the present invention provides a synthetic DNA construct comprising a) at least five nucleic acids, each encoding a different suppressor transfer RNA, and b) a DNA regulatory element functionally linked to the nucleic acids such that at least one of the five nucleic acids can be expressed independently of the other nucleic acids in the construct.
[0088] Each synthetic DNA construct of the present invention comprises at least five, for example, five or six nucleic acids, each encoding a different transfer RNA, preferably one of the transfer RNAs described above with respect to a pharmaceutical composition of the first embodiment of the present invention. However, this does not preclude the synthetic DNA construct of the present invention from comprising two or more nucleic acids selected from the group consisting of five or six nucleic acids encoding different transfer RNAs. To enhance the expression of one or more of these nucleic acids, two or more copies of one, two or more of the five or six nucleic acids may be placed within the synthetic DNA construct of the present invention. Furthermore, the DNA construct of the present invention includes a DNA regulatory element functionally linked to the nucleic acid so that at least one of the five nucleic acids encoding tRNA can be expressed independently of the other nucleic acids in the construct. The construct may be configured to include, for example, a first DNA regulatory element for controlling the expression of a first nucleic acid encoding a first sup-tRNA, and a common second regulatory element for controlling the expression of other nucleic acids encoding other sup-tRNAs. This allows for, for example, higher levels of individual expression of at least one sup-tRNA. The construct preferably includes at least two, three, four, or five DNA regulatory elements for individual control of the expression of nucleic acids encoding sup-tRNAs functionally linked to the DNA regulatory elements. Preferably, the DNA construct is configured to include DNA regulatory elements for each nucleic acid encoding a different sup-tRNA, so that individual control of sup-tRNA expression, e.g., expression level, is possible. The construct can be configured such that, with respect to living cells into which the construct is introduced, e.g., human cells, three of these sup-tRNAs are expressed at a percentage of ≥95% of the total tRNA expressed from the construct, for example, 60% of the first sup-tRNA, 25% of the second sup-tRNA, and 15% of the third sup-tRNA, while the other (e.g., two or three) sup-tRNAs are expressed in amounts such that their combined percentage is 5% by weight or less.As another example, the DNA construct of the present invention can be configured to suppress a single sup-tRNA that targets PTCs present at a high frequency of ≥95%, while other sup-tRNAs are expressed at a total rate of 5% or less.
[0089] The DNA constructs of the present invention can be configured, for example, as gene delivery vehicles (GDVs) for delivering suppressor tRNA to cells, particularly mammalian cells, such as human cells.
[0090] The sup-tRNAs encoded by these nucleic acids are arranged in a synthetic DNA construct, such as a synthetic vector, in a form that is transcribed in nature when introduced into living mammalian cells, such as human cells, thereby enabling the encoded tRNA to be produced intracellularly, preferably using the cell's natural transcription mechanism. The tRNA may also be arranged to be transcribed conditionally, i.e., depending on specific intracellular conditions. Preferably, the sup-tRNAs encoded by the nucleic acids are arranged in the synthetic DNA construct so that they can be expressed independently of each other, for example, each functionally linked to a different regulatory element that determines its respective expression level.
[0091] The synthetic DNA construct of the present invention, which comprises at least five, for example, five or six nucleic acids, each encoding a different sup-tRNA, may, for example, contain the tRNA-coding nucleic acids in the following order (5'-3'): a)tRNA-Arg-UGA -tRNA-Ser-UAG-tRNA-Ser-UAA-tRNA-Gln-UAA-tRNA-Cys-UGA; or b)tRNA-Glu-UAG-tRNA-Glu-UAA-tRNA-Ser-UGA-tRNA-Gly-UGA-tRNA-Tyr-UAG-tRNA-Lys-UAA; or c) tRNA-Trp-UGA -tRNA-Trp-UAG-tRNA-Gln-UAG-tRNA-Lys-UAG-tRNA-Tyr-UAA.
[0092] The above order can be modified as needed or advantageous, for example, depending on the expression level to be achieved. It is preferable that the one or more sup-tRNAs to be most highly expressed be placed in the start region of the construct, i.e., the 5' end. Therefore, it is preferable that the one or more sup-tRNAs to be most highly expressed be placed in the synthetic DNA construct so that these sup-tRNAs are transcribed first. Particularly preferable is that the first sup-tRNA is the sup-tRNA to be highly expressed. As mentioned above, it is preferable that each sup-tRNA in the construct has its own regulatory element, in particular its own promoter. It is even more preferable that each sup-tRNA in the construct also has its own termination signal. The combination of promoter and termination signal can be selected for each sup-tRNA in the construct based on the desired expression level of the individual sup-tRNA. The synthetic DNA construct of the present invention may have, for example, the following structure: a) Promoter 1-tRNA-Arg-UGA-Terminator 1-Promoter 2-tRNA-Ser-UAG-Terminator 2-Promoter 3-tRNA-Ser-UAA-Terminator 3-Promoter 4-tRNA-Gln-UAA-Terminator 4-Promoter 5-tRNA-Cys-UGA-Terminator 5; or b) Promoter 1-tRNA-Glu-UAG-Terminator 1-Promoter 2-tRNA-Glu-UAA-Terminator 2-Promoter 3-tRNA-Ser-UGA-Terminator 3-Promoter 4-tRNA-Gly-UGA-Terminator 4-Promoter 5-tRNA-Tyr-UAG-Terminator 5-Promoter 6-tRNA-Lys-UAA-Terminator 6; or c) Promoter 1-tRNA-Trp-UGA-Terminator 1-Promoter 2-tRNA-Trp-UAG-Terminator 2-Promoter 3-tRNA-Gln-UAG-Terminator 3-Promoter 4-tRNA-Lys-UAG-Terminator 4-Promoter 5-tRNA-Tyr-UAA-Terminator 5.
[0093] As described above, the synthetic DNA construct of the present invention can contain two or more copies of the same sup-tRNA-encoding nucleic acid, for example, to enhance the expression level of nucleic acid, i.e., the expression of sup-tRNA encoded by the nucleic acid. Alternatively or in addition, the nucleic acid can be placed, for example, under the control of a high-expression promoter, i.e., a promoter that brings about high expression in a given cell. Examples of the synthetic DNA construct of the present invention that contains at least five types of nucleic acids encoding different sup-tRNAs, an additional nucleic acid encoding one of the five types of sup-tRNAs, and regulatory elements are as follows: Promoter 1 - tRNA-Arg-UGA - Terminator 1 - Promoter 2 - tRNA-Arg-UGA - Terminator 2 - Promoter 3 - tRNA-Ser-UAG - Terminator 3 - Promoter 4 - tRNA-Ser-UAA - Terminator 4 - Promoter 5 - tRNA-Gln-UAA - Terminator 5 - Promoter 6 - tRNA-Cys-UGA - Terminator 6.
[0094] In the above construct example, for the high expression of sup-tRNA-Arg-UGA, two copies of sup-tRNA-Arg-UGA are present and arranged tandemly at the beginning. Each sup-tRNA is functionally linked to a unique promoter and a unique termination signal. Promoters 1 and 2 that control the expression of sup-tRNA-Arg-UGA are preferably high-expression promoters, and the other promoters can be, for example, low-expression promoters.
[0095] Preferably, the synthetic DNA construct of the present invention contains at least one type of nucleic acid encoding tRNA, and the tRNA has a) an anticodon arm having or containing one of the sequences of SEQ ID NOs: 1 to 16, and / or b) a variable loop having or containing one of the sequences of SEQ ID NOs: 17 to 18, and / or c) a T arm having or containing one of the sequences of SEQ ID NOs: 19 to 27, and / or d) Acceptor stem having the structure 5'-GGCUCUG-rest tRNA-CAGAGUC-3' or 5'-GGCGCUG-rest tRNA-CAGCGUC-3' This includes, most preferably, at least two, three, four, five, or all of the encoded tRNAm have an anticodon arm and / or a variable loop and / or a T arm selected from one of the individual sequences described above. To avoid misunderstanding, it should be noted here that the sequences associated with the tRNA portions mentioned above, e.g., the anticodon arm, variable loop, or T arm, are identical at the DNA level to the sequences presented above and / or sequences having the sequence identification numbers shown above, except that U is replaced with T.
[0096] In a third embodiment, the present invention relates to a pharmaceutical composition comprising: a) i. a synthetic DNA construct of the present invention according to a second embodiment of the present invention; or ii. at least five, preferably five or six, different synthetic DNA constructs (wherein each synthetic DNA construct comprises a nucleic acid encoding a different suppressor transfer RNA and a DNA regulatory element functionally linked to the nucleic acid such that at least one of the five nucleic acids in the pharmaceutical composition can be expressed at an expression level different from that of the other nucleic acids in the composition, or at least one of the at least five, preferably five or six, different synthetic DNA constructs is present in the pharmaceutical composition at a higher copy number than the other synthetic DNA constructs); and b) a pharmaceutically acceptable carrier.
[0097] Any of the DNA constructs in the pharmaceutical compositions of the present invention can be configured, for example, as a gene delivery vehicle (GDV) for delivering suppressor tRNA to cells, particularly mammalian cells, such as human cells.
