Antisense oligonucleotides targeting SCN2A for the treatment of SCN1A encephalopathy

SCN2A antisense oligonucleotides are used to treat SCN1A-related disorders by reducing SCN2A expression, effectively addressing the lack of effective treatments for SCN1A encephalopathies such as Dravet syndrome.

JP7851349B2Active Publication Date: 2026-04-24LOGICON INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2024066672
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-08-20
Filing Date
2024-04-17
Publication Date
2026-04-24
Estimated Expiration
2039-08-20

AI Technical Summary

Technical Problem

Current methods are inadequate for treating SCN1A-related encephalopathies such as Dravet syndrome, as the mechanism of SCN1A mutations causing these disorders is not well understood, and there is a lack of effective treatments.

Method used

The use of SCN2A antisense oligonucleotides (ASOs) to regulate the expression of sodium voltage-gated channel alpha subunit 2 (SCN2A) to treat SCN1A-related disorders, including Dravet syndrome, by administering single-stranded oligonucleotides with specific nucleobase sequences complementary to SCN2A pre-mRNA or mRNA transcripts.

Benefits of technology

Reduces SCN2A expression, thereby alleviating symptoms of SCN1A encephalopathies like Dravet syndrome, including prolonged seizures and developmental delays, with selective targeting and minimal impact on SCN1A expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007851349000007
    Figure 0007851349000007
  • Figure 0007851349000008
    Figure 0007851349000008
  • Figure 0007851349000009
    Figure 0007851349000009
Patent Text Reader

Abstract

To provide methods, compounds and compositions for reducing the expression of SCN2A in subjects.SOLUTION: Such methods, compounds and compositions are useful for treating, preventing, delaying or ameliorating a SCN1A associated disease or disorder (e.g., Dravet syndrome) in a subject in need thereof. The disclosure provides compositions, compounds and methods for modulating expression of sodium voltage-gated channel alpha subunit 2 (SCN2A) in order to treat sodium voltage-gated channel alpha subunit 1 (SCN1A)-associated diseases such as SCN1A encephalopathies, including Dravet syndrome (severe myoclonic epilepsy of infancy (SMEI)), epilepsy, generalized epilepsy with febrile seizures, familial febrile seizures, migraines, and early infantile epileptic encephalopathy 6.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-reference with related applications This application claims the benefits of U.S. Provisional Patent Application No. 62 / 765,344, filed on 2 August 2018. The contents of the application referenced above are incorporated herein by reference in their entirety.

[0002] Sequence List This application includes an electronically submitted sequence listing in ASCII format, which is incorporated herein by reference in its entirety. The above ASCII copy, created on September 23, 2019, is named PRX-057 WO_SL.txt and is 2,235 bytes in size.

[0003] Provided herein are methods, compounds, and compositions useful for reducing the expression of sodium voltage-gated channel alpha subunit 2 (SCN2A) in subjects (e.g., humans). Also provided herein are methods, compounds, and compositions comprising SCN2A antisense oligonucleotides (ASOs) that may be useful for treating diseases or conditions associated with sodium voltage-gated channel alpha subunit 1 (SCN1A) in subjects. Such methods, compounds, and compositions may be useful for treating, preventing, delaying, or improving SCN1A-related encephalopathy, such as Dravet syndrome. [Background technology]

[0004] The voltage-gated sodium channel alpha subunit 1 (SCN1A) gene is located at position 24.3 on the long (q) arm of human chromosome 2, is expressed in the brain, and encodes NaV1.1, an alpha subunit of the voltage-gated sodium channel involved in nerve signal transmission. Mutations in SCN1A may be associated with epilepsy, generalized epilepsy with febrile seizures, familial febrile seizures, migraine, early infantile epileptic encephalopathy 6, Doose syndrome (severe myoclonic epilepsy in infancy), and other SCN1A-related encephalopathies. However, the mechanism by which SCN1A mutations cause harmful effects is not well understood in the art, and satisfactory methods for treating SCN1A encephalopathies are not available. Thus, new methods useful for treating these SCN1A-related disorders are still needed.

Summary of the Invention

Means for Solving the Problems

[0005] Provided herein are compositions, compounds, and methods for regulating the expression of voltage-gated sodium channel alpha subunit 2 (SCN2A) for treating voltage-gated sodium channel alpha subunit 1 (SCN1A)-related disorders such as Doose syndrome (severe myoclonic epilepsy in infancy (SMEI)), epilepsy, generalized epilepsy with febrile seizures, familial febrile seizures, migraine, and early infantile epileptic encephalopathy 6.

[0006] In one aspect, the invention is a method of treating SCN1A encephalopathy in a subject that requires treatment of SCN1A encephalopathy, the method comprising administering to the subject a compound comprising a single-stranded oligonucleotide 10 to 80 nucleosides in length having a nucleobase sequence comprising a 10-consecutive nucleobase portion having at least 80% complementarity to a target region of a pre-mRNA transcript or mRNA transcript of the human SCN2A gene, in an amount and for a period sufficient to treat the SCN1A encephalopathy.

[0007] In some embodiments, the method reduces the expression of the human SCN2A gene.

[0008] In some embodiments, the oligonucleotide comprises, consists essentially of, or consists of a nucleobase sequence complementary to a portion of the SCN2A mRNA encoding the amino acid sequence of GenBank accession number NP_066287.2, or comprises the nucleobase sequence of GenBank accession number NM_021007.2.

[0009] In some embodiments, the oligonucleotide comprises one or more modified sugars, one or more modified internucleoside linkages, and / or one or more modified nucleobases.

[0010] In some embodiments, the oligonucleotide comprises one or more modified sugars.

[0011] In some embodiments, each of the one or more modified sugars is independently selected from the group consisting of bicyclic sugars, 2'-O-methoxyethyl (2MOE) modified sugars, 2'-O-methoxy (2-OMe) modified sugars, 2'-methoxy modified sugars, 2'-O-alkyl modified sugars, constrained ethyl (cEt) modified sugars, locked sugars, and unlocked sugars.

[0012] In some embodiments, the oligonucleotide has 2MOE modified sugars over the entire length of the oligonucleotide.

[0013] In some embodiments, the oligonucleotide comprises one or more modified internucleoside linkages.

[0014] In some embodiments, one or more of the modified internucleoside linkages comprise modified phosphates.

[0015] In some embodiments, each of the modified phosphates is independently selected from the group consisting of phosphorothioates, phosphorodithioates, phosphoramidates, phosphorodiamidates, thiophosphoroamidates, thiophosphorodiamidates, methylphosphonates, phosphoromolholides, and phosphoropiperadates.

[0016] In some embodiments, the oligonucleotide has phosphorothioate nucleoside bonds along its entire length.

[0017] In some embodiments, the oligonucleotide has phosphorodiamidate morpholino nucleoside bonds along its entire length.

[0018] In some embodiments, the oligonucleotide comprises one or more modified nucleic acid bases.

