Compositions and methods for the treatment of abnormal hemoglobin disorders

The CRISPR/Cas9 system with gRNA targeting the BCL11A gene enhances fetal hemoglobin expression in hematopoietic stem cells, addressing the inadequacies of current treatments for abnormal hemoglobin disorders.

JP7851081B2Active Publication Date: 2026-04-24NOVARTIS AG +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2021096653
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2016-06-08
Filing Date
2021-06-09
Publication Date
2026-04-24
Estimated Expiration
2036-12-26

AI Technical Summary

Technical Problem

Current treatments for abnormal hemoglobin disorders such as sickle cell anemia and beta-thalassemia are inadequate in effectively increasing fetal hemoglobin expression in hematopoietic stem cells.

Method used

Utilizing a CRISPR/Cas9 system with gRNA molecules targeting the BCL11A gene and its enhancers to modify hematopoietic stem cells, enhancing fetal hemoglobin expression.

Benefits of technology

The CRISPR/Cas9 system effectively increases fetal hemoglobin expression, potentially treating abnormal hemoglobin disorders by modifying hematopoietic stem cells to improve clinical outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007851081000239
    Figure 0007851081000239
  • Figure 0007851081000240
    Figure 0007851081000240
  • Figure 0007851081000241
    Figure 0007851081000241
Patent Text Reader

Abstract

To provide genome editing systems, reagents and methods for treatment of hemoglobinopathies.SOLUTION: Genome editing systems are provided, comprising: a gRNA molecule comprising a targeting domain that is complementary with a target sequence of a BCL11A gene, a BCL11a enhancer, or a HFPH region; and a Cas9 molecule.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related applications This application is based on U.S. Provisional Patent Application No. 62 / 271,968, filed on December 28, 2015. The specification and U.S. Provisional Patent Application No. 62 / 347,48 filed on June 8, 2016. Priority is claimed to the specification No. 4. The entire contents of these applications are referred to herein by reference. It is used in conjunction with [the text]. [Background technology]

[0002] CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats (Clustered Regular Intervals) Short palindromic repeats are used by bacteria to defend against viral attacks. It evolved as an adaptive immune system. When exposed to a virus, short segments of viral DNA... The virus is incorporated into the CRISPR locus of the bacterial genome. RNA is transcribed from a portion of the R locus. This R locus contains a sequence complementary to the viral genome. NA mediates the targeting of the Cas9 protein to sequences in the viral genome. The AS9 protein cleaves the viral target, thereby silencing it.

[0003] In recent years, this CRISPR / Cas system has been applied to genome editing in eukaryotic cells. This is achieved by introducing site-directed single-strand breaks (SSBs) or double-strand breaks (DSBs). For example, using non-homologous end joining (NHEJ) or homologous recombination repair (HDR) to target the sequence It becomes possible to modify it. [Overview of the Initiative] [Means for solving the problem]

[0004] Although not bound by theory, the present invention is, in part, described herein, for example. Using a CRISPR system as described, such as the Cas9 CRISPR system This increases fetal hemoglobin (HbF) expression and / or β-globin (e.g.) For example, the expression of the β-globin gene (which has a disease-causing mutation) decreases in cells (for example) If so, hematopoietic stem cells / progenitor cells (HSPCs) can be modified, and such cells can be used By doing so, it can treat abnormal hemoglobin disorders, such as sickle cell anemia and beta-thalassemia. It is based on the discovery of obtaining something.

[0005] Therefore, in one embodiment, the present invention relates to the gRNA fraction as described herein. A CRISPR system containing one or more children, for example, one child (e.g., Cas CRISPR system) Stems, for example, Cas9 CRISPR system, for example, Streptococcus pyogenes (S. pyog We provide the Cas9 CRISPR system. In the methods and cells described in this specification, none of the gRNA molecules described herein may be used. It can be used.

[0006] In one aspect, the present invention provides a gRNA molecule comprising tracr and crRNA. Here, crRNA is the BCL11A gene, BCL11a enhancer, or HF. It contains a targeting domain complementary to the target sequence in the PH region.

[0007] In another embodiment, the present invention relates to a target sequence complementary to the BCL11A gene, for example, BC Within the L11a code region (for example, within a BCL11a exon, for example, a BCL11a exon) The present invention provides a gRNA molecule containing a targeting domain complementary to the target sequence in (2). In this context, this gRNA corresponds to SEQ ID NOs. 1-85 or SEQ ID NOs. 400-12. Includes, for example, a targeting domain consisting of one of the 31.

[0008] In another embodiment, the present invention provides complementary targeting of the target sequence of the BCL11A enhancer. This provides a gRNA molecule containing a domain.

[0009] In this embodiment, the gRNA is one of the sequence numbers 1232 to 1499. Includes, for example, a targeting domain consisting of such domains.

[0010] In this embodiment, the gRNA for the target sequence of the BCL11a enhancer is BCL This is a gRNA for the target sequence within the +58 region of the 11a enhancer, and the targeting domain This is either sequence numbers 182-277 or sequence numbers 334-341. It includes one, for example, consisting of one. In this embodiment, the targeting domain is Sequence ID No. 34 1, SEQ ID NO: 246, SEQ ID NO: 248, SEQ ID NO: 247, SEQ ID NO: 245, SEQ ID NO: 24 9, SEQ ID NO: 244, SEQ ID NO: 199, SEQ ID NO: 251, SEQ ID NO: 250, SEQ ID NO: 33 4. Any of the following: SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO: 336, or SEQ ID NO: 337 or including one, for example, consisting of the same. In the embodiment, the targeting domain is Sequence ID No. 2 For example, it includes 48. In one embodiment, the targeting domain is SEQ ID NO: 24 For example, it includes 7. In one embodiment, the targeting domain is SEQ ID NO: 245 This includes, for example, consisting of the same. In this embodiment, the targeting domain is sequence number 336 Includes, for example, consisting of. In an embodiment, the targeting domain includes SEQ ID NO: 337 For example, it consists of the following. In this embodiment, the targeting domain includes SEQ ID NO: 338 , for example, consists of the same. In the embodiment, the targeting domain includes SEQ ID NO: 335, For example, it consists of the following. In an embodiment, the targeting domain includes, for example, SEQ ID NO: 252. For example, it consists of that. In one embodiment, the gRNA is, for example, from 5' to 3', sequence number crRNA including, for example, number 248-sequence number 6607, and, for example, from 5' At 3', a dgRNA containing, for example, tracr consisting of sequence number 6660. Yes. In one embodiment, the gRNA is, for example, 5' to 3', with the sequence number 247- For example, a crRNA containing sequence number 6607, and for example, a sequence from 5' to 3'. This is a dgRNA containing, for example, tracr consisting of the number 6660. In the application form, the gRNA molecule is an sgRNA molecule, for example, from 5' to 3', the sequence number For example, including sequence number 338-SEQ ID NO: 6604-UUUU. In one embodiment, Furthermore, gRNA molecules are sgRNA molecules, for example, from 5' to 3', SEQ ID NO: 335- For example, including sequence number 6604-UUUU. In one embodiment, gR NA molecules are sgRNA molecules, for example, from 5' to 3', SEQ ID NOs: 336-6 For example, it consists of 604-UUUU. In one embodiment, the gRNA molecule is It is an sgRNA molecule, for example, from 5' to 3', SEQ ID NOs: 245-6604-U For example, it consists of UUU. In one embodiment, the gRNA molecule is sgRNA. It is a molecule, for example, containing SEQ ID NOs: 337-6604-UUUU from 5' to 3'. For example, it consists of such a molecule. In one embodiment, the gRNA molecule is an sgRNA molecule. For example, from 5' to 3', including sequence numbers 252-6604-UUUU, for example It consists of that.

[0011] In this embodiment, the gRNA for the target sequence of the BCL11a enhancer is BCL This is a gRNA for the target sequence within the +62 region of the 11a enhancer, and the targeting domain This includes, for example, one of sequence numbers 278 through 333. Morphologically, the targeting domains are sequence numbers 318, 312, and 313. Sequence ID 294, Sequence ID 310, Sequence ID 319, Sequence ID 298, Sequence ID 322, SEQ ID NOs: 311, 315, 290, 317, 309, For example, a sequence containing either sequence number 289 or sequence number 281. In the application form, the targeting domain includes, for example, sequence number 318.

[0012] In this embodiment, the gRNA for the target sequence of the BCL11a enhancer is BCL This is a gRNA for the target sequence within the +55 region of the 11a enhancer, and the targeting domain This includes, for example, one of sequence numbers 1596 through 1691. In this embodiment, the targeting domains are SEQ ID NO: 1683, SEQ ID NO: 1638, SEQ ID NO: 1647, SEQ ID NO: 1609, SEQ ID NO: 1621, SEQ ID NO: 1617, SEQ ID NO: 1654 , Sequence ID 1631, Sequence ID 1620, Sequence ID 1637, Sequence ID 1612, Sequence Number Code 1656, Sequence ID 1619, Sequence ID 1675, Sequence ID 1645, Sequence ID 159 8. Sequence ID 1599, Sequence ID 1663, Sequence ID 1677, or Sequence ID 1626 For example, it includes one of the following, or consists of one of them.

[0013] In another embodiment, the present invention targets the hereditary hyperfetal hemoglobinemia (HPFH) region. The present invention provides a gRNA molecule containing a targeting domain complementary to its sequence. In one embodiment, The HPFH region is a French-type HPFH region. In the embodiment, the targeting domain is Either SEQ ID NOs. 86-181 or SEQ ID NOs. 1500-1595 For example, it includes, or consists of. In the embodiment, the targeting domain is sequence number 100 , SEQ ID NO: 165, SEQ ID NO: 113, SEQ ID NO: 99, SEQ ID NO: 112, SEQ ID NO: 98, Distribution Column number 1580, Sequence ID 106, Sequence ID 1503, Sequence ID 1589, Sequence ID 16 0, SEQ ID NO: 1537, SEQ ID NO: 159, SEQ ID NO: 101, SEQ ID NO: 162, SEQ ID NO: 1 04, SEQ ID NO: 138, SEQ ID NO: 1536, SEQ ID NO: 1539, SEQ ID NO: 1585 It includes, for example, one of the following. In the embodiment, the targeting domain is the sequence number. For example, consisting of 100. In this embodiment, the targeting domain is SEQ ID NO: 1 For example, it includes 65, or consists of the same. In this embodiment, the targeting domain is sequence number 11 For example, consisting of 3.

[0014] In any of the embodiments described above, the gRNA molecule has the region described herein and It may further have the properties of a gRNA molecule (e.g., the aforementioned state The gRNA molecule (either of the above or the embodiment) has a targeting domain sequence described. Choose any one of 17, 18, 19, 20, 21, 22, 23, or 24 consecutive nucleic acids Includes, for example, a targeting domain consisting thereof. In an embodiment, the targeting 17, 18, 19, 20, 21, 22, 23, or 24 of any one of the domain sequences The following consecutive nucleic acids are located at the 3' end of the described targeting domain sequence: 17, 18 These are 19, 20, 21, 22, 23, or 24 consecutive nucleic acids. Then, one of the targeting domain sequences described is 17, 18, 19, 20, 21, 2 2, 23, or 24 consecutive nucleic acids are located at the 5' end of the described targeting domain sequence. With 17, 18, 19, 20, 21, 22, 23, or 24 consecutive nucleic acids arranged in a sequence Yes. In an embodiment, one of the targeting domain sequences described 17, 18, 19, 20, 21, 22, 23, or 24 consecutive nucleic acids are used in the described targeted domain It does not contain either the 5' nucleic acid or the 3' nucleic acid of the in sequence. In the case of misalignment, the targeting domain may consist of the described targeting domain sequence.

[0015] In any of the embodiments and models described above, the gRNA molecule The targeting domain is one of the 17, 18, of the described targeting domain sequences. 19, 20, 21 (if present in the reference array), 22 (if present in the reference array), 23 (If present in the reference array), 24 (If present in the reference array), or 25 (Reference array (If present) Contains 1 consecutive nucleic acid. In other embodiments of the gRNA molecule, including those described, the targeting domain is the target of the described target. One of the domain sequences 17, 18, 19, 20, 21 (where present in the reference sequence) (combined), 22 (if present in the reference array), 23 (if present in the reference array), or 24 (If present in the reference sequence), or 25 consecutive nucleic acids (if present in the reference sequence) This comprises the implementation of a gRNA molecule, including any of the embodiments and models described above. Morphologically, any one of the described target domain sequences 17, 18, 19, 20 , 21 (if present in the reference array), 22 (if present in the reference array), 23 (reference array (if present in the reference array), or 24 (if present in the reference array), or 25 (if present in the reference array) If present, the following consecutive nucleic acids are located at the 3' end of the described targeting domain sequence. 17, 18, 19, 20, 21 (if present in the reference array), 22 (if present in the reference array) If (if present), 23 (if present in the reference array), or 24 (if present in the reference array), or 25 consecutive nucleic acids (if present in the reference sequence). The aforementioned embodiments and embodiments In other embodiments of the gRNA molecule, including those in any of its forms, the mark described is One of the targeting domain sequences 17, 18, 19, 20, 21 (present in the reference sequence) (if), 22 (if present in the reference array), 23 (if present in the reference array), or 2 4 (if present in the reference sequence) or 25 (if present in the reference sequence) consecutive kernels The acid is located at the 5' end of the described targeting domain sequence, 17, 18, 19, 20. 21 (if present in the reference array), 22 (if present in the reference array), 23 (if present in the reference array) (if present in the reference array), or 24 (if present in the reference array), or 25 (if present in the reference array) (In this case) It is a sequence of nucleic acids. In addition, any of the targeting domain sequences described in other embodiments of the gRNA molecule. One 17, 18, 19, 20, 21 (if present in the reference array), 22 (if present in the reference array) 23 (if present in the reference array), or 24 (if present in the reference array) ), or 25 (if present in the reference sequence) consecutive nucleic acids, are the targeted domain described. It does not contain either the 5' nucleic acid or the 3' nucleic acid of the in sequence.

[0016] In some embodiments, including those described in any of the aforementioned aspects or embodiments, gRNA The molecules hybridize to form a flagpole containing sequence numbers 6584 or 6585. It contains a portion of the crRNA and a portion of tracr. In the embodiment, the flag The pole is the first flagpole extension located at the 3' end of the crRNA portion of the flagpole. Further including an elongated portion, the first flagpole extension portion includes sequence number 6586. Implementation form In this state, the flagpole is located at the 3' end of the crRNA portion of the flagpole. The second flagpole extension section, and the first flagpole extension section if present, The second flagpole extension part includes sequence number 6587.

[0017] In some embodiments, including those described above, the present invention is real. including, for example, a tracr containing sequence number 6660 or sequence number 6661. Provides a gRNA molecule. In one embodiment, the crRNA portion of the flagpole is sequence Includes number 6607 or sequence number 6608.

[0018] In some embodiments, including those described above, the present invention is real. , tracr containing sequence number 6589 or 6590, and optionally, the first flag point If a rib extension is present, the first rib located on the 5' side of sequence number 6589 or 6590 A tracr extension portion comprising a first tracr extension portion including sequence number 6591. This provides a gRNA molecule.

[0019] In some embodiments, including those described above, the present invention is real. , gRNA molecules in which the targeting domain and tracr are located on separate nucleic acid molecules (for example, It provides dgRNA molecules.

[0020] In some embodiments, including those described above, the present invention is real. The targeting domain and tracr are located on a single nucleic acid molecule, where tracr is the targeting domain. Provides a gRNA molecule (e.g., an sgRNA molecule) positioned on the 3' side of the targeting domain. In the embodiment, the sgRNA molecule has the targeting domain at the 3' end and the tracr at the 5' end. Loops placed on the side, for example, a loop containing array index 6588, for example, a loop consisting of such loops include.

[0021] In some embodiments, including those described above, the present invention is real. , from 5' to 3', [targeting domain]-: (a) Sequence ID 6601; (b) Sequence ID 6602; (c) Sequence ID 6603; (d) Sequence ID 6604; or (e) 1, 2, 3, 4, 5, 6 or 7 uracil (U) nucleotides, for example 4 gR containing any of the above (a) to (d) further containing a uracil nucleotide at the 3' end Provides an NA molecule. In an embodiment, a targeting domain and any of (a) to (e) There are no intervening nucleotides between the sequences.

[0022] In another embodiment, the present invention relates to a gRNA molecule of any of the embodiments and models described above. One or more CRISPR systems, for example, one including a Cas CRISPR system. For example, the Cas9 CRISPR system, for example, Streptococcus pyogenes (S. pyogenes) s) Provides a Cas9 CRISPR system. In one embodiment, the present invention provides the aforementioned A first gRNA molecule comprising any of the embodiments and further comprising a Cas9 molecule The present invention provides a composition. In one embodiment, the Cas9 molecule is active or inactivated Streptococcus pyogenes. (s.pyogenes)Cas9. In an embodiment, the first gRNA molecule and The Cas9 molecule is located within the ribonucleoprotein complex (RNP).

[0023] In another embodiment, the present invention relates to a gRNA comprising two or more gRNAs, for example, as described herein. For example, an embodiment or implementation of the aforementioned gRNA molecule comprising two or more gRNA molecules as described above. The present invention provides a composition containing two or more gRNA molecules of any form. In aspect, the present invention relates to a second gRNA molecule; a second gRNA molecule and a third gRNA A molecule; or a second gRNA molecule, a third gRNA molecule, and a fourth gRNA molecule Furthermore, the present invention provides a composition that includes any of the embodiments and models of the aforementioned compositions, where, The second gRNA molecule, the third gRNA molecule (if present), and the fourth gRNA molecule (If present) gRNA molecules as described herein, for example, the aforementioned gR It is a gRNA molecule of any form or embodiment of an NA molecule. In one embodiment, Each gRNA molecule in this composition is complementary to a different target sequence. In one embodiment, Each gRNA molecule is complementary to a target sequence within the same gene or region. In some cases, Then, the first gRNA molecule, the second gRNA molecule, and the third gRNA molecule (if present), And the fourth gRNA molecule (if present) is less than 20,000 nucleotides, 1,000 0 nucleotides or less, 6000 or less, 5000 nucleotides or less, 4000 or less, 100 Less than 0 nucleotides, less than 500 nucleotides, less than 400 nucleotides, less than 300 nucleotides Below ostido, below 200 nucleotides, below 100 nucleotides, below 90 nucleotides , 80 nucleotides or less, 70 nucleotides or less, 60 nucleotides or less, 50 nucleos Less than 100, less than 40 nucleotides, less than 30 nucleotides, less than 20 nucleotides or It is complementary to target sequences located 10 nucleotides or less apart. In another embodiment, each of the compositions gRNA molecules are complementary to target sequences within different genes or regions.

[0024] Specific and preferred combinations of two or more gRNA molecules of the present invention are described herein. In one embodiment, the composition comprises a first gRNA molecule and a second gRNA molecule. Here, the first gRNA molecule and the second gRNA molecule are complementary to different target sequences. , and: (a) From the gRNA molecules described herein (e.g., above) for the BCL11a gene Will they be selected independently? (b) +58 g as described herein (for example above) for BCL11a enhancer Is it selected independently of RNA molecules? (c)+62 g as described herein (for example above) for BCL11a enhancer Is it selected independently of RNA molecules? (d) +55 g as described herein (for example above) for BCL11a enhancer Selected independently of RNA molecules; or (e) Independent of the gRNA molecules described herein (e.g., above) for the HPFH region It is selected.

[0025] In one embodiment, the composition comprises a first gRNA molecule and a second gRNA molecule, Thus, the first gRNA molecule and the second gRNA molecule are complementary to different target sequences, Call: (a) The first gRNA molecule is the one specified herein for the BCL11a gene (e.g., above). Selected from the listed gRNA molecules, and the second gRNA molecule is +58 BCL11a enhancement Selected from the gRNA molecules described herein (e.g., above) for the sensor; (b) The first gRNA molecule is the one specified herein for the BCL11a gene (e.g., above). Selected from the listed gRNA molecules, and the second gRNA molecule is +62 BCL11a enhancement Selected from the gRNA molecules described herein (e.g., above) for the sensor; (c) The first gRNA molecule is the one specified herein for the BCL11a gene (e.g., above). Selected from the listed gRNA molecules, and the second gRNA molecule is +55 BCL11a enhancement Selected from the gRNA molecules described herein (e.g., above) for the sensor; (d) The first gRNA molecule is the one specified herein for the BCL11a gene (e.g., above). Selected from the listed gRNA molecules, and the second gRNA molecule is the HPFH region of this specification Selected from the gRNA molecules described in the book (for example, above); (e) The first gRNA molecule is used in this specification for +58 BCL11a enhancer (for example) If selected from the gRNA molecules described above, the second gRNA molecule is +62 BC Select from the gRNA molecules described herein (e.g., above) for L11a enhancers. And; (f) The first gRNA molecule is +58 BCL11a enhancer as specified herein (for example) If selected from the gRNA molecules described above, the second gRNA molecule is +55 BC Select from the gRNA molecules described herein (e.g., above) for L11a enhancers. And; (g) The first gRNA molecule is used in this specification for +58 BCL11a enhancer (for example) If, then, selected from the gRNA molecules described above, the second gRNA molecule has an HPFH region. Selected from the gRNA molecules described herein (for example, above); (h) The first gRNA molecule is used in this specification for +62 BCL11a enhancer (for example) If selected from the gRNA molecules described above, the second gRNA molecule is +55 BC Select from the gRNA molecules described herein (e.g., above) for L11a enhancers. And; (i) The first gRNA molecule is used in this specification for +62 BCL11a enhancer (for example) If, then, selected from the gRNA molecules described above, the second gRNA molecule has an HPFH region. Selected from the gRNA molecules described herein (for example, above); (j) The first gRNA molecule is +55 BCL11a enhancer as specified herein (for example) If, then, selected from the gRNA molecules described above, the second gRNA molecule has an HPFH region. Selected from the gRNA molecules described herein (for example, above) for the purpose of [the relevant entity].

[0026] In another embodiment, the composition comprising a first gRNA molecule and a second gRNA molecule is Includes the following: (a) Selected from the gRNA molecules described herein (e.g., above) for the HPFH region It contains a first gRNA molecule, and the second gRNA molecule is the target of the β-globin gene. The column contains complementary targeting domains; or (b) BCL11a enhancer, e.g., +58 BCL11a enhancer, +55 This specification applies to BCL11a enhancer or +62 BCL11a enhancer. (For example,) comprising a first gRNA molecule selected from the gRNA molecules described above, The second gRNA molecule contains a targeting domain complementary to the target sequence of the β-globin gene.

[0027] In all of the aforementioned embodiments and aspects of the composition, the composition is the gRN of the composition. Component A may consist of a first gRNA molecule and a second gRNA molecule.

[0028] In all of the aforementioned embodiments and aspects of the composition, the composition is electroporous It can be formulated in a suitable medium for application.

[0029] In another embodiment, the present invention relates to gRNA molecules and / or C in the CRISPR system. It provides nucleic acids that encode molecules as. Although not constrained by theory, It is thought that when nucleic acids are delivered to cells, the expression of the CRISPR system will occur within the cells. In one aspect, the present invention relates to any of the aforementioned gRNA forms and embodiments. Provides nucleic acid sequences encoding one or more gRNA molecules. In an embodiment, the nucleic acid is , comprising a promoter operably ligated to a sequence encoding one or more gRNA molecules In this embodiment, this promoter is used with RNA polymerase II or RNA polymerase It is a promoter recognized by Lase III. In an embodiment, this promoter The promoter is either a U6 promoter or an HI promoter.

[0030] In a further embodiment, the nucleic acid further comprises a sequence encoding the Cas9 molecule. In this state, nucleic acids are operably linked to a promoter that encodes the Cas9 molecule. —Includes. In embodiments, this promoter is the EF-1 promoter, CMV I E gene promoter, EF-1α promoter, ubiquitin C promoter, or H It is a phosphate kinase (PGK) promoter.

[0031] In one embodiment, the present invention includes a nucleic acid of any of the aforementioned nucleic acid embodiments and models. A vector is provided. In an embodiment, the vector is a lentiviral vector, Ade Novirus vectors, adeno-associated virus (AAV) vectors, herpes simplex virus ( HSV vectors, plasmids, minicircles, nanoplasmids, and RNA vectors It is selected from the group consisting of the following.

[0032] In another embodiment, the present invention relates to one or more gRNA molecules, for example, as described herein. In any of the gRNA molecules, for example, in any of the embodiments and models of the gRNA molecules mentioned above The present invention provides a composition comprising a gRNA molecule and a nucleic acid encoding a Cas9 molecule.

[0033] In another embodiment, the present invention relates to one or more gRNA molecules (e.g., as described herein) gRNA molecules as described above, for example, any of the embodiments and models of the gRNA molecules mentioned above The present invention provides a composition comprising a nucleic acid encoding a gRNA molecule and a Cas9 molecule.

[0034] In another embodiment, the present invention relates to a composition further comprising a template nucleic acid, for example, the aforementioned composition The present invention provides a composition according to any aspect and embodiment. In another aspect, the present invention provides a mold Compositions further comprising nucleic acid sequences encoding nucleic acids, for example, embodiments and embodiments of the above-mentioned compositions. The present invention provides a composition of any form. In one embodiment, the template nucleic acid is a gRNA molecule. It contains nucleotides corresponding to nucleotides in the target sequence. In embodiments, the template nucleic acid is Human β-globin, for example, containing one or more mutants G16D, E22A, and T87Q It contains a nucleic acid that encodes human β-globin. In one embodiment, the template nucleic acid is human γ-globin It contains nucleic acids that code for [something].

[0035] In another embodiment, the present invention relates to gRNA molecules, CRISPR systems, compositions or nuclei Acids (for example, as described herein, e.g., in the embodiments and examples described above) Provide cells containing (or having contained at any time) any of the following: In this embodiment, the present invention provides cells that are modified by thus including To provide.

[0036] Therefore, in one aspect, the present invention relates to a method for modifying a target sequence within the nucleic acid of a cell. A method, for example, a method for modifying the structure, for example, the sequence, of the cells, 1) One or more gRNA molecules of any of the aforementioned gRNA molecule embodiments and examples, and Cas9 molecules (for example, as described herein); 2) One or more gRNA molecules of any of the above-described embodiments and models of gRNA molecules, nucleic acids that encode Cas9 molecules (for example, as described herein); 3) One or more gRNA molecules of any of the above-described embodiments and forms of gRNA molecules nucleic acids and Cas9 molecules (for example, as described herein); 4) Nuclei encoding one or more gRNA molecules of the aforementioned gRNA molecule embodiments and embodiments Acids, and nucleic acids that encode Cas9 molecules (e.g., as described herein); or 5) Any of the above 1) to 4), and template nucleic acid (for example, as described herein) of); 6) Any of the above 1) to 4), and template nucleic acid (for example, as described herein) Nucleic acids containing sequences that code for () 7) Any of the embodiments and forms of the compositions described herein (for example, any of the embodiments and forms of the compositions described above) any) composition; or 8) A vector of any of the vector embodiments and models described above. The present invention provides a method that includes bringing into contact with the object.

[0037] In one embodiment, a gRNA molecule or a nucleic acid encoding a gRNA molecule and Cas9 The nucleic acid encoding the Cas9 molecule is formulated into a single composition. Other implementations In this state, a gRNA molecule or nucleic acid encoding a gRNA molecule and a Cas9 molecule or The nucleic acid encoding the Cas9 molecule is formulated into two or more compositions. The two or more compositions are delivered simultaneously or sequentially.

[0038] In one embodiment, the cells are animal cells. In another embodiment, the cells are mammalian cells. These are primate cells or human cells. In embodiments, the cells are hematopoietic stem cell / progenitor cells (H SPCs (e.g., a population of HSPCs). In the embodiment, the cells are CD34+ cells. In this embodiment, the cells are CD34+ / CD38- / CD90+ / CD45RA -The cells are CD34+ / CD90+ / CD49f+ cells. Yes. In one embodiment, the cells are CD34+ / CD38- / CD90+ / CD45RA- / CD49f+ cells. In embodiments, this method uses HSPC, for example, CD34+ Includes a population of cells enriched with other cells.

[0039] In the embodiment, cells (e.g., a population of cells) are isolated from bone marrow. Embodiment In this embodiment, cells (e.g., a population of cells) are isolated from mobilized peripheral blood. The cells (for example, a group of cells) are isolated from umbilical cord blood.

[0040] In one embodiment, the cells (e.g., a population of cells) It is autologous to the patient to whom it is administered. In embodiments, cells (e.g., a collection of cells) The group) is of allogeneic origin to the patient to whom the cells (e.g., a group of cells) are administered. .

[0041] In embodiments of the methods described herein, the resulting modification is the fetal hemoglobin of cells The expression of γ increases. In embodiments of the methods described herein, the cells are modified as a result. Fetal hemoglobin expression decreases.

[0042] In another embodiment, the present invention relates to any of the methods and embodiments described above. The invention provides modified cells. In another embodiment, the present invention provides the aforementioned embodiments and embodiments A first gRNA molecule in any of the states (for example, as described herein), or A composition (for example, as described herein), or a first gRNA molecule (for example) The embodiment provides cells containing nucleic acids encoding (as described herein). In this embodiment, the cells are animal cells. In this embodiment, the cells are mammalian cells, primate cells, etc. These are human cells. In the embodiment, the cells are hematopoietic stem cell / progenitor cells (HSPCs) (e.g. For example, a population of HSPCs. In this embodiment, the cells are CD34+ cells. Morphologically, the cells are CD34+ / CD38- / CD90+ / CD45RA- cells. In this embodiment, the cells are CD34+ / CD90+ / CD49f+ cells. In this context, the method includes a population of cells enriched with HSPCs, such as CD34+ cells.

[0043] In the embodiment, cells (e.g., a population of cells) are isolated from bone marrow. Embodiment In this embodiment, cells (e.g., a population of cells) are isolated from mobilized peripheral blood. The cells (for example, a group of cells) are isolated from umbilical cord blood.

[0044] In one embodiment, the cells (e.g., a population of cells) It is autologous to the patient to whom it is administered. In embodiments, cells (e.g., a collection of cells) The group) is of allogeneic origin to the patient to whom the cells (e.g., a group of cells) are administered. .

[0045] In this embodiment, the cell is a second gRNA molecule, as described herein, for example. A second gRNA molecule, for example, one of the embodiments and models of the gRNA molecule described above. Contains or includes two gRNA molecules, or nucleic acids encoding a second gRNA molecule. It was, or it will contain, here, the first gRNA molecule and the second gRNA molecule Includes targeting domains that are not identical to the child domain.

[0046] In one embodiment, the expression of fetal hemoglobin in cells is controlled by, for example, gRNA molecules (e.g.) For example, cells of the same cell type that have not been modified to include (as described herein). Compared to, it increases. In embodiments, the expression of β-globin in cells is, for example, gRN The same molecule that has not been modified to include molecule A (for example, as described herein). Compared to cytoplasmic cells, the level decreases. In the embodiment, for example, gRNA molecules (for example, in this specification) Compared to cells of the same cell type that are not modified to include (as described in the book) Fetal hemoglobin expression increases, while β-globin expression decreases.