[0098] A pharmaceutical composition according to a third aspect of the present invention comprises i. at least one of the synthetic DNA constructs of the present invention according to a second aspect of the present invention, or ii. at least five, for example, five or six different synthetic DNA constructs, each of which comprises a nucleic acid encoding a different suppressor transfer RNA. In a pharmaceutical composition comprising at least five, for example, five or six different synthetic DNA constructs, each of the synthetic DNA constructs of the pharmaceutical composition preferably comprises a single nucleic acid encoding a suppressor transfer RNA different from the suppressor transfer RNA encoded by the nucleic acids contained in the other synthetic DNA constructs. Each of the synthetic DNA constructs is configured such that, for example, the nucleic acid encoding the suppressor transfer RNA can be individually expressed from the synthetic DNA construct, thereby, for example, the first suppressor transfer RNA is expressed at a first expression level different from all or at least some of the other suppressor transfer RNAs when introduced into living cells, for example, human cells. Alternatively, or in addition, at least one of five, for example, five or six different synthetic DNA constructs is present in the pharmaceutical composition at a higher copy number than the other synthetic DNA constructs to allow for higher expression levels of tRNA contained in the DNA construct present at a higher copy number. Furthermore, it is naturally possible to include multiple copies of the nucleic acid encoding the same tRNA in the same DNA construct or in different synthetic DNA constructs.
[0099] The pharmaceutical composition of the present invention according to this third aspect may contain any pharmaceutically acceptable excipient.
[0100] The expression level of nucleic acids can be controlled, for example, by an upstream 5' leader sequence functionally linked to a nucleic acid encoding sup-tRNA, when the nucleic acid is in a single synthetic DNA construct of the present invention according to a second aspect of the present invention, or in at least five synthetic DNA constructs combined in a pharmaceutical composition according to a third aspect of the present invention. Another or additional option is to place multiple copies of at least one of the at least five nucleic acids encoding suppressor transfer RNA within a single synthetic DNA, or to place multiple copies of the same synthetic DNA construct within a pharmaceutical composition. The copy number of the nucleic acid or DNA construct can be adjusted to match the PTC signature of the disease being treated. The following more detailed description of 5' leader sequences suitable for expression control relates to both the synthetic DNA construct of the second aspect of the present invention and the synthetic DNA construct in a pharmaceutical composition according to a third aspect of the present invention. Therefore, even if a 5' leader sequence is described below in relation only to a single DNA construct of the present invention according to a second aspect of the present invention, or to different synthetic DNA constructs included in a pharmaceutical composition according to a third aspect of the present invention, it should be noted that the description relates to both aspects.
[0101] The sequence motifs in the 5' leader sequence below cause tRNAs located downstream of the 5' leader sequence to transcribe more strongly (at higher levels) or less strongly (at lower levels) than in the absence of these motifs.
[0102] In preferred embodiments of the synthetic DNA construct according to the second aspect of the present invention, or the pharmaceutical composition according to the third aspect of the present invention, at least five nucleic acids each encode a different suppressor transfer RNA, and at least one, two, three, four, five, or all of these nucleic acids are independently of each other. a) Sequence motif TGACCTAAGTGTAAAGT, I H (Sequence No. 28), TGAGATTTCCTTCAGGTT, II H(Sequence No. 29), TATATAGTTCTGTATGAGACCACTCTTTCCC, III H (Sequence number 30), ACCATAAACGTGAAATG, I L (Sequence No. 31), TCTTTGGATTTGGGAATC, II L (Sequence ID 32, and TTATAAGTTCTGTATGAGACCACTCTTTCCC, III L Sequence motifs selected from the group consisting of (Sequence ID 33); and / or b) Sequence motif VNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND, 50nt H (Sequence No. 34) and GCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT, 50nt L A motif selected from the group consisting of (Sequence No. 35); and / or c) Sequence motif GAAATGCCTT, 10nt H1 (Sequence ID 36), GTGGGAACTA, 10nt H2 (Sequence ID 37), and GTGTTGCTTG, 10nt H3 A sequence motif selected from the group consisting of (Sequence No. 38) Functionally ligated to a 5' leader sequence containing , at least one of the nucleic acids encoding suppressor transfer RNA has a 5' leader sequence different from the other nucleic acids encoding suppressor transfer RNA.
[0103] The single synthetic DNA construct or synthetic DNA construct in a pharmaceutical composition of the present invention comprises a tRNA gene, as well as a 5' leader sequence functionally linked to the nucleic acid encoding tRNA (tRNA gene), or a DNA regulatory element containing the same, wherein the 5' leader sequence includes a sequence motif for binding of the transcription factor TFIIIB. These sequence motifs have promoter activity that can be included in the 5' leader sequence of the tRNA encoded downstream of the 5' leader sequence. In preferred embodiments, additional sequence motifs, namely A and / or B-box sequence motifs, can be included in the transfer RNA encoded downstream of the 5' leader sequence to further enhance or better control the binding of the transcription factor TFIIIC. Appropriate selection of sequence motifs and, optionally, combinations thereof, enable control of transcription and, consequently, the expression level of the downstream tRNA gene. The tRNA encoded by the nucleic acid in the construct may be, for example, an engineered tRNA having a modified anticodon capable of base-pairing with a stop codon on mRNA, and / or a modified T-arm containing the B-box sequence motif as described above. A B-box sequence could be, for example, a sequence that promotes the binding of the transcription factor TFIIIC to the tRNA gene.
[0104] In preferred embodiments of the synthetic DNA construct according to the second aspect of the present invention, or the pharmaceutical composition according to the third aspect of the present invention, the synthetic DNA construct comprises at least one of the 5' leader sequence motifs of feature a), b), or c) described above, or a combination of at least two sequence motifs independently selected from the sequence motifs of feature a), b), or c) described above. In the combination of sequence motifs, all sequence motifs can, without exception, be selected from one of the sequence motifs of feature a), b), or c), for example, from the sequence motif of feature b). Alternatively, in the combination of sequence motifs, the first sequence motif can be selected from the sequence motifs of feature a) or b), and the second sequence motif can be selected from the sequence motif of feature b). For example, the synthetic DNA construct according to the present invention comprises the sequence motif of feature a), i.e., sequence motif I L IIL III L , I H II H , and III H The DNA constructs may include a first sequence motif selected from and a second sequence motif selected from the sequence motifs of feature b). A synthetic DNA construct of a second aspect of the present invention, or a DNA construct of a pharmaceutical composition of a third aspect of the present invention, may also include a combination of three or more sequence motifs, for example, three sequence motifs independently selected from the sequence motifs of features a), b), or c). For example, those skilled in the art may further combine the above-mentioned 5' leader sequence motifs with specific A and / or B boxes, possibly contained in the D-arm or T-arm sequence, to establish better control of the expression of tRNA encoded by the nucleic acid. Preferably, the DNA constructs of the present invention do not include naturally occurring combinations of one or more 5' leader sequence motifs and the encoded tRNA.
[0105] In a first embodiment, the present invention promotes high expression of tRNA when present in the 5' leader sequence of tRNA encoded in nucleic acid, for insertion into one or more of the constructs described herein. H (TGACCTAAGTGTAAAGT, Sequence ID 28), II H (TGAGATTTCCTTCAGGTT, Sequence ID 29) and III H Three sequence motifs called (TATATAGTTCTGTATGAGACCACTCTTTCCC, SEQ ID NO: 30) promote low expression of tRNA, L (ACCATAAACGTGAAATG, Sequence ID 31), II L (TCTTTGGATTTGGGAATC, Sequence ID 32) and III L It provides three sequence motifs called (TTATAAGTTCTGTATGAGACCACTCTTTCCC, SEQ ID NO: 33). These sequence motifs can be included in the 5' leader sequence of the bound tRNA gene to control the tRNA expression level.
[0106] Preferably, array motif I H and I L are not both present in the same 5’ leader sequence. The same applies to array motif II H and II L and array motif III H and III L . Therefore, i. the 5’ leader sequence does not contain array motif I L if it contains array motif I H , and vice versa, ii. the 5’ leader sequence does not contain array motif II L if it contains array motif II H , and vice versa, iii. the 5’ leader sequence does not contain array motif III L if it contains array motif III H , and vice versa is preferred.
[0107] Preferably, array motif I L , II L , III L , I H , II H or III H , if present, is located upstream of the tRNA-encoding nucleic acid at a specific position. In particular, array motif I L and I<000has positions -66 to -50 in the 5'-3' direction and ii. When the 5' leader sequence contains array motif II H 或者 II L array motif II H 或者 II L has positions -49 to -32 in the 5'-3' direction and iii. When the 5' leader sequence contains array motif III H 或者 III L array motif III H 或者 III L has positions -31 to -1 in the 5'-3' direction and is preferably arranged as follows.
[0108] More preferably, the 5' leader sequence contains at least two array motifs selected from array motif I L 、II L 、III L 、I H 、II H 或者 III H and at least two of these array motifs are arranged in the 5'-3' direction as I H -II H 、II H -III H 、I H -III H 、I L -II L 、II L -IIIAs mentioned above, the arrangement motif is preferably in the position described, i.e., arrangement motif I L and I H In that case, it's around -66 to -50, Array Motif II L and II H In this case, -49 to -32, Array Motif III L and III H In that case, they will be positioned to occupy positions -31 to -1.
[0110] More preferably, the 5' leader sequence is sequence motif I L II L III L , I H II H or III H It includes three array motifs selected from the following. Preferably, the array motifs are arranged in the 5'-3' direction in the following order: L -II L -III L , I H -II H -III H , I H -II L -III L , I L -II H -III L , I L -II L -III H , I H -II H -III L , I H -II L -III H , or I L -II H -III H They are arranged in such a manner. Preferably, the sequence motifs are arranged directly and continuously, i.e., without nucleotides or linkers in between. Here again, the sequence motifs preferably have the positions described above.