[0019] In some embodiments, the modified nucleic acid bases are 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propyladenine, 2-propylguanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azocymine, 5-uracil (pseudracil), 4-thiouracil, 8-halouradenine, 8-aminoadenine The following are selected from the group consisting of 8-thiol adenine, 8-thioalkyl adenine, 8-hydroxyl adenine, 8-haloguanine, 8-aminoguanine, 8-thiol guanine, 8-thioalkyl guanine, 8-hydroxyl guanine, 5-bromouracil, 5-trifluoromethyluracil, 5-bromocytosine, 5-trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 2-fluoroadenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0020] In some embodiments, the modified nucleic acid base is 5-methylcytosine.

[0021] In some embodiments, each cytosine is 5-methylcytosine.

[0022] In some embodiments, the modified oligonucleotide is A gap segment consisting of a bound deoxynucleoside; A 5' wing segment consisting of a bound nucleoside; and A 3' wing segment consisting of a bound nucleoside; The gap segment is located directly adjacent to the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment contains a modified sugar.

[0023] In some embodiments, the oligonucleotide consists of 12 to 40 (e.g., 16 to 30) nucleic acid bases.

[0024] In some embodiments, the method includes inhibiting the expression of SCN2A in the target nerve cells.

[0025] In some embodiments, SCN1A encephalopathy is selected from the group consisting of epilepsy, generalized epilepsy with febrile seizures, familial febrile seizures, migraine, early infantile epileptic encephalopathy6, and Dravet syndrome.

[0026] In some embodiments, SCN1A encephalopathy is Dravet syndrome.

[0027] In some embodiments, the compound is administered intrathecally, intramedullarily, or intraventricularly.

[0028] In some embodiments, a reduction in SCN2A expression leads to a therapeutic effect.

[0029] In some embodiments, the method reduces one or more symptoms of SCN1A encephalopathy.

[0030] In some embodiments, one or more symptoms of SCN1A encephalopathy are selected from the group consisting of prolonged seizures, frequent seizures, behavioral and developmental delays, motor and balance problems, orthopedic conditions, speech delays and phonation problems, growth and nutrition problems, sleep difficulties, chronic infections, sensory integration disorders, autonomic nervous system disturbances, and sweating.

[0031] In some embodiments, oligonucleotides are more selective to SCN2A pre-mRNA or mRNA than to SCN1A pre-mRNA or mRNA.

[0032] In some embodiments, the method does not substantially reduce SCN1A expression.

[0033] In some embodiments, the subject has a gain-of-function mutation in SCN1A.

[0034] In some embodiments, the subject has a loss-of-function mutation in SCN1A.

[0035] definition Unless otherwise specified, the following terms have the following meanings:

[0036] "2'-deoxynucleoside" refers to a nucleoside containing a 2'-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxynucleoside may contain a modified nucleic acid base or an RNA nucleic acid base (uracil).

[0037] "2'-O-methoxyethyl" (also known as 2'-MOE or 2'-O(CH2)2-OCH3) refers to the O-methoxyethyl modification at the 2' position of the furanosyl ring. 2'-O-methoxyethyl modified sugars are modified sugars.

[0038] "2'-MOE nucleoside" (also called 2'-O-methoxyethyl nucleoside) refers to a nucleoside that contains a 2'-MOE modified sugar moiety.

[0039] "2'-substituted nucleoside" or "2-modified nucleoside" means a nucleoside containing a 2'-substituted or 2'-modified sugar moiety. As used herein, "2'-substituted" or "2-modified" with respect to a sugar moiety means a sugar moiety containing at least one 2'-substituent instead of H or OH.

[0040] The "3' target site" refers to the nucleotide of the target nucleic acid that is complementary to the 3' end nucleotide of a particular compound.

[0041] The "5' target site" refers to the nucleotide of the target nucleic acid that is complementary to the 5' end nucleotide of a particular compound.

[0042] "5-methylcytosine" refers to cytosine that has a methyl group attached at the 5th position. "Approximately" means within ±10% of the value. For example, if it is stated that "the compound affected approximately 70% of SCN2A inhibition," it implies that the SCN2A level was inhibited within the range of 60% to 80%.

[0043] "Administration" or "administration" refers to a route through which a compound or composition provided herein is introduced to perform its intended function. Examples of usable routes of administration include, but are not limited to, intrathecal, intramedullary, intraventricular, and parenteral administration such as subcutaneous, intravenous, or intramuscular injection or infusion.

[0044] "Simultaneous administration" or "co-administration" means that two or more compounds are administered in any manner that produces both pharmacological effects in the patient. Simultaneous administration does not require that both compounds be in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or administered simultaneously. The effects of both compounds do not necessarily have to appear at the same time. The effects only need to overlap for a certain period, and do not necessarily have to be for the same period. Simultaneous administration or co-administration includes parallel administration or sequential administration.

[0045] "Improvement" means a reduction or improvement in at least one indicator, sign, or symptom of the associated disease, disorder, or condition. In certain embodiments, improvement includes a delay or slowing of the progression or severity of one or more indicators of the condition or disease. The progression or severity of an indicator may be determined by subjective or objective measures known to those skilled in the art.

[0046] "Antisense activity" means any detectable and / or measurable activity resulting from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of the target nucleic acid or the protein encoded by such target nucleic acid compared to the level of the target nucleic acid or target protein in the absence of the antisense compound to the target.

[0047] An "antisense compound" refers to an oligonucleotide and a compound that optionally includes one or more additional features such as a conjugate group or terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as oligonucleotides, ribozymes, siRNA, shRNA, ssRNA, and occupation-based compounds.

[0048] "Antisense inhibition" refers to the reduction of the target nucleic acid level in the presence of a complementary antisense compound compared to the target nucleic acid level in the absence of the antisense compound.

[0049] An "antisense mechanism" is any mechanism involving the hybridization of a compound with a target nucleic acid such that the result or effect of the hybridization is either targeted degradation or targeted occupation, for example, with stalling of cellular mechanisms including transcription or splicing.

[0050] An "antisense oligonucleotide" refers to an oligonucleotide having a nucleic acid base sequence complementary to a target nucleic acid or a region or segment thereof. In certain embodiments, an antisense oligonucleotide can specifically hybridize to a target nucleic acid or a region or segment thereof.

[0051] "Ataxia" refers to the complete loss of control over body movements.

[0052] "Bicyclic nucleoside" or "BNA" means a nucleoside containing a bicyclic sugar moiety. "Bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety containing two rings, where the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not contain a furanosyl moiety.

[0053] A "branched group" means an atomic group having at least three positions that can form covalent bonds to at least three other groups. In certain embodiments, the branched group provides multiple reaction sites for attaching a tethered ligand to an oligonucleotide via a conjugate linker and / or cleavable portion.

[0054] In compounds, "chemical modification" refers to the substitution or change of any unit in the compound due to a chemical reaction. "Modified nucleoside" independently means a nucleoside having a modified sugar moiety and / or a modified nucleic acid base. "Modified oligonucleotide" means an oligonucleotide containing at least one modified nucleoside bond, a modified sugar, and / or a modified nucleic acid base.