[0047] In one embodiment, the cells (or methods comprising cells) of the present invention are stem cell growth agents, for example Stem cell growth agents as described herein, for example, Compound 1, Compound 2, Compound 3 or is a compound 4 that has been brought into contact with the present invention. In one embodiment, the cells (or cells) of the present invention Methods including stem cell growth agents, for example, stem cell growth agents as described herein, for example For example, compound 1, compound 2, compound 3, compound 4, or combinations thereof (e.g., compound This is a substance 1 and compound 4) brought into contact with each other. In one embodiment, the stem cell proliferation agent is This is compound 4. In one embodiment, the stem cell proliferation agent is a combination of compound 1 and compound 4. It is a sieve. In the embodiment, the contact is exovivo.

[0048] In another embodiment, the present invention provides a treatment method, for example, a treatment method for abnormal hemoglobinosis. In one embodiment, the present invention relates to the aforementioned cell or method and embodiments. Abnormal hemoglobin disorders include administering any cells (e.g., a population of cells) to a patient. To provide a method of treatment.

[0049] In another embodiment, the present invention relates to any of the aforementioned cell or method embodiments and models. This involves increasing fetal hemoglobin expression in mammals, including administering cells to patients. The present invention provides a method for doing so. In one embodiment, abnormal hemoglobinopathy is β-thalassemia or It is sickle cell anemia.

[0050] In another embodiment, the present invention is used as a pharmaceutical agent, for example, in the treatment of a disease. We provide guide RNA molecules, such as those described herein. In one embodiment, the disease is an abnormal hemoglobin disorder, such as β-thalassemia or sickle cell anemia. It is a disease.

[0051] In another embodiment, the present invention relates to a gRNA molecule, for example, as described herein. gRNA molecules, for example, as described in any of the embodiments and models of the gRNA molecules described above. The CRISPR system, which includes the gRNA, provides the gRNA molecule as described above, and here the CRISPR system provides the gRNA to the cell When introduced into (for example, CD34+ cells, e.g., HSCs), the results measured by NGS are (a) Frame (b) Shift mutations; or (b) including large deletions. In embodiments, measured by NGS. When measured, at least about 25% of the resulting indels were found to be different from (a) the unmodified target DNA. Frameshift mutations; or (b) including large deletions. In embodiments, NGS Therefore, when measured, at least about 40%, at least about 50%, of the resulting indels At least about 60%, at least about 70%, at least about 80%, at least about 90%, and less At least about 95%, at least about 96%, at least about 97%, at least about 98%, and At least about 99% of these are (a) frameshift mutations compared to unmodified target DNA; (b) Includes large deletions.

[0052] In another embodiment, the present invention relates to the exovivolysis of HSPCs (e.g., CD34+ cells). and a method for modification are provided. In one embodiment, the present invention relates to cells (e.g., a population of cells) A method of modifying, (a) the step of providing a population of cells; (b) The step of growing the cells ex vivo in the presence of a stem cell proliferation agent; (c) The first gRNA molecule (for example, the first gRNA molecule as described herein) (For example, the first gRNA molecule of any of the aforementioned embodiments and models of the gRNA molecule) , a nucleic acid molecule encoding a first gRNA molecule, or a composition (for example, as described herein) A composition as described above, for example, any of the embodiments and models of the composition described above. The step of introducing the above into the cells This includes, and as a result, the cells have a different characteristics compared to the same cell type that has not been subjected to step (c). This invention provides a method for increasing the expression of hemoglobin, such as fetal hemoglobin.

[0053] In one embodiment, the cells are used to target the organism that needs them, for example, in the treatment of abnormal hemoglobin disorders. For example, it is introduced into patients with sickle cell disease or β-thalassemia.

[0054] In the embodiment, the cells are CD34+ cells or include them. The cells are HSPCs or contain them. In some embodiments, the cells are bone marrow, vegetative cells. They are isolated from the peripheral blood or umbilical cord blood of the member. In a preferred embodiment, the cells are bone These cells were isolated from the marrow. In other embodiments, the cells were isolated from mobilized peripheral blood. In this manner, mobilized peripheral blood was isolated from subjects who had been administered G-CSF. In this embodiment, the mobilized peripheral blood is mobilized by a mobilizing agent other than G-CSF, for example, Pleri This was isolated from subjects who received xafor(registered trademark)(AMD3100). In one embodiment, the cells are a population of enriched cells.

[0055] In the embodiment, the stem cell proliferation agent is compound 1, compound 2, compound 3, or compound 4 For example, compound 4. In the embodiment, the stem cell proliferation agent is compound 1, compound 2, Compound 3, Compound 4, or combinations thereof (for example, a combination of Compound 1 and Compound 4) In this embodiment, the cells are at a concentration of approximately 1 to approximately 200 micromoles (μM). The compound 4 is brought into contact with the compound. In one embodiment, the concentration of compound 4 is approximately 75 micromoles. (μM). In the embodiment, the cells are grown ex vivo in the presence of a stem cell proliferation agent. The propagation steps take approximately 1 to 10 days, for example, approximately 1 to 5 days, for example, approximately 2 to 5 days, for example, approximately 4 days It takes place over a period of days.

[0056] In the embodiment, the cells are autologous to the patient to whom the administration of the cells is intended. In the embodiment, the cells are of allogeneic origin to the patient to whom the cells are intended to be administered. be.

[0057] In an embodiment, the proliferation in step (b) is further induced by thrombopoietin (Tpo), Flt3 ligand (Flt-3L), human stem cell factor (SCF), and human interloyal In the presence of Kin-6 (IL-6). In embodiments, thrombopoietin (Tpo) Flt3 ligand (Flt-3L), human stem cell factor (SCF) and human intero Ikin-6 (IL-6) is present at a concentration of approximately 50 ng / mL in each embodiment. , thrombopoietin (Tpo), Flt3 ligand (Flt-3L), human stem cell factor ( SCF and human interleukin-6 (IL-6) were each concentrated at 50 ng / mL. It is a degree.

[0058] Further aspects and embodiments are described below.

[0059] In one aspect, the present invention provides a gRNA molecule comprising tracr and crRNA. Here, crRNA is the BCL11A gene (for example, the human BCL11a gene), B CL11a enhancer (e.g., human BCL11a enhancer), or HFPH region It contains a targeting domain complementary to the target sequence in a region (e.g., the human HPFH region).

[0060] In the embodiment, the target sequence is the target sequence of the BCL11A gene, and the targeting domain This is one of the following: SEQ ID NOs. 1-85 or SEQ ID NOs. 400-1231 These embodiments include, for example, the gRNA molecule. This is referred to as state 2.

[0061] In other embodiments, the target sequence is that of the BCL11a enhancer, and the targeted The main element contains one of the sequence numbers from 1232 to 1499, for example, then These embodiments are referred to herein as Embodiment 3 of the gRNA molecule. In one embodiment, the target sequence is that of the BCL11a enhancer, and the targeted domain The n is either sequence numbers 182-277 or sequence numbers 334-341. or including one, for example, consisting of the same. These embodiments herein refer to the gRNA molecule This is referred to as Embodiment 4. In a more preferred embodiment, the targeting domain is SEQ ID NO: 3 41, SEQ ID NO: 246, SEQ ID NO: 248, SEQ ID NO: 247, SEQ ID NO: 245, SEQ ID NO: 2 49, SEQ ID NO: 244, SEQ ID NO: 199, SEQ ID NO: 251, SEQ ID NO: 250, SEQ ID NO: 3 34, SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO: 336, or SEQ ID NO: 337 These embodiments include, for example, one of the gRNA molecules. This is referred to as Embodiment 5. In a more preferred embodiment, the targeting domain is distributed Column number 247, sequence number 248, sequence number 335, sequence number 336, sequence number 337, or includes any one of sequence numbers 338, for example consisting of (gR in this specification) This is referred to as Embodiment 6 of the NA molecule, for example, SEQ ID NO: 248 or SEQ ID NO: 338. A gRNA molecule comprising, for example, one of the following (as specified in Embodiment 7 of this specification) (referred to as). In an embodiment, the targeting domain includes, for example, SEQ ID NO: 248. This consists of (referred to as Embodiment 8 of the gRNA molecule in this specification). The targeting domain includes, for example, SEQ ID NO: 338 (g in this specification). (This is referred to as the 9th embodiment of the RNA molecule.)

[0062] In other embodiments, the target sequence is that of the BCL11a enhancer, and the targeted The main element consists of, for example, one of the sequence numbers 278 through 333. (referred to herein as Embodiment 10 of the gRNA molecule). In a preferred embodiment, The targeting domains are sequence numbers 318, 312, 313, and 2. 94, SEQ ID NO: 310, SEQ ID NO: 319, SEQ ID NO: 298, SEQ ID NO: 322, SEQ ID NO: 3 11, SEQ ID NO: 315, SEQ ID NO: 290, SEQ ID NO: 317, SEQ ID NO: 309, SEQ ID NO: 2 For example, consisting of either 89 or Sequence ID No. 281 (as specified herein). (This is referred to as Embodiment 11 of the gRNA molecule). In a preferred embodiment, the targeted The main component is, for example, a gRNA molecule, including sequence number 318 (as used herein). (This is referred to as Embodiment 12).

[0063] In other embodiments, the target sequence is that of the BCL11a enhancer, and the targeted The main element contains one of the sequence numbers from 1596 to 1691, for example, then This is (referred to herein as embodiment 13 of the gRNA molecule). In a preferred embodiment, In this context, the targeting domains are sequence numbers 1683, 1638, and 1647. Sequence ID 1609, Sequence ID 1621, Sequence ID 1617, Sequence ID 1654, Sequence ID 1631, SEQ ID NO: 1620, SEQ ID NO: 1637, SEQ ID NO: 1612, SEQ ID NO: 1656 , Sequence ID 1619, Sequence ID 1675, Sequence ID 1645, Sequence ID 1598, Sequence No. Either code number 1599, sequence number 1663, sequence number 1677, or sequence number 1626 One including, for example, consisting of (referred to herein as embodiment 14 of the gRNA molecule) (to be able to).

[0064] In other embodiments, the target sequence is an HFPH region (e.g., a French-type HPFH region) The targeting domains are sequence numbers 86-181 and 1500- Includes either sequence number 1595, or one of sequence numbers 1692 through 1761, For example, it consists of such a (referred to herein as embodiment 15 of the gRNA molecule). In a more accurate embodiment, the targeting domain is sequence number 100, sequence number 165, sequence number 113, SEQ ID NO: 99, SEQ ID NO: 112, SEQ ID NO: 98, SEQ ID NO: 1580, SEQ ID NO: 1 06, SEQ ID NO: 1503, SEQ ID NO: 1589, SEQ ID NO: 160, SEQ ID NO: 1537, Array Number 159, Sequence ID 101, Sequence ID 162, Sequence ID 104, Sequence ID 138, Array For example, include one of the following: number 1536, sequence number 1539, or sequence number 1585. This consists of (referred to herein as embodiment 16 of the gRNA molecule). More preferably In a more accurate embodiment, the targeting domains are sequence numbers 98, 100, and 1 One of the following: 505, SEQ ID NO: 1589, SEQ ID NO: 1700, or SEQ ID NO: 1750 Including, for example, consisting of (referred to herein as Embodiment 17 of a gRNA molecule) ). In other preferred embodiments, the targeting domain is sequence number 100, sequence number 16 5, or one of sequence number 113, for example consisting of the same (as specified herein) This is referred to as embodiment 18 of the gRNA molecule.

[0065] In embodiments, the gRNA molecule is any targeting domain sequence described herein. For example, target domain sequences 17, 18, 19, 20, 21, 22 in Table 1 or Table 2, A target comprising, for example, 23 or 24, preferably 20, consecutive nucleic acids. Includes a targeting domain. In embodiments, any of the targeting domain sequences described herein Choose any one of the targeting domain sequences, for example, 17, 18, 19, 20, and 21 from Table 1 or Table 2. 22, 23, or 24, preferably 20, consecutive nucleic acids are used as the targeted drug described. 17, 18, 19, 20, 21, 22, 23, or located at the 3' end of the main sequence These are 24, preferably 20, consecutive nucleic acids. In other embodiments, as described herein One of the targeting domain sequences listed, for example, the targeting domain sequences in Table 1 or Table 2. 17, 18, 19, 20, 21, 22, 23, or 24, preferably 20, rows The following nucleic acids are located at the 5' end of the described targeting domain sequence, 17, 18, and 19 These are 20, 21, 22, 23, or 24 consecutive nucleic acids, preferably 20 consecutive nucleic acids. In the embodiments thereof, one of the targeting domain sequences described herein, for example Target domain sequences 17, 18, 19, 20, 21, 22, 23, and 23 in Table 1 or Table 2 Alternatively, 24, preferably 20, consecutive nucleic acids are located at 5' of the described targeting domain sequence. It does not contain either nucleic acid or 3' nucleic acid.

[0066] In embodiments, the gRNA molecule is any targeting domain sequence described herein. For example, target domain sequences 17, 18, 19 in Table 5, Table 6, Table 7, Table 8 or Table 9, Or a targeted domain comprising 20, preferably 20 consecutive nucleic acids, for example, Includes in. In embodiments, any one of the targeting domain sequences described herein For example, target domain sequences 17, 18, and 19 in Table 5, Table 6, Table 7, Table 8, or Table 9. , or 20, preferably 20 consecutive nucleic acids, of the described targeting domain sequence 17, 18, 19, or 20, preferably 20, consecutive nuclei located at the 3' end It is an acid. In other embodiments, any of the targeting domain sequences described herein. One example is the targeting domain sequences 17, 18, 1 in Table 5, Table 6, Table 7, Table 8, or Table 9. 9 or 20, preferably 20, consecutive nucleic acids are the described targeting domain sequence. 17, 18, 19, or 20, preferably 20 consecutive ones, located at the 5' end It is a nucleic acid. In other embodiments, any of the targeting domain sequences described herein. Or one, for example, target domain sequences 17, 18 in Table 5, Table 6, Table 7, Table 8 or Table 9, 19 or 20, preferably 20, consecutive nucleic acids are arranged in the described targeting domain. The column does not contain either 5' or 3' nucleic acids.

[0067] The following embodiments describe gRNA molecules that can be combined with any of the embodiments and examples described above. Features are described below. In the embodiments, the gRNA molecule is the embodiment described above. Hybridize to include either gRNA molecule of sequence number 6584 or 6585 It contains a portion of crRNA that forms a flagpole and a portion of tracr. In the application morphology, the flagpole is located on the 3' side of the crRNA portion of the flagpole. It further includes a first flagpole extension section, the first flagpole extension section being numbered in the sequence. Includes part number 6586. In this embodiment, the flagpole is (first flagpole extension part In addition to or instead of the second, located at the 3' end of the crRNA portion of the flagpole The flagpole extension section, and if present, the first flagpole extension section further Including, where the second flagpole extension includes sequence number 6587.

[0068] In embodiments including those described above, t racr includes sequence number 6660 or sequence number 6661. In embodiments, tra cr includes sequence number 7812, with optional additional numbers 1, 2, 3, 4, 5, and 6 at the 3' end. , or further comprising seven uracil (U) nucleotides. In an embodiment, crRN A is located at 5' to 3', [targeting domain]: a) Sequence ID 6584; b) Sequence ID 6 585; c) Sequence ID 6605; d) Sequence ID 6606; e) Sequence ID 6607; f) Distribution Column number 6608; or g) containing sequence number 7806.

[0069] In embodiments including those described above, t racr is located from 5' to 3', a) SEQ ID NO: 6589; b) SEQ ID NO: 6590; c) SEQ ID NO: 6590; Number 6609; d) Sequence ID 6610; e) Sequence ID 6660; f) Sequence ID 6661; g) Sequence ID 7812; h) Sequence ID 7807; i) Sequence ID 7808; j) Sequence ID 7 809;k) at least 1, 2, 3, 4, 5, 6 or 7 uracil(U) nucleotides For example, 1, 2, 3, 4, 5, 6, or 7 uracil (U) nucleotides are 3' The end further includes any of the above a) to j); l) at least 1, 2, 3, 4, 5, 6 or seven adenine (A) nucleotides, for example, 1, 2, 3, 4, 5, 6, or 7 Any of the above a) to k) further containing an adenine (A) nucleotide at its 3' end; also is m) at least 1, 2, 3, 4, 5, 6 or 7 adenine (A) nucleotides, for example 1, 2, 3, 4, 5, 6, or 7 adenine (A) nucleotides at the 5' end (e.g., at the 5' end) further includes any one of a) to l) above.

[0070] In an embodiment, the targeting domain and tracr are arranged on separate nucleic acid molecules. In an embodiment of such a gRNA molecule, the nucleic acid molecule containing the targeting domain optionally contains SEQ ID NO: 6607 arranged immediately 3' to the targeting domain, and the nucleic acid molecule containing tracr contains SEQ ID NO: 6660, for example, consists of it.

[0071] In an embodiment, the crRNA portion of the flagpole contains SEQ ID NO: 6607 or SEQ ID NO: 6608.

[0072] In an embodiment, tracr includes SEQ ID NO: 6589 or 6590, and optionally, when a first flagpole extension is present, a first tracr extension arranged 5' to SEQ ID NO: 6589 or 6590 and the first tracr extension contains SEQ ID NO: 6591.

[0073] In an embodiment, including those in any of the foregoing aspects and embodiments, in an embodiment, the targeting domain and tracr are arranged on separate nucleic acid molecules. In an embodiment, including those in any of the foregoing aspects and embodiments, in other embodiments, the targeting domain and tracr are arranged on a single nucleic acid molecule, for example, tracr is arranged 3' to the targeting domain. In an embodiment, including those in any of the foregoing aspects and embodiments, in an embodiment, the targeting domain and tracr are arranged on separate nucleic acid molecules. In an embodiment, including those in any of the foregoing aspects and embodiments, in other embodiments, the targeting domain and tracr are arranged on a single nucleic acid molecule, for example, tracr is arranged 3' to the targeting domain. In an embodiment, including those in any of the foregoing aspects and embodiments, in other embodiments, the targeting domain and tracr are arranged on a single nucleic acid molecule, for example, tracr is arranged 3' to the targeting domain. In an embodiment, including those in any of the foregoing aspects and embodiments, in other embodiments, the targeting domain and tracr are arranged on a single nucleic acid molecule, for example, tracr is arranged 3' to the targeting domain. 3' side.

[0074] In the embodiment, when the targeting domain and tracr are arranged on a single nucleic acid molecule The gRNA molecule has a loop located at the 3' end of the targeting domain and the 5' end of the tracr. This further includes. In an embodiment, the loop includes, for example, sequence number 6588. ru.

[0075] In the embodiment, when the targeting domain and tracr are arranged on a single nucleic acid molecule The gRNA molecule has a [targeting domain] from 5' to 3': (a) Sequence ID 6601; (b) Sequence ID 6602; (c) Sequence ID 6603; (d) Sequence ID 6604; (e) Column number 7811; or (f) 1, 2, 3, 4, 5, 6 or 7 uracil(U) nuclei The embodiment includes any of (a) to (e) above, further comprising a rheotide at the 3' end. The gRNA molecule then includes the targeting domain and sequence number 7811, for example, Sequence ID 7811 is optionally positioned immediately 3' to the targeting domain.

[0076] In embodiments including those described above, g Each nucleic acid residue of an RNA molecule contains unmodified A, U, G, or C nuclei between each residue of the nucleic acid molecule. These are acid residues and unmodified phosphate bonds. In other embodiments, including the application form, one of the nucleic acid molecules constituting the gRNA molecule, or Two or more of the following are at the discretion of the parties: a) one or more at the 3' end of one or more nucleic acid molecules. , for example, three phosphorothioate modifications; b) the 5' end of one or more nucleic acid molecules c) one or more nuclei One or more 2'-O-methyl modifications at the 3' end of the acid molecule, for example, three; d) the one said Alternatively, one or more 2'-O-methyl modifications at the 5' end of multiple nucleic acid molecules, for example, three 2'-O-methyl modifications. e) The fourth from the end, the third from the end, and the terminal of one or more nucleic acid molecules f) 2'O-methyl modification at each of the second 3' residues; f) the one or more nucleic acids In each of the 4th, 3rd, and 2nd 5' residues from the end of the molecule f) any combination of these modifications: 2'O-methyl modification; or f) any combination of these.

[0077] In a preferred embodiment, the present invention relates to sequence: (a) Sequence ID 342; (b) Sequence ID 343; or (c) gRNA molecules containing, for example, SEQ ID NO: 1762 (e.g.) (This outline of the present invention provides an sgRNA molecule) (an embodiment of a gRNA molecule) (Referred to as 41).

[0078] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 344, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA including, for example, SEQ ID NO: 344, and SEQ ID NO: 346 (c) containing, for example, a tracr; (c) containing, for example, sequence number 345 crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, SEQ ID NO. 345, and SEQ ID NO. 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 42).

[0079] In other preferred embodiments, the present invention provides a gRNA molecule comprising, for example consisting of, the sequence: (a) SEQ ID NO: 347; (b) the sequence SEQ ID NO: 348; or (c) SEQ ID NO: 1763 (for example, an sgRNA molecule). (This embodiment of the gRNA molecule is referred to as Embodiment 43 in this overview of the present invention.)

[0080] In other preferred embodiments, the present invention provides a gRNA molecule comprising, for example consisting of: (a) a crRNA comprising SEQ ID NO: 349, and a tracr comprising SEQ ID NO: 6660; (b) a crRNA comprising SEQ ID NO: 349, and a tracr comprising SEQ ID NO: 346; (c) a crRNA comprising SEQ ID NO: 350, and a tracr comprising SEQ ID NO: 6660; or (d) a crRNA comprising SEQ ID NO: 350, and a tracr comprising SEQ ID NO: 346 (for example, a dual gRNA molecule). (This embodiment of the gRNA molecule is referred to as Embodiment 44 in this overview of the present invention.)

[0081] In other preferred embodiments, the present invention provides a gRNA molecule comprising, for example consisting of, the sequence: (a) SEQ ID NO: 351; (b) the sequence SEQ ID NO: 352; or (c) SEQ ID NO: 1764 (for example, an sgRNA molecule). (This embodiment of the gRNA molecule is referred to as Embodiment 45 in this overview of the present invention.)

[0082] In other preferred embodiments, the present invention provides a gRNA molecule comprising, for example consisting of: (a) a crRNA comprising SEQ ID NO: 353, and a tracr comprising SEQ ID NO: 6660; ​ (b) crRNA including, for example, SEQ ID NO: 353, and SEQ ID NO: 346 (c) including, for example, a tracr consisting of; (c) including, for example, sequence number 354, crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, SEQ ID NO. 354, and SEQ ID NO. 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 46).

[0083] In another preferred embodiment, the present invention relates to sequence: (a) Sequence ID 355; (b) Sequence ID Number 356; or (c) gRNA molecules including, for example, sequence number 1765 ( For example, it is an sgRNA molecule) (In this outline of the present invention, the implementation of a gRNA molecule is provided) (This is referred to as form 47).

[0084] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 357, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA including, for example, SEQ ID NO: 357, and SEQ ID NO: 346 (c) including, for example, a tracr consisting of; (c) including sequence number 358, for example, a tracr consisting of; crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, SEQ ID NO. 358, and SEQ ID NO. 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 48).

[0085] In another preferred embodiment, the present invention relates to sequence: (a) Sequence ID 359; (b) Sequence ID Number 360; or (c) gRNA molecules including, for example, sequence number 1766 ( For example, it is an sgRNA molecule) (In this outline of the present invention, the implementation of a gRNA molecule is provided) (This is referred to as form 49).

[0086] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 361, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA including, for example, SEQ ID NO: 361, and SEQ ID NO: 346 (c) including, for example, a tracr consisting of; (c) including, for example, sequence number 362, crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, SEQ ID NO. 362, and SEQ ID NO. 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 50).

[0087] In another preferred embodiment, the present invention relates to sequence: (a) Sequence ID 363; (b) Sequence ID Number 364; or (c) gRNA molecules including, for example, sequence number 1767 ( For example, it is an sgRNA molecule) (In this outline of the present invention, the implementation of a gRNA molecule is provided) (This is referred to as form 51).

[0088] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 365, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA containing, for example, SEQ ID NO. 365, and SEQ ID NO. 346 (c) including, for example, a tracr consisting of; (c) including, for example, sequence number 366. crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, sequence number 366, and sequence number 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 52).

[0089] In another preferred embodiment, the present invention relates to sequence: (a) Sequence ID 367; (b) Sequence ID Number 368; or (c) gRNA molecules including, for example, sequence number 1768 ( For example, it is an sgRNA molecule) (In this outline of the present invention, the implementation of a gRNA molecule is provided) (This is referred to as form 53).

[0090] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 369, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA including, for example, SEQ ID NO. 369 and SEQ ID NO. 346 (c) including, for example, a tracr consisting of; (c) including, for example, sequence number 370, crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, SEQ ID NO. 370, and SEQ ID NO. 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 54).

[0091] In another preferred embodiment, the present invention relates to sequence: (a) Sequence ID 371; (b) Sequence ID Number 372; or (c) gRNA molecules including, for example, sequence number 1769 ( For example, it is an sgRNA molecule) (In this outline of the present invention, the implementation of a gRNA molecule is provided) (This is referred to as form 55).

[0092] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 373, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA including, for example, SEQ ID NO: 373, and SEQ ID NO: 346 (c) including, for example, a tracr consisting of; (c) including, for example, sequence number 374, crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, SEQ ID NO. 374, and SEQ ID NO. 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 56).

[0093] In another preferred embodiment, the present invention relates to sequence: (a) Sequence ID 375; (b) Sequence ID Number 376; or (c) gRNA molecules comprising, for example, sequence number 1770 ( For example, it is an sgRNA molecule) (In this outline of the present invention, the implementation of a gRNA molecule is provided) (This is referred to as form 57).

[0094] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 377, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA including, for example, SEQ ID NO: 377, and SEQ ID NO: 346 (c) including, for example, a tracr consisting of; (c) including sequence number 378, for example, a tracr consisting of; crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, SEQ ID NO. 378, and SEQ ID NO. 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 58).

[0095] In another preferred embodiment, the present invention relates to sequence: (a) Sequence ID 379; (b) Sequence ID Number 380; or (c) gRNA molecules comprising, for example, sequence number 1771 ( For example, it is an sgRNA molecule) (In this outline of the present invention, the implementation of a gRNA molecule is provided) (This is referred to as form 59).

[0096] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 381, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA including, for example, SEQ ID NO: 381, and SEQ ID NO: 346 (c) including, for example, a tracr consisting of; (c) including, for example, sequence number 382, crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, SEQ ID NO. 382, ​​and SEQ ID NO. 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 60).

[0097] In another preferred embodiment, the present invention relates to sequence: (a) Sequence ID 383; (b) Sequence ID Number 384; or (c) gRNA molecules including, for example, sequence number 1772 ( For example, it is an sgRNA molecule) (In this outline of the present invention, the implementation of a gRNA molecule is provided) (This is referred to as form 61).

[0098] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 385, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA including, for example, SEQ ID NO. 385 and SEQ ID NO. 346 (c) including, for example, a tracr consisting of; (c) including, for example, sequence number 386, crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, sequence number 386, and sequence number 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 62).

[0099] In another preferred embodiment, the present invention relates to sequence: (a) Sequence ID 387; (b) Sequence ID Number 388; or (c) gRNA molecules including, for example, sequence number 1773 ( For example, it is an sgRNA molecule) (In this outline of the present invention, the implementation of a gRNA molecule is provided) (This is referred to as form 63).

[0100] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 389, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA including, for example, SEQ ID NO: 389, and SEQ ID NO: 346 (c) including, for example, a tracr consisting of; (c) including, for example, sequence number 390, crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, sequence number 390, and sequence number 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 64).

[0101] In another preferred embodiment, the present invention relates to sequence: (a) Sequence ID 391; (b) Sequence ID Number 392; or (c) gRNA molecules including, for example, sequence number 1774 ( For example, it is an sgRNA molecule) (In this outline of the present invention, the implementation of a gRNA molecule is provided) (This is referred to as form 65).

[0102] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 393, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA including, for example, SEQ ID NO: 393, and SEQ ID NO: 346 (c) including, for example, a tracr consisting of; (c) including, for example, sequence number 394, crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, SEQ ID NO. 394, and SEQ ID NO. 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 66).

[0103] In another preferred embodiment, the present invention relates to sequence: (a) Sequence ID 395; (b) Sequence ID Number 396; or (c) gRNA molecules comprising, for example, sequence number 1775 ( For example, it is an sgRNA molecule) (In this outline of the present invention, the implementation of a gRNA molecule is provided) (This is referred to as form 67).

[0104] In other preferred embodiments, the present invention includes (a) SEQ ID NO: 397, for example. crRNA consisting of the same, and tracr, for example, containing sequence number 6660; (b) crRNA including, for example, SEQ ID NO: 397, and SEQ ID NO: 346 (c) including, for example, a tracr consisting of; (c) including, for example, sequence number 398, crRNA, and tracr, for example, consisting of sequence number 6660; or (d) crRNA including, for example, SEQ ID NO. 398, and SEQ ID NO. 346 Includes, for example, tracr consisting of, for example, gRNA molecules consisting of (for example) (This outline of the present invention provides a dual gRNA molecule) (This is referred to as form 68).