[0111] In a preferred embodiment of the synthetic DNA construct according to the second aspect of the present invention or the pharmaceutical composition according to the third aspect of the present invention, the 5' leader sequence may have one of the sequences of SEQ ID NOs: 39 to 64 according to the following list. P1(I H -II H -III H , SEQ ID NO: 39): TGACCTAAGTGTAAAGTTGAGATTTCCTTCAGGTTTATATAGTTCTGTATGAGACCACTCTTTCCC P2(I L -II L -III L , SEQ ID NO: 40): ACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCTTTCCC P3(I H , SEQ ID NO: 41): TGACCTAAGTGTAAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN P4(II H , SEQ ID NO: 42): NNNNNNNNNNNNNNNNNTGAGATTTCCTTCAGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN P5(III H , SEQ ID NO: 43): NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATATAGTTCTGTATGAGACCACTCTTTCCC P6(I H -II H , SEQ ID NO: 44): TGACCTAAGTGTAAAGTTGAGATTTCCTTCAGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN P7(II H -III H , SEQ ID NO: 45): NNNNNNNNNNNNNNNNNNTGAATTTCCTTCAGGTTTATATAGTTCTGTATGAGACCACTCTTTCCC P8(I H -III H , Sequence ID 46): TGACCTAAGTGTAAAGTNNNNNNNNNNNNNNNNNNTATATAGTTCTGTATGAGACCACTCTTTCCC P9(I L (Sequence code 47): ACCATAAACGTGAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN P10(II L (Sequence No. 48) NNNNNNNNNNNNNNNNNTCTTTGGATTTGGGAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN P11(III L (Sequence code 49): NNNNNNNNNNNNNNNNNNNNNNNNNTTATAAGTTCTGTATGAGACCACTCTTTCCC P12(I L -II L (Sequence ID 50): ACCATAAACGTGAAATGTCTTTGGATTTGGGAATCNNNNNNNNNNNNNNNNNNNNNNN P13(II L -III L (Sequence No. 51) NNNNNNNNNNNNNNNNNTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCTTTCCC P14 (Sequence ID 52): ACCATAAACGTGAAATGNNNNNNNNNNNNNNNNTTATAAGTTCTGTATGAGACCACTCTTTCCC P15 (Sequence ID 53): TGACCTAAGTGTAAAGTTCTTTGGATTTGGGAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN P16 (Sequence ID 54): TGACCTAAGTGTAAAGTNNNNNNNNNNNNNNNNTTATAAGTTCTGTATGAGACCACTCTTTCCC P17 (Sequence ID 55): NNNNNNNNNNNNNNNNNNTGAGATTTCCTTCAGGTTTTATAAGTTCTGTATGAGACCACTCTTTCCC P18 (Sequence ID 56): ACCATAAACGTGAAATGTGAGATTTCCTTCAGGTTNNNNNNNNNNNNNNNNNNNNNNN P19 (Sequence ID 57): NNNNNNNNNNNNNNNNNTCTTTGGATTTGGGAATCTATATAGTTCTGTATGAGACCACTCTTTCCC P20 (Sequence No. 58): ACCATAAACGTGAAATGNNNNNNNNNNNNNNNNNTATATAGTTCTGTATGAGACCACTCTTTCCC P21 (Sequence ID 59): TGACCTAAGTGTAAAGTTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCTTTCCC P22 (Sequence ID 60): ACCATAAACGTGAAATGTGAGATTTCCTTCAGGTTTTATAAGTTCTGTATGAGACCACTCTTTCCC P23 (Sequence No. 61): ACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTATATAGTTCTGTATGAGACCACTCTTTTCCC P24 (Sequence ID 62): TGACCTAAGTGTAAAGTTGAGATTTCCTTCAGGTTTTATAAGTTCTGTATGAGACCACTCTTTCCC P25 (Sequence ID 63): TGACCTAAGTGTAAAGTTCTTTGGATTTGGGAATCTATATAGTTCTGTATGAGACCACTCTTTCCC P26 (Sequence ID 64): ACCATAAACGTGAAATGTGAGATTTCCTTCAGGTTTATATAGTTCTGTATGAGACCACTCTTTTCCC N represents any nucleotide (A, G, C, or T).
[0112] In preferred embodiments of the synthetic DNA construct according to the second aspect of the present invention, and of the pharmaceutical composition according to the third aspect of the present invention, the above 5' leader sequence is flanked by a linker or spacer region containing a repeat of a linker / spacer sequence at its 3' end, i.e., downstream of the tRNA gene, or at its 5' end, i.e., upstream of the tRNA gene and the above 5' leader sequence. The terms “linker” and “spacer” are used synonymously in this context. The spacer region may contain, for example, a nucleotide sequence up to 300 nt in length. The spacer region preferably contains or consists of a series of repeats of a spacer sequence of 8-12, 9-11, or 10 nucleotides, for example, a series of 10-30 repeats. An example of a suitable spacer sequence is ACTCTTTCCC (SEQ ID NO: 65). A 5' leader sequence according to the first embodiment of the synthetic DNA construct of the present invention containing such a spacer region may have, for example, the following general structure: H -II H -III H -(spacer) n , or (spacer) n -I H -II H -III H (n=10~30). The number and composition of the sequence motifs are as follows: Sequence motif I H II H III H, I L II L , and III L Preferably, the sequence has a combination of at least two or three different sequence motifs selected from and a spacer region at the 5' or 3' end of the combination, but this can vary. The term “sequence motif region” is used for a region having at least one sequence motif or combination of sequence motifs. The spacer region may be directly adjacent to the 5' or 3' end of the sequence motif region, or it may be separated from the sequence motif region by only a number of nucleotides, preferably less than 50, 40, 30, 25, 20, 15, or 10 nucleotides, in the 5' or 3' direction. The above positions are preferably adapted accordingly, in embodiments where the 5' leader sequence includes a spacer repeat, such that the 5' leader sequence extends in the 5' direction by the number of nucleotides covered by the spacer region.
[0113] In a second embodiment of the synthetic DNA construct or pharmaceutical composition of the present invention, the 5' leader sequence is 50nt H The sequence motif called (Sequence ID 34) VNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND and 50nt L It contains one sequence motif selected from the group consisting of GCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT, called (Sequence ID 35). The abbreviation has the standard meaning as shown above (see, for example, ST.26 ver. 1.5).
[0114] Array motif 50nt H This promotes higher expression of downstream tRNA genes, 50nt L This results in lower expression of downstream tRNA genes.
[0115] In this preferred embodiment of the second embodiment of the synthetic DNA construct or pharmaceutical composition of the present invention, the 5' leader sequence is a sequence motif 50nt L If it includes the sequence motif 50ntH It does not include, and vice versa.
[0116] More preferably, the sequence motif 50nt H or 50nt L It occupies the -50 to -1 position, i.e., 50nt H If such an arrangement exists, it is preferable that it occupies the -50 to -1 position in the 5'-3' direction, and 50nt L If such an array exists, it occupies positions -50 to -1 in the 5'-3' direction.
[0117] Array motif 50nt H It may have one of the following sequences. P27 (50 nt) H1 (Sequence code 66) CCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG P28 (50 nt) H2 (Sequence code 67) AGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT P29 (50 nt) H3 (Sequence No. 68) GCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA P30 (50 nt H4 (Sequence No. 69) GCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG P31 (50 nt) H5 (Sequence number 70) GGTTCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG P32 50nt H6 (Sequence number 71) CTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA P33 (50nt) H7 (Sequence ID 72) AACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT
[0118] Array motif 50nt L It may have one of the following sequences. P34 (50nt) L1 (Sequence No. 73) GCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT P35 (50nt) L4 (Sequence code 74) ATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA P36 (50nt) L5 (Sequence number 75) GCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC P37 (50 nt) L6 (Sequence code 76) AAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC P38 (50nt) L7 (Sequence code 77) CAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT
[0119] In a further preferred embodiment of the synthetic DNA construct or pharmaceutical composition of the present invention, the 5' leader sequence may include a spacer region as described below, the sequence motif I of feature a) above. L II L III L , I H II H and III H One of the sequence motifs selected from the above, immediately following in the 5'-3' direction, is the sequence motif 50nt of feature b) described above. H and 50nt L Includes an array motif selected from. In this embodiment, the array motif I of feature a) described above.H (Sequence No. 28), II H (Sequence ID 29), III H (Sequence ID 30), I L (Sequence ID 31), II L (Sequence ID 32) and III L One of the sequences (SEQ ID NO: 33) is the 50nt sequence motif of feature b) described above. H (Sequence ID 34) or 50nt L It is combined with (SEQ ID NO: 35). Preferably, in this embodiment, the sequence motif 50nt H or 50nt L Immediately following is the arrangement motif I H II H III H , I L II L or III L This continues. Any of these combinations are possible. Therefore, for example, Array Motif II L 50nt array motif L And, Array Motif II L 50nt array motif H or, arrangement motif I H 50nt array motif L Or 50nt H It is possible to combine them. Therefore, the following combinations are possible: H -50nt H I H -50nt L II H -50nt H II H -50nt L III H -50nt H III H -50nt L I L -50nt H I L -50nt L II L -50nt H II L -50nt L III L -50nt H IIIL -50nt L Therefore, in this embodiment, the 5' leader sequence includes or has sequences of the following sequence numbers 50 to 61. I H -50nt H (Sequence ID 78) TGACCTAAGTGTAAAGTVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND I H -50nt L (Sequence ID 79) TGACCTAAGTGTAAAGTGCNGGDGGCGNGTTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT II H -50nt H (Sequence ID 80) TGAGATTTCCTTCAGGTTVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND II H -50nt L (Sequence No. 81) TGAGATTTCCTTCAGGTTGCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT III H -50nt H (Sequence No. 82) TATATAGTTCTGTATGAGACCACTCTTTCCCVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND III H -50nt L (Sequence No. 83) TATATAGTTCTGTATGAGACCACTCTTTCCCGCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT I L -50nt H (Sequence No. 84) ACCATAAACGTGAAATGVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND I L -50nt L (Sequence ID 85) ACCATAAACGTGAAATGGCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT II L -50nt H (Sequence No. 86) TCTTTGGATTTGGGAATCVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND II L -50nt L (Sequence ID 87) TCTTTGGATTTGGGAATCGCNGGDGGCGNGTTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT III L -50nt H (Sequence No. 88) TTATAAGTTCTGTATGAGACCACTCTTTCCCVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND III L -50nt L (Sequence ID 89) TTATAAGTTCTGTATGAGACCACTCTTTCCCGCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT N represents any nucleotide (A, G, C, or T).