[0055] A "chemically distinct region" refers to a region of a compound that is chemically different in some way from other regions of the same compound. For example, a region containing a 2'-O-methoxyethyl nucleotide is chemically distinct from a region containing a nucleotide that does not have the 2'-O-methoxyethyl modification.

[0056] A "chimeric antisense compound" means an antisense compound having at least two chemically distinct regions, each of which has multiple subunits at a given position.

[0057] A "cleavable bond" means any chemical bond that can be divided. In certain embodiments, the cleavable bond is selected from amides, polyamides, esters, ethers, phosphodiesters (one or both), phosphate esters, carbamates, disulfides, or peptides.

[0058] "Cuttable portion" refers to a bond or group of atoms that can be cleaved under physiological conditions, for example, within a cell, animal, or human.

[0059] With respect to oligonucleotides, "complementary" means that when two nucleic acid base sequences are aligned in opposite directions, the nucleic acid base sequence of such oligonucleotide, or one or more regions thereof, matches the nucleic acid base sequence of another oligonucleotide or nucleic acid, or one or more regions thereof. Nucleic acid base matches or complementary nucleic acid bases, as described herein, unless otherwise specified, are the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine ( m Limited to C) and guanine (G). Complementary oligonucleotides and / or nucleic acids do not need to have nucleic acid base complementarity at each nucleoside and may contain one or more nucleic acid base mismatches. In contrast, with respect to oligonucleotides, "perfectly complementary" or "100% complementary" means that such oligonucleotides have nucleic acid base matches at each nucleoside without any nucleic acid base mismatches.

[0060] In the context of oligonucleotides, "sequential" refers to nucleosides, nucleic acid bases, sugar moieties, or internucleoside bonds that are directly adjacent to each other. For example, "sequential nucleic acid bases" means nucleic acid bases that are directly adjacent to each other in a sequence.

[0061] "Dementia" refers to the continuous loss of intellectual functions that impair memory, judgment, and thinking.

[0062] "Designing" or "designed to do something" refers to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.

[0063] "Diluent" refers to a component in a composition that lacks pharmacological activity but is necessary or desirable as a medicine. For example, the diluent in a composition to be injected may be a liquid, such as a physiological saline solution.

[0064] "Differently modified" means different chemical modifications or chemical substituents, including the absence of modification. Therefore, for example, an MOE nucleoside and an unmodified DNA nucleoside are "differently modified" even if the DNA nucleoside is not modified. Similarly, DNA and RNA are "differently modified" even if both are naturally occurring unmodified nucleosides. Nucleosides that are the same but contain different nucleic acid bases are not differently modified. For example, a nucleoside containing a 2'-OMe modified sugar and an unmodified adenine nucleic acid base is not differently modified from a nucleoside containing a 2'-OMe modified sugar and an unmodified thymine nucleic acid base.

[0065] "Dose" means a specific amount of a compound or pharmaceutical product provided in a single dose or over a specific period of time. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose may require a volume that cannot be easily accommodated in a single injection. In such embodiments, the desired dose may be achieved using two or more injections. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reactions in the subject. In other embodiments, the compound or pharmaceutical product is administered by infusion over a long period of time or continuously. Dosages may be presented in terms of the amount of pharmaceutical product per hour, day, week, or month.

[0066] A "medication regimen" is a combination of dosages designed to achieve one or more desired effects.

[0067] A "double-stranded compound" refers to a compound that contains two oligomeric compounds that are complementary to each other and form a double chain, wherein one of the two oligomeric compounds contains an oligonucleotide.

[0068] "Effective dose" refers to the amount of compound sufficient to achieve the desired physiological outcome in the subject requiring the compound. The effective dose may vary between subjects depending on the health and physical condition of the subject being treated, the taxonomic group of the subject being treated, the formulation of the composition, the assessment of the subject's medical condition, and other relevant factors. "Efficacy" refers to the ability to produce the desired effect.

[0069] An "Ensembl ID" is an identification number consisting of letters and numbers assigned to gene sequences by Ensembl, a joint project by EMBL-EBI and the Wellcome Trust Sanger Institute to develop a software system that generates and maintains automated annotations of selected eukaryotic genomes. Ensembl annotations help identify the location of genes within a particular genome and can be used to construct equivalent genes on the genomes of other species.

[0070] Epilepsy is a central nervous system disorder characterized by chronic disruption of neuronal activity in the brain. In some cases, it can cause seizures, abnormal behavior, periods of sensation, and sometimes loss of consciousness. Other symptoms may include myoclonus, cognitive impairment, learning disabilities, or, in children, developmental delay. In some cases, it can be fatal. In some cases, several forms of epilepsy are associated with progressive neurodegenerative diseases. Many people with epilepsy experience two or more symptoms.

[0071] "Expression" encompasses all functions that translate information encoded by genes into structures that exist and function within a cell. Such structures include, but are not limited to, the products of transcription and translation.

[0072] A "gapmer" is an oligonucleotide that comprises an inner region containing multiple nucleosides that assist in ribonuclease H cleavage, located between outer regions containing one or more nucleosides, wherein the nucleosides constituting the inner region are chemically distinct from the nucleosides (one or more) constituting the outer region. The inner region is sometimes called a "gap," and the outer region is sometimes called a "wing."

[0073] "SCN1A" refers to human voltage-gated sodium channel alpha subunit 1 and any nucleic acid of SCN1A. For example, in certain embodiments, SCN1A includes a DNA sequence encoding SCN1A, and an RNA sequence transcribed from DNA encoding SCN1A (including genomic DNA containing introns and exons). The target may be referred to in uppercase or lowercase.

[0074] "SCN2A" refers to human sodium voltage-gated channel alpha subunit 2 and any nucleic acid of SCN2A. For example, in certain embodiments, SCN2A includes a DNA sequence encoding SCN2A, and an RNA sequence transcribed from DNA encoding SCN2A (including genomic DNA containing introns and exons). The target may be referred to in uppercase or lowercase.

[0075] A "SCN2A-specific inhibitor" refers to any agent that can specifically inhibit the expression or activity of SCN2A at the molecular level. For example, SCN2A-specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents that can inhibit the expression or activity of SCN2A.

[0076] "Hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. While not limited to a specific mechanism, the most common hybridization mechanism involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding between complementary nucleic acid bases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets.

[0077] "Directly adjacent" means that there are no intervening elements between directly adjacent elements of the same type (for example, no intervening nucleic acid bases between directly adjacent nucleic acid bases).

[0078] "Subject" means a human or non-human animal selected for treatment or therapy.

[0079] "Inhibiting expression or activity" means that the expression or activity is reduced or blocked compared to the expression of activity in the untreated or control sample, and does not necessarily mean that the expression or activity is completely eliminated.

[0080] "Nucleoside bond" refers to a group or bond that forms a covalent bond between adjacent nucleosides in an oligonucleotide. "Modified nucleoside bond" refers to any nucleoside bond other than naturally occurring phosphate nucleoside bonds. Non-phosphate bonds are referred to as modified nucleoside bonds in this specification.