[0105] In embodiments including those described in any of the above aspects and embodiments, this The invention provides a gRNA molecule, and herein, a CRISPR system containing the gRNA molecule (for example) When an RNP (as described herein) is introduced into a cell, the indel becomes gRN It is formed in or near a target sequence complementary to the targeting domain of molecule A. Including embodiments that include a targeting domain complementary to the target sequence of the Hanser region, In the embodiment, the indel is a nucleus of the GATA-1 and / or TAL-1 binding site. It does not contain ocides. In embodiments, the indel is GATA-1 and / or TAL- It does not hinder the bonding of 1 to that bonding site. In embodiments, including the form of application, the present invention provides a gRNA molecule, where the gRNA molecule A CRISPR system containing offspring (e.g., RNP as described herein) is used in cells. When introduced into a population, indels affect at least about 40% of the population's cells, for example, at least Also about 50%, for example at least about 60%, for example at least about 70%, for example at Approximately 80%, for example at least approximately 90%, for example at least approximately 95%, for example at least approximately 96%, for example at least about 97%, for example at least about 98%, for example at least about 9 In 9% of cases, the target sequence is formed in or near the targeting domain of the gRNA molecule. This is done. The embodiments include the embodiments in any of the aforementioned aspects and embodiments. The present invention provides a gRNA molecule, wherein the gRNA molecule is included in the CRISPR system When a substance (for example, RNP as described herein) is introduced into a population of cells, GA Indels that do not contain nucleotides of the TA-1 and / or TAL-1 binding site are population at least about 20% of the cells, for example at least about 30%, for example at least about 35%, For example, at least about 40%, for example at least about 45%, for example at least about 50%, example For example, at least about 55%, for instance at least about 60%, for instance at least about 65%, for example so at least about 70%, for example at least about 75%, for example at least about 80%, for example At least about 85%, for example at least about 90%, for example at least about 95%, for example a small In at least 99% of cases, the target sequence is complementary to the targeting domain of the gRNA molecule or It is formed in its vicinity. Including embodiments in any of the aforementioned aspects and embodiments, In the embodiment, the indel is one of the following: Figure 25, Table 15, Table 26, Table 27, or Table 37 These are indels, which include the following. In one embodiment, at least about 30% of the cells in the population, For example, at least about 40%, for example at least about 50%, for example at least about 60%, example For example, at least about 70%, for instance at least about 80%, for instance at least about 90%, for example so at least about 95%, for example at least about 96%, for example at least about 97%, for example In at least about 98%, for example, at least about 99%, the indels are as shown in Figure 25 and Table 15. or indels listed in Table 26, Table 27, or Table 37. The three indels most frequently detected in the aforementioned cell population are shown in Figure 25 and Table 25. 15. Related to any gRNA molecule listed in Table 26, Table 27, or Table 37 This includes an indel. In an embodiment, an indel (or a pattern of higher indels) For example, by next-generation sequencing (NGS) as described in the relevant technical field. As measured. Including embodiments in any of the aforementioned aspects and embodiments. In embodiments, the present invention provides a gRNA molecule, wherein a CR comprising a gRNA molecule is provided. An ISPR system (e.g., RNP as described herein) is introduced into the cells. For example, assays are performed using HPCS cells, for example, CD34+ cells, for example, next-generation cells. As detectable by quenching and / or nucleotide insertion assays - Get indels are not formed in the aforementioned cells. In embodiments, including those described herein, the present invention provides a gRNA molecule, and here Therefore, a CRISPR system containing a gRNA molecule (for example, as described herein) When RNPs are introduced into a population of cells, for example, a population of HPSC cells, for example, CD34+ Assays performed on populations of cells, such as next-generation sequencing and / or nucleotide assays. Off-target indels, as detectable by insertion assays, account for approximately 5% of the cell population. Detection in cells exceeding % (e.g., over 1%, over 0.1%, over 0.01%). It will not be done.

[0106] In embodiments including those described in any of the above aspects and embodiments, this The invention provides a gRNA molecule, and herein, a CRISPR system containing the gRNA molecule (for example) When RNPs (as described herein) are introduced into cells, fetal hemoglobin Expression occurs in the cells or their offspring, for example, their erythroid offspring, for example, their erythroid cell offspring. It increases in the following embodiment, the cell or its offspring, for example, its erythrocytes In grandchildren, for example, their red blood cell offspring, the expression of fetal hemoglobin is at least about 20%. For example, at least about 30%, for example at least about 40%, for example at least about 50%, For example, at least about 60%, for example at least about 70%, for example at least about 80%, example For example, at least about 90%, for instance at least about 95%, for instance at least about 96%, for example If so, it will increase by at least approximately 97%, for example, at least approximately 98%, for example, at least approximately 99%. In embodiments, the cell or its offspring, for example, its erythrocyte offspring, for example, its red Blood cell progeny contain at least about 6 picograms per cell (for example, at least about 7 picograms). Ram, at least about 8 picograms, at least about 9 picograms, at least about 10 picograms Fetal hemoglobin (rum, or approximately 8-9 picograms, or approximately 9-10 picograms) It produces n. Embodiments including embodiments in any of the above-described aspects and embodiments. In this invention, the present invention provides a gRNA molecule, wherein the gRNA molecule is included in CRISPR When a stem (for example, an RNP as described herein) is introduced into the cell, the fetus The level of moglobin (e.g., gamma globin) mRNA is the level of the cell or its offspring, for example. The amount increases in the erythrocyte offspring, for example, in the erythrocyte offspring. In embodiments, including those in any of the application forms, the present invention provides a gRNA molecule Provided here is a CRISPR system containing a gRNA molecule (for example, as described herein). When the RNP (as described above) is introduced into the cells, the expression of BCL11a mRNA is as described above. The increase occurs in cells or their offspring, such as their erythrocyte offspring, such as their erythrocyte offspring. In embodiments, including those described in any of the above-mentioned aspects and embodiments, The present invention provides a gRNA molecule, wherein a CRISPR system containing the gRNA molecule (e.g.) For example, when an RNP (as described herein) is introduced into cells, BCL11a m RNA levels are measured by the cells or their offspring, for example, their erythrocyte offspring, for example, their red blood cells It decreases in the offspring of globular cells.

[0107] In all of the aforementioned aspects and embodiments that refer to cells, cells are mammalian cells. Primate cells or human cells (or a population of cells that includes them), for example, human cells or is a population of human cells. In an embodiment, the cells are HSPCs (or a collection of cells). The group includes, for example, CD34+, and for example, CD34+CD90+. Morphologically, the cells (or population of cells) are self- It is derived from. In other embodiments, cells (or a group of cells) receive the administration of the cells. For the patient, it is of allogeneic origin.

[0108] In another embodiment, the present invention relates to 1) one or more gRNA molecules described herein (No. (containing gRNA molecules 1), for example, one or more g from any of the embodiments and examples described above. RNA molecules and Cas9 molecules, for example, Cas9 molecules as described herein; 2) One or more gRNA molecules described herein (including the first gRNA molecule), e.g. one or more gRNA molecules and Cas9 molecules of any of the aforementioned embodiments and models. 3) Nucleic acids encoding (as described herein); 4) One or more gRs as described herein NA molecule (including the first gRNA molecule), for example, any of the embodiments and examples described above nucleic acids encoding one or more gRNA molecules, and Cas9 molecules (as described herein) 4) One or more gRNA molecules described herein (including the first gRNA molecule), For example, nucleic acids encoding one or more gRNA molecules as described above in the embodiments and models. , and nucleic acids encoding the Cas9 molecule (as described herein); or 5) 1) ~4) any one of the above, and template nucleic acid; or 6) any one of the above 1)~4), and template The present invention provides a composition containing nucleic acids, which include a sequence that codes for nucleic acids.

[0109] In a preferred embodiment, the present invention relates to a first gRNA molecule (for example, as described herein). For example, the first gR of any of the aforementioned gRNA molecule forms and embodiments. The present invention provides a composition containing an NA molecule and further containing a Cas9 molecule (as described herein). ru.

[0110] In one embodiment, the Cas9 molecule is active or inactivated Streptococcus pyogenes (s.pyoglossum). This is nes)Cas9. In the embodiment, the Cas9 molecule contains SEQ ID NO: 6611. In this embodiment, the Cas9 molecule is (a) SEQ ID NO: 7821; (b) SEQ ID NO: 7822 (c) Sequence ID 7823; (d) Sequence ID 7824; (e) Sequence ID 7825; (f) Sequence ID 7826; (g) Sequence ID 7827; (h) Sequence ID 7828; (i) Sequence ID 7829; (j) Sequence ID 7830; or (k) Sequence ID 7831, for example It consists of.

[0111] In a preferred embodiment, the first gRNA molecule and the Cas9 molecule are ribonucleoproteins It is present in the nucleotide polymorphism (RNP).

[0112] In embodiments, the present invention relates to a second gRNA molecule; a second gRNA molecule and a third gRNA molecule; or a second gRNA molecule, optionally a third gRNA molecule, and any A composition further comprising a fourth gRNA molecule by choice, for example, any of the embodiments and examples described above The present invention provides a composition comprising a second gRNA molecule, an optional third gRNA molecule, and an optional fourth gRNA molecule is a gRNA molecule described herein, for example, The gRNA molecule is one of the gRNA molecules of any of the aforementioned gRNA molecule embodiments and examples. Here, each gRNA molecule in the composition is complementary to a different target sequence.

[0113] In this embodiment, a first gRNA molecule, a second gRNA molecule, and an optional third gRNA The NA molecule and two or more of the optional fourth gRNA molecules are located within the same gene or region. It is complementary to the target sequence within. In an embodiment, the first gRNA molecule, the second gRNA The molecule, an optional third gRNA molecule, and an optional fourth gRNA molecule are 200 Less than 00 nucleotides, less than 10,000 nucleotides, less than 6,000, less than 5,000 nucleos Below 100, below 4000, below 1000nucleotides, below 500nucleotides, 400 Less than nucleotide, less than 300 nucleotides, less than 200 nucleotides, 100 nucleos Below 100, below 90 nucleotides, below 80 nucleotides, below 70 nucleotides, 60 Less than nucleotides, less than 50 nucleotides, less than 40 nucleotides, less than 30 nucleotides Below, it is complementary to target sequences located 20 nucleotides or less, or 10 nucleotides or less.

[0114] In other embodiments, a first gRNA molecule, a second gRNA molecule, and an optional third Two or more gRNA molecules, and two or more of an optional fourth gRNA molecule, are located within different genes. It is complementary to the target sequence within the region.

[0115] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition comprising a first gRNA molecule and a second gRNA molecule, gRNA molecule 1 and gRNA molecule 2 are, (a) gRNA molecule independently selected from the gRNA molecule of Embodiment 4 and with a different target Is it complementary to the array? (b) gRNA molecules independently selected from the gRNA molecules of Embodiment 5 and targeting different targets Is it complementary to the array? c) gRNA molecules independently selected from the gRNA molecules of Embodiment 6 and with different target distributions Is it complementary to the column; or (d) gRNA molecules independently selected from the gRNA molecules of Embodiment 7 and targeting different targets Is it complementary to the sequence; or (e) A gRNA molecule independently selected from any of the gRNA molecules in embodiments 41 to 56 of the gRNA molecule Furthermore, it is complementary to different target sequences.

[0116] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition comprising a first gRNA molecule and a second gRNA molecule, gRNA molecule 1 and gRNA molecule 2 are, (a) gRNA molecules independently selected from the gRNA molecules of Embodiment 10 and different labels Is it complementary to the target sequence; or (b) gRNA molecules independently selected from the gRNA molecules of Embodiment 11 and different labels It is complementary to the target arrangement.

[0117] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition comprising a first gRNA molecule and a second gRNA molecule, gRNA molecule 1 and gRNA molecule 2 are, (a) gRNA molecules independently selected from the gRNA molecules of Embodiment 13 and with different labels Is it complementary to the target sequence; or (b) gRNA molecules independently selected from the gRNA molecules of Embodiment 14 and with different labels It is complementary to the target arrangement.

[0118] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition comprising a first gRNA molecule and a second gRNA molecule, gRNA molecule 1 and gRNA molecule 2 are, (a) gRNA molecules independently selected from the gRNA molecules of Embodiment 16 and different labels Is it complementary to the target arrangement? (b) gRNA molecules independently selected from the gRNA molecules of Embodiment 17 and with different labels Is it complementary to the target arrangement? (c) gRNA molecules independently selected from the gRNA molecules of Embodiment 18 and with different labels Is it complementary to the target sequence; or (d) A gRNA molecule independently selected from any of the gRNA molecules in embodiments 57 to 68 of the gRNA molecule Furthermore, it is complementary to different target sequences.

[0119] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition comprising a first gRNA molecule and a second gRNA molecule. (1) The first gRNA molecule is selected from the gRNA molecules of Embodiment 4 of (a) gRNA molecule. (b) gRNA molecule selected from gRNA molecules of Embodiment 5, or (c) g A gRNA molecule selected from embodiment 6 of the RNA molecule, or (d) an embodiment of the gRNA molecule Selected from gRNA molecules of form 7, or (e) gRNA molecules of embodiments 41-56 Selected from any of the gRNA molecules; and (2) The second gRNA molecule is selected from the gRNA molecules of embodiment 10 of (a) gRNA molecule. (b) Selected from the gRNA molecules of Embodiment 11 of the gRNA molecule.

[0120] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition comprising a first gRNA molecule and a second gRNA molecule. (1) The first gRNA molecule is selected from the gRNA molecules of Embodiment 4 of (a) gRNA molecule. (b) gRNA molecule selected from gRNA molecules of Embodiment 5, or (c) g A gRNA molecule selected from embodiment 6 of the RNA molecule, or (d) an embodiment of the gRNA molecule Selected from gRNA molecules of form 7, or (e) gRNA molecules of embodiments 41-56 Selected from any of the gRNA molecules; and (2) The second gRNA molecule is selected from the gRNA molecules of Embodiment 13 of (a) gRNA molecule. Selected, (b) gRNA molecule is selected from the gRNA molecules of Embodiment 14.

[0121] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition comprising a first gRNA molecule and a second gRNA molecule. (1) The first gRNA molecule is selected from the gRNA molecules of Embodiment 4 of (a) gRNA molecule. (b) gRNA molecule selected from gRNA molecules of Embodiment 5, or (c) g A gRNA molecule selected from embodiment 6 of the RNA molecule, or (d) an embodiment of the gRNA molecule Selected from gRNA molecules of form 7, or (e) gRNA molecules of embodiments 41-56 Selected from any of the gRNA molecules; and (2) The second gRNA molecule is selected from the gRNA molecules of Embodiment 16 of (a) gRNA molecule. (b) Selected from the gRNA molecules of Embodiment 17 of the gRNA molecule, (c ) Selected from the gRNA molecules of Embodiment 18 of the gRNA molecule, or (d) gRNA A gRNA molecule is selected from any of the molecular embodiments 57 to 68.

[0122] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition comprising a first gRNA molecule and a second gRNA molecule. (1) The first gRNA molecule is selected from the gRNA molecules of Embodiment 10 of (a) gRNA molecule. (b) Selected from the gRNA molecules of Embodiment 11 of the gRNA molecule; call (2) The second gRNA molecule is selected from the gRNA molecules of Embodiment 13 of (a) gRNA molecule. Selected, (b) gRNA molecule is selected from the gRNA molecules of Embodiment 14.

[0123] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition comprising a first gRNA molecule and a second gRNA molecule. (1) The first gRNA molecule is selected from the gRNA molecules of Embodiment 10 of (a) gRNA molecule. (b) Selected from the gRNA molecules of Embodiment 11 of the gRNA molecule; call (2) The second gRNA molecule is selected from the gRNA molecules of Embodiment 16 of (a) gRNA molecule. (b) Selected from the gRNA molecules of Embodiment 17 of the gRNA molecule, (c ) Selected from the gRNA molecules of Embodiment 18 of the gRNA molecule, or (d) gRNA A gRNA molecule is selected from any of the molecular embodiments 57 to 68.

[0124] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition comprising a first gRNA molecule and a second gRNA molecule. (1) The first gRNA molecule is selected from the gRNA molecules of Embodiment 13 of (a) gRNA molecule. Selected, and selected from the gRNA molecules of Embodiment 14 of the gRNA molecule; and (2) The second gRNA molecule is selected from the gRNA molecules of Embodiment 16 of (a) gRNA molecule. (b) Selected from the gRNA molecules of Embodiment 17 of the gRNA molecule, (c ) Selected from the gRNA molecules of Embodiment 18 of the gRNA molecule, or (d) gRNA A gRNA molecule is selected from any of the molecular embodiments 57 to 68.

[0125] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition comprising a first gRNA molecule and a second gRNA molecule. (1) The first gRNA molecule is selected from the gRNA molecules of Embodiment 16 of (a) gRNA molecule. (b) Selected from the gRNA molecules of Embodiment 17 of the gRNA molecule, (c ) Selected from the gRNA molecules of Embodiment 18 of the gRNA molecule, or (d) gRNA (2) Selected from any gRNA molecule of any of the molecular embodiments 57-68; and (2) Second The gRNA molecule contains a targeting domain complementary to the target sequence of the β-globin gene; also teeth (1) The first gRNA molecule is selected from the gRNA molecules of Embodiment 4 of (a) gRNA molecule. (b) gRNA molecule selected from gRNA molecules of Embodiment 5, or (c) g A gRNA molecule selected from embodiment 6 of the RNA molecule, or (d) an embodiment of the gRNA molecule Selected from gRNA molecules of form 7, or (e) any of the gRNA molecules of embodiments 41 to 56 Selected from any of the gRNA molecules, or (f) gRNA molecules of embodiment 10 Selected from the offspring, or selected from the gRNA molecule of Embodiment 11 of the (g)gRNA molecule. (h) Selected from the gRNA molecules of Embodiment 13 of the gRNA molecule, or (i) (2) Selected from the gRNA molecules of Embodiment 14 of the gRNA molecule; and (2) Second gRNA The molecule contains a targeting domain complementary to the target sequence of the β-globin gene.

[0126] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. In this invention, the first gRNA molecule and the second gRNA molecule are embodiments of the gRNA molecule. The present invention provides a composition independently selected from any of the gRNA molecules in states 41 to 68.

[0127] In embodiments of this composition, with respect to the gRNA molecular component of the composition, this composition is first It consists of a gRNA molecule and a second gRNA molecule.

[0128] In embodiments of this composition, each of the gRNA molecules is a Ca as described herein. It is found in the ribonucleoprotein complex (RNP) along with the s9 molecule.

[0129] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. The present invention provides a composition further comprising a template nucleic acid, wherein the template nucleic acid is a first gRNA component The child contains nucleotides corresponding to nucleotides in or near the target sequence. Morphologically, the template nucleic acid is (a) human β-globin, e.g., mutant G16D, E22A and human β-globin or fragment thereof containing one or more T87Q; or (b) human It contains nucleic acids that code for gamma globin or a fragment thereof.

[0130] The embodiments include embodiments in any of the aforementioned forms and embodiments of the composition. Therefore, this composition is suitable for electroporation, for example, electroporation of HSPC cells. The composition is formulated in a medium suitable for electroporation. This composition contains one or more gRNA molecules. In the embodiment, each of the gRNA molecules is coupled with the Cas9 molecule described herein. It is present in the RNP, and each of the RNPs is less than about 10 μM, for example less than about 3 μM. For example, less than approximately 1 μM, less than approximately 0.5 μM, less than approximately 0.3 μM, approximately 0. The concentration is less than 1 μM.

[0131] In another embodiment, the present invention relates to one or more gRNA molecules described herein, for example, The present invention provides a nucleic acid sequence encoding a gRNA molecule in any of the aforementioned embodiments and models. In an embodiment, the nucleic acid is operable to a sequence encoding one or more gRNA molecules. A linked promoter, for example, RNA polymerase II or RNA polymerase I Promoters recognized by II, such as the U6 promoter or HI promoter. It includes. In embodiments, the nucleic acid is a Cas9 molecule, for example, C as described herein. AS9 molecules, for example, SEQ ID NO: 6611, SEQ ID NO: 7821, SEQ ID NO: 7822, Sequence ID NO: Number 7823, Sequence ID 7824, Sequence ID 7825, Sequence ID 7826, Sequence ID 782 7, Sequence ID 7828, Sequence ID 7829, Sequence ID 7830, or Sequence ID 7831 Further encoding a Cas9 molecule containing (e.g., consisting of) any of the following embodiments. In this context, the nucleic acid is a promoter operably linked to a sequence encoding the Cas9 molecule. —For example, EF-1 promoter, CMV IE gene promoter, EF-1α promoter Motor, ubiquitin C promoter, or phosphoglycerate kinase (PGK) promoter Includes motors.

[0132] In another embodiment, the present invention includes a nucleic acid of any of the aforementioned nucleic acid embodiments and models. A vector is provided. In an embodiment, this vector is a lentiviral vector, Denovirus vectors, adeno-associated virus (AAV) vectors, herpes simplex virus (HSV) vectors, plasmids, minicircles, nanoplasmids, and RNA vectors Selected from the group consisting of -.

[0133] In another embodiment, the present invention relates to a cell (e.g., a population of cells) with a target sequence within the cell. or a method of modifying it in its vicinity (for example, modifying the structure of nucleic acids (e.g., sequence)) Therefore, the aforementioned cells (for example, a group of cells) are 1) the embodiments and forms of the gRNA molecule mentioned above. One or more gRNA molecules of any state, and a Cas9 molecule (for example, as described herein). (2) One or more gRNs of any of the aforementioned gRNA molecule forms and embodiments Nucleic acids encoding molecule A and Cas9 molecules (e.g., as described herein);3) Encoding one or more gRNA molecules of any of the aforementioned gRNA molecule embodiments and models nucleic acids and Cas9 molecules (e.g., those described herein); 4) the aforementioned gRNA nucleic acids encoding one or more gRNA molecules in any of the molecular forms and embodiments, and 5) nucleic acids encoding Cas9 molecules (e.g., as described herein); 1) to 4 above ) one of the above, and template nucleic acid; 6) one of the above 1) to 4), and template nucleic acid Nucleic acids containing a sequence; 7) A composition of any of the embodiments and models of the compositions described above; 8) Contacting the vector of any of the vector embodiments and models described above (for example The present invention provides a method that includes the step of introducing a gRNA molecule into it. or nucleic acids encoding a gRNA molecule and a Cas9 molecule or a Cas9 molecule encoding a Cas9 molecule Nucleic acids are formulated into a single composition. In other embodiments, gRNA molecules or g What is the difference between nucleic acids that encode RNA molecules and Cas9 molecules or nucleic acids that encode Cas9 molecules? The composition is formulated into two or more compositions. In embodiments comprising two or more compositions, two or more The above compositions are delivered simultaneously or sequentially. In the embodiment, the cells are animal cells, e.g. For example, mammalian cells, primate cells, or human cells. In embodiments, the cells are hematopoietic cells. Stem cell / progenitor cells (HSPCs) (for example, a population of HSPCs), and for example, cells are CD3 These are 4+ cells, for example, the cells are CD34+CD90+ cells. In the embodiment, The cells are placed in a composition containing a population of cells enriched with respect to CD34+ cells. Morphologically, cells (e.g., a population of cells) are isolated from bone marrow, mobilized peripheral blood, or umbilical cord blood. In this embodiment, the cells are autologous to the patient receiving the administration of the cells. In other embodiments, the cells are homogeneous for the patient receiving the administration of the cells. In this embodiment, the method involves targeting the domain of one or more gRNA molecules and Indels in or near complementary genomic DNA sequences, e.g., Figure 25, Table 15, Table 26 , the indels shown in Table 27 or Table 37, for example, Figure 25, Table 15, Table 26, Table 27 Alternatively, as shown in Table 37, gRNA molecules have indels associated with the targeting domain. In an embodiment, the indel has fewer than about 40 nucleotides, for example, 30 nucleotides. Insertions or deletions of less than 20 nucleotides, for example, less than 10 nucleotides Yes, for example, a single nucleotide deletion. In embodiments, the method is used for small populations. At least about 50%, for example at least about 60%, for example at least about 70%, for example at least At least about 80%, for example at least about 90% (for example at least about 95%, at least Fine details of approximately 96%, at least approximately 97%, at least approximately 98%, or at least approximately 99% The cells are modified, resulting in a population of cells containing, for example, indels. In one embodiment, This method (for example, when performed on a population of cells, for example, a population of cells as described herein) The method involves cells that have the ability to differentiate into differentiated cells of the erythrocyte lineage (e.g., erythrocytes). For example, it results in a population of cells, where the differentiated cells are, for example, unmodified cells (for example, It exhibits an increased level of fetal hemoglobin compared to a population of cells. In one embodiment, This method involves differentiating a population of cells, for example, a population of cells of the erythrocyte lineage (for example, a cluster of erythrocytes). This results in a population of cells that have the ability to differentiate into a group, where the population of differentiated cells is, for example, Compared to the unmodified cell population, the F cell population increased (e.g., at least about 15%, at least (Approximately 20%, at least 25%, at least 30%, or at least 40% higher) It has a proportion. In an embodiment, this method uses differentiated cells, for example, cells of the erythrocyte lineage (for example) This results in cells that have the ability to differentiate into red blood cells, where one differentiated cell is equivalent to one cell. or at least about 6 picograms (for example, at least about 7 picograms, at least about 8 picograms) cograms, at least about 9 picograms, at least about 10 picograms, or about 8 to about 9 It produces picograms (or about 9 to 10 picograms) of fetal hemoglobin. Embodiments In this embodiment, the method is performed ex vivo. In another embodiment, the method is performed in vivo. It will be implemented in [location / location].

[0134] In another embodiment, the present invention modifies the cells of any of the embodiments and methods described above. We provide cells that have been modified by altering the method.

[0135] In another embodiment, the present invention modifies the cells of any of the embodiments and methods described above. We provide cells that can be obtained through a modified method.

[0136] In another embodiment, the present invention relates to a first gRNA molecule, for example, the first gRNA molecule described herein. 1 gRNA molecule, for example, one of the embodiments and models of the gRNA molecule described above gRNA molecules or compositions, for example, compositions described herein, for example, the aforementioned A composition, nucleic acid, etc., according to any of the embodiments and forms of the composition described herein. Nucleic acids, for example, nucleic acids of any of the embodiments and models of nucleic acids described above, or vectors, e.g. For example, the vectors described herein, for instance, the embodiments and models of the aforementioned vectors The present invention provides cells containing one of the vectors. In an embodiment, these cells contain the Cas9 molecule For example, the Cas9 molecules described herein, e.g., SEQ ID NO: 6611, SEQ ID NO: 7 821, SEQ ID NO: 7822, SEQ ID NO: 7823, SEQ ID NO: 7824, SEQ ID NO: 7825, Sequence ID 7826, Sequence ID 7827, Sequence ID 7828, Sequence ID 7829, Sequence ID For example, a Cas9 molecule containing either 7830 or SEQ ID NO: 7831. The following are further included. In embodiments, the cell contains a second gRNA molecule, for example, as described herein. The second gRNA molecule described, for example, any of the embodiments and models of the aforementioned gRNA molecule Any second gRNA molecule, or a molecule encoding a second gRNA molecule, for example, as specified herein The second gRNA molecule described above, for example, the embodiment of the aforementioned gRNA molecule and comprising, or including, a nucleic acid encoding a second gRNA molecule of any of the embodiments. or including it, here, the first gRNA molecule and the second gRNA molecule It includes a targeting domain that is not identical to the other. In the embodiment, the expression of fetal hemoglobin is Compared to cells of the same cell type or their offspring that have not been modified to contain gRNA molecules, In the record cell or its offspring (for example, its erythroid offspring, for example, its erythrocyte offspring) They increase. In an embodiment, these cells are differentiated cells, for example, cells of the erythrocyte lineage (for example) If it has the ability to differentiate into red blood cells, the differentiated cells contain, for example, gRNA molecules. Compared to cells of the same type that have not been modified, these cells exhibit increased levels of fetal hemoglobin. In the embodiment, differentiated cells (for example, cells of the erythrocyte lineage, for example, erythrocytes) For example, compared to the same type of cell that has not been modified to include a gRNA molecule, at least Approximately 6 picograms (for example, at least about 7 picograms, at least about 8 picograms, less At most about 9 picograms, at least about 10 picograms, or about 8 to about 9 picograms, It produces approximately 9 to 10 picograms of fetal hemoglobin. In this embodiment, the following The cells contain stem cell growth agents, such as those described herein, for example, Compound 1, Compound 2. , compound 3, compound 4, or a combination thereof (e.g., compound 1 and compound 4) A stem cell proliferation agent, for example, a stem cell proliferation agent that is compound 4, for example, E It is brought into contact with Kisovivo. An embodiment in any of the above-described aspects and embodiments In embodiments including the state, the cell is subjected to the gRNA molecule introduced therein (as specified herein). As described, for example, a gRNA molecule of any of the embodiments and examples described above. Indels are located in or near the genomic DNA sequence that is complementary to the targeting domain, for example, as shown in Figure 25, the indels shown in Table 15, Table 26, Table 27 or Table 37, for example, introduced therein gRNA molecules (as described herein, for example, in the embodiments and embodiments described above) Figure 25, Table 15, Table 26, Table 27 or Table 3 relating to any of the gRNA molecules (of any form) The indel is shown in 7. In the embodiment, the indel is less than about 40 nucleotides. For example, less than 30 nucleotides, for example less than 20 nucleotides, for example 10 nucleotides An insertion or deletion of less than 1 nucleotide; for example, an indel is a single nucleotide deletion. In embodiments, including embodiments in any of the cell forms and embodiments, this The cells are animal cells; for example, these cells are mammalian cells, primate cells, or human cells. The embodiments include embodiments in any of the aforementioned cell forms and embodiments. These cells are hematopoietic stem cell / progenitor cells (HSPCs) (for example, a population of HSPCs), For example, this cell is a CD34+ cell, and for example, this cell is a CD34+CD90+ cell. Yes. The embodiments include embodiments in any of the aforementioned cell forms and embodiments. In this context, these cells (for example, a population of cells) are isolated from bone marrow, mobilized peripheral blood, or umbilical cord blood. The embodiments include embodiments in any of the aforementioned cell forms and embodiments. In this embodiment, the cells are of autologous origin to the patient receiving the administration of the cells. Furthermore, these cells are allogeneic to the patients receiving the aforementioned cells.

[0137] In another embodiment, the present invention includes cells of any of the aforementioned cell types and embodiments. Provides a population of cells. In an embodiment, at least about 50% of this population, for example, a small number At least about 60%, for example at least about 70%, for example at least about 80%, for example at least Both are approximately 90% (for example, at least approximately 95%, at least approximately 96%, at least approximately 97%) At least approximately 98%, or at least approximately 99%, of the cells exhibit the aforementioned cellular characteristics and properties. These are cells related to one of the application forms. In one embodiment, the population of these cells is a collection of differentiated cells. A group, for example, a group of cells of the erythrocyte lineage (for example, a group of erythrocyte cells), Here, the population of differentiated cells shows an increase in F cells compared to, for example, a population of unmodified cells of the same type. (For example, at least about 15%, at least about 20%, at least about 25%, less Both have a proportion of approximately 30%, or at least approximately 40% higher. In the embodiment, differentiation The F cells in a population of cells average at least about 6 picograms per cell (for example, at least Also about 7 picograms, at least about 8 picograms, at least about 9 picograms, at Fetus (approximately 10 picograms, or approximately 8-9 picograms, or approximately 9-10 picograms) It produces infant hemoglobin. In this embodiment, the population is 1) at least 1e6 CD 34+ cells / kg of body weight of the patient to whom cells are administered; 2) at least 2e6 CD34+ cells / Body weight in kg of the patient to whom cells are administered; 3) At least 3e6 CD34+ cells / cells to be administered. Patient weight in kg; 4) Patient weight to administer at least 4e6 CD34+ cells / cells kg; or 5) 2e6~10e6 CD34+ cells / cells. Includes. In embodiments, at least about 40% of the population, for example, at least about 50% (e.g., For example, at least about 60%, at least about 70%, at least about 80%, or at least Approximately 90% of the cells are CD34+ cells. In this embodiment, a small portion of the cells in this population Approximately 10%, for example at least approximately 15%, for example at least approximately 20%, for example at least Approximately 30% are CD34+CD90+ cells. In the embodiment, this cell population is Bone marrow, peripheral blood (e.g., mobilized peripheral blood), umbilical cord blood, or induced pluripotent stem cells (iPSCs) Derived from. In a preferred embodiment, the population of cells is derived from bone marrow. Therefore, this cell population includes mammalian cells, such as human cells, for example. Morphologically, this cell population is autologous to the patient to whom it is administered. In terms of administration, the cell population is of allogeneic origin to the patient to whom it is administered.