[0120] The above 50nt H and 50nt L Considering the motif arrangement (P27~P38), the 5' leader arrangement may include or have one of the following arrangements. TGACCTAAGTGTAAAGTCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG (Sequence No. 90) TGACCTAAGTGTAAAGTAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT (Sequence No. 91) TGACCTAAGTGTAAAGTGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA (Sequence No. 92) TGACCTAAGTGTAAAGTGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG (Sequence No. 93) TGACCTAAGTGTAAAGTGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG(Sequence No. 94) TGACCTAAGTGTAAAGTCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA(Sequence No. 95) TGACCTAAGTGTAAAGTAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT(Sequence ID 96) TGACCTAAGTGTAAAGTGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT(Sequence No. 97) TGACCTAAGTGTAAAGTATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA (Sequence No. 98) TGACCTAAGTGTAAAGTGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC(Sequence No. 99) TGACCTAAGTGTAAAGTAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC(Sequence ID 100) TGACCTAAGTGTAAAGTCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT(Sequence No. 101) TGAGATTTCCTTCAGGTTCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG (Sequence No. 102) TGAGATTTCCTTCAGGTTAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT (Sequence No. 103) TGAGATTTCCTTCAGGTTGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA (Sequence No. 104) TGAGATTTCCTTCAGGTTGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG (Sequence No. 105) TGAGATTTCCTTCAGGTTGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG (Sequence No. 106) TGAGATTTCCTTCAGGTTCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA(Sequence ID 107) TGAGATTTCCTTCAGGTTAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT (Sequence ID 108) TGAGATTTCCTTCAGGTTGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT (Sequence No. 109) TGAGATTTCCTTCAGGTTATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA (Sequence ID 110) TGAGATTTCCTTCAGGTTGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC (SEQ ID NO: 111) TGAGATTTCCTTCAGGTTAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC (Sequence No. 112) TGAGATTTCCTTCAGGTTCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT (Sequence No. 113) TATATAGTTCTGTATGAGACCACTCTTTCCCCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG (Sequence ID 114) TATATAGTTCTGTATGAGACCACTCTTTCCCAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT (Sequence No. 115) TATATAGTTCTGTATGAGACCACTCTTTCCCGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA (Sequence No. 116) TATATAGTTCTGTATGAGACCACTCTTTCCCGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG (Sequence ID 117) TATATAGTTCTGTATGAGACCACTCTTTCCCGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG (Sequence No. 118) TATATAGTTCTGTATGAGACCACTCTTTCCCCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA (Sequence ID 119) TATATAGTTCTGTATGAGACCACTCTTTCCCAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT(Sequence ID 120) TATATAGTTCTGTATGAGACCACTCTTTCCCGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT(Sequence No. 121) TATATAGTTCTGTATGAGACCACTCTTTCCCATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA (Sequence ID 122) TATATAGTTCTGTATGAGACCACTCTTTCCGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC (SEQ ID NO: 123) TATATAGTTCTGTATGAGACCACTCTTTCCCAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC (Sequence ID 124) TATATAGTTCTGTATGAGACCACTCTTTCCCCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT(Sequence No. 125) ACCATAAACGTGAAATGCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG (SEQ ID NO: 126) ACCATAAACGTGAAATGAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT (Sequence No. 127) ACCATAAACGTGAAATGGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA (SEQ ID NO: 128) ACCATAAACGTGAAATGGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG (Sequence No. 129) ACCATAAACGTGAAATGGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG (Sequence No. 130) ACCATAAACGTGAAATGCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA (Sequence ID 131) ACCATAAACGTGAAATGAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT (Sequence ID 132) ACCATAAACGTGAAATGGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT (Sequence No. 133) ACCATAAACGTGAAATGATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA (SEQ ID NO: 134) ACCATAAACGTGAAATGGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC (SEQ ID NO: 135) ACCATAAACGTGAAATGAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC (SEQ ID NO: 136) ACCATAAACGTGAAATGCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT (Sequence No. 137) TCTTTGGATTTGGGAATCCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG (Sequence No. 138) TCTTTGGATTTGGGAATCAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT (Sequence No. 139) TCTTTGGATTTGGGAATCGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA (Sequence No. 140) TCTTTGGATTTGGGAATCGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG (Sequence ID 141) TCTTTGGATTTGGGAATCGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG (Sequence No. 142) TCTTTGGATTTGGGAATCCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA (Sequence ID 143) TCTTTGGATTTGGGAATCAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT (Sequence ID 144) TCTTTGGATTTGGGAATCGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT (Sequence No. 145) TCTTTGGATTTGGGAATCATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA (Sequence No. 146) TCTTTGGATTTGGGAATCGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC (Sequence No. 147) TCTTTGGATTTGGGAATCAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC (Sequence No. 148) TCTTTGGATTTGGGAATCCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT (Sequence No. 149) TTATAAGTTCTGTATGAGACCACTCTTTCCCCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG (SEQ ID NO: 150) TTATAAGTTCTGTATGAGACCACTCTTTCCAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT (SEQ ID NO: 151) TTATAAGTTCTGTATGAGACCACTCTTTCCCGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA (SEQ ID NO: 152) TTATAAGTTCTGTATGAGACCACTCTTTCCCGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG (Sequence ID 153) TTATAAGTTCTGTATGAGACCACTCTTTCCCGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG (Sequence ID 154) TTATAAGTTCTGTATGAGACCACTCTTTCCCCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA (SEQ ID NO: 155) TTATAAGTTCTGTATGAGACCACTCTTTCCCAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT (Sequence ID 156) TTATAAGTTCTGTATGAGACCACTCTTTCCCGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT (Sequence No. 157) TTATAAGTTCTGTATGAGACCACTCTTTCCCATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA (Sequence No. 158) TTATAAGTTCTGTATGAGACCACTCTTTCCGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC (SEQ ID NO: 159) TTATAAGTTCTGTATGAGACCACTCTTTCCCAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC (Sequence ID 160) TTATAAGTTCTGTATGAGACCACTCTTTCCCCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT (SEQ ID NO: 161)
[0121] In a further preferred embodiment of this embodiment of the synthetic DNA construct or pharmaceutical composition according to the present invention, the 5' leader sequence is sequence motif I H II H III H One of them, and immediately following it in the 5'-3' direction, is a sequence motif of 50nt. H Includes; or arrangement motif I L II L III L One of them, and immediately following it in the 5'-3' direction, is a sequence motif of 50nt. L Includes. Array motif I H II H III H One of them, and immediately following it in the 5'-3' direction, is a sequence motif of 50nt. H The 5' leader sequence containing may contain, or may have, one of the sequences of sequence numbers 78, 80, or 82, or one of the sequences of sequence numbers 90-96, 102-108, or 114-120. Sequence motif I L II L III L One of them, and immediately following it in the 5'-3' direction, is a sequence motif of 50nt. L A 5' leader sequence containing may contain, or may have, one of the sequences of sequence numbers 85, 87, or 89, or one of the sequences of sequence numbers 133-137, 145-149, or 157-161, for example. As mentioned above, however, it is also possible to combine any one of the lower-expression motifs (represented by the subscript "L") with any higher-expression motif (represented by the subscript "H").
[0122] In a preferred embodiment of the second embodiment of the synthetic DNA construct according to the present invention, the 5' leader sequence is i) the sequence motif I of feature a) described above. H II H III H , I L II L , and III LOne of the sequence motifs selected from, and immediately thereafter, in the 5'-3' direction, a spacer region comprising or consisting of 10-30 repeats of a spacer sequence of 8-12, preferably 9-11, more preferably 10 nucleotides, and immediately thereafter, in the 5'-3' direction, the sequence motif of feature b) described above, 50 nucleotides L and 50nt H ii) a spacer region comprising or consisting of 10 to 30 repeats of a spacer sequence of 8 to 12, preferably 9 to 11, more preferably 10 nucleotides at the 5' end, and the 3' end of the 5' end of the sequence motif of feature b) described above (50 nucleotides). L and 50nt H One of the array motifs selected from is adjacent to array motif I of the above characteristic a). H II H III H , I L II L , and III L It includes one of the sequence motifs selected from. The spacer sequence may have, for example, the sequence ACTCTTTCCC (sequence number 65). The term "first sequence motif region" refers to sequence motif I H II H III H , I L II L , and III L The term "second sequence motif region" can be used for regions containing or composed of sequence motifs selected from the sequence motif 50nt L and 50nt H It can be used in a region that includes or is composed of array motifs selected from. As described above with respect to the first embodiment, the number and composition of array motifs in the first array motif region is array motif I H II H III H , I L II L , and III LA combination of at least two or three different sequence motifs selected from, a spacer region at the 5' or 3' end of the first sequence motif region, and the sequence motif 50nt of feature b) above at the 5' or 3' end of the combination L and 50nt H Preferably, the sequence motif is selected from, but can vary. The spacer region at the 5' end of the first sequence motif region may be directly adjacent to the 5' end of the first sequence motif region, or it may be separated from the sequence motif region by only a number of nucleotides in the 5' direction, preferably less than 50, 40, 30, 25, 20, 15, or 10 nucleotides.