[0081] "Intraventricular administration" means administration into the ventricular system.

[0082] "Intraperitoneal administration" refers to administration into the peritoneum by injection or infusion. "Intramedullary administration" refers to administration into the spinal cord, medulla oblongata, or bone marrow cavity.

[0083] "Intrathecal administration" means administering the drug into the spinal canal or subarachnoid space so that it reaches the cerebrospinal fluid (CSF).

[0084] "Intravenous administration" means administering the drug intravenously.

[0085] An "extended oligonucleotide" is an oligonucleotide disclosed herein, for example, one having one or more additional nucleosides relative to the parent oligonucleotide.

[0086] "Bound nucleosides" refers to adjacent nucleosides that are bound together by internucleoside bonds.

[0087] "Mismatched" or "non-complementary" means that when the first and second oligonucleotides are aligned, the nucleic acid base of the first oligonucleotide is not complementary to the corresponding nucleic acid base of the second oligonucleotide or the target nucleic acid. For example, but not limited to, nucleic acid bases including universal nucleic acid bases, inosine, and hypoxanthine can hybridize with at least one nucleic acid base, but are still mismatched or non-complementary with respect to the nucleic acid base they hybridize with. As another example, when the first and second oligonucleotides are aligned, the nucleic acid base of the first oligonucleotide that cannot hybridize with the corresponding nucleic acid base of the second oligonucleotide or the target nucleic acid is a mismatched or non-complementary nucleic acid base.

[0088] "Modifying" refers to altering or adjusting the characteristics of a cell, tissue, organ, or organism. For example, modulating SCN2A may mean increasing or decreasing the level of SCN2A in a cell, tissue, organ, or organism. A "modulator" is something that causes a change in a cell, tissue, organ, or organism. For example, a compound may be an SCN2A modulator that reduces the amount of SCN2A in a cell, tissue, organ, or organism.

[0089] "MOE" stands for methoxyethyl.

[0090] A "monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

[0091] A "motif" refers to the pattern of unmodified and / or modified sugar moieties, nucleic acid bases, and / or nucleoside bonds in an oligonucleotide.

[0092] Myoclonus refers to episodes of recurrent, stereotyped, involuntary muscle spasms or contractions that may affect part or the whole of the body for an indefinite period of time.

[0093] "Natural" or "naturally occurring" means that something is found in nature.

[0094] "Non-bicyclic modified sugar" or "non-bicyclic modified sugar moiety" refers to a modified sugar moiety that does not form a bridge that would create a second ring between two atoms of the sugar, such as a modified sugar moiety that includes substituents.

[0095] "Nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

[0096] "Nucleic acid base" refers to a heterocyclic portion that can pair with a base of another nucleic acid. As used herein, "naturally occurring nucleic acid bases" are adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). "Modified nucleic acid base" refers to a naturally occurring nucleic acid base that has been chemically modified. "Universal base" or "universal nucleic acid base" refers to a nucleic acid base other than naturally occurring nucleic acid bases and modified nucleic acid bases that can pair with any nucleic acid base.

[0097] "Nucleic acid base sequence" refers to the sequence of nucleic acid bases in a nucleic acid or oligonucleotide, independent of any sugar or nucleoside bonds.

[0098] A "nucleoside" refers to a compound containing a nucleic acid base and a sugar moiety. The nucleic acid base and sugar moiety are either unmodified or modified, independently of each other. A "modified nucleoside" refers to a nucleoside containing a modified nucleic acid base and / or a modified sugar moiety. Modified nucleosides include debasic nucleosides, which lack a nucleic acid base.

[0099] An "oligomeric compound" means a compound comprising a single oligonucleotide and, optionally, one or more additional features, such as a conjugate group or terminal group.

[0100] An "oligonucleotide" is a polymer of linked nucleosides, where each nucleoside may or may not be independently modified. Unless otherwise specified, an oligonucleotide consists of 8 to 80 linked nucleosides. A "modified oligonucleotide" is an oligonucleotide in which at least one sugar, nucleic acid base, or nucleoside bond has been modified. An "unmodified oligonucleotide" is an oligonucleotide that does not contain any sugar, nucleic acid base, or nucleoside bond modifications.

[0101] A "parent oligonucleotide" refers to an oligonucleotide whose sequence is used as the basis for the design of many other oligonucleotides that have a similar sequence but differ in length, motif, and / or chemistry. Newly designed oligonucleotides may have the same or overlapping sequences as the parent oligonucleotide.

[0102] "Pareral administration" refers to administration by injection or infusion. Parenteral administration includes subcutaneous, intravenous, intramuscular, intra-arterial, intraperitoneal, or intracranial administration, such as intrathecal or intraventricular administration.

[0103] "Pharmacovigilantly acceptable carrier or diluent" means any substance suitable for use in administration to a subject (e.g., a human). For example, a pharmacovigilantly acceptable carrier may be a sterile aqueous solution, such as PBS or water for injection.

[0104] "Medicinal salts" refer to physiologically and medicinally acceptable salts of compounds such as oligomeric compounds or oligonucleotides; that is, salts that retain the desired biological activity of the parent compound without imparting any unwanted toxicological effects.

[0105] "Pharmaceuticals" refer to compounds that, when administered to a target, provide therapeutic benefits.

[0106] A "pharmaceutical composition" means a mixture of substances suitable for administration to a target. For example, a pharmaceutical composition may include one or more compounds or salts thereof and a sterile aqueous solution.

[0107] A "phosphorothioate bond" refers to a modified phosphate bond in which one of the non-bridged oxygen atoms is replaced by a sulfur atom. A phosphorothioate nucleoside bond is a modified nucleoside bond.

[0108] The "phosphorus moiety" refers to an atomic group containing a phosphorus atom. In certain embodiments, the phosphorus moiety includes mono-, di-, or tri-phosphates, or phosphorothioates.

[0109] A "portion" refers to a predetermined number of consecutive (i.e., linked) nucleic acid bases of a nucleic acid. In a particular embodiment, a portion is a predetermined number of consecutive nucleic acid bases of the target nucleic acid. In a particular embodiment, a portion is a predetermined number of consecutive nucleic acid bases of the oligomer compound.

[0110] "Prevention" means delaying or preventing the onset, development, or progression of a disease, disability, or condition for a period ranging from a few minutes to an indefinite period.

[0111] A “prodrug” refers to an extracorporeal form of a compound that, upon administration to a subject, is metabolized into another form within the body or its cells. In certain embodiments, the metabolized form is the active or more active form of the compound (e.g., a drug). Typically, the conversion of a prodrug in the body is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals (e.g., chemicals) present in cells or tissues, and / or by physiological conditions.

[0112] "To reduce" means to decrease the degree, size, quantity, or number.

[0113] A "RefSeq number" is a unique combination of letters and numbers assigned to a sequence, indicating that the sequence is for a specific target transcript (e.g., a target gene). Such sequences and information about a target gene (collectively, the gene record) can be found in gene sequence databases. Gene sequence databases include the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Databank of Japan (the latter three form the International Nucleotide Sequence Database Collaboration (INSDC)).