[0138] In another embodiment, the present invention relates to any of the cell embodiments and models described above, The present invention provides a composition comprising a population of cells according to any of the aforementioned embodiments and configurations of the cell population. In embodiments, the composition is provided in a pharmaceutically acceptable medium, for example, one suitable for cryopreservation. Contains a suitable pharmaceutically acceptable medium.

[0139] In another embodiment, the present invention relates to any of the cell embodiments and models described above, A population of cells in any of the embodiments or forms of the aforementioned population of cells, or a population of cells in any of the aforementioned compositions A method comprising administering a composition of any of the embodiments to a patient with abnormal hemoglobin The present invention provides a method for treating thalassemia. In one embodiment, the abnormal hemoglobin disorder is thalassemia, For example, β-thalassemia or sickle cell disease.

[0140] In another embodiment, the present invention relates to any of the cell embodiments and models described above, A population of cells in any of the embodiments or forms of the aforementioned population of cells, or a population of cells in any of the aforementioned compositions A mammalian method comprising the step of administering to a patient any of the compositions of the model and embodiment. This invention provides a method for increasing fetal hemoglobin expression.

[0141] In another embodiment, the present invention relates to (a) cells (e.g., a population of cells) (e.g., HSPC (b) providing a population of HSPCs (for example); (c) cell culture containing a stem cell growth agent The steps of culturing the cells (e.g., the population of cells) ex vivo in a culture medium; and (c) The first gRNA molecule (for example, those described herein, e.g., the aforementioned gRN) A gRNA molecule (either an embodiment or a representation of molecule A), a first gRNA molecule (for example) , any of the embodiments and examples of the gRNA molecules described herein, Nucleic acid molecules encoding any gRNA molecule, composition (for example, as described herein) For example, a composition of any of the embodiments and forms of the composition described above), nucleic acids (for example, Those described herein, for example, any of the nucleic acid embodiments and embodiments described herein ), or vectors (for example, those described herein, for example, the state of the aforementioned vectors) The step of introducing a vector (of any of the embodiments) into the cells ( For example, a method for preparing a population of cells is provided. In an embodiment of the method, the After the introduction of step (c), the cells (e.g., a population of cells) become differentiated cells (e.g., differentiated cells). A group of cells), for example, cells of the red blood cell lineage (for example, a group of cells of the red blood cell lineage), for example , having the ability to differentiate into erythrocytes (for example, a population of erythrocytes), and here, the differentiated cells ( For example, a population of differentiated cells is compared to the same cells that were not subjected to step (c), for example. It produces increased fetal hemoglobin. In any of the embodiments and aspects of the method described above In embodiments including the embodiment described above, the stem cell proliferation agent is compound 1, compound 2, compound 3. Compound 4 or a combination thereof (e.g., Compound 1 and Compound 4), for example. For example, compound 4. This includes embodiments in any of the embodiments and aspects of the method described above. In this embodiment, the cell culture medium contains thrombopoietin (TPO), FLT3 ligan. This includes (Flt-3L) and human stem cell factor (SCF). Embodiments of the above method and In embodiments, including those in any of the embodiments, the cell culture medium is human Further comprising leukin-6 (IL-6). Any aspect and embodiment of the method described above In any embodiment, including the embodiment described in any of the embodiments, the cell culture medium contains thrombopoietin ( Tpo), Flt3 ligand (Flt-3L), and human stem cell factor (SCF) are used in Each concentration ranges from approximately 10 ng / mL to approximately 1000 ng / mL, for example, approximately 50 ng each. It is contained at a concentration of / mL, for example, a concentration of 50 ng / mL. The embodiments and examples of the method described above In any of the embodiments, including the one described above, the cell culture medium is human interlibrium Kin-6 (IL-6) at concentrations ranging from approximately 10 ng / mL to approximately 1000 ng / mL, for example It contains at a concentration of approximately 50 ng / mL, for example, at a concentration of 50 ng / mL. The embodiments of the method described above and In embodiments, including those in any of the embodiments, the cell culture medium is a stem cell culture medium. The growth agent is administered at a concentration in the range of approximately 1 nM to approximately 1 mM, for example, at a concentration in the range of approximately 1 μM to approximately 100 μM. For example, concentrations in the range of approximately 50 μM to approximately 75 μM, for example, a concentration of approximately 50 μM, for example, 50 μ It contains at a concentration of M, or a concentration of approximately 75 μM, for example, at a concentration of 75 μM. In embodiments, including those in any of the embodiments, step (b) The culture includes the culture period prior to the introduction of step (c), for example, before the introduction of step (c) The incubation period is at least 12 hours, for example, a period of about 1 to 3 days, for example, The period is 1 to approximately 2 days, for example, approximately 2 days. The manner and implementation of the aforementioned method. In embodiments including those in any state, in the embodiment, the culture in step (b) is This includes the culture period after the introduction of step (c), for example, the culture period after the introduction of step (c). It is at least 12 hours, for example, a period of about 1 to about 10 days, for example, about 1 to about It is a period of 5 days, for example a period of about 2 to 4 days, for example a period of about 2 days, The period is approximately 3 days, or approximately 4 days. Appearances and embodiments of the aforementioned method In embodiments including any of the embodiments in which a population of cells is, for example, in step (b) Compared to cells not cultured, at least 4 times, for example, at least 5 times, For example, it multiplies at least 10 times. In any of the embodiments and examples of the method described above In embodiments including the above, the introduction of step (c) is electroporation For example, including electroporation with 1 to 5 pulses, for example, 1 pulse, here Each pulse has a pulse voltage in the range of 700 volts to 2000 volts and a duration of 10ms. The pulse duration is in the range of ~100ms. Any aspect or embodiment of the method described above In any embodiment, including the embodiment described above, electroporation is performed in one pulse. Including, for example, consisting of. An embodiment in any of the aforementioned methods and embodiments. In embodiments, including the state, the pulse voltage is in the range of 1500 to 1900 volts, for example. For example, 1700 volts. In the embodiment, including the state, the pulse duration is in the range of 10ms to 40ms, for example The response time is 20ms. This includes embodiments of any of the aforementioned methods and embodiments. In one embodiment, the cells provided in step (a) (e.g., a population of cells) are human cells. This is a cell (for example, a population of human cells). In embodiments including the following, the cells provided in step (a) (for example, The cells (a group of cells) can be found in bone marrow, peripheral blood (e.g., mobilized peripheral blood), umbilical cord blood, or induced pluripotent stem cells ( iPSCs), preferably isolated from bone marrow. Embodiments and implementations of the above method Embodiments, including those in any of the states, are provided in step (a) Cells (e.g., a group of cells) are isolated from bone marrow, for example, in hemoglobin disorders. It is isolated from the bone marrow of a patient with the disease. The aspects and embodiments of the method described above In any embodiment, including the embodiment in which the cells provided in step (a) are provided. The population is enriched with respect to HSPCs, e.g., CD34+ cells. Aspects of the method described above. And, including embodiments in any of the embodiments, step (c) After the introduction of the method, the cells (e.g., a population of cells) are cryopreserved. The embodiments and practices of the method described above In embodiments, including those in any of the implementation forms, the introduction of step (c) Subsequently, the cell (for example, a group of cells) has a targeting domain complementary to the first gRNA molecule. Indels are present in or near the nom DNA sequence, e.g., Figure 25, Table 15, Table 26, Table 27 Alternatively, see Figure 25, as shown in Table 37, for example, as it relates to the first gRNA molecule. , including the indels shown in Table 15, Table 26, Table 27, or Table 37. Embodiments of the above method In embodiments, including those in any of the embodiments, step (c) After introduction, at least about 50% of the cells in the cell population, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% are the first Indels are found in or near the genomic DNA sequence complementary to the targeting domain of the gRNA molecule. For example, the indels shown in Figure 25, Table 15, Table 26, Table 27, or Table 37, for example, the Figure 25, Table 15, Table 26, Table 27, or Table 37 show the gRNA molecules related to each gRNA molecule. It includes the indel that is included.

[0142] In another embodiment, the present invention relates to a cell preparation method of any of the aforementioned embodiments and models. This provides cells (e.g., a population of cells) that can be obtained. In another embodiment, The invention relates to abnormal hemoglobin disorders (e.g., thalassemia (e.g., β-thalassemia) or sickle hemoglobin). A method for treating cystic erythrocytes, comprising a composition containing the cells (e.g., a population of cells) The present invention provides a method comprising the step of administering to a human patient. In another embodiment, the present invention provides a method comprising the step of administering to a human patient. A method for increasing fetal hemoglobin expression in a patient, wherein the cells (e.g., a population of cells) The present invention provides a method comprising the step of administering a composition containing ) to the human patient. In human patients, cells (e.g., CD34+ cells, e.g., the aforementioned embodiments and implementations) Cells that can be obtained by any of the cell preparation methods in the state are given per 1 kg of body weight of a human patient. or containing at least about 1e6 cells, for example, any of the cell preparations of the above-described embodiments and models. CD34+ cells obtainable by this method can be obtained in less than 1 kg of body weight per human patient. A composition containing approximately 1e6 cells is administered. In one embodiment, a human patient is given cells (e.g., CD34+ cells, for example, by any of the cell preparation methods described above. Cells that can be obtained by this method contain at least approximately 2 e6 cells per kg of body weight of a human patient, for example. For example, C can be obtained by any of the cell preparation methods described above. A composition containing at least approximately 2e6 D34+ cells per kg of body weight was administered to a human patient. In the embodiment, a human patient is given cells (e.g., CD34+ cells, e.g., the aforementioned Cells that can be obtained by any of the cell preparation methods of the embodiment and aspects of the present invention are used in human patients. Each person's body weight contains approximately 2 to 10 units, for example, the embodiments and models described above. CD34+ cells obtainable by any of the following cell preparation methods can be obtained from a human patient's body weight 1 A composition containing at least about 2e6 to about 10e6 particles per kg is administered.

[0143] In another embodiment, the present invention relates to the gRNA described herein, which is used as a drug. A molecule, for example, a gRNA molecule of any of the embodiments and models of the gRNA molecule described above. The compositions described in the specification, for example, any combination of the embodiments and forms of the compositions mentioned above. Products, nucleic acids described herein, for example, any of the embodiments and models of nucleic acids described herein. nucleic acids, vectors described herein, for example, embodiments and models of the vectors described above. Any of the vectors, cells described herein, for example, the embodiments and organisms of the cells described above Any of the cell forms, or populations of cells described herein, for example, the aforementioned cells The present invention provides a population of cells in any of the forms and embodiments of the population.

[0144] In another embodiment, the present invention relates to a gRN used in the manufacture of a pharmaceutical product as described herein. Molecule A, for example, a gRNA molecule of any of the embodiments and models of the gRNA molecule described above, The compositions described herein, for example, any of the embodiments and models of the compositions described herein Composition, nucleic acids described herein, for example, any of the embodiments and models of the nucleic acids described herein. The nucleic acid, the vector described herein, for example, embodiments and embodiments of the aforementioned vector A vector in any form, a cell as described herein, for example, the form of the cell described above and Cells of any embodiment, or populations of cells described herein, for example, the aforementioned cells The present invention provides a population of cells in any form or embodiment of a cellular population.

[0145] In another embodiment, the present invention relates to the use of the gRN described herein for the treatment of a disease. Molecule A, for example, a gRNA molecule of any of the embodiments and models of the gRNA molecule described above, The compositions described herein, for example, any of the embodiments and models of the compositions described herein Composition, nucleic acids described herein, for example, any of the embodiments and models of the nucleic acids described herein. The nucleic acid, the vector described herein, for example, embodiments and embodiments of the aforementioned vector A vector in any form, a cell as described herein, for example, the form of the cell described above and Cells of any embodiment, or populations of cells described herein, for example, the aforementioned cells The present invention provides a population of cells in any form or embodiment of a cellular population.

[0146] In another embodiment, the present invention relates to the use of the gRN described herein for the treatment of a disease. Molecule A, for example, a gRNA molecule of any of the embodiments and models of the gRNA molecule described above, The compositions described herein, for example, any of the embodiments and models of the compositions described herein Composition, nucleic acids described herein, for example, any of the embodiments and models of the nucleic acids described herein. The nucleic acid, the vector described herein, for example, embodiments and embodiments of the aforementioned vector A vector in any form, a cell as described herein, for example, the form of the cell described above and Cells of any embodiment, or populations of cells described herein, for example, the aforementioned cells The present invention provides a population of cells in any form or embodiment of a cell population, where the disease is abnormal Moglobinosis, such as thalassemia (e.g., β-thalassemia) or sickle cell anemia. . [Brief explanation of the drawing]

[0147] [Figure 1] Cas9 editing of the Bcl11a +58 erythroid enhancer region. The percentage of editing detected by NGS in HEK-293 Cas9GFP 24 hours after lipofection delivery of crRNA and trRNA targeting the +58 enhancer region. Each dot represents a different crRNA, while the trRNA was kept constant. Genomic coordinates indicate the location on chromosome 2, for example, using hg38 as a reference. (n=1) [Figure 2] Cas9 editing of the Bcl11a +62 erythroid enhancer region. The percentage of editing detected by NGS in HEK-293 Cas9GFP 24 hours after lipofection delivery of crRNA and trRNA targeting the +62 enhancer region. Each dot represents a different crRNA, while the trRNA was kept constant. Genomic coordinates indicate the location on chromosome 2, for example, using hg38 as a reference. (n=1) [Figure 3] Gating strategies for cell selection after the introduction of the Cas9 editing system. [Figure 4] Agarose gel electrophoresis of gene fragments from CD34+ cells processed with a Cas9 editing system (showing both CD34+CD90+ and CD34+CD90- cell populations, along with unsorted reference cells). The upper bands represent uncleaved homozygous double-stranded DNA, and the lower bands represent cleavage products resulting from heterozygous double-stranded DNA. The leftmost lane is the DNA ladder. Band intensity was calculated by peak integration of the unprocessed image using ImageJ software. % gene modification (indel) was calculated as follows: % gene modification = 100 × (1 - (1 - cleavage rate) 1 / 2), and is shown below each corresponding lane on the gel. [Figure 5]The erythroid enhancer region shows the site of genomic DNA targeted by an sgRNA molecule containing a targeting domain complementary to the underlined nucleotide. The figure discloses Sequence ID No. 2841. [Figure 6A] NGS results of indel formation by sgEH1(CR00276)(A) in CD34+ HSC cells. Insertions are capitalized. Deletions are indicated by dashed lines. Microhomology regions near cleavage sites are highlighted with bold underlines. In both figures, Figure 6A displays sequence numbers 2842-2854, and Figure 6B displays sequence numbers 2855-2867, in the order they are presented. [Figure 6B] NGS results of indel formation by sgEH2(CR00275)(B) in CD34+ HSC cells. Insertions are capitalized. Deletions are indicated by dashed lines. Microhomology regions near the cleavage site are highlighted with bold underlines. In both figures, Figure 6A displays sequence numbers 2842-2854, and Figure 6B displays sequence numbers 2855-2867, in the order they are presented. [Figure 6C] NGS results of indel formation by sgEH8(CR00273)(C) in CD34+ HSC cells. Insertions are capitalized. Deletions are indicated by dashed lines. Microhomology regions near the cleavage site are highlighted with bold underlines. In order of presentation, Figure 6C discloses sequence numbers 2868-2880, and Figure 6D discloses sequence numbers 2881-2893. [Figure 6D] NGS results of indel formation by sgEH9(CR00277)(D) in CD34+ HSC cells. Insertions are capitalized. Deletions are indicated by dashed lines. Microhomology regions near the cleavage site are highlighted with bold underlines. In order of presentation, Figure 6C discloses sequence numbers 2868-2880, and Figure 6D discloses sequence numbers 2881-2893. [Figure 7]NGS results for g7, g8, and g2, and indel pattern formation across multiple donors. The top three indel sequences from two biological replicating experiments using g7 and g8 were identical, and the top three indel sequences using g2 were identical to those from the previous experiment. The figures disclose sequence numbers 2894-2911, in the order they are presented. [Figure 8] NGS results and indel pattern formation using modified gRNA scaffolds (BCs). The sequences of the top three indels from these experiments are identical to those formed when using standard gRNA scaffolds. The figures disclose sequence numbers 2912-2921 in order of appearance. [Figure 9] Comparison of indel patterns between different delivery methods. The mean % refers to the percentage of NGS reads exhibiting the indicated indel (average of two experiments). The figures disclose sequence numbers 2922-2946 in order of appearance. [Figure 10] Indel formation by co-introduction of g7 gRNA and g8 gRNA, each having either a non-extended flagpole region ("reg") or a first flagpole extension and a first tracr extension ("BC"). The PAM sequences of these two gRNAs are enclosed in a box. The figures disclose sequence numbers 2947-2955 in the order they are presented. [Figure 11] Top gRNA sequences pointing to the +58 enhancer region of the BCL11a gene in CD34+ cells, as measured by NGS (n=3). [Figure 12] Top gRNA sequences pointing to the +62 enhancer region of the BCL11a gene in CD34+ cells, as measured by NGS (n=3). [Figure 13] Predicted excision size when two gRNA molecules targeting the BCL11 +62 enhancer locus are introduced into HEK293_Cas9 cells, with either CR00187 (light gray bar) or CR00202 (dark gray bar) being constant, and co-inserted into cells together with a second gRNA molecule containing the targeting domain of the indicated gRNA. [Figure 14]Excavation of genomic DNA within the +62 enhancer of BCL11a by adding a gRNA molecule containing the targeting domain of CR00187 and a second gRNA molecule indicating the graph. Asterisks (*) indicate excisions observed at a frequency greater than 30%, and carets (^) indicate excisions observed at a lower frequency (<30%). Expected excision products resulting in fragments smaller than 50 nt could not be distinguished. [Figure 15] Excavations of genomic DNA within the +62 enhancer of BCL11a by adding a gRNA molecule containing the targeting domain of CR00202 and a second gRNA molecule indicating the graph. Asterisks (*) indicate excisions observed at a frequency greater than 30%, and carets (^) indicate excisions observed at a lower frequency (<30%). [Figure 16] % indel formation by 192 gRNA molecules targeted in the French-type HPFH region (Sankaran VG et al. "A functional element necessary for fetal hemoglobin silencing". NEJM (2011) 365:807-814). [Figure 17] An experimental scheme for Cas9:gRNA ribonucleoprotein (Cas9-RNP) delivery to primary human CD34+ HSPCs for genome editing and subsequent gene and phenotypic characterization. [Figure 18] Cell viability after mock electroporation or electroporation of Cas9-RNP complexes in CD34+ HSPCs. HSPCs were grown in vitro for 48 hours after electroporation of the RNP complex to monitor cell viability and determine percentage viability. The gRNA names used to construct the RNP complexes are shown on the x-axis, and the corresponding cell viability is shown on the y-axis. The CRxxxx identification name indicates the targeting domain of the gRNA molecule. [Figure 19]Mismatch detection was performed using the T7 endonuclease assay. Indels were introduced into the +58 DHS region of the BCL11A erythroid enhancer by NHEJ by electroporating human HSCs to deliver an RNP complex. PCR amplicons across the target region were subjected to the T7E1 assay, and the resulting fragments were analyzed by 2% agarose gel electrophoresis. The +58 erythroid enhancer BCL11A region was disrupted using both guide RNA formats (dual guide RNA - black; single guide RNA - gray (g7BCL11a-BC(1) and g7BCL11A-BC(2) in the graph below and above)). The percentage of edited alleles was determined by estimating DNA band intensity using ImageJ software (http: / / rsb.info.nih.gov / ij / ). The names of the gRNAs used and the corresponding gene editing efficiencies determined from the mismatch detection assay are also shown in the table below the gel images. [Figure 20] Percent allele editing by next-generation sequencing. Labels are as described in Figures 18 and 19. [Figure 21] Colony-forming cell (CFC) unit assays showing observed colony count and colony type for five selected gRNAs. HSPC genomes edited with +58 erythroid enhancers were plated onto methylcellulose, and clonal colonies were classified and counted based on the number and type of mature cells using morphological and phenotypic criteria using STEMvision. Colonies were classified into erythroid colony-forming cells (CFU-E), erythroid burst-forming cells (BFU-E), granulocyte / macrophage colony-forming cells (CFU-GM), and granulocyte / erythrocyte / macrophage / megakaryocyte colony-forming cells (CFU-GEMM). [Figure 22] Cell division dynamics during erythroid differentiation. The total number of cells was determined and the cell proliferation ratio was calculated on days 0, 7, 14, and 21 during erythroid differentiation. [Figure 23]BCL11A, γ, and β-globin mRNA levels in HSCs after genome editing and erythroid differentiation. Relative mRNA expression of BCL11A, γ, and β-globin chains in monophyletic erythrocyte cultures was quantified by real-time PCR. Transcript levels were normalized to human GAPDH transcript levels. [Figure 24A] High levels of HbF were induced by efficient editing of HSCs achieved with a dual gRNA / cas9 system to disrupt the BCL11a enhancer (+58). HSCs 48 hours post-electroporation were subjected to in vitro erythroid differentiation, and HbF expression was measured. HbF-positive cell (F-cell) percentages were monitored by FACS analysis on days 7, 14, and 21. The data shown in this figure were generated using a dgRNA system containing a targeting domain directed by dgRNA. [Figure 24B] High levels of HbF were induced by efficient editing of HSCs achieved with an sgRNA / cas9 system to disrupt the BCL11a enhancer (+58). HSCs 48 hours post-electroporation were subjected to in vitro erythroid differentiation, and HbF expression was measured. HbF-positive cell (F-cell) percentages were monitored by FACS analysis on days 7, 14, and 21. The data shown in this figure were generated using an sgRNA system containing a targeting domain directed by the sgRNA. [Figure 25] Indel patterns generated in HSPCs by gRNAs containing the indicated targeting domain. The figures disclose sequence numbers 2956-2968 in order of appearance. [Figure 26A]Phenotyping of edited and unedited cultures in CD34+ cell growth medium by cell surface marker staining. All gRNA molecules were tested in dgRNA format. The Tracr used was SEQ ID NO: 7808, and the crRNA had the following format and sequence (showing 2'O-methyl (m) modification and phosphorothioate binding (*) modification): mN*mN*mN*rNrNrNrNrNrNrNrNrNrNrNrNrNrNrNrNrGrUrUrUrUrArGrArGrCrUrArU*mG*mC*mU (SEQ ID NO: 2003) (wherein N is a residue of the indicated targeting domain). Representative dot plots showing fluorescence of cells stained with each antibody panel or corresponding isotype control as described in "Materials and Methods" are shown. The cells shown were pre-gated with respect to the viable cell population by forward and side scattering properties and DAPI (4',6-diamidino-2-phenylindole) discrimination. The percentage of each cell population, indicated by a name on the plot, was determined by the gates shown enclosed in thick lines. [Figure 26B] Phenotyping of edited and unedited cultures in CD34+ cell growth medium by cell surface marker staining. All gRNA molecules were tested in dgRNA format. The Tracr used was SEQ ID NO: 7808, and the crRNA had the following format and sequence (indicating 2'O-methyl (m) modification and phosphorothioate-binding (*) modification): mN*mN*mN*rNrNrNrNrNrNrNrNrNrNrNrNrNrNrNrNrGrUrUrUrUrArGrArGrCrUrArU*mG*mC*mU (SEQ ID NO: 2004) (wherein N is a residue of the indicated targeting domain). The percentage of each cell population indicating the name present in the edited and unedited cultures is shown. The targeting domain of the edited culture is as indicated. [Figure 27] %F cells in erythrocytes differentiated from a population of CD34+ cells edited with RNPs containing dgRNAs targeting two sites within the HPFH region. "g2" is a positive control (targeting domain for the coding region of the BCL11a gene), and "cntrl" is a negative control (introduction of Cas9 only). [Figure 28A] % editing rate as determined by NGS in CD34+ HSPCs 2 days after electroporation of RNPs containing the indicated dgRNA (unmodified or modified as indicated). Controls included dgRNA containing the targeting domain of unmodified CR00317 (CR00317-m) or electroporation in buffer only (no Cas9 or gRNA; "mock"). [Figure 28B] % editing rate as determined by NGS in CD34+ HSPCs 2 days after electroporation of RNPs containing the indicated dgRNA (unmodified or modified as indicated). Controls include electroporation with buffer only (no Cas9 or gRNA; "mock"). [Figure 29] The % edit rate determined by NGS in CD34+ HSPCs 2 days after electroporation of RNPs containing the indicated sgRNA (unmodified or modified as indicated; in either case, the number corresponds to the CRxxxxxx identifier of the targeting domain, for example, Unmod sg312 refers to an unmodified sgRNA containing the CR00312 targeting domain). Controls include electroporation of Cas9 protein alone ("Cas9"), electroporation with buffer only ("mock"), or no electroporation ("WT"). [Figure 30A] CD34+ HSPCs were electroporated with RNP containing the indicated dgRNA (unmodified or modified as indicated), and then cultured in erythroid differentiation medium to induce differentiation, resulting in normalized % erythrocytes ("mock" with reduced % F cells). The control consisted of electroporation with buffer only ("mock"). [Figure 30B]CD34+ HSPCs were electroporated with RNP containing the indicated dgRNA (unmodified or modified as indicated), and then cultured in erythroid differentiation medium to induce differentiation, resulting in normalized % erythrocytes ("mock" with reduced % F cells). The control consisted of electroporation with buffer only ("mock"). [Figure 31] CD34+ HSPCs were electroporated with RNP containing the indicated sgRNA (unmodified or modified as indicated; in either case, the number corresponds to the CRxxxxxx identifier of the targeting domain; for example, Unmod sg312 refers to an unmodified sgRNA containing the targeting domain of CR00312) and then cultured in erythroid differentiation medium to induce differentiation, resulting in normalized % erythrocytes ("mock" % F cells reduced). Controls included electroporation with Cas9 protein and tracr only ("Cas9 + TracRNA only"), electroporation with buffer only ("cells only + pulse"), or no electroporation ("cells only, no pulse"). [Figure 32] Total cell proliferation ratio in cultures 14 days post-erythroid differentiation after electroporation of CD34+ cells with RNP containing the indicated sgRNA (in all cases, the number corresponds to the CRxxxxxx identifier name of the targeting domain; for example, Unmod sg312 refers to an unmodified sgRNA containing the targeting domain of CR00312). Controls include electroporation with Cas9 protein and tracr only ("Cas9 + TracRNA only"), electroporation with buffer only ("cells only + pulse"), or no electroporation ("cells only, no pulse"). [Figure 33] Evaluation of potential off-target sites cleaved by Cas9, guided by dgRNA molecules targeting the BCL11a enhancer region. For each guide RNA tested, triangles represent on-target sites, while open circles represent potential off-target sites. [Figure 34]Editing efficiency at the target B2M locus of CD34+ hematopoietic stem cells by various Cas9 mutants, as determined by NGS and flow cytometry. NLS=SV40 NLS, His6 or His8 refer to 6 or 8 histidine residues, respectively (SEQ ID NOs. 2969 and 2670, respectively), TEV=tobacco etch virus cleavage site, Cas9=wild-type Streptococcus pyogenes (S. pyogenes) Cas9-mutant or variant as indicated. [Figure 35] The data show the multiplier increase in cell number after a total of 10 days of culture in growth medium (3 days before electroporation and 7 days after electroporation). Cell proliferation ranged from 2 to 7 times with all guide RNAs tested, including both single and dual guide RNA formats. CR00312 and CR001128, indicated by the arrows, demonstrated a 3 to 6-fold increase after 10 days of cell proliferation. The label "Crxxxx" refers to a dgRNA having a targeted domain that indicates a targeting domain, "sgxxxx" refers to an sgRNA having a targeted domain with the same numbered CRxxxxx identifier (for example, sg312 has the targeted domain of CR00312), "Unmod" indicates that the RNA is unmodified, "O'MePS" when used for dgRNA, in combination with unmodified tracr, refers to a crRNA having three 3' and three 5' 2'-OMe modifications and phosphorothioate bonds, and "O'MePS" when used for sgRNA, refers to a gRNA having three 5' end 2'-OMe modifications and phosphorothioate bonds, three 3' end phosphorothioate bonds, and three 2'OMe modifications on the fourth to last, third to last, and second to last 3' nucleotides. [Figure 36] Gating strategies for distinguishing different HSPC subgroups. [Figure 37] Frequency of each hematopoietic subset after 48 hours of ex vivo incubation in the indicated medium (IL-6, compound 4, or a modified STF containing both IL-6 and compound 4), but prior to electroporation using a CRISPR system. STF = StemSpan SFEM. [Figure 38] Frequency of each hematopoietic subset 7 days after electroporation targeting the +58 enhancer of BCL11a, cultured in the indicated medium (IL6, compound 4, or modified STF containing both IL6 and compound 4). STF = StemSpan SFEM. [Figure 39A] This shows the cell viability when gene editing is performed using various RNP concentrations, where RNP contains dgRNA targeting the +58 region. [Figure 39B] This shows the cell viability when gene editing is performed using various RNP concentrations, where RNP contains sgRNA targeting the +58 region. [Figure 40A] This represents the gene editing efficiency measured by NGS when gene editing was performed using various RNP concentrations, where RNP contains dgRNA targeting the +58 region. [Figure 40B] This represents the gene editing efficiency measured by NGS when gene editing was performed using various RNP concentrations, where RNP contains sgRNA targeting the +58 region. [Figure 41A] This represents the percentage of HbF induction measured by flow cytometry when gene editing was performed using various RNP concentrations, where RNP contains dgRNA targeting the +58 region. [Figure 41B] This represents the percentage of HbF induction measured by flow cytometry when gene editing was performed using various RNP concentrations, where RNP contains sgRNA targeting the +58 region. [Figure 42A] Gene editing efficiency of RNPs containing various Cas9 proteins. Gene editing was performed using various Cas9 variants (listed on the X axis) in combination with either the unmodified versions of sgRNA CR00312 and sgRNA CR001128, or the modified versions of sgRNA CR00312 and sgRNA CR001128. Edited cells were subjected to NGS to determine the % editing rate (Y axis). [Figure 42B]Induction of HbF+ cells by gene editing using various Cas9 proteins. Gene editing was performed using various Cas9 mutants (listed on the X axis) in combination with either the unmodified versions of sgRNA CR00312 and sgRNA CR001128, or the modified versions of sgRNA CR00312 and sgRNA CR001128. Edited cells were differentiated into erythrocyte lineages, and HbF production was evaluated by flow cytometry using anti-HbF antibodies conjugated with fluorophores. [Figure 43] % edit rate determined by NGS in CD34+ HSPCs after electroporation of RNPs containing the indicated dgRNA or sgRNA (unmodified or modified as indicated) (labels refer to the gRNA sequence as indicated in Table 36). Editing was determined 2 days (black bars) or 6 days (gray bars) after electroporation. After control electroporation with Cas9 protein and Tracr only ("none," data not shown), edit rates of less than 1.5% were detected at each site. Mean + standard deviation of two electroporation replicates are shown. [Figure 44] Percentage of viable cells that are CD71+ after electroporation of RNPs containing the indicated dgRNA or sgRNA (unmodified or modified as indicated) (labels refer to gRNA sequences as indicated in Table 36) to CD34+ HSPCs and cultured for 7 days under erythroid differentiation conditions. After electroporation, cells were maintained by Protocol 1 (black bars) or Protocol 2 (gray bars) as described in Example 4.7. Controls included electroporation of Cas9 protein and Tracr only ("none"). Mean + standard deviation of the two electroporation replicates are shown. [Figure 45]Percentage of erythroid cells that are HbF+ after electroporation of RNPs containing the indicated dgRNA or sgRNA (unmodified or modified as indicated) (labels refer to gRNA sequences as indicated in Table 36) to CD34+ HSPCs and cultured for 7 days under erythroid differentiation conditions. After electroporation, cells were maintained by Protocol 1 (black bars) or Protocol 2 (gray bars) as described in Example 4.7. Controls included electroporation of Cas9 protein and Tracr only ("none"). Mean + standard deviation of the two electroporation replicates are shown. [Figure 46] Percentage of cells that are HbF+ after electroporation of CD34+ HSPCs with RNPs containing the indicated dgRNA or sgRNA (unmodified or modified as indicated) (labels refer to gRNA sequences as indicated in Table 36) and cultured for 14 days under erythroid differentiation conditions. After electroporation, cells were maintained by Protocol 1 (black bars) or Protocol 2 (gray bars) as described in Example 4.7. Controls included electroporation of Cas9 protein and Tracr only ("none"). Mean + standard deviation of the two electroporation replicates are shown. [Figure 47] Percentage of cells that are HbF+ after electroporation of CD34+ HSPCs with RNPs containing the indicated dgRNA or sgRNA (unmodified or modified as indicated) (labels refer to gRNA sequences as indicated in Table 36) and cultured for 21 days under erythroid differentiation conditions. After electroporation, cells were maintained by Protocol 1 (black bars) or Protocol 2 (gray bars) as described in Example 4.7. Controls included electroporation of Cas9 protein and Tracr only ("none"). Mean + standard deviation of the two electroporation replicates are shown. [Figure 48]Total cell proliferation multipliers in erythroid differentiation culture over 7 days (black bars) or 21 days (black bars) after electroporation of RNPs containing the indicated dgRNA or sgRNA (unmodified or modified as indicated) (labels refer to gRNA sequences as indicated in Table 36) to CD34+ HSPCs. After electroporation, cells were maintained according to Protocol 2 as described in Example 4.7. Controls included electroporation of Cas9 protein and Tracr only ("none"). Mean + standard deviation of the two electroporation replicates are shown. [Figure 49] Evaluation of potential off-target sites cleaved by Cas9, guided by dgRNA molecules targeting the HPFH region. For each guide RNA tested, triangles represent on-target sites, while open circles represent potential off-target sites. [Modes for carrying out the invention]

[0148] definition The terms "CRISPR system," "Cas system," or "CRISPR / Cas system" The "stem" works together with the target sequence to form RNA-guided nucleases or other effectors. - RNA guide nuclei necessary and sufficient to induce and achieve molecular modification of nucleic acids. This refers to a set of molecules comprising a ze or other effector molecule and a gRNA molecule. In one embodiment... The CRISPR system uses gRNA and Cas proteins, such as the Cas9 protein. This includes the substance. Such a system containing Cas9 or a modified Cas9 molecule is referred to herein as " It is called the "Cas9 system" or "CRISPR / Cas9 system". Then, the gRNA molecule and the Cas molecule complex together to form a ribonucleoprotein (RNP) complex. It is possible.