[0123] The synthetic DNA construct of the present invention, or the pharmaceutical composition according to the present invention comprising the synthetic DNA construct of the present invention, comprises a sequence motif I arranged in a row, which may or may not include the above-described spacer region at the 5' or 3' end. L II L III L , I H II H III H Arrange any two or three of the motifs 50nt H or 50nt L It can also be combined with one of the others.
[0124] In preferred embodiments of the synthetic DNA construct of the present invention, or a pharmaceutical composition of the present invention comprising the synthetic DNA construct of the present invention, the 5' leader sequence and the encoded transfer RNA do not originate from the same tRNA if the tRNA is a natural tRNA; that is, if the nucleic acid of the synthetic DNA construct of the present invention encodes a natural transfer RNA, the 5' leader sequence does not originate from the said natural transfer RNA.
[0125] In a third embodiment of the synthetic DNA construct or pharmaceutical composition of the present invention, the 5' leader sequence of the nucleic acid encoding the transfer RNA is 10nt H1 The sequence motif GAAATGCCTT, 10nt, is called (Sequence ID 36). H2GTGGGAACTA, called (Sequence ID 37), and 10nt H3 It contains at least one sequence motif selected from GTGTTGCTTG, called (Sequence ID 38). To promote higher expression of tRNA genes located downstream of the 5' leader sequence in the synthetic DNA construct, 10nt H1 , 10nt H2 and 10nt H3 Sequence motifs known as can be advantageously used. These motifs are preferably located within the region -100 to -1 relative to the tRNA gene.
[0126] Preferably, the 5' leader sequence is a sequence motif 10nt H1 , 10nt H2 and 10nt H3 It includes at least two array motifs selected from the following. Preferably, these at least two array motifs are as follows: i.GAAATGCCTT,10nt H1 (Sequence ID 36) and GTGTTGCTTG,10nt H3 (Sequence ID 38), the sequence motif is arranged in the 5'-3' direction in the following order: GTGTTGCTTG (Sequence ID 38)-GAAATGCCTT (Sequence ID 36), i.e., 10nt H3 -10nt H1 To be placed, or ii. GAAATGCCTT,10nt H1 (Sequence ID 36) and GTGGGAACTA,10nt H2 (Sequence ID 37), the sequence motif is arranged in the 5'-3' direction in the following order: GAAATGCCTT (Sequence ID 36)-GTGGGAACTA (Sequence ID 37), i.e., 10nt H1 -10nt H2 To be placed, or iii.GTGGGAACTA,10nt H2 (Sequence ID 37) and GTGTTGCTTG,10nt H3(Sequence ID 38), the sequence motif is arranged in the 5'-3' direction in the following order: GTGTTGCTTG (Sequence ID 38)-GTGGGAACTA (Sequence ID 37), i.e., 10nt H3 -10nt H2 It will be placed there.
[0127] More preferably, in this third embodiment of the synthetic DNA construct or pharmaceutical composition of the present invention, the 5' leader sequence is all three sequence motifs GAAATGCCTT (SEQ ID NO: 36), 10nt H1 , GTGGGAACTA (Sequence No. 37), 10nt H2 , and GTGTTGCTTG (SEQ ID NO: 38), 10nt H3 Preferably, in the 5'-3' direction, in the following order: GTGTTGCTTG (SEQ ID NO: 38)-GAAATGCCTT (SEQ ID NO: 36)-GTGGGAACTA (SEQ ID NO: 37), i.e., 10nt H3 -10nt H1 -10nt H2 Includes.
[0128] In preferred embodiments of the synthetic DNA constructs or pharmaceutical compositions comprising the synthetic DNA constructs according to the present invention, each synthetic DNA construct preferably includes a termination signal on the 3' side of each encoded sup-tRNA. Preferably, in a synthetic DNA construct comprising two or more encoded sup-tRNAs, each encoded sup-tRNA is functionally linked to a unique termination signal. The termination signals assigned to the encoded sup-tRNAs may be identical or different from one another. The termination signals can be selected based on the desired expression level of each sup-tRNA and / or depending on the promoter used for the sup-tRNA. The termination signals may have, or include, the following sequences, for example: Terminator 1 (Sequence ID 162) CCTCACCACACACACAGCATCAGCACCAGAACTGAAAAAGCACATACCTTCTGCATCACCGAGCCATCTCAGCATCCTGCTCTCTGAGCGGTGGGGGGGGA Terminator 2 (Sequence ID 163) ACTTCGTCTGTAATTTTTAACCTCAATTTAATTCAATTATCCCATAAGGGGAAAGGCTTGGAGGCCTCCTGTGACTTAGCATTCGTACTGCCGTCAGTCCA Terminator 3 (Sequence ID 164) CTGATATGTGTAATGTTTCTCTTCTCAACAGTTTCATTTGGCAATTCCTATTCTTTTGTTAAATGTTTTCAGTGACGGAAATAATGGATAAATGGCCCTCT Terminator 4 (Sequence ID 165) CCGCACGGCGCGGGCAGCCCCGCCGCGCCGGCCCGGGGCTCCCACCAGCGCGCCGCCGACGCCCGGGGCAGGCCGGCCCCGACGCCCGGTCCGTCCGCCCG Terminator 5 (Sequence ID 166) CTTTACCTGTTAAAAGCTCCCTCCTTGTCCACTTACGGTGACTCAATACATTCAAGTTCCACCCACAGGAGTTCTGGCAAGCTTTGTGTTCTAAAGCCCCA Terminator 6 (Sequence ID 167) AACGTTTTTGTCTTTCCTTCTACGAAAAACTTTTCTGAGCCGGAGCCTCCAGCGCGCTGTGTATTCGTTTTACGCCTCAACGAAACTGCAGCAATACCTCA
[0129] Any of the termination signals mentioned above can be combined with any of the 5' leader sequences (promoter sequences) described above.
[0130] The tRNA encoded by the nucleic acid may be a native tRNA or an engineered tRNA, for example, a microbiologically engineered tRNA. Preferably, the tRNA is engineered to have, for example, a modified anticodon, such as an anticodon that forms a base pair with a stop codon in mRNA, or to have a D arm, anticodon arm, T arm, or acceptor stem modified as described above.
[0131] In any preferred embodiment of the synthetic DNA construct according to the present invention, the nucleic acid encoding tRNA is sequence H 54 T 55 C 56 G 57 A 58 N 59 T 60 Preferably, T 54 T 55 C 56 G 57 A 58 N 59 T 60 The B-box contains the following sequence: the index represents the nucleotide position of the transfer RNA, the position numbering follows the transfer RNA numbering rules, N represents any nucleotide (A, C, G, or T), and H represents A, C, or T. Nucleotides 54-60 are located within the T-arm of mature tRNA, forming a T-loop. tRNAs containing the B-box with the above sequence are transcribed more strongly than tRNAs lacking such a B-box. The encoded tRNA can be native or synthetic (manipulated) transfer RNA.
[0132] The nucleic acid encoding transfer RNA may also contain one or more introns. These introns may be native introns. In a preferred embodiment, the introns are inserted into the nucleic acid encoding tRNA that does not naturally contain introns. However, the tRNA encoded by the nucleic acid may also be a tRNA containing the tRNA body of a tRNA whose gene or pretRNA naturally contains one or more introns, but preferably different from the introns inserted into the nucleic acid according to the present invention. By including one or more introns, in at least some applications, it is possible to approximate native tRNA transcription using factors (enzymes) that co-modify the tRNA, resulting in more stable production of functional tRNA.
[0133] In a preferred embodiment, the encoded tRNA may be structurally modified in such a way that it has a structurally modified D arm, anticodon arm, variable loop, and / or T arm. "Structurally modified" means that the mature tRNA has a modified anticodon arm and / or variable loop and / or T arm and / or D arm, i.e., it has a different nucleotide sequence of stem or loop portion than the D arm and / or anticodon arm and / or variable loop and / or T arm of a comparable native tRNA. A "comparable" tRNA is a tRNA aminoacylated by the same aminoacyl-tRNA synthetase. Particularly preferred is that the encoded tRNA, in its mature form, includes a D arm, anticodon arm, and / or variable loop, and / or T arm that are not present in native tRNA.
[0134] To avoid unnecessary repetition, refer to the above description of structurally modified tRNA with respect to the pharmaceutical composition according to the first aspect of the present invention. All of the above tRNAs and tRNA structures can be included in any of the DNA constructs described according to the second or third aspect of the present invention. Naturally, the U nucleotides described above at the RNA level need to be replaced with T nucleotides at the DNA level.
[0135] For any tRNA encoded by any synthetic DNA construct of the present invention, the anticodon arm or at least the anticodon stem, V-loop, T-arm, or at least the T-stem, and the acceptor stem can be independently selected from the anticodon arm / stem, V-loop, T-arm / stem, and acceptor stem described above. Accordingly, the encoded tRNA may include only one of the anticodon arm / stem, V-loop, T-arm / stem, or acceptor stem described above, for example, only the anticodon arm having the sequence of SEQ ID NO: 10, or any combination thereof, for example, an anticodon arm having the sequence of SEQ ID NO: 15 and a T-arm having the sequence of SEQ ID NO: 21, or an anticodon arm having the sequence of SEQ ID NO: 10 and the acceptor stem described above.