[0114] A "region" is defined as a portion of a target nucleic acid having at least one identifiable structure, function, or property.

[0115] "RNAi compounds" refer to antisense compounds that act at least partially via RISC or Ago2, but not via ribonuclease H, to modulate target nucleic acids and / or proteins encoded by those target nucleic acids. Examples of RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNAs, including microRNA mimes.

[0116] A "segment" is defined as a smaller or sub-part of a region within a nucleic acid.

[0117] A “seizure” is a symptom of many different disorders and conditions that may affect the brain. Seizures are typically caused by a disruption in electrical communication between neurons in the brain, resulting from brain damage or disease or disorder. Seizures can take many forms and affect many different people in many different ways. Common physical changes that may occur during a seizure include difficulty speaking, difficulty swallowing, drooling, repetitive blinking, staring, lack of muscle tone movement, worsening tremors, simple contractions or spasms, stiff or tense muscles, repetitive involuntary movements including the face, arms, or legs, called automatisms, convulsions, loss of control of urine or feces, sweating, changes in skin color (pallor or flushing), dilated pupils, tongue biting, difficulty breathing, and heart palpitations. In some embodiments, seizures are mild. In other embodiments, seizures can result in complete incapacitation or even death. Abnormal brain activity is often recorded by abnormal findings on an electroencephalogram (EEG).

[0118] "Side effects" refer to physiological disorders and / or conditions other than the desired effect resulting from the treatment. In certain embodiments, side effects include injection site reactions, abnormal liver function tests, abnormal kidney function, hepatotoxicity, nephrotoxicity, central nervous system abnormalities, myopathy, and fatigue. For example, an increase in serum aminotransferase levels may indicate hepatotoxicity or abnormal liver function. For example, an increase in bilirubin may indicate hepatotoxicity or abnormal liver function.

[0119] In relation to a compound, "single-stranded" means that the compound has only one oligonucleotide. "Self-complementary" means that the oligonucleotide hybridizes with itself, at least partially. A compound consisting of one oligonucleotide, where the oligonucleotide of that compound is self-complementary, is a single-stranded compound. A single-stranded compound can sometimes bind to a complementary compound to form a double-stranded compound.

[0120] A "site" is defined as a specific nucleic acid base position within a target nucleic acid.

[0121] "Specifically hybridizable" refers to an oligonucleotide that exhibits sufficient complementarity between the oligonucleotide and the target nucleic acid to induce the desired effect, while showing minimal or no effect on the non-target nucleic acid. In certain embodiments, specific hybridization occurs under physiological conditions.

[0122] "Specifically inhibiting" a target nucleic acid means reducing or blocking the expression of the target nucleic acid, while having less, minimal, or no effect on reducing non-target nucleic acids, and does not necessarily mean completely eliminating the expression of the target nucleic acid.

[0123] "Standard cell assay" refers to the assay(s) described in the examples and their reasonable variations.

[0124] "Standard in vivo experiment" refers to the procedure(s) described in the example(s) and their reasonable variations.

[0125] "Subjects" refers to humans, or non-human animals, such as, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, such as, but not limited to, monkeys and chimpanzees.

[0126] "Sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. "Unmodified sugar moiety" or "unmodified sugar" means a 2'-OH(H) furanosyl moiety found in RNA ("unmodified RNA sugar moiety") or a 2'-H(H) moiety found in DNA ("unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. "Modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or sugar substitute. "Modified furanosyl sugar moiety" means a furanosyl sugar containing a non-hydrogen substituent in place of at least one hydrogen of the unmodified sugar moiety. In certain embodiments, the modified furanosyl sugar moiety is a 2'-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and acyclic sugars.

[0127] A "sugar substitute" refers to a modified sugar moiety in an oligonucleotide that has a non-furanosyl sugar moiety and can bind a nucleic acid base to another group (e.g., an internucleoside bond, a conjugate group, or a terminal group). Modified nucleosides containing sugar substitutes can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or nucleic acids.

[0128] "Subcutaneous administration" means administration directly beneath the skin.

[0129] A "target gene" refers to a gene that codes for a target.

[0130] "Targeting" refers to the specific hybridization of a compound to a target nucleic acid in order to induce the desired effect.

[0131] "Target nucleic acid," "target RNA," "target RNA transcript," and "nucleic acid target" all refer to nucleic acids that can be targeted by the compounds described herein.

[0132] A "target region" refers to a portion of a target nucleic acid that is targeted by one or more compounds.

[0133] "Target segment" refers to the nucleotide sequence of the target nucleic acid targeted by the compounds described herein. "5' target site" refers to the 5' end nucleotide of the target segment. "3' target site" refers to the 3' end nucleotide of the target segment.

[0134] A "terminal group" refers to a chemical group or atomic group covalently bonded to the end of an oligonucleotide.

[0135] "Therapeutic effective dose" refers to the amount of compound, drug, or composition that produces a therapeutic benefit to the subject.

[0136] "To treat" means to administer a compound or pharmaceutical composition to a subject in order to bring about a modification or improvement of a disease, disorder, or condition in that subject. [Brief explanation of the drawing]

[0137] [Figure 1] Figures 1A and 1B show the changes in SCN2A mRNA levels in mice heterozygous for the SCN2A R1882Q mutation at P15 (n=3 in all treatment groups) (Figure 1A) and P35 (ASO 1 n=4, ASO 2 n=4, ASO 3 n=1, untreated n=3) (Figure 1B). The magnification changes were normalized to age-matched untreated wild-type mice. All mice were injected at P1 and P2. [Figure 2] This graph shows the normalized reduction rate (percentage) of Scn2a mRNA compared to age-matched, untreated Scn1a RX heterozygous mice. mRNA was measured at P15. N = 3 brain samples per treatment group. [Figure 3]This graph shows the survival rate (%) after injection of Scn2a downregulating ASO (5 μg) or scrambled ASO (50 μg) in mice heterozygous for Scn1a. All mice were injected in Phase 1 and followed for 45 days. [Figure 4-1] This graph shows the P21 body weight of Scn1a RX mice treated with scrambled ASO or mScn2a ASO. N=15 for scrambled and N=18 for ASO. [Figure 4-2] This graph shows the P45 body weight of Scn1a RX mice treated with scrambled ASO or mScn2a ASO. N=15 for scrambled mice and N=18 for ASO mice. [Figure 5] This graph shows the number of seizures after injection with Scn2a downregulating ASO (5 μg; n=9) or scrambled ASO (50 μg; n=17) in mice heterozygous for Scn1a. All mice were injected at P1. [Modes for carrying out the invention]

[0138] It should be understood that the general description above and the detailed description below are merely illustrative and descriptive, and do not limit the embodiments as in the claims. In this specification, the use of the singular includes the plural unless otherwise specified. As used herein, the use of "or" means "and / or" unless otherwise specified. Furthermore, the use of the term "including," as well as other forms such as "includes" and "included," is not limiting.