[0149] The terms "guide RNA," "guide RNA molecule," "gRNA molecule," or "gRNA" The terms are used synonymously and refer to RNA-guided nucleases or other effector molecules (typically The nucleus (which is complexed with a gRNA molecule) promotes the specific induction of the target sequence. This refers to a set of acid molecules. In some embodiments, the induction involves a portion of gRNA being transferred to DNA. (For example, through hybridization via gRNA targeting domains), A portion of a gRNA molecule can be used by an RNA-guided nuclease or other effector molecule (e.g.) For example, this is achieved by binding (at least via gRNA tracr). Morphologically, a gRNA molecule consists of a single, continuous polynucleotide molecule, as specified herein. In other embodiments, it is referred to as "single guide RNA" or "sgRNA". In this context, gRNA molecules have the ability to associate with each other, normally through hybridization. It consists of multiple, usually two, polynucleotide molecules that possess force, and in this specification, "du It is also called "gRNA" or "dgRNA". The following is about the gRNA molecule. Further details will be provided, but generally, it includes the targeting domain and tracr. Morphologically, the targeting domain and tracr are located on a single polynucleotide. In other embodiments, the targeting domain and tracr are located on separate polynucleotides. It will be done.

[0150] The term "targeting domain" refers to the domain that is targeted when used in relation to gRNA. A sequence, for example, recognizes a target sequence within the nucleic acid of a cell, for example, within a gene, for example, a sequence that is complementary to it. It is a part of the gRNA molecule.

[0151] The term "crRNA" is used in relation to gRNA molecules, and when this term is used, it refers to targeted gRN includes a main region and a region that interacts with tracr to form a flagpole region. It is a part of molecule A.

[0152] The term "target sequence" refers to a nucleic acid that is complementary, for example, completely complementary, to the gRNA targeting domain. Refers to a sequence. In one embodiment, the target sequence is located on genomic DNA. Morphologically, the target sequence is a tan having nuclease activity or other effector activity. Protospacer adjacent motif (PAM) sequences recognized by the protein, for example, Cas The PAM sequence recognized by 9 is adjacent to (either on the same strand or the complementary strand of DNA) They are in contact. In one embodiment, the target sequence is a genetic sequence that affects the expression of the globin gene. Intraferential or intra-locus expression, for example, of β-globin or fetal hemoglobin (HbF), is affected. The target sequence is located within the gene or gene locus that exerts an effect. In one embodiment, the target sequence The column is a target sequence located within the globin gene locus. In one embodiment, the target sequence is BC The target sequence is located within the L11a gene. In this embodiment, the target sequence is BCL11a The target sequence is located within the enhancer region. In this embodiment, the target sequence is located within the HPFH region. It is a target sequence located within the region.

[0153] The term "flagpole" is used herein in relation to a gRNA molecule, cr RNA and tracr bind to or hybridize a portion of the gRNA. To point.

[0154] The term "tracr" as used herein in relation to gRNA molecules refers to a nucleus. This refers to a portion of gRNA that binds to enzymes or other effector molecules. In embodiments, this refers to a portion of gRNA that binds to enzymes or other effector molecules. tracr includes a nucleic acid sequence that specifically binds to Cas9. In one embodiment, tr acr contains nucleic acid sequences that form part of the flagpole.

[0155] The term "Cas9" or "Cas9 molecule" refers to bacterial type II CRI involved in DNA cleavage. This refers to the enzymes of the SPR / Cas system. Cas9 includes the wild-type protein and its mechanism. Potential and non-functional mutants are also included. In embodiments, Cas9 is a pyogenic streptococcus. This is Cas9 from the bacterium S. pyogenes.

[0156] The term "complementary" is used in relation to nucleic acids, such as A and T or U, and G and C. This refers to the pairing of bases. The term complementary means that they are perfectly complementary, i.e., across the entire reference sequence. Nucleic acid molecules in which A forms a pair with T or U, and G forms a pair with C, and This refers to molecules that are at least 80%, 85%, 90%, 95%, or 99% complementary.

[0157] When used in relation to homologous recombination repair or homologous recombination, the "template nucleic acid" is cleaved. For gene repair (insertion) at the site, the CRISPR system is modified by the donor sequence. This refers to the nucleic acid inserted at a specific position.

[0158] In this specification, "indel" refers to a set containing a gRNA molecule. Products, such as those produced after exposure to the CRISPR system, which include one or more nucleic acids compared to a reference nucleic acid. Cleotide insertion, one or more nucleotide deletions, or a combination of nucleotide insertions and deletions This refers to nucleic acids that include combinations. Indels are nucleic acids after exposure to a composition containing gRNA molecules. This can be determined, for example, by sequencing using NGS. Then, the indel is approximately 10, 9, 8, 7, 6, 5, 4, 3, 2 from the reference site, and is a single nucleotide containing at least one insertion or deletion, or the reference It overlaps with part or all of the site (for example, a gRNA molecule, for example, this specification) The gRNA molecule described in the book has a site that is complementary to and overlaps with the targeting domain. or a range of 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide. If the reference site (e.g., gRNA) is located within the bounding box, it may contain at least one insertion or deletion. It is said that the targeting domain of a molecule is located "in or near" a site that is complementary to the targeting domain.

[0159] In this specification, the term "indel pattern" refers to a gRNA molecule. This refers to a set of indels that form after exposure to a composition containing [a certain substance]. In one embodiment, the indels The pattern consists of the top three indels based on their frequency of occurrence. In one embodiment The indel pattern consists of the top 5 indels based on their frequency of occurrence. In this state, indel patterns occur at a frequency of approximately 5% or higher compared to all sequencing reads. It consists of indels that exist in one embodiment. The total number of scannable reads (i.e., reads that do not consist of an unmodified reference nucleic acid sequence) In contrast, it consists of indels that are present at a frequency of about 10% or higher. In one embodiment, The del pattern includes any three of the top five most frequently observed indels. A del pattern is used to sequence cells in a population of cells exposed to a gRNA molecule, for example. This can be determined by...

[0160] "Off-target indel" is a term used herein, and when this term is used, it refers to gRN. This refers to an indel located in a region other than the target sequence of the targeting domain of molecule A, or in its vicinity. These sites may be, for example, 1, 2, 3, 4, or 5 locations apart from the sequence of the gRNA's targeting domain. or may include mismatched nucleotides exceeding that number. In exemplary embodiments, such The site can be determined by using target sequencing of off-target sites expected in silico, or Alternatively, it may be detected by insertion methods known in the relevant art.

[0161] The terms "a" and "an" refer to one of the grammatical references of their articles. It refers to one or more (i.e., at least one). For example, "element" refers to one element. Or it means two or more elements.

[0162] The term "approximately" when referring to measurable values ​​such as quantity or duration is used to mean approximately the same as the specified value. ±20% or ±10% in some cases, or ±5% in some cases, or in some cases A variation of ±1%, or in some cases ±0.1%, is acceptable (if such variation is suitable for the implementation of the method of this disclosure). It is intended to include (as something separate).

[0163] The term "antigen" or "Ag" refers to a molecule that triggers an immune response. This may include either antibody production or activation of specific immunocompetent cells, or both. Those skilled in the art will know that any macromolecule, including virtually any protein or peptide, can be an antigen. They will understand that this is possible. Furthermore, antigens can be found in recombinant DNA or genomic DNA. It can be derived from. Those skilled in the art will therefore know that a nucleus encoding a protein that produces an immune response can be derived from. Any DNA containing an ocidal sequence or a partial nucleotide sequence is referred to herein by its terminology. You will understand that it codes for "antigens" as they are used in this context. Furthermore, in this field The antigen does not need to be encoded solely by the full-length nucleotide sequence of a certain gene. They will understand that. The present invention is not limited to, but includes, the partial modification of two or more genes. This includes the use of nucleotide sequences, and the fact that these nucleotide sequences are used for the desired immune response. They are arranged in various combinations to encode polypeptides that produce a response. It is readily apparent. Furthermore, those skilled in the art will see that it is not necessary for the antigen to be encoded by a "gene". You will understand that there is absolutely nothing. Antigens can be synthesized or obtained from biological samples. It is readily apparent that these are often macromolecules other than polypeptides. Such biological samples may include, but are not limited to, tissue samples, cells, or other biological components. It may contain bodily fluids.

[0164] The term "self-derived" refers to any originating from the same individual, which will later be reintroduced. It refers to the material.

[0165] The term "of the same species but from different lineages" refers to any material that originates from different animals of the same species as the individual from which it is introduced. This refers to the material. When two or more individuals have different genes at one or more gene loci, they It is said to be of the same species but of a different lineage. In some embodiments, it is said to be of the same species but of a different lineage from individuals of the same species. The source material may be genetically distinct enough to interact as an antigen.

[0166] The term "heterogeneous" refers to a graft derived from an animal of a different species.

[0167] "~derived from" means, when used herein, the first nutrient and the second nutrient This shows the relationship between the molecules. This generally refers to the structural class between the first molecule and the second molecule. This refers to similarity and does not include limitations on the process or source of the first molecule derived from the second molecule. It does not mean or include.

[0168] The term "encode" refers to a polynucleotide, such as a gene, cDNA, or mRNA. The specific nucleotide sequence is defined as a specific nucleotide sequence (e.g., rRNA, t RNA and mRNA) or any of the defined amino acid sequences and derived therefrom Castings for the synthesis of other polymers and macromolecules in biological processes that possess biological properties. It refers to the inherent characteristics that serve as a type. Therefore, genes, cDNA, or RNs. A is produced by the transcription and translation of mRNA corresponding to that gene in cells or other biological systems. When a protein is produced in a system, it codes for that protein. Its nucleotide sequence The column is identical to the mRNA sequence, and is typically provided in the sequence listing as the coding strand, and the gene or cDNA Both the non-coding strand, which is used as a transcription template, and the tangent of the gene or cDNA It may be said that this codes for a protein or other product.

[0169] Unless otherwise specified, "nucleotide sequences encoding amino acid sequences" are degenerate of each other. It is a variant and contains all nucleotide sequences that code for the same amino acid sequence. The phrase "nucleotide sequence that codes for protein or RNA" refers to the sequence that codes for that protein. As long as the nucleotide sequence can contain one or more introns in any version In this context, introns may also be included.

[0170] The terms “effective dose” or “therapeutic effective dose” are used synonymously in this specification. If the compound, formulation, material, or composition described herein achieves a specific biological outcome, It refers to an effective amount.

[0171] The term "endogenous" refers to any organism that originates from or is produced within an organism, cell, tissue, or system. It refers to the materials used.

[0172] The term "exogenous" means introduced from outside the organism, cell, tissue, or system. This refers to any material produced by [the process].

[0173] The term "expression" refers to the transcription of a specific nucleotide sequence driven by a promoter. And / or refers to translation.

[0174] The term "transfer vector" refers to a composition containing isolated nucleic acids that allows for the transfer of substances into the interior of a cell. This refers to compositions that can be used for the delivery of isolated nucleic acids. It is not limited to, but may include, linear polynucleotides. Polynucleotides, plasmids, and viruses associated with ionic or amphiphilic compounds Many vectors, including S, are publicly known in the relevant technical field. Therefore, the term "tra A "self-replicating plasmid or virus" is a self-replicating vector. For example, polylysine compounds and liposomes facilitate the transfer of nucleic acids into cells. It must be interpreted that this further includes nonplasmid and nonviral compounds. Examples of viral transfer vectors include, but are not limited to, adenovirus vectors. Vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors - are some examples.

[0175] The term "expression vector" refers to an expression control vector that is operablely linked to the nucleotide sequence to be expressed. This refers to a vector containing recombinant polynucleotides that include a sequence. Expression vectors are for expression purposes. It contains sufficient cis-acting elements. Other expression elements are supplied by the host cell. Alternatively, it can be supplied to an in vitro expression system. The expression vector contains recombinant polynucleate. Cosmids and plasmids that incorporate creotides (e.g., naked or liposome-containing) (and other things that are born) and viruses (e.g., lentiviruses, retroviruses, adenoviruses) This includes all known in the art, including adenoviruses and adeno-associated viruses. ru.

[0176] The term "homology" or "identity" refers to the relationship between two polymer molecules, for example, two DNA molecules. Or between two nucleic acid molecules, such as two RNA molecules, or between two polypeptide molecules This refers to the sequence identity of the subunits. The subunit positions are the same in both molecules. When occupied by monomeric subunits, for example, the position of each of two DNA molecules If they are occupied by adenine, they are homologous or identical in that position. Homologiety between arrays is a direct function of the number of matching or homologous positions. For example, 2 Half of the positions in one arrangement (for example, 5 positions in a polymer with a length of 10 subunits) If the positions are homologous, then the two sequences are 50% homologous. 90% of the positions (for example) If 9 out of 10 sequences match or are homologous, then those two sequences are 90% homologous. That is the case.

[0177] The term "isolated" means that something has been modified or extracted from its natural state. This means that nucleic acids or peptides that are naturally present in living animals are "isolated". It is not that it is "being separated," but rather that it is partially or completely separated from the materials in which it coexists in its natural state. The same nucleic acid or peptide is "isolated." An isolated nucleic acid or protein is essentially It can exist in a purified form, or in non-natural environments such as host cells. It is possible to exist.

[0178] The terms "operably linked" or "transcriptional regulation" refer to the interaction between a regulatory sequence and a heterologous nucleic acid sequence. This refers to a functional linkage that results in the expression of the latter in the second nucleus. For example, the first nucleic acid sequence leads to the second nucleus When placed in a state functionally related to the acid sequence, the first nucleic acid sequence and the second nucleic acid sequence They are operablely linked. For example, a promoter influences the transcription or expression of a coding sequence. If applicable, the promoter is operably linked to the code sequence. The DNA sequences being analyzed may be adjacent to each other; for example, two protein-coding regions may be adjacent to each other. If they need to be joined together, they should be within the same reading frame.

[0179] The term "parenteral" administration of immunogenic compositions does not include, for example, subcutaneous (sc), intravenous ( iv) including intramuscular (im) or intrasternal injection, intratumor, or injection techniques.

[0180] The term "nucleic acid" or "polynucleotide" refers to a single-stranded or double-stranded molecule. This refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and their polymers. Unless specifically limited, this term refers to substances that have similar binding properties to a reference nucleic acid and are naturally occurring. Nucleic acids containing known analogues of natural nucleotides that are metabolized in the same way as nucleotides. This is included. Unless otherwise specified, certain detailed nucleic acid sequences also implicitly imply their conservation. Modified variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and This also includes complementary sequences and explicitly indicated sequences. Specifically, degenerate codon substitutions are , the third position of one or more selected (or all) codons is a mixed base and / or This can be achieved by creating sequences that are substituted with oxyinosine residues (Batz er et al., Nucleic Acid Res. 19:5081(1991) ;Ohtsuka et al.,J.Biol.Chem.260:2605-260 8(1985); and Rossolini et al., Mol.Cell.Pro bes 8:91-98 (1994).

[0181] The terms "peptide," "polypeptide," and "protein" are used synonymously. This refers to a compound composed of amino acid residues covalently linked by butyl bonds. Proteins or peptides must contain at least two amino acids. There is no limit on the maximum number of amino acids that can be included in a sequence or peptide sequence. Polypeptides contain two or more amino acids linked together by peptide bonds. Contains any peptide or protein. When used herein, this term means In this technical field, these are generally also referred to as peptides, oligopeptides, and oligomers. Short chains and longer chains, of which there are many types, generally referred to as proteins in this technical field. It refers to both. "Polypeptide" can mean, for example, a biologically active fragment, or substantially homologous... polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modifications Polypeptides, derivatives, analogs, and fusion proteins are particularly included. Polypeptides include, Contains natural peptides, recombinant peptides, or combinations thereof.

[0182] The term "promoter" refers to the mechanism necessary to initiate the specific transcription of a polynucleotide sequence. This refers to a DNA sequence recognized by a cellular synthesis mechanism, or a synthesized synthesis mechanism introduced into a cell. .

[0183] The term "promoter / regulatory sequence" refers to a sequence that is operably linked to that promoter / regulatory sequence. This refers to the nucleic acid sequence necessary for the expression of the gene product. In some cases, this sequence is core promotion It may also be an enhancer sequence, and in other cases this sequence is an enhancer sequence and gene product It may also include other regulatory elements necessary for expression. Promoter / regulatory sequences are, for example, genetic. The offspring may be expressed in a tissue-specific manner.

[0184] The term "constitutive" promoter refers to a promoter that codes for or designates a gene product. When nucleotides are operably linked, under most or all physiological conditions of the cell This refers to a nucleotide sequence that causes the production of a gene product in a cell.

[0185] The term "inducible" refers to a promoter that codes for or designates a gene product. When operably linked to a nucleotide, the inducer substantially corresponds to the promoter. Nucleotides produce gene products in cells only when their properties are present within the cell. It refers to an array.

[0186] The term "tissue-specific" promoter refers to a promoter that codes for or is designated by a gene. When polynucleotides are operably linked, the cell effectively controls the promoter. Nuclei that cause the production of gene products in cells only when they are cells of the corresponding tissue type. This refers to the rheotide sequence.

[0187] When used herein in relation to messenger RNA (mRNA), the 5' cap is used. (RNA cap, RNA7-methylguanosine cap or RNA m7G cap) (also known as 'P') is the "pre" or 5' of eukaryotic messenger RNA immediately after transcription initiation. This is a modified guanine nucleotide added to the terminal. The 5' cap is the first transcription nucleus. It consists of terminal groups linked to rheotides. Its presence is recognized by ribosomes and RNs. It is important for protection from -ase. Cap addition is linked to transfer, with each contributing to the other. It occurs simultaneously in a way that influences the transcription. Immediately after transcription initiation, the 5' of the synthesized mRNA A cap synthesis complex related to RNA polymerase binds to the end. However, it catalyzes the chemical reactions necessary for mRNA capping. Synthesis is a multi-step biochemical reaction. The process continues. The capping region modifies the function of mRNA, such as its stability or translation efficiency. It can be modified in order to do so.

[0188] As used herein, "in vitro transcription RNA" refers to in vitro synthesized RN A, preferably mRNA. Generally, in vitro transcription RNA is an in vitro transcription vector. - is created from. In vitro transcription vectors are used to create in vitro transcription RNA. Includes the mold.

[0189] As used herein, "poly(A)" refers to the attachment of a substance to mRNA by polyadenylation. A series of adenosines are added. A preferred embodiment of the construct for transient expression In this case, polyA is 50 to 5000 (SEQ ID NO: 6596), preferably more than 64, and more Preferably more than 100, most preferably more than 300 or 400. Poly(A) The columns are chemically or to modulate mRNA function such as localization, stability, or translation efficiency. It can be modified enzymatically.

[0190] As used herein, "polyadenylation" refers to the process of adding a poly to a messenger RNA molecule. This refers to the covalent bond of the riadenylyl moiety or its modified variants. In eukaryotes, most me The messenger RNA (mRNA) molecule is polyadenylated at its 3' end. The tail is added to the mRNA precursor by the action of the enzyme polyadenylate polymerase. It is a long sequence of adenine nucleotides (often several hundred). The poly(A) tail is added to a transcript containing a specific sequence and a polyadenylation signal. The poly(A) tail and the protein bound to it transmit mRNA as an exonuclear. It helps protect against degradation by enzymes. Polyadenylation is a transcriptional termination and mRN from the nucleus. It is also important for the export and translation of A. Polyadenylation occurs immediately after transcription from DNA to RNA. It occurs in the nucleus, but can also occur later in the cytoplasm. After transcription is complete, RNA polymerase The mRNA strand is cleaved by the action of an endonuclease complex associated with the enzyme. The cleavage site is usually characterized by the presence of the base sequence AAUAAA near the cleavage site. After mRNA is cleaved, an adenosine residue is added to the free 3' end of the cleavage site.

[0191] As used herein, “transient” refers to a period of time lasting several hours, several days, or several weeks. This refers to the expression of unintegrated trans genes, and this expression period is when the host cell's genome is integrated. Gene expression when embedded or contained within a stable plasmid replicon It's shorter than the duration.

[0192] As used herein, the terms “to treat,” “treatment,” and “treating” are: One or more therapies (for example, the gRNA molecule of the present invention, the CRISPR system, or modified molecules) Disorders caused by the administration of one or more therapeutic agents (such as cysts), for example, abnormal hemoglobin Reduction or improvement in the progression, severity and / or duration of the disease, or impairment, e.g., abnormality This refers to the improvement of one or more symptoms (preferably one or more recognizable symptoms) of moglobinopathy. In specific mechanisms, the terms "to treat," "treatment," and "treating" are used. At least one measurable physical symptom of abnormal hemoglobin disorder that is unrecognizable to the patient It refers to improvement of the lameter. In other mechanisms, the terms “to treat,” “to cure,” and “to cure.” "Treating" refers to the physical inhibition of the progression of the disorder, for example, by stabilizing recognizable symptoms. This refers to either or both of the following: inhibition due to a scientific cause, such as the stabilization of a scientific parameter. In other mechanisms, the terms “to treat,” “to treat,” and “is treating” are used to describe abnormalities. This refers to the reduction or stabilization of symptoms of moglobin disorders, such as sickle cell anemia or beta-thalassemia. vinegar.

[0193] The term "signaling pathway" refers to the transmission of signals from one part of a cell to another part of the cell. This refers to the biochemical relationships between various signal transduction molecules that play a role in the cell surface. "Receptors" are molecules and molecular complexes that receive signals and transmit those signals across the cell membrane. Includes fusion.

[0194] The term "target" refers to a living organism capable of eliciting an immune response (e.g., mammals). It is intended to include things (people, objects, etc.).

[0195] The term "substantially purified" refers to cells that essentially contain no other cell types. Qualitatively purified cells are those that, in their naturally occurring state, are not bound to other cells. This also refers to cells that have been separated from the cytoplasmic type. In some cases, a population of substantially purified cells is, It refers to a homogeneous group of cells. In other examples, the term simply refers to a group of cells that, in their natural state, are naturally formed. This refers to cells that have been separated from the attached cells. In some embodiments, these cells They are cultured in vitro. In other embodiments, these cells are not cultured in vitro.

[0196] The term "therapeutic," as used herein, means treatment. Therapeutic effects are related to disease. This is achieved by reducing, suppressing, relieving, or eradicating the condition.

[0197] The term "prevention" as used herein means the prevention or protection of a disease or disease condition. It means targeted treatment.

[0198] The term "transfected," "transformed," or "transformed" This refers to the process of transferring or introducing exogenous nucleic acids and / or proteins into host cells. Refers to a ses. "Transfected" or "transformed" or "transformed" "Cells that have been transfected with exogenous nucleic acids and / or proteins, are transfected." These are cells that have been replaced or transduced. The cells include primary target cells and their offspring. Born.

[0199] The term "specifically binds" refers to a binding partner present in the sample (for example, a protein). A molecule that recognizes and binds to nucleic acids, but substantially blocks other molecules in the sample. This refers to molecules that are not recognized or bound to [the target molecule].

[0200] The term "biologically equivalent" refers to the effect produced by a reference dose or reference amount of the reference compound. This refers to the amount of a drug other than the reference compound required to produce a uniform effect.

[0201] When used herein, "refractory" refers to a disease that does not respond to treatment, such as an abnormal hemoglobin. This refers to refractory hemoglobinopathy. In the embodiment, refractory abnormal hemoglobinopathy is treated before or after the initiation of treatment. It may be resistant to treatment at the initial stage. In other embodiments, refractory abnormal hemoglobinopathy is Resistance can develop during treatment. Refractory abnormal hemoglobinopathy is also known as resistant abnormal hemoglobinopathy. To be called.

[0202] When used herein, "recurrent" means after a period of improvement, for example, after a certain therapy, for example, a different treatment. Diseases such as abnormal hemoglobinosis (for example, abnormal hemoglobinosis) after prior treatment with normal hemoglobinosis therapy. This refers to the recurrence of signs and symptoms of globinosis (or other disease).

[0203] Scope: Throughout this disclosure, various aspects of the present invention may be presented in the form of a scope. It is important to understand that the formal descriptions are merely for convenience and to keep things concise. This must not be interpreted as inflexibly limiting the scope of the present invention. The range description refers to any possible partial range and the individual numerical values ​​within that range. It must be considered to have been specifically disclosed. For example, a description of a range such as 1 to 6. This includes partial ranges such as 1-3, 1-4, 1-5, 2-4, 2-6, 3-6, and their Each individual number within the range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6, is specific. It must be considered to have been disclosed. Another example is 95-99% identity. Within such ranges, there are those that have 95%, 96%, 97%, 98%, or 99% identity. This includes 96-99%, 96-98%, 96-97%, 97-99%, and 97- This includes partial ranges such as 98% and 98-99% identity. This is not the same as the breadth of the range. It applies regardless of the circumstances.

[0204] The term "BCL11a" refers to RNA polymerase II core promoter proximity region sequence specific. B-cell lymphoma / leukemia 11A, which is a DNA-binding protein, and the said protein This refers to the encoding gene, along with all its introns and exons. This gene is C2H It encodes type 2 zinc finger protein. BCL11A is involved in fetal hemoglobin production. It is known to play a role in the suppression of B cell CLL / phosphorus. Parkinson's disease 11A (zinc finger protein), CTIP1, EVI9, Ecotropic Virus integration site 9 protein homolog, COUP-TF interaction protein 1, zinc Finger protein 856, KIAA1809, BCL-11A, ZNF856, EV Also known as I-9 and B-cell CLL / lymphoma 11A. This term includes BCL1 This includes all isoforms and splice variants of 1a. The human gene that maps is located at chromosome position 2p16.1 (according to Ensembl) (The data is from GenBank, UniProt.) Human and mouse amino acid and nucleic acid sequences are from GenBank, UniProt. You can refer to public databases such as Swiss-Prot, and human B The genome sequence for CL11a can be found in GenBank, specifically NC_000002.12. It is possible. The BCL11a gene includes all introns and exons, and this gene This refers to the nom position. There are several known isotypes for BCL11a.

[0205] The mRNA sequence encoding human BCL11a isoform 1 is NM_02289. You can refer to 3.

[0206] The peptide sequence of human BCL11a isoform 1 is as follows: [ka]

[0207] Sequences of other BCL11a protein isoforms are provided below. Isoform 2: Q9H165-2 Isoform 3: Q9H165-3 Isoform 4: Q9H165-4 Isoform 5: Q9H165-5 Isoform 6: Q9H165-6

[0208] When used herein, the human BCL11a protein has a full length BCL11a isoforms 1-6 and at least approximately 70%, 71%, 72%, 73%, and 7 4%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 8 4%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 9 Ta Proteins are also included, and here, such proteins still have a significant role in the function of BCL11a. It also has one more.

[0209] The term "globin locus" is used herein to refer to the embryo (ε) and fetus (G(γ)). and A(γ), adult globin genes (γ and β), gene locus regulatory regions and DNA This refers to the region of human chromosome 11 that contains the gene for the -ase I hypersensitivity site.

[0210] The term "complementary" is used in relation to nucleic acids, such as A and T or U, and G and C. This refers to the pairing of bases. The term complementary means that they are perfectly complementary, i.e., across the entire reference sequence. Nucleic acid molecules in which A forms a pair with T or U, and G forms a pair with C, and This refers to molecules that are at least 80%, 85%, 90%, 95%, or 99% complementary.