[0136] Any synthetic DNA construct can be, for example, a synthetic vector or incorporated therein, and thus can be incorporated into, for example, any suitable biological nucleic acid delivery vehicle, particularly a delivery vehicle suitable for the delivery of nucleic acids to mammalian living cells, such as human cells. Suitable vehicles include, for example, viral vectors such as adeno-associated virus (AAV) viral vectors, nanoparticles, such as encapsulation or binding to lipid nanoparticles, and others. Preferably, the vector is a viral vector. Examples of viral vectors include adeno-associated (AAV) viruses, adenoviruses (e.g., AAV3, AAV8, or AAV9), and retroviruses (see, for example, Non-Patent Document 9; Non-Patent Document 10).
[0137] In further embodiments, the present invention relates to a pharmaceutical composition according to a first aspect of the present invention, a synthetic DNA construct according to a second aspect of the present invention, or a pharmaceutical composition according to a third aspect of the present invention, for use as a pharmaceutical agent. The pharmaceutical composition or synthetic DNA construct of the present invention is particularly useful for treating patients with diseases associated with nonsense mutations that cause the absence or dysfunction of functional proteins, i.e., immature stop codons (PTCs). Examples of such diseases for which this code can be advantageously used include Hurler syndrome (MPS I, ICD code E76.0), beta-thalassemia (ICD-10 code D56.1), neurofibromatosis type 1 (NF1, ICD-10 code Q85.0), Duchenne muscular dystrophy (DMD, ICD-10 code G71.0), Crohn's disease (CD, ICD-10 code K50), cystic fibrosis (CF, ICD-10 code E84), neuronal ceroid lipofuscinosis (NCL, ICD-10 code E75.4), spinal muscular atrophy (ICD-10 code G12.9), and Tay-Sachs disease (TSD, ICD-10 code E75.0). The DNA constructs of the present invention, such as vectors, are also useful for treating patients with diseases that are at least partially caused by tRNA sequestration leading to depletion of the cellular pool of tRNA, such as Charcot-Marie-Tooth disease (CMT, ICD-10 code DG600).
[0138] In a further embodiment, the present invention relates to a kit comprising three pharmaceutical compositions according to a first aspect of the present invention, wherein a suppressor transfer RNA present in one of the three pharmaceutical compositions is not present in any of the other two pharmaceutical compositions. Preferably, each of these three pharmaceutical compositions does not contain five or more different suppressor transfer RNAs. In a preferred embodiment, the kit comprises a first pharmaceutical composition containing five suppressor transfer RNAs, a second pharmaceutical composition containing six suppressor transfer RNAs (the suppressor transfer RNAs in the second pharmaceutical composition are different from those in the first pharmaceutical composition), and a third pharmaceutical composition containing five suppressor transfer RNAs (the suppressor transfer RNAs in the third pharmaceutical composition are different from those in the first and second pharmaceutical compositions). An example of a kit of the present invention is shown in Table 1 below.
[0139] In a further embodiment, the present invention relates to a method for treating a person having a disease associated with a nonsense (PTC) mutation, comprising administering to the person an effective amount of a pharmaceutical composition according to a first or third aspect of the present invention, or a synthetic DNA construct according to a second aspect of the present invention. In preferred embodiments, this method is for the treatment of Hurler syndrome (MPS I, ICD code E76.0), beta-thalassemia (ICD-10 code D56.1), neurofibromatosis type 1 (NF1, ICD-10 code Q85.0), Duchenne muscular dystrophy (DMD, ICD-10 code G71.0), Crohn's disease (CD, ICD-10 code K50), cystic fibrosis (CF, ICD-10 code E84), neuronal ceroid lipofuscinosis (NCL, ICD-10 code E75.4), spinal muscular atrophy (ICD-10 code G12.9), or Tay-Sachs disease (TSD, ICD-10 code E75.0).
[0140] It should be noted that when referring to tRNA structures within a DNA construct (e.g., T-arms, AC-arms, etc.), it is understood to mean the DNA sequences that encode these structures within the DNA construct. When transcribed into mature tRNA, these sequences are transcribed into RNA sequences that form the structure of the mature tRNA.
[0141] The present invention will be described below with reference to examples and accompanying drawings, for illustrative purposes only.
[0142] Figure 1 shows an example of a tRNA numbered according to conventional numbering applied to generalized “consensus” tRNA, starting at 1 at the 5' end and ending at 76 at the 3' end. This tRNA consists of 11 tRNA nucleotides and has the typical cloverleaf structure of tRNA, including an acceptor stem 2 with a CCA tail 10, a T arm 3 with a TψC loop 6, a D arm 4 with a D loop 7, and an anticodon arm 5 with a 5-nucleotide stem portion 8 and an anticodon loop 9. In such a “consensus” tRNA, the nucleotides of the natural anticodon triplet 25 are always at positions 34, 35, and 36, regardless of the actual number of preceding nucleotides. The tRNA may contain additional nucleotides between positions 1 and 34, such as between positions 45 and 46 of the D loop and variable loop 24. Additional nucleotides can be numbered by adding letters, such as 20a, 20b, etc. In variable loop 24, additional nucleotides are numbered with a preceding "e" followed by a number, depending on their position within the loop. The positions of the modified nucleotides within the tRNA of this invention are indicated by black-filled circles.
[0143] Figure 2 schematically shows an embodiment of the synthetic DNA construct according to the present invention. This construct contains six different nucleic acids (sup-tRNA1-6), each encoding a suppressor tRNA, within a single nucleic acid. Each sup-tRNA is functionally linked to a promoter, i.e., placed under a specific promoter (P1-6), and functionally linked to a termination signal (terminator, T1-6). Therefore, all sup-tRNAs can be expressed independently of each other. At least five of the encoded sup-tRNAs are different from each other. At least one of the sup-tRNAs can base-pair with the UGA stop codon, at least one of the sup-tRNAs can base-pair with the UAA stop codon, and at least one of the sup-tRNAs can base-pair with the UAG stop codon. These promoters can be identical, but preferably at least some or all of them are different from each other. Preferably, the promoter functionally linked to the sup-tRNA to be highly expressed is different from the promoter linked to the sup-tRNA to be expressed at a lower level. The same applies to Terminators. Preferably, the first sup-tRNA (tRNA1) is the sup-tRNA that should be highly expressed.
[0144] The construct schematically shown here may also contain two identical sup-tRNAs encoded in DNA, and four other sup-tRNAs (which are different from each other and also different from the two identical sup-tRNAs mentioned above). If the intention is to overexpress the duplicated sup-tRNAs in the construct, it is preferable to place them together at the start, i.e., at the positions of sup-tRNA1 and sup-tRNA2.
[0145] As an example, a construct designed for the expression of a sup-tRNA cocktail in which arginine UGA sup-tRNA is highly expressed and the remaining sup-tRNAs are low-expressed may have the following composition. Promoter expression sup-tRNA terminator P1 High sup-tRNA1: Arginine UGA T1 P2 High sup-tRNA2: Arginine UGA T2 P3 low sup-tRNA3: serine UAA T3 P4 low sup-tRNA4: Glutamine UAA T4 P5 low sup-tRNA5: serine UAG T5 P6 low sup-tRNA6: cystine UGA T6
[0146] In this construct, two copies of the arginine UGA sup-tRNA are inserted in tandem at the start. Both are placed under a promoter, which can be the same or different promoter that results in high expression. Other sup-tRNAs are placed under the control of promoters that result in low (lower) expression of the sup-tRNA, which in this case may also be the same or partially different from each other.
[0147] As another example, a construct designed for the expression of a sup-tRNA cocktail in which serine UAA sup-tRNA is highly expressed and the remaining sup-tRNAs are low-expressed may have the following composition: Promoter expression sup-tRNA terminator P1 High sup-tRNA1: Serine UAA T1 P2 high sup-tRNA2: serine UAA T2 P3 low sup-tRNA3: cystine UGA T3 P4 low sup-tRNA4: Arginine UGA T4 P5 low sup-tRNA5: serine UAG T5 P6 low sup-tRNA6: Glutamine UAA T6
[0148] Both constructs result in the production of the same cocktail of five different sup-tRNAs (arginine UGA, serine UAG, serine UAA, glutamine UAA, and cystine UGA), but in different amounts depending on the type of promoter and / or its position within the construct. [Examples]
[0149] Table 1 below shows examples of sup-tRNA compositions ("cocktails") customized to treat all possible nonsense mutations in the CFTR gene; these mutations cause a severe cystic fibrosis phenotype. CFTR has 79 PTC mutations in the codons encoding a total of nine amino acids: cysteine (UGA), glutamine (UAA / UAG), glycine (UGA), lysine (UAA / UAG), glutamic acid (UAA / UAG), arginine (UGA), serine (UGA / UAG / UAA), tryptophan (UGA / UAG), and tyrosine (UAG / UAA) (https: / / cftr2.org / ). The attributes of the stop codons are shown in parentheses. A total of three cocktails are required to suppress all mutations. Only these three formulations require approval, but they can be used to cure all CF patients with nonsense mutations.