[0139] The section headings used herein are for structural purposes only and should not be construed as limiting the subject matter described herein. However, all documents or parts of documents cited in this application, including patents, patent applications, articles, books, papers, and GenBank and NCBI reference sequence records, are expressly incorporated herein by reference, not only in whole but also in part, of the documents considered herein.

[0140] It is understood that the sequences described in each sequence number of the examples contained herein are independent of any modifications to the sugar moiety, nucleoside bond, or nucleic acid base. Therefore, the compounds defined by the sequence number may independently contain one or more modifications to the sugar moiety, nucleoside bond, or nucleic acid base. The compounds described by the ISIS number (ISIS#) indicate a combination of nucleic acid base sequence, chemical modification, and motif.

[0141] This invention is partly based on the discovery that oligonucleotides targeting the SCN2A gene are useful in treating subjects with SCN1A encephalopathy. Accordingly, this invention features a method for preventing and treating SCN1A encephalopathy in subjects by administering oligonucleotides targeting the SCN2A gene.

[0142] Specific Embodiments Certain embodiments provide methods, compounds, and compositions for modulating SCN1A encephalopathy (e.g., Dravet syndrome) or its symptoms in a subject by administration of a compound or composition to the subject, wherein the compound or composition comprises an SCN2A modulator. Modulation of SCN2A can reduce the level or expression of SCN2A so that its expression is reduced in order to treat, prevent, improve, or delay SCN1A encephalopathy or its symptoms. In certain embodiments, the SCN2A modulator is an SCN2A-specific inhibitor. In certain embodiments, the SCN2A-specific inhibitor is a nucleic acid (including antisense compounds), peptide, antibody, small molecule, and other activators that can inhibit the expression or activity of SCN2A. In certain embodiments, the subject is a human.

[0143] In some specific embodiments, the oligonucleotide is selective for SCN2A pre-mRNA or mRNA to SCN1A pre-mRNA or mRNA. In certain embodiments, the method does not substantially reduce SCN1A expression. In certain embodiments, the subject has a gain-of-function mutation in SCN1A. In certain embodiments, the subject has a loss-of-function mutation in SCN1A.

[0144] Specific embodiments disclosed herein provide compounds or compositions comprising an SCN2A modulator. Such compounds or compositions are useful for treating, preventing, improving, or delaying the onset of SCN1A encephalopathy (e.g., Dravet syndrome) or its symptoms. In specific embodiments, the compound comprises an SCN2A-specific inhibitor. In specific embodiments, the SCN2A-specific inhibitor is a nucleic acid, polypeptide, antibody, small molecule, or other activator that can inhibit the expression or activity of SCN2A. In specific embodiments, the SCN2A-specific inhibitor is a nucleic acid that targets SCN2A. In specific embodiments, the nucleic acid is single-stranded. In specific embodiments, the nucleic acid is double-stranded. In specific embodiments, the compound or composition comprises an antisense compound. In any of the embodiments described above, the compound or composition comprises an oligomeric compound. In specific embodiments, the compound or composition comprises an oligonucleotide that targets SCN2A. In specific embodiments, the oligonucleotide is single-stranded. In specific embodiments, the compound comprises a deoxyribonucleotide. In specific embodiments, the compound comprises a ribonucleotide and is double-stranded. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the modified oligonucleotide is single-stranded.

[0145] In any of the embodiments described above, the compound may include modified oligonucleotides with a binding nucleoside length of 8-80, 10-30, 12-50, 13-30, 13-50, 14-30, 14-50, 15-30, 15-50, 16-30, 16-50, 17-30, 17-50, 18-22, 18-24, 18-30, 18-50, 19-22, 19-30, 19-50, or 20-30. In certain embodiments, at least one nucleoside bond of the modified oligonucleotide is a modified nucleoside bond. In certain embodiments, at least one nucleoside bond is a phosphorothioate nucleoside bond. In certain embodiments, the nucleoside bonds are a phosphorothioate bond and a phosphate ester bond.

[0146] In certain embodiments, any of the aforementioned oligonucleotides comprises at least one modified sugar. In certain embodiments, the at least one modified sugar comprises a 2'-O-methoxyethyl group. In certain embodiments, the at least one modified sugar is a bicyclic sugar such as a 4'-CH(CH3)-O-2' group, a 4'-CH2-O-2' group, or a 4'-(CH2)2-O-2' group.

[0147] In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified nucleic acid base. In certain embodiments, the modified nucleic acid base is 5-methylcytosine.

[0148] In certain embodiments, the compound or composition comprises a modified oligonucleotide comprising a) a gap segment consisting of a bonded deoxynucleoside; b) a 5' wing segment consisting of a bonded nucleoside; and c) a 3' wing segment consisting of a bonded nucleoside. The gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment contains a modified sugar. In certain embodiments, at least one internucleoside bond is a phosphorothioate bond. In certain embodiments, at least one cytosine is 5-methylcytosine.

[0149] In certain embodiments, the compound comprises a modified oligonucleotide with a bonded nucleoside length of 12 to 80. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide has a bonded nucleoside length of 12 to 30.

[0150] In certain embodiments, the compounds or compositions disclosed herein further comprise pharmaceutically acceptable carriers or diluents.

[0151] In certain embodiments, the compound or composition is co-administered with a second activator. In certain embodiments, the compound and the second activator are administered simultaneously.

[0152] In certain embodiments, the compounds and compositions described herein that target SCN2A can be used in methods to inhibit the expression of SCN2A in cells. In certain embodiments, the compounds and compositions described herein that target SCN2A can be used in methods to treat, prevent, delay, or improve SCN1A-related diseases or disorders (e.g., Dravet syndrome, but not limited to).

[0153] Specific indications The specific embodiments provided herein relate to methods for inhibiting the expression or activity of SCN2A by administering SCN2A-targeting compounds or compositions that may be useful in treating, preventing, or improving SCN1A-related diseases in a subject. In specific embodiments, such compounds or compositions include SCN2A-specific inhibitors. In specific embodiments, the compounds include SCN2A-targeted antisense compounds or oligomeric compounds. In specific embodiments, the compounds include SCN2A-targeted modified oligonucleotides.