[0211] The term "HPFH" refers to hereditary hyperfetal hemoglobinemia, which is characterized by high fetal hemoglobin levels in adult red blood cells. It is characterized by an increase in infant hemoglobin. The term "HPFH region" is modified (for example, (When mutated or deleted) genotypes cause increased HbF production in adult red blood cells. This refers to the mu region and includes HPFH sites identified in the literature (for example, Online Mendelian Inheritance in Man:http: / / www. See omim.org / entry / 141749. In exemplary embodiments... Therefore, the HPFH region is located within the β-globin gene cluster on chromosome 11p15. or is the region that encompasses it. In an exemplary embodiment, the HPFH region is δglobin Within the range of at least a portion of the genes, or encompassing them. In exemplary embodiments, The HPFH region is the region of the HBG1 promoter. In an exemplary embodiment, The HPFH region is the promoter region of HBG1. In exemplary embodiments, HP The FH region is described in Sankaran VG et al. NEJM (2011) 365:80. This is the region described in 7-814. In an exemplary embodiment, the HPFH region is San As described in Karan VG et al. NEJM (2011) 365:807-814. This is a French-type breakpoint-deficient HPFH as described. In an exemplary embodiment... The HPFH region is described in Sankaran VG et al. NEJM (2011) 365. This is an Algerian-type HPFH as described in 807-814. Exemplary Embodiment In this context, the HPFH region is described by Sankaran VG et al. NEJM (2011). This is the Sri Lankan type HPFH as described in 365:807-814. In terms of application method, the HPFH region is described by Sankaran VG et al. NEJM(2 HPFH-3 as described in 011)365:807-814. Exemplary implementation In terms of morphology, the HPFH region is described by Sankaran VG et al. NEJM (20 11) HPFH-2 as described in 365:807-814. One embodiment In this study, the HPFH-1 region was identified by Sankaran VG et al. NEJM (2020). 11) HPFH-3 as described in 365:807-814. Exemplary implementation. In this state, the HPFH region is described in Sankaran VG et al. NEJM (201 1) Sri Lankan type (δβ) as described in 365:807-814 0 - Thalassemia This is HPFH. In an exemplary embodiment, the HPFH region is Sankaran VG Sichili as described in et al. NEJM (2011) 365:807-814 Type A (δβ) 0 - Thalassemia HPFH. In an exemplary embodiment, the HPFH region is , Sankaran VG et al.NEJM(2011)365:807-814 Macedonian type (δβ) as described in [reference] 0 - Thalassemia HPFH. Exemplary implementation. In terms of morphology, the HPFH region is described by Sankaran VG et al. NEJM (20 11) Kurdish type β as described in 365:807-814 0 - Thalassemia HPFH In an exemplary embodiment, the HPFH region is Chr11:5213874~52 This is the region located at 14400 (hg18). In an exemplary embodiment, the HPFH region. This region is located at Chr11:5215943~5215046(hg18). In an exemplary embodiment, the HPFH region is Chr11:5234390~523848 This region is located at 6(hg38).

[0212] "BCL11a enhancer" is used in this specification when this term is used. This refers to nucleic acid sequences that affect, for example, enhance the expression or function of L11a. For example, Bauer et al.,Science,vol.342,2013,pp. See pages 253-257. BCL11a enhancers are, for example, used in certain cell types. For example, it may only be possible to act on cells of the red blood cell lineage. BCL11a An example of a enhancer is the nucleic acid sequence between exon 2 and exon 3 of the BCL11a gene ( For example, the position recorded in hg38 is +55:Chr2:60497676~ 60498941;+58:Chr2:60494251~60495546;+62: (The nucleic acids located at Chr2:60490409~60491734 or the corresponding nucleic acids) Yes. In one embodiment, the BCL11a enhancer is an extrusion of the BCL11a gene. This is the +62 region of the nucleic acid sequence located between exon 2 and exon 3. In one embodiment, The BCL11a enhancer is located between exon 2 and exon 3 of the BCL11a gene. This is the +58 region of the nucleic acid sequence. In one embodiment, the BCL11a enhancer is This is the +55 region of the nucleic acid sequence located between exon 2 and exon 3 of the BCL11a gene. .

[0213] The terms "hematopoietic stem cells / progenitor cells" or "HSPC" are used synonymously, and hematopoietic stem cells ( This refers to a population of cells that includes both "HSCs" and hematopoietic progenitor cells ("HPCs"). The cells are characterized as, for example, CD34+. In an exemplary embodiment, the HSPC is It is isolated from bone marrow. In other exemplary embodiments, HSPC is isolated from peripheral blood. It is separated. In other exemplary embodiments, HSPC is isolated from umbilical cord blood. That is the case.

[0214] When used herein, "stem cell proliferation agent" refers to cells, for example, HSPCs, HSCs. To cause HPCs to grow at a faster rate than the same cell type without the aforementioned drug, for example This refers to compounds that increase the number of cells. In one exemplary embodiment, the stem cell proliferation agent is aryl carbon. It is an inhibitor of the hydrogen acceptor pathway. Further examples of stem cell proliferation agents are provided below. Embodiments In this context, proliferation, such as an increase in number, is achieved exovivovitally.

[0215] "Engraftment" or "to engraft" refers to the process of engrafting into the body of a recipient, such as a mammal or human subject. This refers to the uptake of cells or tissues, such as a population of HSPCs, into the retrieval site. In one example, engraftment is the uptake of cells or tissues into the retrieval site. This includes the growth, proliferation, and / or differentiation of engrafted cells in the cypient. For example, HSP Engraftment of C is necessary for the differentiation of the HSPC into erythroid cells and development of the HSPC within the recipient's body. Includes length.

[0216] The term "hematopoietic progenitor cell" (HPC), as used herein, refers to a cell with limited self-renewal capacity. Furthermore, depending on their position within the hematopoietic hierarchy, they undergo multi-system differentiation (e.g., bone marrow, lymph). monophyletic differentiation (e.g., bone marrow or lymphoid cell differentiation) or cell type-limited differentiation (e.g., erythrocyte cell lineage) This refers to primitive hematopoietic cells that possess the potential to be progenitor cells (Doulatov et al. l., Cell Stem Cell 2012).

[0217] When used herein, "hematopoietic stem cells" (HSCs) are self-replicating cells that produce granulocytes (e.g., For example, promyelocytes, neutrophils, eosinophils, basophils), red blood cells (for example, reticulocytes, red blood cells), Thrombocytocytes (e.g., megakaryoblasts, platelet-producing megakaryocytes, platelets), and monocytes (e.g., monocytes, ma) This refers to immature blood cells that have the ability to differentiate into more mature blood cells, including clophages. Throughout this specification, HSC is used synonymously with stem cells. In the art, It is well known that such cells may or may not contain CD34+ cells. CD34+ cells are immature cells that express the CD34 cell surface marker. Cells are thought to comprise a subpopulation of cells possessing the stem cell characteristics defined above. However, primitive progenitor cells (e.g., pluripotent progenitor cells) and / or specific hematopoietic lineages (e.g., Pluripotent cells that can generate progenitor cells committed to lymphocyte progenitor cells. This is well known in the field of technology. Stem cells committed to a specific hematopoietic lineage are T Cell lineages, B cell lineages, dendritic cell lineages, Langerhans cell lineages and / or lymphoid lineages It may be of a tissue-specific macrophage cell lineage. In addition, HSCs also have long-term HS This also refers to C (LT-HSC) and Short-Term HSC (ST-HSC). ST-HSC is LT-H It is more active and proliferates faster than SC. However, LT-HSC does not self-replicate indefinitely. ST-HSCs have (i.e., they survive throughout adulthood), while ST-HSCs self-replicate. It is limited (i.e., it survives only for a limited period). Any of these HSCs can be used in any of the laws. ST-HSC Because it is highly prolific, and therefore the number of HSCs and their offspring increases rapidly, it can be selectively selected. ST-HSCs are useful. Hematopoietic stem cells are obtained from blood products by choice. The preparations include those derived from the body or organs of the body, including hematopoietic cells. The sources include unfractionated bone marrow, umbilical cord, and peripheral blood (e.g., mobilized peripheral blood, e.g., G-CSF). or those mobilized with mobilization agents such as Plerixafor(registered trademark)(AMD3100). ), liver, thymus, lymph nodes, and spleen are included. All of the aforementioned crude or unfractionated blood products Cells having hematopoietic stem cell characteristics can be enriched by methods known to those skilled in the art. In terms of morphology, HSC is characterized as CD34+ / CD38- / CD90+ / CD45RA- It is characterized. In an embodiment, HSCs are CD34+ / CD90+ / CD49f+ cells. It can be characterized as follows.

[0218] In relation to cells, "proliferation" or "to proliferate" may or may not be the same. This refers to an increase in the number of one or more characteristic cell types from an initial population of good cells. The initial cells used for proliferation do not necessarily have to be the same as the cells produced by proliferation.

[0219] "Cell populations" are isolated from biological sources, such as blood products or tissues, and 2 This refers to cells derived from more than one cell line of a eukaryotic mammal, preferably human cells.

[0220] When "enriched" is used in relation to a cell population, it refers to one or more markers, for example. This refers to a population of cells selected based on the presence of CD34+.

[0221] The term "CD34+ cells" refers to cells that express the CD34 marker on their surface. 34+ cells can be detected, for example, using flow cytometry and fluorescently labeled anti-CD34 antibodies. And it can be counted.

[0222] "CD34+ cells enriched" means that the cell population was selected based on the presence of the CD34 marker. This means that the CD34+ cells in the cell population after the selection method - The centage is CD34 in the initial cell population before the selection step based on the CD34 marker. Higher than the percentage of + cells. For example, CD34+ cells enrich CD34+ cells. At least 50%, 60%, 70%, 80%, or at least 9% of the cells in the resulting cell population. It could account for 0%.

[0223] The terms "F cell" and "F- cell" refer to cells that contain and / or produce fetal hemoglobin. Cells that express (for example, cells that express), usually red blood cells (for example, red blood cells). For example, F -Cells are cells that contain or produce detectable levels of fetal hemoglobin. For example F- cells are cells that contain or produce at least 5 picograms of fetal hemoglobin. In another example, F- cells contain at least 6 picograms of fetal hemoglobin. These are cells that possess or produce. In another example, F- cells have at least 7 picograms These are cells that contain or produce fetal hemoglobin. In another example, F- cells are few in number. These are cells that contain or produce at least 8 picograms of fetal hemoglobin. In another example, F- cells are cells that contain or produce at least 9 picograms of fetal hemoglobin. In another example, F- cells contain at least 10 picograms of fetal hemoglobin. These are cells that contain or produce fetal hemoglobin. The level of fetal hemoglobin is as described herein. Use a ssey or other method known in the art, such as antifetal hemoglobin. Flow cytometry, high-performance liquid chromatography, and mass spectrometry using bottle detection reagents Alternatively, it can be measured by an enzyme-linked immunosorbent assay.

[0224] Unless otherwise specified, all genome or chromosome coordinates are based on hg38.

[0225] The gRNA molecules, compositions, and methods described herein are CRISPR / Cas9-based This relates to genome editing in eukaryotic cells using stems. Details are described herein. gRNA molecules, compositions, and methods relating to the regulation of globin levels, for example, globin This gRNA molecule is useful in regulating gene and protein expression and production. The product and method may be useful in the treatment of abnormal hemoglobin disorders.

[0226] I.gRNA molecule gRNA molecules can have several domains, as will be described in more detail below. However, gRNA molecules typically have at least a crRNA domain (targeted domain). Includes the main component and tracr. Used as a component of the CRISPR system. The gRNA molecule of the present invention modifies DNA at or near the target site (e.g., sequence). It is useful for modifications of genes. Such modifications include, for example, the development of functional products of genes containing the target site. This includes deletions and / or insertions that result in a decrease or disappearance of the present. Their use and Further details on its use are provided below.

[0227] In one embodiment, a single molecule, i.e., sgRNA, is preferably 5' to 3', c rRNA (a targeting domain complementary to the target sequence and a region that forms part of the flagpole) Contains the region (i.e., the crRNA flagpole region); loops; and trac r(crRNA flagpole region and complementary domain, and nuclease or other A domain to further bind effector molecules, such as Cas molecules, such as Cas9 molecules. It includes (and can take the following format (from 5' to 3'): [Targeting domain]-[crRNA flagpole region]-[Optional first flag] [Pole extension section]-[Loop]-[Optional first tracr extension section]-[tracr section] [Ragpole region]-[tracr nuclease binding domain].

[0228] In an embodiment, the tracr nuclease-binding domain is a Cas protein, for example Binds to the Cas9 protein.

[0229] In one embodiment, two molecules, i.e., dgRNA, consist of two polynucleotides; the first A polynucleotide, preferably at 5' to 3', containing crRNA (a target complementary to the target sequence). It contains regions that form part of the chemical domain and flagpole; and a second polynucle Rheotide, preferably from 5' to 3', tracr(crRNA flagpole region) Complementary domains, and nucleases or other effector molecules, such as Cas molecules. For example, it includes a domain that further binds the Cas9 molecule, in the following format Possible changes (from 5' to 3'): Polynucleotide 1 (crRNA):[Targeting Domain]-[crRNA Flagpole] [Region] - [Optional first flagpole extension] - [Optional second flagpole] [Extension part] Polynucleotide 2 (tracr): [Optional first tracr extension]-[tra [CR flagpole region]-[TRACR nuclease binding domain].

[0230] In an embodiment, the tracr nuclease-binding domain is a Cas protein, for example Binds to the Cas9 protein.

[0231] In some embodiments, the targeting domain is a targeting domain sequence described herein. For example, the target domains listed in Table 1, Table 2, Table 3, Table 4, Table 5, or Table 6, 17 of the targeting domain sequences listed in Table 1, Table 2, Table 3, Table 4, Table 5, or Table 6, 18, 19, 20, 21, 22, 23, 24, or 25 (preferably 20) consecutive It contains or comprises a targeting domain consisting of a nucleotide or ru.

[0232] In some embodiments, the flagpole, for example, the crRNA flagpole region, is 5' From 3', it includes GUUUUAGAGCUA (sequence number 6584).

[0233] In some embodiments, the flagpole, for example, the crRNA flagpole region, is 5' From 3', it contains GUUUAAGAGCUA (sequence number 6585).

[0234] In some embodiments, the loop includes GAAA (SEQ ID NO: 6588) from 5' to 3'. .

[0235] In some embodiments, the tracer is 5' to 3'. [ka] It is used for gRNA molecules that include, and preferably, SEQ ID NO: 6584.

[0236] In some embodiments, the tracer is 5' to 3'. [ka] It is used in gRNA molecules that include, and preferably, SEQ ID NO: 6585.

[0237] In some embodiments, gRNA may also contain additional U nucleic acids at its 3' end. For example, gRNA may have 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional U nucleic acids at its 3' end. (Sequence ID 2006) It may include. In one embodiment, the gRNA contains four additional U nucleic acids at its 3' end. In the case of dgRNA, one or more of the polynucleotides of the dgRNA (e.g., a polynucleotide containing a targeting domain and a polynucleotide containing tracr) may contain one, two, three, four, five, six, seven, eight, nine, or ten additional U nucleic acids at its 3' end. For example, in the case of dgRNA, one or more of the polynucleotides of the dgRNA (e.g., a polynucleotide containing a targeting domain and a polynucleotide containing tracr) may contain one, two, three, four, five, six, seven, eight, nine, or ten additional U nucleic acids at its 3' end. (Sequence ID 2006) This may include: In one embodiment, in the case of dgRNA, one or more polynucleotides of the dgRNA (e.g., a polynucleotide containing a targeting domain and a polynucleotide containing tracr) contain four additional U nucleic acids at the 3' end. In embodiments of dgRNA, only the polynucleotide containing tracr contains the additional U nucleic acids, e.g., four U nucleic acids. In embodiments of dgRNA, only the polynucleotide containing a targeting domain contains the additional U nucleic acids. In embodiments of dgRNA, both the polynucleotide containing a targeting domain and the polynucleotide containing tracr contain the additional U nucleic acids, e.g., four U nucleic acids.

[0238] In some embodiments, gRNA may also contain additional A nucleic acids at its 3' end. For example, gRNA may have 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional A nucleic acids at its 3' end. (Sequence ID 2007)It may include. In one embodiment, the gRNA contains four additional A nucleic acids at its 3' end. In the case of dgRNA, one or more of the polynucleotides of the dgRNA (e.g., polynucleotides containing a targeting domain and polynucleotides containing tracr) may contain one, two, three, four, five, six, seven, eight, nine, or ten additional A nucleic acids at its 3' end. For example, in the case of dgRNA, one or more of the polynucleotides of the dgRNA (e.g., polynucleotides containing a targeting domain and polynucleotides containing tracr) may contain one, two, three, four, five, six, seven, eight, nine, or ten additional A nucleic acids at its 3' end. (Sequence ID 2007) This may include: In one embodiment, in the case of dgRNA, one or more polynucleotides of the dgRNA (e.g., a polynucleotide containing a targeting domain and a polynucleotide containing tracr) contain four additional A nucleic acids at the 3' end. In an embodiment of dgRNA, only the polynucleotide containing tracr contains the additional A nucleic acids, e.g., four A nucleic acids. In an embodiment of dgRNA, only the polynucleotide containing a targeting domain contains the additional A nucleic acids. In an embodiment of dgRNA, both the polynucleotide containing a targeting domain and the polynucleotide containing tracr contain the additional U nucleic acids, e.g., four A nucleic acids.

[0239] In this embodiment, one or more polynucleotides of the gRNA molecule are capped at the 5' end. It may include.

[0240] In one embodiment, a single molecule, i.e., sgRNA, is preferably 5' to 3'. crRNA (containing a targeting domain complementary to the target sequence; crRNA flagpo Loop region; first flagpole extension; loop; first tracr extension (first flat It contains a domain that is complementary to at least a portion of the extended portion of the ligule; and tracr (further binding of a domain complementary to the crRNA flagpole region and the Cas9 molecule) Includes (containing a domain that does so). In some embodiments, the targeting domain is specified herein The target domain sequences described, for example, in Table 1, Table 2, Table 3, Table 4, Table 5, or Table 6 The target domains described, or those listed in Table 1, Table 2, Table 3, Table 4, Table 5, or Table 6 The targeting domain sequences 17, 18, 19, 20, 21, 22, 23, 24, or 2 Five (preferably 20) consecutive nucleotides, for example, Table 1, Table 2, Table 3, Table 4, The 3' ends of the targeting domain sequences listed in Table 5 or Table 6 are 17, 18, 19, 20. It contains 21, 22, 23, 24, or 25 (preferably 20) consecutive nucleotides. Includes a targeting domain consisting of a hyacinth or a hyacinth.

[0241] In an embodiment including a first flagpole extension and / or a first tracr extension, The flagpole, loop, and tracr arrangement may be as described above. Generally, any first flagpole extension and first tracr extension can be used. Yes, however they are complementary. In one embodiment, the first flagpole The elongated portion and the first tracr elongated portion are 3, 4, 5, 6, 7, 8, 9, 10 or so It consists of complementary nucleotides exceeding this number.

[0242] In some embodiments, the first flagpole extension section extends from 5' to 3', UGCUG( Includes sequence number 6586). In some embodiments, the first flagpole extension is sequence number 6586. It consists of number 6586.

[0243] In some embodiments, the first tracr extension is CAGCA (array) from 5' to 3'. Includes (number 6591). In some embodiments, the first tracr extension is sequence number 659 It consists of 1.

[0244] In some embodiments, dgRNA comprises two nucleic acid molecules. In some embodiments, dgRNA comprises a first nucleic acid preferably comprising, from 5' to 3', a targeting domain complementary to the target sequence; a crRNA flagpole region; optionally a first flagpole extension; and optionally a second flagpole extension; and preferably, from 5' to 3', an optional first tracr extension; and a second nucleic acid (which may be referred to herein as tracr) comprising tracr (which comprises a domain complementary to the crRNA flagpole region and a domain for further binding Cas, e.g., a Cas9 molecule), and at least a domain for binding a Cas molecule, e.g., a Cas9 molecule). The second nucleic acid also comprises an additional U nucleic acid at its 3' end (e.g., on the 3' side of tracr). (Sequence ID 2006) The second nucleic acid may include, for example, an additional 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 U nucleic acids at its 3' end (e.g., on the 3' side of tracr). The second nucleic acid may, in addition or instead, include an additional A nucleic acid at its 3' end (e.g., on the 3' side of tracr). For example, tracr may include an additional 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 A nucleic acids at its 3' end (e.g., on the 3' side of tracr). (Sequence ID 2007) This may include. In some embodiments, the targeting domain includes a targeting domain sequence described herein, for example, a targeting domain described in Table 1, Table 2, Table 3, Table 4, Table 5, or Table 6, or a targeting domain comprising 17, 18, 19, 20, 21, 22, 23, 24, or 25 (preferably 20) consecutive nucleotides of a targeting domain sequence described in Table 1, Table 2, Table 3, Table 4, Table 5, or Table 6.

[0245] In the dgRNA-involved aspects, the crRNA flagpole region, and the first of optional selections The flagpole extension portion, the optional first tracr extension portion, and the tracr sequence are as described above. It may be as described above.

[0246] In some embodiments, an optional second flagpole extension is provided from 5' to 3', U Includes UUUG (sequence number 6587).

[0247] In embodiments, gRNA molecules (and in the case of dgRNA molecules, including a targeting domain) The 3' end of polynucleotides (including tracr) 2, 3, 4, or 5 nucleotides, 1, 2, 3, 4, or 5 nucleotides on the 5' side, Alternatively, the 1st, 2nd, 3rd, 4th, or 5th nucleotides on both the 3' and 5' ends are the following: As will be explained in more detail in Section XIII, it is a modified nucleic acid.

[0248] These domains are briefly discussed below: 1) Targeting domain: For guidelines on selecting targeting domains, see, for example, Fu Y el al.NA T BIOTECHNOL 2014(doi:10.1038 / nbt.2808) Sternberg, SH, el al. NATURE 2014 (doi:10). You can refer to 1038 / naturel3011.

[0249] The targeting domain is complementary to the target sequence on the target nucleic acid, for example, at least 80, 85. Includes 90, 95, or 99% complementary, e.g., perfectly complementary nucleotide sequences. Target The chemical domain is part of the RNA molecule and therefore contains the base uracil (U). On the other hand, any DNA that codes for a gRNA molecule will contain the base thymine (T). While we do not wish to be constrained by theory, the complementarity of the targeting domain with the target sequence. This contributes to the specificity of the interaction between the gRNA molecule / Cas9 molecule complex and the target nucleic acid. It is possible. In the pair of targeting domain and target sequence, the uracil salt in the targeting domain. It is understood that the group can pair with an adenine base in the target sequence.

[0250] In one embodiment, the targeting domains are 5-50, for example 10-40, for example 10 The nucleotide length is ~30, for example 15~30, for example 15~25. In one embodiment The target domains are 15, 16, 17, 18, 19, 20, 21, 22, 23, 2 It is 4 or 25 nucleotides long. In one embodiment, the targeting domain is 16 nucleotides long. It is the rheotide length. In one embodiment, the targeting domain is 17 nucleotides long. In one embodiment, the targeting domain is 18 nucleotides long. In one embodiment, the targeting domain is 19 nucleotides long. The main part is 20 nucleotides long. In one embodiment, the targeting domain is 21 nucleotides long. It is the rheotide length. In one embodiment, the targeting domain is 22 nucleotides long. In one embodiment, the targeting domain is 23 nucleotides long. In this embodiment, the targeting domain is 24 nucleotides long. The main part is 25 nucleotides long. In the embodiment, as described above, 16, 17, 18, 19 nucleotides 20, 21, 22, 23, 24, or 25 are shown in Tables 1, 2, 3, and 4. , 5'-16, 17, 18, 19 from the targeting domains listed in Table 5 or Table 6, It comprises 20, 21, 22, 23, 24, or 25 nucleotides. In embodiments, the preceding The 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides mentioned above This is 3' from the targeting domains listed in Table 1, Table 2, Table 3, Table 4, Table 5, or Table 6. -16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides include.

[0251] Although not constrained by theory, the target located at the 3' end of the targeting domain Nucleic acids 8, 9, 10, 11, or 12 in the chemical domain are important for targeting the target sequence. It is thought to be the "core" region of the targeting domain, and therefore can be referred to as such. In this state, the core domain is perfectly complementary to the target sequence.

[0252] In this specification, the chain of target nucleic acid in which the targeting domain is complementary is referred to as the target sequence. In one embodiment, the target sequence is located on a chromosome and is, for example, a target within a gene. In some embodiments, the target sequence is located within the exon of a gene. The sequence is located within the intron of a gene. In some embodiments, the target sequence is the desired gene. The binding site of the child regulatory element, for example, the promoter or transcription factor binding site or are close to it (for example, 10, 20, 30, 40, 50, 100, 200, 3 (Within 00, 400, 500, or 1000 nucleic acids). One of the nucleotides of the domain. Part or all of it may have modifications, for example, the modifications listed in Section XIII of this Specified Publication.

[0253] 2) crRNA flagpole region: The flagpole includes parts from both crRNA and tracr. The A flagpole region is complementary to a portion of the tracr, and in some embodiments, at least Both are sufficient to form a double-stranded region under certain physiological conditions, for example, under normal physiological conditions. It has complementarity with a part of tracr. In one embodiment, the crRNA flag The pole region is 5 to 30 nucleotides long. In one embodiment, crRNA flare The flagpole region is 5-25 nucleotides long. The crRNA flagpole region is found in bacteria. The repeat sequences from the CRISPR array share homology with naturally occurring portions. or it may be derived therefrom. In one embodiment, this is the crRNA disclosed herein. Flagpole regions, for example, Streptococcus pyogenes or S. thermophila The S. thermophilus crRNA flagpole region and at least They have 50% homology.

[0254] In one embodiment, a flagpole, for example, a crRNA flagpole region, is distributed Includes column number 6584. In one embodiment, a flagpole, for example, a crRNA flagpole. The lag pole region is at least 50%, 60%, 70%, 80%, 8% of sequence number 6584. It includes sequences having 5%, 90%, 95%, or 99% homology. In one embodiment, The flagpole, for example, the crRNA flagpole region, is less than the sequence number 6584. Each contains 5, 6, 7, 8, 9, 10, or 11 nucleotides. In one embodiment, The flagpole region, for example, the crRNA flagpole region, includes sequence number 6585. In one embodiment, the flagpole is at least 50% of the number 6585 and 60% of the number 60%. Includes sequences with homology of %, 70%, 80%, 85%, 90%, 95%, or 99%. In one embodiment, the flagpole, for example, the crRNA flagpole region, is distributed Contains at least 5, 6, 7, 8, 9, 10, or 11 nucleotides in column number 6585 .

[0255] Some or all of the nucleotides of the domain have been modified, for example, in Section XIII of this Specified It may have the modifications described.

[0256] 3) First flagpole extension section When tracr containing the first tracr extension is used, crRNA is the first fura It may include a flagpole extension. Generally, any first flagpole extension and first t RCR extensions may be used, provided they are complementary. In this configuration, the first flagpole extension section and the first tracr extension section are 3, 4, 5, 6 It consists of 7, 8, 9, 10 or more complementary nucleotides.

[0257] The first flagpole extension is complementary to the nucleotides of the first tracr extension, e.g. For example, 80%, 85%, 90%, 95%, or 99%, for instance, perfectly complementary nucleotides. It may include a complement nucleotide of the first tracr extension and a high The nucleotides of the first flagpole extension that bred are continuous. In this, the first fur hybridizes with the complementary nucleotide of the first tracr extension. The nucleotides in the tracr extension region are discontinuous, for example, the nucleotides in the first tracr extension region Two or more hybridises separated by a creotide and a nucleotide that does not base-pair. Includes a region. In some embodiments, the first flagpole extension portion is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, Containing 18, 19, 20 or more nucleotides. In some embodiments, the first The flagpole extension section includes UGCUG (Sequence ID 6586) from 5' to 3'. In one embodiment, the first flagpole extension part consists of sequence number 6586. In this configuration, the first flagpole extension section is at least 80% of the part of sequence number 6586, 85 Contains nucleic acids with %, 90%, 95%, or 99% homology.

[0258] Some or all of the nucleotides in the first tracr extension are modified, for example, as specified herein. It may have the modifications listed in Section XIII.

[0259] 3) Loop The loop is located in the crRNA flagpole region of the sgRNA (or optionally, if present). Select the first flagpole extension part (or optionally select if available) It serves to connect to the first tracr extension. The loop is the crRNA flagpole. The region and tracr can be connected covalently or non-covalently. In one embodiment, This linkage is covalent. In one embodiment, the loop is a crRNA flag. The pole region and tracr are covalently coupled. In one embodiment, The loop covalently couples the first flagpole extension and the first tracr extension. In one embodiment, the loop connects the crRNA flagpole region and the crR Intermediate between the tracr domain and the NA flagpole region It is bonded or contains bonded elements. Typically, the loop consists of one or more nucleotides, for example. , containing 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.

[0260] In dgRNA molecules, the two molecules are at least a portion of crRNA (e.g., crR (NA flagpole region) and at least a portion of tracr (e.g., crRNA flagpole region) Hybridization between the Gpol region and the complementary tracr domain They can meet.

[0261] A variety of loops are suitable for use in sgRNA. The loops can be made of covalent bonds. Often, they are as short as one or a few nucleotides, for example, 1, 2, 3, 4, or 5 nucleotides. The creotide length may also be 2, 3, 4, 5, 6, It is 7, 8, 9, 10, 15, 20, or 25 nucleotides long or longer. In one embodiment, the loops are 2-50, 2-40, 2-30, 2-20, 2-1 The length is 0 or 2-5 nucleotides. In one embodiment, the loop is naturally occurring. It shares homology with or derives from a sequence. In one embodiment, the loop is It has at least 50% homology to the loops disclosed herein. In one embodiment, The loop includes sequence number 6588.

[0262] Some or all of the nucleotides of the domain have been modified, for example, in Section XIII of this Specified It may have the modifications described.

[0263] 4) Second flagpole extension section In one embodiment, dgRNA is a crRNA flagpole region, or is present in In this case, the second flag pole is located on the 3' side of the first flag pole extension section. It may include an additional arrangement referred to as a rib extension. In one embodiment, a second flag The pole extension section can be 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, or 2-4. It is the length of the creotide. In one embodiment, the second flagpole extension is 2, 3, It is 4, 5, 6, 7, 8, 9, or 10 nucleotides long or longer. In this embodiment, the second flagpole extension portion includes sequence number 6587.

[0264] 5) Tracr: tracr is a nucleic acid sequence required for the binding of nucleases, such as Cas9. Theoretically, Therefore, although not constrained, each Cas9 species is associated with a specific tracr sequence. It is thought that the tracr sequence is used in both sgRNA and dgRNA systems. In one embodiment, tracr is used to identify Streptococcus pyogenes. )Contains or derives sequences from tracr.In some embodiments, trac r is a part that hybridizes to the flagpole portion of crRNA, for example, at least under certain physiological conditions, sufficient crRNA flagpole regions to form a double-stranded region. A portion that has complementarity with the region (sometimes referred to herein as the tracr flagpole region) It is sometimes referred to as the tracr domain, which is complementary to the crRNA flagpole region. ) has. In this embodiment, t hybridizes with the crRNA flagpole region. The racr domain is a hybrid of the complementary nucleotide of the crRNA flagpole region. Iz at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, Containing 17, 18, 19, or 20 nucleotides. In some embodiments, crRNA The tracr nucleotides that hybridize with the complementary nucleotides of the ragpole region are linked. It continues. In some embodiments, the complementary nucleotide of the crRNA flagpole region and The tracr nucleotides that hybridize are discontinuous, for example, crRNA flush Two or more nucleotides separated by a nucleotide in the group region that does not base-pair. Includes the hybridization region. In some embodiments, the crRNA flagpole A portion of the tracr that hybridizes into the region is UAGCAAGUU, from 5' to 3'. Includes AAAA (SEQ ID NO: 6597). In some embodiments, crRNA flagpoles. A portion of the tracr that hybridizes into the region is UAGCAAGUU, from 5' to 3'. Includes UAAA (SEQ ID NO: 6598). In embodiments, the crRNA flagpole region Sequences that hybridize with the region include nucleases, such as Cas molecules, such as Cas9 molecules. It is placed on the 5' end of the tracr sequence that further combines them.