[0150] Table 1: Example of a set of three pharmaceutical compositions (sup-tRNA "cocktails") of the present invention suitable for the treatment of cystic fibrosis: Cocktail 1 Cocktail 2 Cocktail 3 tRNAArg(UGA)5.67% tRNAGlu(UAG)6.86% tRNATrp(UGA)1.31% tRNASer(UAG)8.11% tRNAGlu(UAA)6.86% tRNATrp(UAG)1.31% tRNASer(UAA)8.11% tRNASer(UGA)8.11% tRNAGln(UAG)4.65% tRNAGln(UAA)4.65% tRNAGly(UGA)6.60% tRNALys(UAG)5.63% tRNACys(UGA)2.32% tRNATyr(UAG)2.75% tRNATyr(UAA)2.75% tRNALys(UAA) 5.63%
[0151] Each cocktail contains suppressor tRNAs that combine the constituent rules of the present invention disclosed herein. The percentages shown refer to the frequency of the corresponding amino acid affected by the PTC in the genome (representing the cumulative value of multiple codons encoding the same amino acid). This percentage should be used to determine the ratio of suppressor tRNAs in the cocktail. For example, to introduce arginine in a UGA mutation, tRNAs should be included in cocktail 1. Arg (TCA) can be used at a 95% concentration, and the remaining tRNA in Cocktail 1 should be kept at a total of 5%, according to codon frequency (percentage shown in the table). The selection of suppressor tRNA types in each cocktail is equalized by the number of identical PTCs in the CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) gene, which is involved in the pathogenesis of cystic fibrosis. In each cocktail, the selection of suppressor tRNAs was based on their frequency as PTC mutations in CFTR. For example, in Cocktail 1, arginine and serine tRNAs were the highest in the CFTR gene, followed by glutamine, and cysteine was the lowest. Similarly, in Cocktail 2, glutamine was the highest percentage and lysine was the lowest, corresponding to the PTC frequency in CFTR. In each cocktail, the selection of suppressor tRNAs was guided by the idea of adjusting the percentage of suppressors according to the frequency of PTC mutations in CFTR, while avoiding competition between identical codon attributes.
[0152] Experimental data material and method tRNA was transcribed in vitro using the T7 transcription system, as described in Non-Patent Document 11. Briefly, in vitro tRNA synthesis was performed using two partially duplicated DNA oligonucleotides encoding the corresponding tRNA sequence and having a T7 promoter upstream. Both 24 μM oligonucleotides were denatured at 95°C for 2 minutes and then aligned at room temperature in 20 mM Tris-HCl (pH 7.5) for 3 minutes. 0.4 mM dNTPs were added and incubated with 4 U / μL RevertAid reverse transcriptase (Thermo Fisher Scientific) at 37°C for 40 minutes. This dsDNA template was purified with phenol / chloroform, washed with 80% ethanol, and resuspended in DEPC-H2O.
[0153] HEK293 cells were placed in a 96-well plate at a rate of 1 × 10⁶ 4 Cells were seeded in wells and grown in Dulbecco's Modified Basic Medium (DMEM, Pan Biotech) supplemented with 10% fetal bovine serum (FBS, Pan Biotech) and 2 mM L-glutamine (Thermo Fisher Scientific). After 16–24 hours, tRNA embodiments of varying concentrations and proportions of a single tRNA in the cocktail were administered using Lipofectamine 3000 (Thermo Fisher Scientific). A corresponding amount of Lipofectamine 3000 (Thermo Fisher Scientific) was used as a control. After 4–6 hours, the medium was changed, and 2X RealTime-Glo® reagent was added to the changed medium according to the RealTime-Glo® MT cell viability assay (Promega). After 18 hours of medium change, cells were lysed with 1x Passivation Buffer (Promega), and luciferase activity was measured using a Spark microplate reader (Tecan) with the Luciferase Assay System (Promega). This is shown as a percentage of the survival rate of untreated cells, which was set at 100%.
[0154] For activity measurement, cells were grown using the same method. After 16–24 hours, cells were co-transfected in 3 replicates with various concentrations and combinations of suppressor tRNA embodiments along with a W1204X PTC-FLuc PTC reporter or WT (wild-type) Fluc plasmid and a control empty plasmid, using lipofectamine 3000 (Thermo Fisher Scientific). The PTC reporter was a luciferase gene without a start codon, with 15 codons corresponding to PTC (W1204X, X=UGA) extended to the 5' end. The transfection medium was changed after 4–6 hours. 24 hours after transfection, cells were lysed with 1x passivation buffer (Promega), and luciferase activity was measured using a luciferase assay system (Promega) with a Spark microplate reader (Tecan). Readthrough activity is shown as a percentage of wild-type luciferase activity.
[0155] result To evaluate the cytotoxicity of a tRNA embodiment consisting of multiple suppressor tRNAs, experiments were conducted using a composition containing five different suppressor tRNAs mixed in equal amounts (Figure 3A). The total concentration of suppressor tRNA was 500 ng / 10 4 Beyond the cell limit, cell viability was maintained at less than 50%, and at a concentration of 1500 ng, it fell to less than 25%. Suppressor tRNA concentration was 50 ng / 10 4 cells, 100ng / 10 4 cells, 250ng / 10 4 In the case of cells, little to no toxicity was observed (Figure 3A), therefore the maximum usable concentration is 200-250 ng / 10 4 Cells are preferred. As shown in Figure 3A, readthrough and luciferase activity rescue in PTC mutations were tested to evaluate the readthrough efficiency of suppressor tRNAs in the cocktail. Compared to wild-type luciferase, up to 11% readthrough was observed overall. In this cocktail, each tRNA reached up to 30 ng / 10 4It is present in cells, and this corresponds to the decoding efficiency exhibited at its concentration by a single functional suppressor tRNA (i.e., one whose amino acids match those of the PTC).
[0156] As shown in Figure 3A, to evaluate the read-through efficiency of suppressor tRNAs in the cocktail, we tested read-through and luciferase activity rescue in PTC mutations. Compared to wild-type luciferase, up to 11% read-through was observed overall (Figure 3B). In this cocktail, each tRNA reached a maximum of 30 ng / 10 4 It is present in cells, and this corresponds to the decoding efficiency exhibited at its concentration by a single functional suppressor tRNA (i.e., one whose amino acids match those of the PTC).
[0157] Total tRNA amounts of 100 and 200 ng / 10 4 In both cell cocktails, read-through efficiency was significantly increased with functional suppressor tRNA (i.e., one whose amino acids match those of the PTC) at a concentration equivalent to 95% of the total concentration (Figure 4A). To test the competitive effect of suppressor tRNA with anticodons matching those of the PTC at low concentrations (Figure 4A), a control experiment was conducted in which all other tRNAs were replaced with non-functional mismatched tRNAs. Notably, at this concentration, the functional suppressor tRNA was non-functional, exhibiting lower read-through activity than the native background read-through (Figure 4B), suggesting that other low concentrations of suppressors matching those of the PTC do not interfere with the major functional tRNA in the cocktail.
Claims
1. At least five different suppressor transfer RNAs, here, a) At least one of the suppressor transfer RNAs can form a base pair with the UGA stop codon, at least one of the suppressor transfer RNAs can form a base pair with the UAA stop codon, and at least one of the suppressor transfer RNAs can form a base pair with the UAG stop codon; b) The suppressor transfer RNAs are not all present in the composition in equal amounts; and a pharmaceutically acceptable carrier A pharmaceutical composition characterized by the following features.
2. The at least five types of suppressor transfer RNAs are tRNA-Arg-UR 1 R 2 、tRNA-Ser-UR 1 R 2 、tRNA-Gln-UR 1 R 2 、tRNA-Cys-UR 1 R 2 、tRNA-Glu-UR 1 R 2 、tRNA-Gly-UR 1 R 2 、tRNA-Tyr-UR 1 R 2 、tRNA-Lys-UR 1 R 2 、tRNA-Trp-UR 1 R 2 、and tRNA-Leu-UR 1 R 2 selected from the group of suppressor transfer RNAs consisting of, where R 1 and R 2 are independently A or G, provided that R 1 and R 2 are not both G, preferably selected from the group of suppressor transfer RNAs consisting of tRNA-Arg-UGA, tRNA-Ser-UAG, tRNA-Ser-UAA, tRNA-Ser-UGA, tRNA-Gln-UAA, tRNA-Gln-UAG, tRNA-Cys-UGA, tRNA-Glu-UAG, tRNA-Glu-UAA, tRNA-Gly-UGA, tRNA-Tyr-UAG, tRNA-Tyr-UAA, tRNA-Lys-UAA, tRNA-Lys-UAG, tRNA-Trp-UGA, tRNA-Trp-UAG, tRNA-Leu-UGA, tRNA-Leu-UAA, and tRNA-Leu-UAG The pharmaceutical composition according to claim 1.
3. The composition comprises three or fewer suppressor transfer RNAs that form base pairs with the same stop codon; however, if the composition comprises two or more suppressor transfer RNAs that form base pairs with the same stop codon, the suppressor transfer RNAs that form base pairs with the same stop codon have different homologous amino acids and preferably have a tRNA body or a part thereof derived solely from non-homologous tRNA. The pharmaceutical composition according to claim 1 or 2.
4. The composition comprises five or six types of suppressor transfer RNA, preferably five or six or fewer types of suppressor transfer RNA, and the composition comprises the following suppressor tRNAs: The r-!!AA、t444-,lm-!A。、およびt28A4tm-!? or b) tRNA-Glu-UAG, tRNA-Glu-UAA, tRNA-Ser-UGA, tRNA-Gly-UGA, tRNA-Tyr-UAG, and tRNA-Lys-UAA; or c) tRNA-Trp-UGA, tRNA-Trp-UAG, tRNA-Gln-UAG, tRNA-Lys-UAG, and tRNA-Tyr-UAA including A pharmaceutical composition according to any one of claims 1 to 3.