[0154] In certain embodiments, a method for inhibiting the expression or activity of SCN2A in cells comprises contacting the cells with a compound or composition containing an SCN2A-specific inhibitor to thereby inhibit the expression or activity of SCN2A in the cells. In certain embodiments, the cells are neurons. In certain embodiments, the cells are located in brain tissue. In certain embodiments, the cells are located in brain tissue of a subject who has, or is at risk of having, a disease, disorder, condition, symptom, or physiological marker associated with SCN1A disorder. In certain embodiments, the SCN1A disease or disorder is Dravet syndrome. In certain embodiments, the SCN1A disease is epilepsy. In certain embodiments, the SCN1A disease is generalized epilepsy with febrile seizures. In certain embodiments, the SCN1A disease is familial febrile seizures. In certain embodiments, the SCN1A disease is early infantile epileptic encephalopathy. In certain embodiments, the SCN2A-specific inhibitor is a nucleic acid, peptide, antibody, small molecule, or other agonist that can inhibit the expression or activity of SCN2A. In certain embodiments, the SCN2A-specific inhibitor is an antisense compound or oligomeric compound targeted to SCN2A. In certain embodiments, the SCN2A-specific inhibitor is an oligonucleotide targeted to SCN2A. In certain embodiments, the compound or composition comprises a modified oligonucleotide with a binding nucleoside length of 8 to 80. In certain embodiments, the compound or composition comprises a modified oligonucleotide with a binding nucleoside length of 10 to 30. In certain embodiments, the compound comprising the modified oligonucleotide may be single-stranded. In certain embodiments, the compound comprising the modified oligonucleotide may be double-stranded.

[0155] In certain embodiments, a method for treating, preventing, delaying the onset, slowing the progression of, or improving one or more diseases, disorders, conditions, symptoms, or physiological markers associated with SCN1A comprises administering a compound or composition containing an SCN2A-specific inhibitor to a subject. In certain embodiments, a method for treating, preventing, delaying the onset, slowing the progression of, or improving diseases, disorders, conditions, symptoms, or physiological markers associated with SCN1A-related diseases or disorders in a subject comprises administering a compound or composition containing an SCN2A-specific inhibitor to a subject to thereby treat, prevent, delay the onset, slow the progression of, or improve the disease. In certain embodiments, a subject is identified as having or being at risk of having a disease, disorder, condition, symptom, or physiological marker. In certain embodiments, the SCN1A disease or disorder is Dravet syndrome. In certain embodiments, the SCN1A disease is epilepsy. In certain embodiments, the SCN1A disease is generalized epilepsy with febrile seizures. In certain embodiments, SCN1A disease is familial febrile seizures. In certain embodiments, SCN1A disease is early infantile epileptic encephalopathy.6 In certain embodiments, SCN2A-specific inhibitors are administered parenterally to subjects. In certain embodiments, parenteral administration is intraventricular administration. In certain embodiments, parenteral administration is intrathecal administration. In certain embodiments, parenteral administration is subcutaneous administration. In certain embodiments, subjects are humans. In certain embodiments, SCN2A-specific inhibitors are nucleic acids, peptides, antibodies, small molecules or other activators that can inhibit the expression or activity of SCN2A. In certain embodiments, SCN2A-specific inhibitors include antisense compounds or oligomeric compounds targeted to SCN2A. In certain embodiments, SCN2A-specific inhibitors are oligonucleotides targeted to SCN2A. In certain embodiments, a compound or composition includes a modified oligonucleotide with a binding nucleoside length of 10 to 30. In certain embodiments, a compound containing a modified oligonucleotide may be single-stranded.In certain embodiments, the compound containing the modified oligonucleotide may be double-stranded.

[0156] In certain embodiments, reducing seizures, reducing myoclonus or muscle spasms, alleviating gait difficulties (peripheral neuropathy), reducing spasms, reducing dementia, preventing its onset, or treating dementia, alleviating speech disorders, reducing hallucinations, or preventing their onset, treating, reducing, or preventing progressive neurodegeneration, treating, reducing, or preventing damage to nerves controlling bladder function, reducing hypotonia, improving muscle tone, reducing hepatomegaly, preventing its onset, reducing or preventing cardiac defects, reducing or preventing intracellular polyglucosane body accumulation, improving or preventing cognitive decline, and reducing ataxia, or a combination thereof, involves administering a compound or composition containing an SCN2A-specific inhibitor to the subject. In certain embodiments, the cells are neurons. In certain embodiments, administration of the compound or composition reduces seizures in the subject. In certain embodiments, administration of the compound or composition reduces myoclonus or muscle spasms in the subject. In certain embodiments, administration of the compound or composition alleviates difficulty walking in the subject. In certain embodiments, administration of the compound or composition alleviates peripheral neuropathy in the subject. In certain embodiments, administration of the compound or composition alleviates spasms in the subject. In certain embodiments, administration of the compound or composition reduces, prevents the onset of, or treats dementia in the subject. In certain embodiments, administration of the compound or composition alleviates speech disorders in the subject. In certain embodiments, administration of the compound or composition reduces or prevents the onset of visual hallucinations in the subject. In certain embodiments, administration of the compound or composition treats, reduces, or prevents the onset of progressive neurodegeneration in the subject. In certain embodiments, administration of the compound or composition treats, reduces, or prevents the onset of damage to nerves controlling bladder function in the subject. In certain embodiments, administration of the compound or composition treats, reduces, or prevents the onset of hypotonia in the subject.In certain embodiments, administration of the compound or composition improves muscle tone in the subject. In certain embodiments, administration of the compound or composition improves or prevents cognitive decline. In certain embodiments, administration of the compound or composition treats or reduces ataxia in the subject. In certain embodiments, administration of the compound or composition treats, reduces or prevents one or more of the following: chronic seizures, frequent seizures, behavioral and developmental delays, motor and balance problems, orthopedic conditions, speech delays and vocal problems, growth and nutrition problems, sleep difficulties, chronic infections, sensory integration disorders, autonomic nervous system disorders, and sweating. In certain embodiments, the subject is identified as having or being at risk of having a disease, disorder, condition, symptom, or physiological marker associated with SCN1A. In certain embodiments, the SCN1A disease or disorder is Dravet syndrome. In certain embodiments, the SCN1A disease is epilepsy. In certain embodiments, the SCN1A disease is generalized epilepsy with febrile seizures. In certain embodiments, SCN1A disease is familial febrile seizures. In certain embodiments, SCN1A disease is early infantile epileptic encephalopathy.6 In certain embodiments, the SCN2A-specific inhibitor is administered parenterally to the subject. In certain embodiments, parenteral administration is intraventricular administration. In certain embodiments, parenteral administration is intrathecal administration. In certain embodiments, administration is intrathecal administration. In certain embodiments, parenteral administration is subcutaneous administration. In certain embodiments, the subject is human. In certain embodiments, the SCN2A-specific inhibitor is a nucleic acid, peptide, antibody, small molecule or other activator that can inhibit the expression or activity of SCN2A. In certain embodiments, the SCN2A-specific inhibitor is an antisense compound or oligomeric compound targeted to SCN2A. In certain embodiments, the SCN2A-specific inhibitor is an oligonucleotide targeted to SCN2A. In certain embodiments, the compound or composition comprises a modified oligonucleotide with a binding nucleoside length of 8 to 80.In certain embodiments, the compound or composition contains a modified oligonucleotide having a bonded nucleoside length of 10 to 30. In certain embodiments, the compound containing the modified oligonucleotide may be single-stranded. In certain embodiments, the compound containing the modified oligonucleotide may be double-stranded.