[0265] tracr further binds to nucleases, such as Cas molecules, such as Cas9 molecules. It further includes the domain. Although not constrained by theory, different species of Cas9 It is thought that it binds to different tracr sequences. In some aspects, tracr is Contains a sequence that binds to the Cas9 molecule of Streptococcus pyogenes. In this configuration, tracr includes a sequence that binds to the Cas9 molecule disclosed herein. In some embodiments, the domain that further binds the Cas9 molecule extends from 5' to 3'. UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAG UCGGUGC (Sequence ID 6599) Includes. In some embodiments, the domain that further binds the Cas9 molecule is 5' to 3'. to, UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAG UCGGUGCUUUU (Sequence ID 6600) Includes.

[0266] In some embodiments, tracr includes sequence number 6589. And tracr includes sequence number 6590.

[0267] Some or all of the nucleotides of tracr are modified, for example, see Section XIII of this specification. It may have the modifications listed in [reference]. In an embodiment, gRNA (e.g., sgRNA or dgRNA tracr and / or crRNA), for example, the gRN described above Either A or gRNA component is the 5' end, 3' end, or 5' end and 3 'Contains inverted debase residues at both ends.' In an embodiment, gRNA (e.g., sgR tracr and / or crRNA of NA or dgRNA, for example, as described above. Either the gRNA or gRNA component is between the residues at the 5' end of the polynucleotide. It contains one or more phosphorothioate bonds, for example, between the first two 5' residues, the first three Between each of the 5' residues, between each of the first four 5' residues, or between the first five 5' residues Each of the groups contains a phosphorothioate bond. In embodiments, gRNA or gR The NA component may be present in place of or in addition to one residue between the 3' terminal residues of the polynucleotide. The above phosphorothioate bond is included, for example, between the first two 3' residues, and between the first three 3' residues. Between each of the residues, between each of the first four 3' residues, or between each of the first five 3' residues A phosphorothioate bond may be included between them. In one embodiment, gRNA (for example) , tracr and / or crRNA of sgRNA or dgRNA, for example, the above Either the gRNA or gRNA component described herein is one of the first four 5' residues It contains phosphorothioate bonds in between (for example, three phosphorothioate bonds at the 5' end) It includes, for example, a (and consists of), and between each of the first four 3' residues, phosphorothioe It contains a phosphate bond (for example, it contains three phosphorothioate bonds at the 3' end, for example) (consisting of) In one embodiment, any of the phosphorothioate modifications described above However, at the 5' end, 3' end, or both the 5' and 3' ends of a polynucleotide... It is combined with an inverted debase residue. In this mechanism, the inverted debase nucleoti The nucleo is connected by a phosphate bond or a phosphorothioate bond to the 5' and / or 3' nucleo It can be ligated to a cytoplasm. In an embodiment, gRNA (e.g., sgRNA or dgRN) A's tracr and / or crRNA), for example, the gRNA or described above Each gRNA component contains one or more nucleotides with 2'O-methyl modification. In the application form, each of the first one, two, three, or more of the 5' residues This includes a 2'O-methyl modification. In the embodiment, the first 1, 2, and 3 of the 3' residue, and Each of the or more contains a 2'O-methyl modification. In embodiments, terminal The fourth, third from the terminal, and second from the terminal 3' residues undergo 2'O-methyl modification. Includes. In embodiments, the first one, two, three or more of the 5' residues. Each of them contains a 2'O-methyl modification, and the first 1, 2, 3 or 3 of the 3' residue Each of those exceeding this amount contains a 2'O-methyl modification. In one embodiment, the 5' residue Each of the first three contains a 2'O-methyl modification, and each of the first three 3' residues is 2' Includes O-methyl modification. In embodiments, each of the first three 5' residues is 2'O-methyl It includes a 3' modification and the 4th, 3rd, and 2nd 3' residues from the terminal. This includes a 2'O-methyl modification. In embodiments, any of the 2'O-methyl modifications, for example As described above, one or more phosphorothioate modifications, for example, as described above As listed above, and / or one or more inverse debase modifications, for example, as described above. It may be combined with the same thing. In one embodiment, gRNA (e.g., sg RNA or dgRNA tracr and / or crRNA), for example, as described above. Either the gRNA or gRNA component being processed has a 5' residue between each of the first four 5' residues. Phosphorothioate linkage (for example, three phosphorothioates at the 5' end of a polynucleotide) A phosphorothio bond is present between each of the first four 3' residues (for example, consisting of a 3' bond). A ethyl ethyl bond (for example, a polynucleotide containing three phosphorothioate bonds at its 5' end) For example, consisting of the following, each of the first three 5' residues has a 2'O-methyl modification, and the most For example, one implementation consists of a compound in which each of the first three 3' residues contains a 2'O-methyl modification. In terms of morphology, gRNA (e.g., sgRNA or dgRNA tracr and / or (or crRNA), for example, any of the gRNAs or gRNA components described above , a phosphorothioate bond (e.g., polynucleotide) between each of the first four 5' residues The first four A phosphorothioate bond is formed between each of the 3' residues (e.g., at the 5' end of a polynucleotide). The first three 5' residues contain three phosphorothioate bonds at the end (for example, consisting of the first three 5' residues) Each of the groups has a 2'O-methyl modification, and the fourth from the terminal, the third from the terminal, and from the terminal For example, a compound consisting of a 2'O-methyl modification in each of the second 3' residues.

[0268] In one approach, the trace of gRNA (e.g., sgRNA or dgRNA) (and / or crRNA), for example, the gRNA or gRNA component described above Either way, a phosphorothioate bond (for example, poly) is formed between each of the first four 5' residues. (For example, a nucleotide containing three phosphorothioate bonds at its 5' end.) , a phosphorothioate bond (e.g., polynucleotide) between each of the first four 3' residues The first three Each of the 5' residues has a 2'O-methyl modification, and each of the first three 3' residues has a 2'O-methyl modification. For example, modifications including additional inverse debase residues at the 5' and 3' ends. It consists of that.

[0269] In one approach, the trace of gRNA (e.g., sgRNA or dgRNA) (and / or crRNA), for example, the gRNA or gRNA component described above Either way, a phosphorothioate bond (for example, poly) is formed between each of the first four 5' residues. (For example, a nucleotide containing three phosphorothioate bonds at its 5' end.) , a phosphorothioate bond (e.g., polynucleotide) between each of the first four 3' residues The first three Each of the 5' residues has a 2'O-methyl modification, and the 4th from the end, the 3rd from the end, and each of the 3' residues second from the terminal has a 2'O-methyl modification, and the 5' and 3' terminals For example, it consists of a molecule with an additional inverted debase residue at each of its terminals.

[0270] In one embodiment, the gRNA is a dgRNA and includes, for example, the following: crRNA: mN*mN*mN*NNNNNNNNNNNNNNNNGUUUUAGAGCUAU*mG*mC*mU (Sequence ID 2008) (wherein m represents a base having a 2'O-methyl modification, * represents a phosphorothioate bond, and N represents a residue of the targeting domain as described herein, for example) (optionally having inverted debase residues at the 5' and / or 3' ends); and tracr: [ka] (Optionally, it has an inverted debase residue at the 5' and / or 3' end.)

[0271] In one embodiment, the gRNA is a dgRNA and includes, for example, the following: crRNA: mN*mN*mN*NNNNNNNNNNNNNNNNGUUUUAGAGCUAU*mG*mC*mU (Sequence ID 2009) (wherein m represents a base having a 2'O-methyl modification, * represents a phosphorothioate bond, and N represents a residue of the targeting domain as described herein, for example) (optionally having inverted debase residues at the 5' and / or 3' ends); and tracr: [ka] (wherein m represents a base having a 2'O-methyl modification, * represents a phosphorothioate bond, and N represents a residue of the targeting domain as described herein, for example) (optionally having inverted debase residues at the 5' and / or 3' ends).

[0272] In one embodiment, the gRNA is a dgRNA and includes, for example, the following: crRNA: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAGCUAUGCUGUU*mU*mU*mG (Sequence ID 2010) (wherein m represents a base having a 2'O-methyl modification, * represents a phosphorothioate bond, and N represents a residue of the targeting domain as described herein, for example) (optionally having inverted debase residues at the 5' and / or 3' ends); and tracr: [ka] (Optionally, it has an inverted debase residue at the 5' and / or 3' end.)

[0273] In one embodiment, the gRNA is a dgRNA and includes, for example, the following: crRNA: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAGCUAUGCUGUU*mU*mU*mG (Sequence ID 2011) (wherein m represents a base having a 2'O-methyl modification, * represents a phosphorothioate bond, and N represents a residue of the targeting domain as described herein, for example) (optionally having inverted debase residues at the 5' and / or 3' ends); and tracr: [ka] (wherein m represents a base with a 2'O-methyl modification, and * represents a phosphorothioate bond) (optionally has inverted debase residues at the 5' and / or 3' ends).

[0274] In one embodiment, the gRNA is a dgRNA and includes, for example, the following: crRNA: NNNNNNNNNNNNNNNNNNNNGUUUUUAGAGCUAUGCUGUUUUG (Sequence ID 2012) (wherein N represents a residue of the targeting domain as described herein, for example) (optionally having inverted debase residues at the 5' and / or 3' ends); and tracr: [ka] (wherein m represents a base with a 2'O-methyl modification, and * represents a phosphorothioate bond) (optionally has inverted debase residues at the 5' and / or 3' ends).

[0275] In one embodiment, the gRNA is an sgRNA and includes, for example, the following: [ka] (wherein m represents a base having a 2'O-methyl modification, * represents a phosphorothioate bond, and N represents a residue of the targeting domain as described herein, for example) (optionally having inverted debase residues at the 5' and / or 3' ends).

[0276] In one embodiment, the gRNA is an sgRNA and includes, for example, the following: [ka] (wherein m represents a base having a 2'O-methyl modification, * represents a phosphorothioate bond, and N represents a residue of the targeting domain as described herein, for example) (optionally having inverted debase residues at the 5' and / or 3' ends).

[0277] In one embodiment, the gRNA is an sgRNA and includes, for example, the following: [ka] (wherein m represents a base having a 2'O-methyl modification, * represents a phosphorothioate bond, and N represents a residue of the targeting domain as described herein, for example) (optionally having inverted debase residues at the 5' and / or 3' ends).

[0278] 6) First Tracr extension If the gRNA contains the first flagpole extension region, then the tracr extension region It may include an elongated portion. The first tracr elongated portion is the nucleoti of the first flagpole elongated portion. Complementary to D, for example, 80%, 85%, 90%, 95%, or 99%, for example, perfectly complementary. It may contain a specific nucleotide. In some embodiments, it complements the first flagpole extension. The first tracr extension nucleotide that hybridizes with the nucleotide is continuous. In some embodiments, the complementary nucleotide of the first flagpole extension and hybridize The first tracr extension nucleotide is discontinuous, for example, the first flagpo Two or more nucleotides separated by nucleotides that do not base-pair with the nucleotide in the elongation portion. Includes a hybridization region. In some embodiments, the first tracr extension is At least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 1 Contains 6, 17, 18, 19, 20 or more nucleotides. In some embodiments, The first tracr extension includes sequence number 6591. In some embodiments, the first tr The acr extension portion is at least 80%, 85%, 90%, 95% or It contains nucleic acids with 99% homology.

[0279] Some or all of the nucleotides in the first tracr extension are modified, for example, as specified herein. It may have the modifications listed in Section XIII.

[0280] In some embodiments, the sgRNA is located from 5' to 3', with the targeting domain on the 3' side. The following may be included in the arrangement: [ka] e) At least 1, 2, 3, 4, 5, 6, or 7 uracil (U) nucleos at the 3' end For example, 1, 2, 3, 4, 5, 6, or 7 uracil (U) nucleotides any of the above a) to d); f) At least 1, 2, 3, 4, 5, 6 or 7 adenine (A) nucleos at the 3' end A nucleotide, for example, 1, 2, 3, 4, 5, 6, or 7 adenine (A) nucleotides any of the above a) to d) included in the above; or g) At least 1 at the 5' end (e.g., the 5' side, e.g., the 5' side of the targeting domain) , 2, 3, 4, 5, 6 or 7 adenine (A) nucleotides, for example, 1, 2, 3 The above a) to f) further comprises 4, 5, 6, or 7 adenine (A) nucleotides. Is it a misalignment? In the embodiment, any of the above a) to g) is immediately 3' to the targeting domain. It will be placed there.

[0281] In one embodiment, the sgRNA of the present invention has a [targeting domain] from 5' to 3'. - [ka] For example, it includes, or consists of.

[0282] In one embodiment, the sgRNA of the present invention is 5' to 3', [Targeted Domain]- [ka] For example, it includes, or consists of.

[0283] In some mechanisms, dgRNA may include the following: From 5' to 3', preferably a crR containing the following, located immediately 3' to the targeting domain: NA: a) GUUUUAGAGCUA(Sequence ID 6584); b) GUUUAAGAGCUA(Sequence ID 6585); c) GUUUUAGAGCUAUGCUG(Sequence ID 6605); d) GUUUAAGAGCUAUGCUG(Sequence ID 6606); e) GUUUUAGAGCUAUGCUGUUUUG (Sequence ID 6607); f) GUUUAAGAGCUAUGCUGUUUUG(sequence number 6608); or g) GUUUUAGAGCUAUGCU (Sequence ID 7806): And the tracr from 5' to 3' includes the following: [ka] k) At least 1, 2, 3, 4, 5, 6 or 7 uracil (U) nucleos at the 3' end For example, 1, 2, 3, 4, 5, 6, or 7 uracil (U) nucleotides any of the above a) to j) included in the above; l) At least 1, 2, 3, 4, 5, 6 or 7 adenine (A) nucleos at the 3' end A nucleotide, for example, 1, 2, 3, 4, 5, 6, or 7 adenine (A) nucleotides any of the above a) to j) included in the above; or m) At least 1, 2, 3, 4, 5, 6 or 7 at the 5' end (for example, at the 5' side end) Adenine (A) nucleotides, for example, 1, 2, 3, 4, 5, 6, or 7 adenines (A) Any of the above a) to l) further comprising a nucleotide.

[0284] In one embodiment, the sequence k) above is used, for example, when the U6 promoter is used for transcription. In this case, it includes the 3' sequence UUUUUU. In one embodiment, the sequence of k) above is, for example If the HI promoter is used for transcription, it includes the 3' sequence UUUU. In one embodiment, In this context, the sequence of k) above is, for example, the termination signal of the pol-III promoter used. It includes a number of 3'U that may vary depending on the element. In one embodiment, the sequence k) above is T 7. When a promoter is used, it includes a variable 3' sequence derived from the DNA template. In the embodiment, the sequence k) above is used to create an RNA molecule, for example, by in vitro transcription. If so, it includes a variable 3' sequence derived from the DNA template. In one embodiment, The sequence k) is, for example, when transcription is driven using the pol-II promoter. It contains a variable 3' sequence derived from the DNA template.

[0285] In one embodiment, the crRNA has a targeting domain and a 3' side of the targeting domain. The sequence number 6607 is positioned (for example, immediately 3' to the targeting domain). Includes, for example, an array consisting of, [ka] Includes, for example, a tracr consisting of, and includes, for example, consisting of.

[0286] In one embodiment, the crRNA has a targeting domain and a 3' side of the targeting domain. The sequence number 6608 is positioned (for example, immediately 3' to the targeting domain). Includes, for example, an array consisting of, [ka] Includes, for example, a tracr consisting of, and includes, for example, consisting of.

[0287] In one embodiment, the crRNA has a targeting domain and a 3' side of the targeting domain. GUUUUAGAG is positioned (for example, immediately 3' to the targeting domain). For example, a sequence containing CUAUGCU (sequence number 7806), [ka] Includes, for example, a tracr consisting of, and includes, for example, consisting of.

[0288] In one embodiment, the crRNA has a targeting domain and a 3' side of the targeting domain. GUUUUAGAG is positioned (for example, immediately 3' to the targeting domain). For example, a sequence containing CUAUGCU (sequence number 7806), [ka] Includes, for example, a tracr consisting of, and includes, for example, consisting of.

[0289] In one embodiment, the crRNA has a targeting domain and a 3' side of the targeting domain. GUUUUAGAG is positioned (for example, immediately 3' to the targeting domain). For example, an array containing CUAUGCUGUUUUG (sequence number 6607), [ka] Includes, for example, a tracr consisting of, and includes, for example, consisting of.

[0290] II. Targeted domains useful for modifying globin gene expression The following table shows various embodiments of the present invention, for example, globin genes, for example, fetal hemoglobin. Targeted domains of gRNA molecules used to modify the expression of genes or hemoglobin β genes Provides input.

[0291] [Table 1]

[0292] Table 2

[0293] Table 3

[0294] Table 4

[0295] Table 5

[0296] Table 6

[0297] Table 7

[0298] Table 8

[0299] Table 9

[0300] Table 10

[0301] Table 11

[0302] Table 12

[0303] Table 13

[0304] Table 14

[0305] Table 15

[0306] Table 16

[0307] Table 17

[0308] Table 18

[0309] Table 19

[0310] Table 20

[0311] Table 21

[0312] Table 22

[0313] Table 23

[0314] Table 24

[0315] Table 25

[0316] Table 26

[0317] Table 27

[0318] Table 28

[0319] Table 29

[0320] Table 30

[0321] Table 31

[0322] Table 32

[0323] Table 33

[0324] Table 34

[0325] Table 35

[0326] Table 36

[0327] Table 37

[0328] Table 38

[0329] Table 39

[0330] Table 40

[0331] Table 41

[0332] Table 42

[0333] Table 43

[0334] Table 44

[0335] Table 45

[0336] Table 46

[0337] Table 47

[0338] Table 48

[0339] Table 49

[0340] Table 50

[0341] Table 51

[0342] Table 52

[0343] Table 53

[0344] Table 54

[0345] Table 55

[0346] Table 56

[0347] Table 57

[0348] Table 58

[0349] Table 59

[0350] Table 60

[0351] Table 61

[0352] Table 62

[0353] Table 63

[0354] Table 64

[0355] In the embodiment, the gRNA targeting domain is one of the sequences in the table above. It consists of 20 3'nts.

[0356] The compositions and methods of the present invention include exemplary preferred gRNA targeting domains that are useful in the present invention. The following table will be used.

[0357] [Table 65]

[0358] [Table 66]

[0359] [Table 67]

[0360] [Table 68]

[0361] [Table 69]

[0362] [Table 70]

[0363] [Table 71]

[0364] [Table 72]

[0365] [Table 73]

[0366] [Table 74]

[0367] [Table 75]

[0368] [Table 76]

[0369] In some embodiments of the present invention, the gRNA molecule for the HPFH region is, for example, Example 4 In the assay described, an increase of at least approximately 20% in F cells was observed compared to the control. It is preferable that the gRNA includes a targeting domain that has the ability to cause this, for example, consisting of such a domain. In one embodiment, the gRNA molecule is a label containing, for example, SEQ ID NO: 113. It includes a targeting domain. In one embodiment, the gRNA molecule includes, for example, SEQ ID NO: 99. It includes a targeting domain consisting of the same. In one embodiment, the gRNA molecule is sequence number 11 Includes, for example, a targeting domain comprising 2. In one embodiment, a gRNA molecule This includes, for example, a targeting domain comprising sequence number 98. In one embodiment The gRNA molecule includes, for example, a targeting domain comprising SEQ ID NO: 1580. In one embodiment, the gRNA molecule is a target comprising, for example, SEQ ID NO: 106. It includes a chemical domain. In one embodiment, the gRNA molecule includes SEQ ID NO: 1589, for example. if it includes a targeting domain consisting thereof. In one embodiment, the gRNA molecule is Sequence ID No. 1 Includes, for example, a targeting domain consisting of 503. In one embodiment, gRNA The molecule includes, for example, a targeting domain comprising SEQ ID NO: 160. In one embodiment, In this context, the gRNA molecule contains, for example, a targeting domain comprising SEQ ID NO: 1537. Includes. In one embodiment, the gRNA molecule includes, for example, SEQ ID NO: 159. It includes a targeting domain. In one embodiment, the gRNA molecule includes SEQ ID NO: 101, For example, it includes a targeting domain consisting of the same. In one embodiment, the gRNA molecule has a sequence number Includes, for example, a targeting domain comprising No. 162. In one embodiment, gRN Molecule A includes, for example, a targeting domain comprising SEQ ID NO: 104. In this context, the gRNA molecule includes, for example, a targeting domain comprising SEQ ID NO: 138. It includes. In one embodiment, the gRNA molecule includes, for example, SEQ ID NO: 1536. It includes a targeting domain. In one embodiment, the gRNA molecule includes SEQ ID NO: 1539 For example, it includes a targeting domain consisting of the same. In one embodiment, the gRNA molecule is distributed This includes, for example, a targeting domain consisting of column number 1585.