5. The proportion of each suppressor transfer RNA in the composition is adjusted so that the first suppressor transfer RNA, configured to suppress the most frequent PTC mutations in a given target gene, is present in the largest proportion of the composition, while the second, third, fourth, and subsequent suppressor transfer RNAs, configured to suppress less frequent PTCs, are present in the composition in correspondingly lower proportions depending on the frequency of the target PTCs in the target gene. A pharmaceutical composition according to any one of claims 1 to 4.
6. The proportion of suppressor transfer RNA present in the composition that targets PTCs at a frequency of at least 0.5% in the target gene is at least 95% by weight of the total suppressor transfer RNA present in the composition. The pharmaceutical composition according to claim 5.
7. a) at least five nucleic acids, each encoding a different suppressor transfer RNA; and b) a DNA regulatory element functionally linked to at least one of the five nucleic acids so as to be expressible independently of the other nucleic acids in the construct. A synthetic DNA construct characterized by the following features.
8. i. A synthetic DNA construct according to claim 7, or ii. a) at least five different synthetic DNA constructs, each of which comprises a nucleic acid encoding a different suppressor transfer RNA and a DNA regulatory element functionally linked to the nucleic acid such that at least one of the five nucleic acids in the pharmaceutical composition is expressible at an expression level different from the expression levels of the other nucleic acids in the composition, or at least one of the at least five different synthetic DNA constructs is present in the pharmaceutical composition at a higher copy number than the other synthetic DNA constructs, and b) comprising a pharmaceutically acceptable carrier. A pharmaceutical composition characterized by the following features.
9. Each of the five nucleic acids codes for a different transfer RNA, and at least one, two, three, four, five, or all of the nucleic acids are functionally linked to a 5' leader sequence, and the 5' leader sequence is a) Sequence motif TGACCTAAGTGTAAAAGT, I H (Sequence No. 28), TGAGATTTCCTTCAGGTT, II H (Sequence No. 29), TATATAGTTCCTGTTAGAGAACCACTCTTTCCCC, III H (Sequence ID 30), ACCATAAACGTGAAAATG, I L (Sequence No. 31), TCTTTGGGATTGGGAATC, II L (Sequence ID 32), and TTATAAGTTCTGTTAGAGAACCACTCTTTCC, III L Sequence motifs selected from the group consisting of (Sequence ID 33); and / or b) Sequence motif VNANANTTVHANANNTTTNNNATRANAATTCNGDGVGNAANATABTNCTVGND, 50nt H (Sequence No. 34) and GCNGGDGGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNNCNTCGGT, 50nt L Sequence motifs selected from the group consisting of (Sequence ID 35); and / or c) Sequence motif GAAATGCCTT, 10nt H1 (Sequence ID 36), GTGGGAACTA 10nt H2 (Sequence ID 37), and GTGTTGCTTG 10nt H3 Sequence motif selected from the group consisting of (Sequence No. 38) The nucleic acids comprising the suppressor transfer RNA have a 5' leader sequence different from the other nucleic acids encoding the suppressor transfer RNA. A synthetic DNA construct according to claim 7 or a pharmaceutical composition according to claim 8.
10. aa) Regarding the above a), i. The 5' leader sequence is sequence motif I L If it includes, sequence motif I H It does not include, and vice versa, and the 5' leader sequence is sequence motif I H Or I L If it includes one of the following, then the sequence motif I H Or I L It preferably has a position of -66 to -50 in the 5'-3' direction; ii. The aforementioned 5' leader sequence is sequence motif II L If it includes, Array Motif II H It does not include, and vice versa, and the 5' leader sequence is sequence motif II H Or II L If one of the following is included, then the arrangement motif II H Or II L It preferably has positions -49 to -32 in the 5'-3' direction. iii. The 5' leader sequence is sequence motif III. L If it includes, Array Motif III H It does not include, and vice versa, and the 5' leader sequence is sequence motif III H Or III L If one of them is included, then the array motif III H Or III L It preferably has positions -31 to -1 in the 5'-3' direction; or, bb) Regarding the above b), the 5' leader sequence is the sequence motif 50nt L If it includes, the sequence motif 50nt H It does not include, and vice versa, and the 5' leader array is the array motif 50nt H Or 50 nt L If one of the following is included, the sequence motif 50nt H Or 50 nt L It preferably has a position of -50 to -1 in the 5'-3' direction. The synthetic DNA construct or pharmaceutical composition according to claim 9.
11. The aforementioned 5' leader arrangement is aa) Regarding the above a), arrangement motif I L II L , III L , I H II H or III H At least two array motifs selected from, where the at least two array motifs are in the 5'–3' direction, I H -II H II H -III H , I H -III H , I L -II L II L -III L , I L -III L , I H -II L , I H -III L II H -III L , I L -II H II L -III H , or I L -III H They are arranged in the following order; or, cc) Regarding c) above, array motif 10 nt H1 , 10 nt H2 , and 10 nt H3 among at least two of the array motifs, the at least two array motifs are i. GAAATGCCTT, 10nt H1 (Sequence No. 9) and GTGTTGCTTG, 10nt H3 (Sequence ID 11), where the sequence motif is arranged in the 5'-3' direction in the following order: 10nt H3 -10nt H1 To be placed in, or ii. GAAATGCCTT, 10 nt H1 (SEQ ID NO: 9) and GTGGGACTTA, 10 nt H2 (SEQ ID NO: 10), wherein said array motif is in the 5'-3' direction, in the following order: 10 nt H1 -10 nt H2 is arranged in, or iii. GTGGGAACTA, 10nt H2 (Sequence number 10), and GTGTTGCTTG, 10nt H3 (Sequence ID 11), where the sequence motif is arranged in the 5'-3' direction in the following order: 10nt H3 -10nt H2 Placed including The synthetic DNA construct or pharmaceutical composition according to claim 9 or 10.
12. The aforementioned 5' leader arrangement is aa) Regarding the above a), arrangement motif I L II L , III L , I H II H Or III H Three array motifs selected from, preferably in the 5'-3' direction, in the following order: L -II L -III L , I H -II H -III H , I H -II L -III L , I L -II H -III L , I L -II L -III H , I H -II H -III L , I H -II L -III H , or I L -II H -III H ;or, cc) Regarding the above c), three sequence motifs 10nt H1 , 10nt H2 , and 10nt H3 All of them, preferably in the 5'-3' direction, in the following order: 10nt H3 -10nt H1 -10nt H2 including A synthetic DNA construct or pharmaceutical composition according to any one of claims 9 to 11.
13. The aforementioned 5' leader arrangement is the arrangement motif I of feature a). H II H , III H , I L II L , and III L One of the sequence motifs selected from and immediately following it in the 5'-3' direction is the sequence motif 50nt of feature b). L and 50nt H Includes one of the array motifs selected from A synthetic DNA construct or pharmaceutical composition according to any one of claims 9 to 11.
14. The 5' leader sequence includes or has one of the sequences of sequence numbers 78 to 89, preferably one of the sequences of sequence numbers 90 to 161. The synthetic DNA construct or pharmaceutical composition according to claim 13.
15. The aforementioned 5' leader array is array motif I H II H , III H , one of them and immediately following it in the 5'-3' direction, an array motif 50nt H ; or arrangement motif I L II L , III L One of them and immediately following it in the 5'-3' direction is an array motif 50nt L including The synthetic DNA construct or pharmaceutical composition according to claim 13.
16. The aforementioned 5' leader array is the array motif I of the above-described feature a). H II H , III H , I L II L , and III L A spacer region comprising one of the sequence motifs selected from, and immediately following it in the 5'-3' direction, 10 to 30 repeats of a spacer sequence of 8 to 12, preferably 9 to 11, more preferably 10 nucleotides, and immediately following it in the 5'-3' direction, the sequence motif 50 nt of feature b) described above L and 50nt H Includes one of the array motifs selected from A synthetic DNA construct or pharmaceutical composition according to any one of claims 9 to 11.
17. The nucleic acid encodes a native transfer RNA, and the 5' leader sequence does not originate from the native transfer RNA. A synthetic DNA construct or pharmaceutical composition according to any one of claims 9 to 16.
18. The aforementioned 5' leader arrangement is aa) Regarding the above a), one of the sequences from sequence numbers 39 to 64, bb) Regarding the above b), one of the sequences from sequence numbers 66 to 77, Having or including A synthetic DNA construct or pharmaceutical composition according to any one of claims 9 to 17.
19. Array H 54 T 55 C 56 G 57 A 58 N 59 T 60 Preferably, T 54 T 55 C 56 G 57 A 58 N 59 T 60 Further includes a coding sequence of natural or synthetic transfer RNA containing a B-box (where the index represents the nucleotide position of the transfer RNA, and the position numbering follows the transfer RNA numbering rules). A synthetic DNA construct or pharmaceutical composition according to any one of claims 9 to 18.
20. A pharmaceutical composition according to any one of claims 1 to 6, a synthetic DNA construct according to any one of claims 7, 9 to 19, or a pharmaceutical composition according to any one of claims 8 to 19, for use as a pharmaceutical agent.
21. A pharmaceutical composition according to any one of claims 1 to 6, a synthetic DNA construct according to any one of claims 7, 9 to 19, or a pharmaceutical composition according to any one of claims 8 to 19, for use as a drug in a disease at least partially caused by immature stop codons, PTCs, which result in the production of a protein that is dysfunctional or non-functional compared to the wild-type protein.