[0370] In some embodiments of the present invention, for example, as pointed out herein, two or more For example, a gRNA molecule that targets two target sites (e.g., the first gRNA molecule and It may be beneficial to include a second gRNA molecule. In some embodiments, two targets Both target sites are located in the HPFH region. In this embodiment, the targeting listed in Table 6 Two or more gRNA molecules containing a domain, for example, two gRNA molecules (for example, the first gRNA molecule) Any combination of (and a second gRNA molecule) can be used. In one embodiment The first gRNA molecule and the second gRNA molecule are sequence numbers 100 and sequence numbers, respectively. Includes, for example, a targeting domain consisting of the number 165. In one embodiment, the first The first gRNA molecule and the second gRNA molecule are sequence number 100 and sequence number 1, respectively. Includes, for example, a targeting domain comprising 13. In one embodiment, a first gR The NA molecule and the second gRNA molecule contain SEQ ID NO: 100 and SEQ ID NO: 99, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule And the second gRNA molecule includes, for example, SEQ ID NO: 100 and SEQ ID NO: 112. For example, it includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and The second gRNA molecule contains, for example, SEQ ID NO: 100 and SEQ ID NO: 98. It includes a targeting domain consisting of a first gRNA molecule and a second g The RNA molecules include, for example, SEQ ID NOs. 100 and 1580, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRN Molecule A is a molecule containing, for example, SEQ ID NO: 100 and SEQ ID NO: 106. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule This includes, for example, sequence numbers 100 and 1503, respectively, a targeted Includes a domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted dormant molecules, for example, those containing sequence numbers 100 and 1589 respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule are For example, a targeting domain consisting of sequence numbers 100 and 160 respectively. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are each Including, for example, a targeting domain consisting of column number 100 and sequence number 1537. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain consisting of, code 100 and sequence number 159. In this embodiment, the first gRNA molecule and the second gRNA molecule are each sequence number 10. Includes, for example, a targeting domain comprising 0 and sequence number 101. In this case, the first gRNA molecule and the second gRNA molecule each have sequence number 100. Includes, for example, a targeting domain comprising SEQ ID NO: 162. In one embodiment The first gRNA molecule and the second gRNA molecule are sequence numbers 100 and sequence numbers, respectively. Includes, for example, a targeting domain including number 104. In one embodiment, the first The first gRNA molecule and the second gRNA molecule are sequence number 100 and sequence number 1, respectively. Includes, for example, a targeting domain comprising 38. In one embodiment, a first gR The NA molecule and the second gRNA molecule are sequence numbers 100 and 1536, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA The molecule and the second gRNA molecule contain SEQ ID NOs: 100 and 1539, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule And the second gRNA molecule contains SEQ ID NO: 100 and SEQ ID NO: 1585, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule and The second gRNA molecule contains, for example, SEQ ID NO: 165 and SEQ ID NO: 113. It includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and a second The gRNA molecules include, for example, SEQ ID NO: 165 and SEQ ID NO: 99, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRN Molecule A is a molecule containing, for example, SEQ ID NO: 165 and SEQ ID NO: 112, respectively, and is a label consisting of the same. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule This includes, for example, targeted dormant molecules comprising SEQ ID NOs. 165 and 98, respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeting domains comprising, for example, sequence numbers 165 and 1580. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively Includes, for example, a targeting domain comprising SEQ ID NOs. 165 and SEQ ID NOs. 106. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain consisting of, code 165 and sequence number 1503. In this embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1 Includes, for example, a targeting domain consisting of 65 and sequence number 1589. In this example, the first gRNA molecule and the second gRNA molecule are each sequence number 165. and includes, for example, a targeting domain comprising SEQ ID NO: 160. The first gRNA molecule and the second gRNA molecule are, respectively, sequence number 165 and Includes, for example, a targeting domain comprising SEQ ID NO: 1537. In one embodiment The first gRNA molecule and the second gRNA molecule are sequence number 165 and sequence number 165, respectively. Includes, for example, a targeting domain including number 159. In one embodiment, the first The first gRNA molecule and the second gRNA molecule are sequence number 165 and sequence number 1, respectively. Includes, for example, a targeting domain consisting of 01. In one embodiment, a first gR The NA molecule and the second gRNA molecule are sequence numbers 165 and 162, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA component The child and second gRNA molecules contain SEQ ID NOs. 165 and 104, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule and The second gRNA molecule contains, for example, SEQ ID NO: 165 and SEQ ID NO: 138. It includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and a second The gRNA molecules include, for example, SEQ ID NO: 165 and SEQ ID NO: 1536, respectively. It includes a targeting domain consisting of a first gRNA molecule and a second g RNA molecules, for example, include SEQ ID NOs. 165 and 1539, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRN Molecule A includes, for example, SEQ ID NO: 165 and SEQ ID NO: 1585, respectively. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule The children include, for example, the targeted, which include SEQ ID NOs. 113 and 165, respectively. Includes a domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeting domains comprising, for example, sequence numbers 113 and 99, respectively. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively Includes, for example, a targeting domain comprising SEQ ID NOs. 113 and SEQ ID NOs. 112. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain consisting of, code 113 and sequence number 98. In this example, the first gRNA molecule and the second gRNA molecule are each sequence number 113. and includes, for example, a targeting domain comprising sequence number 1580. In this study, the first gRNA molecule and the second gRNA molecule are each sequence number 113. Includes, for example, a targeting domain comprising SEQ ID NO: 106. In one embodiment The first gRNA molecule and the second gRNA molecule are sequence number 113 and sequence number 113, respectively. Includes, for example, a targeting domain consisting of the number 1503. In one embodiment, gRNA molecule 1 and gRNA molecule 2 are sequence numbers 113 and 113, respectively. Includes, for example, a targeting domain consisting of 1589. In one embodiment, the first The gRNA molecule and the second gRNA molecule are sequence numbers 113 and 16, respectively. Includes, for example, a targeting domain consisting of 0. In one embodiment, a first gRN The A molecule and the second gRNA molecule are sequence numbers 113 and 1537, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA component The child and second gRNA molecules contain SEQ ID NOs. 113 and 159, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule and The second gRNA molecule contains, for example, SEQ ID NO: 113 and SEQ ID NO: 101. It includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and a second The gRNA molecules include, for example, SEQ ID NOs. 113 and 162, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gR The NA molecule includes, for example, SEQ ID NOs: 113 and 104, respectively. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule The children include, for example, sequence numbers 113 and 138, and are targeted Includes a domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted dormant molecules, for example, those containing sequence numbers 113 and 1536 respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeting domains comprising, for example, sequence numbers 113 and 1539. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively Includes, for example, a targeting domain comprising sequence numbers 113 and 1585. In one embodiment, the first gRNA molecule and the second gRNA molecule are sequence Includes, for example, a targeting domain consisting of number 99 and sequence number 165. In this embodiment, the first gRNA molecule and the second gRNA molecule are each sequence number 99. and includes, for example, a targeting domain comprising SEQ ID NO: 113. The first gRNA molecule and the second gRNA molecule are, respectively, sequence number 99 and Includes, for example, a targeting domain including, column number 112. In one embodiment, gRNA molecule 1 and gRNA molecule 2 are sequence number 99 and sequence number 9, respectively. Includes, for example, a targeting domain comprising 8. In one embodiment, a first gRN The A molecule and the second gRNA molecule contain SEQ ID NOs. 99 and 1580, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule And the second gRNA molecule includes SEQ ID NO: 99 and SEQ ID NO: 106, for example if it includes a targeting domain consisting thereof. In one embodiment, a first gRNA molecule and The two gRNA molecules include, for example, SEQ ID NO: 99 and SEQ ID NO: 1503. It includes a targeting domain consisting of a first gRNA molecule and a second g RNA molecules containing SEQ ID NOs. 99 and SEQ ID NOs. 1589, for example, then... It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA minutes The children include, for example, targeted drugs consisting of sequence numbers 99 and 160, respectively. Includes the main molecule. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeting domains comprising, for example, SEQ ID NOs: 99 and 1537, respectively. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively Includes, for example, a targeting domain comprising sequence numbers 99 and 159. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers. Includes, for example, a targeting domain comprising 99 and sequence number 101. In this case, the first gRNA molecule and the second gRNA molecule each have sequence number 99. Includes, for example, a targeting domain comprising SEQ ID NO: 162. In one embodiment The first gRNA molecule and the second gRNA molecule are sequence number 99 and sequence number 99, respectively. Includes, for example, a targeting domain comprising No. 104. In one embodiment, the first The gRNA molecule and the second gRNA molecule are sequence numbers 99 and 138, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA The molecule and the second gRNA molecule contain SEQ ID NOs. 99 and 1536, respectively. , for example, including a targeting domain consisting thereof. In one embodiment, the first gRNA molecule The second gRNA molecule includes, for example, SEQ ID NO: 99 and SEQ ID NO: 1539. if it includes a targeting domain consisting thereof. In one embodiment, a first gRNA molecule and The two gRNA molecules include, for example, SEQ ID NO: 99 and SEQ ID NO: 1585. It includes a targeting domain consisting of a first gRNA molecule and a second g RNA molecules containing, for example, SEQ ID NOs. 112 and 165, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA The molecules include, for example, a target comprising SEQ ID NOs: 112 and 113, respectively. It contains a chemical domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are , for example, a targeted domain comprising SEQ ID NOs: 112 and 99, respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule each This includes, for example, a targeting domain comprising SEQ ID NOs. 112 and SEQ ID NOs. 98. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain consisting of, code 112 and sequence number 1580. In this embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1 Includes, for example, a targeting domain comprising 12 and sequence number 106. In this case, the first gRNA molecule and the second gRNA molecule are each sequence number 112. and includes, for example, a targeting domain comprising SEQ ID NO: 1503. The first gRNA molecule and the second gRNA molecule are, respectively, sequence number 112 and Includes, for example, a targeting domain comprising sequence number 1589. In one embodiment The first gRNA molecule and the second gRNA molecule are sequence number 112 and sequence number 112, respectively. Includes, for example, a targeting domain consisting of the number 160. In one embodiment, the first The first gRNA molecule and the second gRNA molecule are sequence number 112 and sequence number 1, respectively. Includes, for example, a targeting domain comprising 537. In one embodiment, the first g The RNA molecule and the second gRNA molecule are sequence numbers 112 and 159, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA The molecule and the second gRNA molecule contain SEQ ID NO: 112 and SEQ ID NO: 101, respectively. , for example, including a targeting domain consisting thereof. In one embodiment, the first gRNA molecule The second gRNA molecule contains, for example, SEQ ID NO: 112 and SEQ ID NO: 162. if it includes a targeting domain consisting thereof. In one embodiment, a first gRNA molecule and The two gRNA molecules include, for example, SEQ ID NO: 112 and SEQ ID NO: 104. It includes a targeting domain consisting of a first gRNA molecule and a second g RNA molecules, for example, include SEQ ID NOs. 112 and 138, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA The molecule is a label containing, for example, SEQ ID NO: 112 and SEQ ID NO: 1536, respectively. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule This includes, for example, sequence numbers 112 and 1539, respectively, and targeting consisting of the same. Includes a domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted dormant molecules, for example, including sequence numbers 112 and 1585 respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule are Each includes, for example, a targeting domain comprising SEQ ID NOs. 98 and 165. In one embodiment, the first gRNA molecule and the second gRNA molecule are sequence Includes, for example, a targeting domain consisting of number 98 and sequence number 113. In this embodiment, the first gRNA molecule and the second gRNA molecule are each sequence number 98. and includes, for example, a targeting domain comprising SEQ ID NO: 99. The first gRNA molecule and the second gRNA molecule are sequence number 98 and sequence number 98, respectively. Includes, for example, a targeting domain including number 112. In one embodiment, the first The first gRNA molecule and the second gRNA molecule are sequence numbers 98 and 15, respectively. Includes, for example, a targeting domain comprising 80. In one embodiment, a first gR The NA molecule and the second gRNA molecule contain SEQ ID NOs. 98 and 106, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule And the second gRNA molecule includes, for example, SEQ ID NO: 98 and SEQ ID NO: 1503. For example, it includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and The second gRNA molecule includes, for example, SEQ ID NO: 98 and SEQ ID NO: 1589. It includes a targeting domain consisting of the following. In one embodiment, a first gRNA molecule and a second The gRNA molecules include, for example, SEQ ID NOs. 98 and SEQ ID NOs. 160, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA The molecules include, for example, a target comprising SEQ ID NOs: 98 and 1537, respectively. It contains a chemical domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are , for example, a targeted domain including SEQ ID NOs. 98 and SEQ ID NOs. 159, respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule each This includes, for example, a targeting domain comprising SEQ ID NOs. 98 and SEQ ID NOs. 101. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain consisting of, code 98 and sequence number 162. In this case, the first gRNA molecule and the second gRNA molecule are each sequence number 98. Includes, for example, a targeting domain comprising sequence number 104. The first gRNA molecule and the second gRNA molecule are sequence number 98 and sequence number 98, respectively. Includes, for example, a targeting domain including number 138. In one embodiment, the first The first gRNA molecule and the second gRNA molecule are sequence numbers 98 and 15, respectively. Includes, for example, a targeting domain comprising 36. In one embodiment, a first gR The NA molecule and the second gRNA molecule are sequence numbers 98 and 1539, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA component The child and second gRNA molecules contain SEQ ID NOs. 98 and 1585, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule and The second gRNA molecule contains, for example, SEQ ID NO: 1580 and SEQ ID NO: 165. if it includes a targeting domain consisting thereof. In one embodiment, a first gRNA molecule and The two gRNA molecules include, for example, SEQ ID NO: 1580 and SEQ ID NO: 113. It includes a targeting domain consisting of the following. In one embodiment, a first gRNA molecule and a second The gRNA molecules include, for example, SEQ ID NO: 1580 and SEQ ID NO: 99. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRN Molecule A includes, for example, sequence numbers 1580 and 112. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule The children include, for example, the targeted, which include sequence numbers 1580 and 98, respectively. Includes a domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted domains, for example, including sequence numbers 1580 and 106 respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted domains comprising, for example, sequence numbers 1580 and 1503. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule each A targeting domain comprising, for example, sequence numbers 1580 and 1589. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively Includes, for example, a targeting domain comprising sequence numbers 1580 and 160. In one embodiment, the first gRNA molecule and the second gRNA molecule are sequence Including, for example, a targeting domain comprising number 1580 and sequence number 1537. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain consisting of, code 1580 and sequence number 159. In this embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1 Includes, for example, a targeting domain consisting of 580 and sequence number 101. In this example, the first gRNA molecule and the second gRNA molecule are each sequence number 158. Includes, for example, a targeting domain comprising 0 and sequence number 162. In this study, the first gRNA molecule and the second gRNA molecule are each sequence number 1580. Includes, for example, a targeting domain comprising sequence number 104. The first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1580 and Includes, for example, a targeting domain comprising SEQ ID NO: 138. In one embodiment, The first gRNA molecule and the second gRNA molecule are sequence number 1580 and sequence number 1580, respectively. Includes, for example, a targeting domain consisting of the number 1536. In one embodiment, gRNA molecule 1 and gRNA molecule 2 are sequence number 1580 and sequence number 1580, respectively. Includes, for example, a targeting domain comprising No. 1539. In one embodiment, the first The first gRNA molecule and the second gRNA molecule are sequence numbers 1580 and 1580, respectively. Includes, for example, a targeting domain consisting of 1585. In one embodiment, the first The gRNA molecule and the second gRNA molecule are sequence numbers 106 and 16, respectively. Includes, for example, a targeting domain comprising 5. In one embodiment, a first gRN The A molecule and the second gRNA molecule contain SEQ ID NOs: 106 and 113, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule And the second gRNA molecule includes SEQ ID NO: 106 and SEQ ID NO: 99, for example Ba It includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and a second The gRNA molecules include, for example, SEQ ID NOs: 106 and 112, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gR The NA molecule includes, for example, a label consisting of the same molecule, containing SEQ ID NO: 106 and SEQ ID NO: 98, respectively. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule This includes, for example, the targeted sequences containing SEQ ID NOs. 106 and 1580, respectively. Includes a domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted dormant molecules, for example, including sequence numbers 106 and 1503 respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeting domains comprising, for example, SEQ ID NOs. 106 and 1589. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively Includes, for example, a targeting domain comprising SEQ ID NOs: 106 and 160. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain consisting of, code 106 and sequence number 1537. In this embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1 Includes, for example, a targeting domain comprising 06 and sequence number 159. In this case, the first gRNA molecule and the second gRNA molecule are each sequence number 106. and includes, for example, a targeting domain comprising SEQ ID NO: 101. The first gRNA molecule and the second gRNA molecule are, respectively, sequence number 106 and Includes, for example, a targeting domain consisting of column number 162. In one embodiment, gRNA molecule 1 and gRNA molecule 2 are sequence numbers 106 and 106, respectively. Includes, for example, a targeting domain comprising 104. In one embodiment, the first g The RNA molecule and the second gRNA molecule are sequence numbers 106 and 138, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA The molecule and the second gRNA molecule contain SEQ ID NOs: 106 and 1536, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule And the second gRNA molecule contains SEQ ID NO: 106 and SEQ ID NO: 1539, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule and The second gRNA molecule contains, for example, SEQ ID NO: 106 and SEQ ID NO: 1585. if it includes a targeting domain consisting thereof. In one embodiment, a first gRNA molecule and The two gRNA molecules include, for example, SEQ ID NO: 1503 and SEQ ID NO: 165. It includes a targeting domain consisting of the following. In one embodiment, a first gRNA molecule and a second gRNA molecules include, for example, SEQ ID NO: 1503 and SEQ ID NO: 113. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gR The NA molecule includes, for example, SEQ ID NO: 1503 and SEQ ID NO: 99. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule The children include, for example, a target consisting of sequence numbers 1503 and 112, respectively. It contains a chemical domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are For example, targeted doping including sequence numbers 1503 and 98, respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted domains comprising, for example, sequence numbers 1503 and 1580. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule each For example, a targeting domain comprising sequence numbers 1503 and 106. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are each Includes, for example, a targeting domain consisting of column number 1503 and sequence number 1589. In one embodiment, the first gRNA molecule and the second gRNA molecule are sequence This includes, for example, a targeting domain comprising number 1503 and sequence number 160. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers. Includes, for example, a targeting domain consisting of 1503 and sequence number 1537. In this embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1 Includes, for example, a targeting domain consisting of 503 and sequence number 159. In this example, the first gRNA molecule and the second gRNA molecule are each sequence number 150. Includes, for example, a targeting domain comprising 3 and Sequence ID No. 101. In one embodiment, In this study, the first gRNA molecule and the second gRNA molecule are each sequence number 1503. Includes, for example, a targeting domain comprising sequence number 162. The first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1503 and Includes, for example, a targeting domain comprising SEQ ID NO: 104. In one embodiment, The first gRNA molecule and the second gRNA molecule are sequence number 1503 and sequence number 1503, respectively. Includes, for example, a targeting domain including number 138. In one embodiment, the first The first gRNA molecule and the second gRNA molecule are sequence numbers 1503 and 1503, respectively. Includes, for example, a targeting domain comprising 1536. In one embodiment, the first The gRNA molecule and the second gRNA molecule are sequence number 1503 and sequence number 1, respectively. Includes, for example, a targeting domain comprising 539. In one embodiment, the first g The RNA molecule and the second gRNA molecule are sequence numbers 1503 and 1503, respectively. Includes, for example, a targeting domain comprising 85. In one embodiment, a first gR The NA molecule and the second gRNA molecule are sequence numbers 1589 and 165, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA The molecule and the second gRNA molecule contain SEQ ID NOs: 1589 and 113, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule And the second gRNA molecule includes, for example, SEQ ID NO: 1589 and SEQ ID NO: 99. For example, it includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and The second gRNA molecule includes, for example, SEQ ID NO: 1589 and SEQ ID NO: 112. It includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and a second The gRNA molecules include, for example, SEQ ID NO: 1589 and SEQ ID NO: 98. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gR The NA molecules include, for example, SEQ ID NOs. 1589 and 1580, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRN Molecule A includes, for example, SEQ ID NO: 1589 and SEQ ID NO: 106. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule The children include, for example, labels containing sequence numbers 1589 and 1503, respectively. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule This includes, for example, the targeted sequences containing SEQ ID NOs. 1589 and 160, respectively. Includes a domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted drugs including, for example, sequence numbers 1589 and 1537 respectively. Includes the main molecule. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted domains comprising, for example, sequence numbers 1589 and 159, respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule each A targeting domain including, for example, sequence numbers 1589 and 101. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are each Including, for example, a targeting domain consisting of column number 1589 and sequence number 162. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain consisting of, code 1589 and sequence number 104. In this embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1 Includes, for example, a targeting domain consisting of 589 and sequence number 138. In this example, the first gRNA molecule and the second gRNA molecule are each sequence number 158. Includes, for example, a targeting domain comprising 9 and sequence number 1536. In this case, the first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1589. and includes, for example, a targeting domain comprising SEQ ID NO: 1539. In this study, the first gRNA molecule and the second gRNA molecule are each sequence number 1589. and includes, for example, a targeting domain comprising sequence number 1585. The first gRNA molecule and the second gRNA molecule are, respectively, sequence number 160 and Includes, for example, a targeting domain comprising SEQ ID NO: 165. In one embodiment, The first gRNA molecule and the second gRNA molecule are sequence number 160 and sequence number 160, respectively. Includes, for example, a targeting domain comprising No. 113. In one embodiment, the first The gRNA molecule and the second gRNA molecule are sequence numbers 160 and 99, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA The molecule and the second gRNA molecule contain SEQ ID NO: 160 and SEQ ID NO: 112, respectively. , for example, including a targeting domain consisting thereof. In one embodiment, the first gRNA molecule The second gRNA molecule includes, for example, SEQ ID NO: 160 and SEQ ID NO: 98. It includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and a second The gRNA molecules include, for example, SEQ ID NOs: 160 and 1580, respectively. It includes a targeting domain consisting of a first gRNA molecule and a second g The RNA molecules include, for example, SEQ ID NOs: 160 and 106, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA The molecule is a label containing, for example, SEQ ID NO: 160 and SEQ ID NO: 1503, respectively. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule This includes, for example, the targeted sequences comprising SEQ ID NOs. 160 and 1589, respectively. Includes a domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are For example, targeted dormant molecules comprising sequence numbers 160 and 1537, respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule are For example, a targeting domain consisting of sequence numbers 160 and 159 respectively. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are each This includes, for example, a targeting domain consisting of, column number 160 and sequence number 101. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers. Includes, for example, a targeting domain consisting of 160 and sequence number 162. In this example, the first gRNA molecule and the second gRNA molecule are each sequence number 160. and includes, for example, a targeting domain comprising SEQ ID NO: 104. The first gRNA molecule and the second gRNA molecule are, respectively, sequence number 160 and Distribution Includes, for example, a targeting domain consisting of column number 138. In one embodiment, gRNA molecule 1 and gRNA molecule 2 are sequence numbers 160 and 160, respectively. Includes, for example, a targeting domain comprising 1536. In one embodiment, the first The gRNA molecule and the second gRNA molecule are sequence numbers 160 and 15, respectively. Includes, for example, a targeting domain comprising 39. In one embodiment, a first gR The NA molecule and the second gRNA molecule are sequence numbers 160 and 1585, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA The molecule and the second gRNA molecule contain SEQ ID NOs. 1537 and 165, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule And the second gRNA molecule contains SEQ ID NO: 1537 and SEQ ID NO: 113, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule and The second gRNA molecule includes, for example, SEQ ID NO: 1537 and SEQ ID NO: 99. It includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and a second The gRNA molecules include, for example, SEQ ID NO: 1537 and SEQ ID NO: 112. It includes a targeting domain consisting of a first gRNA molecule and a second g RNA molecules, for example, include SEQ ID NOs. 1537 and SEQ ID NOs. 98, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA The molecule consists of, for example, the sequence numbers 1537 and 1580, respectively. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule The children include, for example, a target consisting of sequence numbers 1537 and 106, respectively. It contains a chemical domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are , for example, a targeting comprising SEQ ID NO: 1537 and SEQ ID NO: 1503, respectively. Includes a domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted drugs including, for example, sequence numbers 1537 and 1589 respectively. Includes the main molecule. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted domains comprising, for example, sequence numbers 1537 and 160, respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule each For example, a targeting domain comprising sequence numbers 1537 and 159. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are each Including, for example, a targeting domain consisting of column number 1537 and sequence number 101. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain consisting of, code 1537 and sequence number 162. In this embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1 Includes, for example, a targeting domain consisting of 537 and sequence number 104. In this example, the first gRNA molecule and the second gRNA molecule are each sequence number 153. Includes, for example, a targeting domain comprising 7 and sequence number 138. In this study, the first gRNA molecule and the second gRNA molecule are each sequence number 1537. and includes, for example, a targeting domain comprising sequence number 1536. And the first gRNA molecule and the second gRNA molecule each have sequence number 1537. and includes, for example, a targeting domain comprising SEQ ID NO: 1539. The first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1537 and Includes, for example, a targeting domain comprising sequence number 1585. In one embodiment The first gRNA molecule and the second gRNA molecule are sequence number 159 and sequence number 159, respectively. Includes, for example, a targeting domain consisting of the number 165. In one embodiment, the first The first gRNA molecule and the second gRNA molecule are sequence number 159 and sequence number 159, respectively. Includes, for example, a targeting domain comprising 13. In one embodiment, a first gR The NA molecule and the second gRNA molecule contain SEQ ID NO: 159 and SEQ ID NO: 99, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule And the second gRNA molecule includes, for example, SEQ ID NO: 159 and SEQ ID NO: 112. For example, it includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and The second gRNA molecule includes, for example, SEQ ID NO: 159 and SEQ ID NO: 98. It includes a targeting domain consisting of a first gRNA molecule and a second g The RNA molecules include, for example, SEQ ID NOs. 159 and 1580, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRN Molecule A is a molecule containing, for example, SEQ ID NO: 159 and SEQ ID NO: 106, respectively, and is a label consisting of the same. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule This includes, for example, the targeted sequence containing SEQ ID NOs. 159 and SEQ ID NOs. 1503, respectively. Includes a domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted dormant drugs, for example, that include sequence numbers 159 and 1589 respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule are For example, a targeting domain consisting of sequence numbers 159 and 160 respectively. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are each Including, for example, a targeting domain consisting of column number 159 and sequence number 1537. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain comprising code 159 and sequence number 101. In this embodiment, the first gRNA molecule and the second gRNA molecule are each sequence number 15. Includes, for example, a targeting domain comprising 9 and sequence number 162. In this study, the first gRNA molecule and the second gRNA molecule are each sequence number 159. Includes, for example, a targeting domain comprising SEQ ID NO: 104. In one embodiment The first gRNA molecule and the second gRNA molecule are sequence number 159 and sequence number 159, respectively. Includes, for example, a targeting domain including number 138. In one embodiment, the first The first gRNA molecule and the second gRNA molecule are sequence number 159 and sequence number 159, respectively. Includes, for example, a targeting domain comprising 536. In one embodiment, the first g The RNA molecule and the second gRNA molecule are sequence numbers 159 and 153, respectively. Includes, for example, a targeting domain comprising 9. In one embodiment, a first gRN The A molecule and the second gRNA molecule are sequence numbers 159 and 1585, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA component The child and second gRNA molecules contain SEQ ID NOs. 101 and 165, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule and The second gRNA molecule contains, for example, SEQ ID NO: 101 and SEQ ID NO: 113. It includes a targeting domain consisting of the same. In one embodiment, a first gRNA molecule and a second The gRNA molecules include, for example, SEQ ID NO: 101 and SEQ ID NO: 99, respectively. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRN Molecule A is a molecule containing, for example, SEQ ID NO: 101 and SEQ ID NO: 112. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule This includes, for example, targeted dormant molecules comprising SEQ ID NOs. 101 and SEQ ID NOs. 98, respectively. It contains. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeted domains comprising, for example, sequence numbers 101 and 1580. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively Includes, for example, a targeting domain comprising SEQ ID NOs: 101 and 106. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain consisting of, code 101 and sequence number 1503. In this embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence number 1 Includes, for example, a targeting domain consisting of 01 and sequence number 1589. In this example, the first gRNA molecule and the second gRNA molecule are each sequence number 101. and includes, for example, a targeting domain comprising SEQ ID NO: 160. The first gRNA molecule and the second gRNA molecule are, respectively, sequence number 101 and Includes, for example, a targeting domain comprising SEQ ID NO: 1537. In one embodiment The first gRNA molecule and the second gRNA molecule are sequence number 101 and sequence number 101, respectively. Includes, for example, a targeting domain including number 159. In one embodiment, the first The first gRNA molecule and the second gRNA molecule are sequence number 101 and sequence number 1, respectively. Includes, for example, a targeting domain comprising 62. In one embodiment, a first gR The NA molecule and the second gRNA molecule are sequence numbers 101 and 104, respectively. Includes, for example, a targeting domain consisting thereof. In one embodiment, the first gRNA component The child and second gRNA molecules contain SEQ ID NOs: 101 and 138, respectively. For example, it includes a targeting domain consisting of the same. In one embodiment, the first gRNA molecule and The second gRNA molecule contains, for example, SEQ ID NO: 101 and SEQ ID NO: 1536. if it includes a targeting domain consisting thereof. In one embodiment, a first gRNA molecule and The two gRNA molecules each contain, for example, SEQ ID NO: 101 and SEQ ID NO: 1539. It includes a targeting domain consisting of the following. In one embodiment, a first gRNA molecule and a second gRNA molecules include, for example, SEQ ID NO: 101 and SEQ ID NO: 1585. It includes a targeting domain. In one embodiment, a first gRNA molecule and a second gR The NA molecule includes, for example, SEQ ID NOs. 162 and 165, respectively. Includes a targeting domain. In one embodiment, a first gRNA molecule and a second gRNA molecule The children include, for example, the targeted, which include SEQ ID NOs. 162 and SEQ ID NOs. 113, respectively. Includes a domain. In one embodiment, the first gRNA molecule and the second gRNA molecule are Targeting domains comprising, for example, sequence numbers 162 and 99, respectively. Includes. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively Includes, for example, a targeting domain comprising SEQ ID NOs. 162 and SEQ ID NOs. 112. In one embodiment, the first gRNA molecule and the second gRNA molecule are, respectively, sequence numbers Includes, for example, a targeting domain consisting of, code 162 and sequence number 98. In this example, the first gRNA molecule and the second gRNA molecule are each sequence number 162. and includes, for example, a targeting domain comprising sequence number 1580. In this case, the first gRNA molecule and the second gRNA molecule are each sequence number 162. Includes, for example, a targeting domain comprising SEQ ID NO: 106. In one embodiment The first gRNA molecule and t...

Claims

1. From 5' to 3', a) A targeting domain comprising 17, 18, 19, or 20 consecutive nucleic acids of the sequence described in Sequence ID No. 253, and b) Sequence described in Sequence ID No. 7811 gRNA molecules containing this molecule.

2. The gRNA molecule according to claim 1, further comprising 1, 2, 3, 4, 5, 6, or 7 uracil (U) nucleotides at its 3' end.

3. The gRNA molecule according to claim 1 or 2, wherein the targeting domain and the sequence described in Sequence ID No. 7811 are arranged in a single nucleic acid molecule, and the nucleic acid molecule includes or consists of the targeting domain and the sequence described in Sequence ID No. 7811, and the sequence described in Sequence ID No. 7811 is located immediately 3' to the targeting domain.

4. (a) One or more phosphorothioate modifications at the 3' end of the gRNA molecule, (b) One or more phosphorothioate modifications at the 5' end of the gRNA molecule, (c) One or more 2'-O-methyl modifications at the 3' end of the gRNA molecule, (d) One or more 2'-O-methyl modifications at the 5' end of the gRNA molecule, (e) 2'O-methyl modification at the fourth, third, and second 3' residues from the terminal of the gRNA molecule, (f) 2'O-methyl modification at the fourth, third, and second 5' residues from the end of the gRNA molecule, or (f) Any combination of these A gRNA molecule according to any one of claims 1 to 3, comprising:

5. (a) A gRNA molecule and a Cas9 molecule according to any one of claims 1 to 4, (b) A nucleic acid encoding a gRNA molecule and a Cas9 molecule according to any one of claims 1 to 4, (c) A nucleic acid encoding a gRNA molecule according to any one of claims 1 to 4, and a Cas9 molecule, or (d) A nucleic acid encoding a gRNA molecule according to any one of claims 1 to 4, and a nucleic acid encoding a Cas9 molecule A composition containing the following:

6. A composition comprising a gRNA molecule according to any one of claims 1 to 4, further comprising a Cas9 molecule, wherein the Cas9 molecule is active or inactivated Streptococcus pyogenes Cas9.

7. The composition according to claim 6, wherein the Cas9 molecule comprises one of the sequences described in SEQ ID NO: 6611, SEQ ID NO: 7821, SEQ ID NO: 7822, SEQ ID NO: 7823, SEQ ID NO: 7824, SEQ ID NO: 7825, SEQ ID NO: 7826, SEQ ID NO: 7827, SEQ ID NO: 7828, SEQ ID NO: 7829, SEQ ID NO: 7830, or SEQ ID NO: 7831.

8. The composition according to claim 6 or 7, wherein the gRNA molecule and the Cas9 molecule are present in the ribonucleoprotein complex (RNP).

9. The composition according to any one of claims 5 to 8, which is formulated in a medium suitable for electroporation.

10. A nucleic acid encoding a gRNA molecule according to any one of claims 1 to 4.

11. A vector comprising the nucleic acid described in claim 10.

12. The vector according to claim 11, selected from the group consisting of lentiviral vectors, adenovirus vectors, adeno-associated virus (AAV) vectors, herpes simplex virus (HSV) vectors, plasmids, minicircles, nanoplasmides, and RNA vectors.

13. An exovivo method for modifying a cell in or near a target sequence within the cell, wherein the cell (a) A gRNA molecule and a Cas9 molecule according to any one of claims 1 to 4, (b) A nucleic acid encoding a gRNA molecule and a Cas9 molecule according to any one of claims 1 to 4, (c) A nucleic acid encoding a gRNA molecule according to any one of claims 1 to 4, and a Cas9 molecule (d) A nucleic acid encoding a gRNA molecule according to any one of claims 1 to 4, and a nucleic acid encoding a Cas9 molecule, (e) any one of (a) to (d) above, and template nucleic acid, (f) Any one of (a) to (d) above, and a nucleic acid that codes for a template nucleic acid, (g) The composition according to any one of claims 5 to 9, or (h) The vector according to claim 11 or 12 A method that includes the step of bringing into contact with.

14. The method according to claim 13, wherein the cells are CD34+ cells.

15. (a) The modification brings an indel in or near a genomic DNA sequence complementary to the targeting domain of the gRNA molecule. (c) A population of cells, wherein at least 50% of the cells in the population are modified, (d) The modification results in cells having the ability to differentiate into differentiated cells of the erythrocyte lineage, and these differentiated cells exhibit increased levels of fetal hemoglobin compared to unmodified cells. (e) The modification results in a population of cells having the ability to differentiate into a population of differentiated cells, the population of differentiated cells having an increased proportion of F cells compared to the population of unmodified cells, or (f) The modification results in cells having the ability to differentiate into differentiated cells, and these differentiated cells produce at least 6 picograms of fetal hemoglobin per cell. The method according to claim 13 or 14.

16. A cell comprising a gRNA molecule according to any one of claims 1 to 4, a composition according to any one of claims 5 to 9, a nucleic acid according to claim 10, or a vector according to claim 11 or 12, wherein the cell is a hematopoietic stem cell or progenitor cell (HSPC), a CD34+ cell, or a CD34+CD90+ cell.

17. The cell according to claim 16, further comprising a Cas9 molecule.

18. (a) The expression of fetal hemoglobin is increased in the cells or their offspring compared to cells of the same cell type that are not modified to contain the gRNA molecule or their offspring, or (b) Having the ability to differentiate into differentiated cells, the differentiated cells exhibiting increased levels of fetal hemoglobin compared to cells of the same type that are not modified to contain the gRNA molecule, The cell according to claim 16 or 17.

19. The cells according to any one of claims 16 to 18, wherein the cells are arranged in a composition comprising a population of cells enriched with respect to CD34+ cells, and / or the cells are derived from cells isolated from bone marrow, mobilized peripheral blood, or umbilical cord blood.

20. A population of cells comprising the cells described in any one of claims 16 to 19, wherein at least 50% of the cells in the population are the cells described in any one of claims 16 to 19.

21. A composition comprising cells according to any one of claims 16 to 19 or a population of cells according to claim 20, and a pharmaceutically acceptable medium.

22. A method for preparing cells, (a) step of providing cells, (b) The step of culturing the cells ex vivo in a cell culture medium containing a stem cell proliferation agent, (c) Step of introducing the gRNA molecule according to any one of claims 1 to 4, the nucleic acid molecule encoding the gRNA molecule according to any one of claims 1 to 4, the composition according to any one of claims 5 to 9, the nucleic acid according to claim 10, or the vector according to claim 11 or 12 into the cells. A method that includes this.

23. The method according to claim 22, wherein the stem cell proliferation agent is (1r,4r)-N1-(2-benzyl-7-(2-methyl-2H-tetrazole-5-yl)-9H-pyrimido[4,5-b]indole-4-yl)cyclohexane-1,4-diamine, methyl4-(3-piperidine-1-ylpropylamino)-9H-pyrimido[4,5-b]indole-7-carboxylate, 4-(2-(2-(benzo[b]thiophen-3-yl)-9-isopropyl-9H-purine-6-ylamino)ethyl)phenol, (S)-2-(6-(2-(1H-indole-3-yl)ethylamino)-2-(5-fluoropyridine-3-yl)-9H-purine-9-yl)propan-1-ol or a combination thereof.

24. The method according to claim 22 or 23, wherein the cell culture medium contains a stem cell proliferation agent at a concentration in the range of 1 nM to 1 mM.

25. The method according to any one of claims 22 to 24, wherein the introduction of step (c) includes electroporation.

26. The method according to any one of claims 22 to 25, wherein the cells are hematopoietic stem cells or progenitor cells (HSPCs), CD34+ cells, or CD34+CD90+ cells.

27. The method according to claim 26, wherein the cells are arranged in a composition comprising a population of cells enriched with respect to CD34+ cells, and / or the cells are isolated from bone marrow, mobilized peripheral blood, or umbilical cord blood.

28. A gRNA molecule according to any one of claims 1 to 4, a composition according to any one of claims 5 to 9 and 21, a nucleic acid according to claim 10, a vector according to claim 11 or 12, a cell according to any one of claims 16 to 19, or a population of cells according to claim 20, for use as a pharmaceutical agent.

29. A gRNA molecule, composition, nucleic acid, vector, cell, or population of cells according to claim 28 for the treatment of sickle cell disease or β-thalassemia.

30. A pharmaceutical composition for treating an abnormal hemoglobin disorder in a subject, comprising a gRNA molecule according to any one of claims 1 to 4, a composition according to any one of claims 5 to 9 and 21, a nucleic acid according to claim 10, a vector according to claim 11 or 12, a cell according to any one of claims 16 to 19, or a population of cells according to claim 20.

31. The pharmaceutical composition according to claim 30, wherein the abnormal hemoglobin disorder is β-thalassemia or sickle cell disease.

32. A pharmaceutical composition for increasing fetal hemoglobin expression in a subject, comprising a gRNA molecule according to any one of claims 1 to 4, a composition according to any one of claims 5 to 9 and 21, a nucleic acid according to claim 10, a vector according to claim 11 or 12, a cell according to any one of claims 16 to 19, or a population of cells according to claim 20.

Citation Information

Patent Citations

  • CRISPR / Cas9 recombinant lentiviral vector for human immunodeficiency virus gene therapy and lentivirus of CRISPR / Cas9 recombinant lentiviral vector

    CN104480144A

  • Compositions and methods for the treatment of abnormal hemoglobin disorders

    JP2015516146A

  • Nuclease-mediated regulation of gene expression

    US20150132269A1

  • Crispr-CAS systems and methods for altering expression of gene products

    US20150203872A1

  • Optimized crispr-CAS double nickase systems, methods and compositions for sequence manipulation

    WO2014204725A1