[0157] In certain embodiments, administration of the compounds or compositions disclosed herein results in: reduced seizures; reduced myoclonus or muscle spasms; alleviation of difficulty walking; alleviation of spasms; reduction, prevention, or treatment of dementia; alleviation of speech disorders; reduction or prevention of hallucinations; treatment, reduction, or prevention of progressive neurodegeneration; treatment, reduction, or prevention of damage to nerves controlling bladder function; reduction, improvement of muscle tone, improvement of cognitive decline; and reduction of ataxia; or a combination thereof. In certain embodiments, seizures were independently reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%. In certain embodiments, myoclonus or muscle spasms were independently reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%. In certain embodiments, difficulty walking was independently alleviated by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%. In certain embodiments, spasms were independently reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%. In certain embodiments, speech impairment was independently alleviated by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%. In certain embodiments, hallucinations were independently reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%. In certain embodiments, progressive neurodegeneration was independently reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%.In certain embodiments, the progression of dementia was independently reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%. In certain embodiments, nerve damage to bladder function was independently reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%. In certain embodiments, hypotonia was independently reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%. In certain embodiments, cognitive decline was reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%. In certain embodiments, ataxia was independently reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%. In certain embodiments, the cells are neurons.

[0158] Certain embodiments provide compounds and compositions described herein for use in therapy. Certain embodiments relate to compounds or compositions comprising SCN2A-specific inhibitors for use in the treatment, prevention, delay of onset, slowing of progression, or improvement of one or more diseases, disorders, conditions, symptoms, or physiological markers associated with SCN1A. Certain embodiments relate to compounds or compositions for use in the treatment, prevention, delay of onset, slowing of progression, or improvement of SCN1A diseases or disorders, or their symptoms or physiological markers. In certain embodiments, the SCN1A disease or disorder is Dravet syndrome. In certain embodiments, the SCN1A disease is epilepsy. In certain embodiments, the SCN1A disease is generalized epilepsy with febrile seizures. In certain embodiments, the SCN1A disease is familial febrile seizures. In certain embodiments, the SCN1A disease is early infantile epileptic encephalopathy.

[0159] In certain embodiments, the SCN1A disease or disorder is Dravet syndrome. In certain embodiments, an SCN2A-specific inhibitor is a nucleic acid, peptide, antibody, small molecule, or other activator that can inhibit the expression or activity of SCN2A. In certain embodiments, an SCN2A-specific inhibitor is an antisense compound or oligomeric compound targeted to SCN2A. In certain embodiments, an SCN2A-specific inhibitor is an oligonucleotide targeted to SCN2A. In certain embodiments, a compound or composition comprises a modified oligonucleotide with a binding nucleoside length of 8 to 80. In certain embodiments, a compound or composition comprises a modified oligonucleotide with a binding nucleoside length of 10 to 30. In certain embodiments, a compound comprising a modified oligonucleotide may be single-stranded. In certain embodiments, a compound comprising a modified oligonucleotide may be double-stranded.

[0160] Specific embodiments relate to compounds or compositions comprising SCN2A-specific inhibitors for use in reducing seizures, myoclonus or muscle spasms, alleviating gait difficulties, reducing dementia, preventing its onset, or treating it; alleviating speech disorders, reducing or preventing hallucinations; treating, reducing, or preventing progressive neurodegeneration; treating, reducing, or preventing damage to nerves controlling bladder function; reducing hypotonia, improving muscle tone, improving or preventing cognitive decline; and reducing ataxia, or a combination thereof. In specific embodiments, administration of the compound or composition reduces seizures in the subject. In specific embodiments, administration of the compound or composition reduces myoclonus or muscle spasms in the subject. In specific embodiments, administration of the compound or composition alleviates gait difficulties in the subject. In specific embodiments, administration of the compound or composition reduces, prevents, or treats dementia in the subject. In specific embodiments, administration of the compound or composition alleviates speech disorders in the subject. In certain embodiments, administration of the compound or composition reduces or prevents the onset of hallucinations in a subject. In certain embodiments, administration of the compound or composition treats, reduces or prevents the onset of progressive neurodegeneration in a subject. In certain embodiments, administration of the compound or composition treats, reduces or prevents the onset of damage to nerves controlling bladder function in a subject. In certain embodiments, administration of the compound or composition treats, reduces or prevents hypotonia in a subject. In certain embodiments, administration of the compound or composition improves muscle tone in a subject. In certain embodiments, the cells are neurons. In certain embodiments, administration of the compound or composition improves or prevents cognitive decline. In certain embodiments, administration of the compound or composition treats or reduces ataxia in a subject. In certain embodiments, the subject is identified as having, or at risk of having, a disease, disorder, condition, symptom, or physiological marker associated with SCN1A.In certain embodiments, the SCN1A disease or disorder is Dravet syndrome. In certain embodiments, the SCN1A disease is epilepsy. In certain embodiments, the SCN1A disease is generalized epilepsy with febrile seizures. In certain embodiments, the SCN1A disease is familial febrile seizures. In certain embodiments, the SCN1A disease is early infantile epileptic encephalopathy. In certain embodiments, the subject is human. In certain embodiments, the SCN2A-specific inhibitor is a nucleic acid, peptide, antibody, small molecule, or other activator that can inhibit the expression or activity of SCN2A. In certain embodiments, the SCN2A-specific inhibitor is an antisense compound or oligomeric compound targeted to SCN2A. In certain embodiments, the SCN2A-specific inhibitor is an oligonucleotide targeted to SCN2A. In certain embodiments, the compound or composition comprises a modified oligonucleotide with a binding nucleoside length of 8 to 80. In certain embodiments, the compound or composition comprises a modified oligonucleotide with a binding nucleoside length of 10 to 30. In certain embodiments, the compound containing the modified oligonucleotide may be single-stranded. In certain embodiments, the compound containing the modified oligonucleotide may be double-stranded.

[0161] Specific embodiments relate to the use of the compounds or compositions described herein for the manufacture or preparation of a therapeutic medicament. Specific embodiments relate to the use of the compounds or compositions described herein in the manufacture or preparation of a medicament for treating, preventing, delaying the onset, slowing the progression of, or improving one or more diseases, disorders, conditions, symptoms, or physiological markers associated with SCN1A. In specific embodiments, the compounds or compositions described herein are used in the manufacture or preparation of a medicament for treating, improving, delaying, or preventing SCN1A disease or disorder. In specific embodiments, the SCN1A disease or disorder is Dravet syndrome. In specific embodiments, the SCN1A disease is epilepsy. In specific embodiments, the SCN1A disease is generalized epilepsy with febrile seizures. In specific embodiments, the SCN1A disease is familial febrile seizures. In specific embodiments, the SCN1A disease is early infantile epileptic encephalopathy. In certain embodiments, the compound or composition comprises a nucleic acid, peptide, antibody, small molecule, or other activator capable of inhibiting the expression or activity of SCN2A. In certain embodiments, the compound comprises an antisense compound or oligomeric compound targeted to SCN2A. In certain embodiments, the compound or composition comprises an oligonucleotide targeted to SCN2A. In certain embodiments, the compound or composition comprises a modified oligonucleotide with a binding nucleoside length of 8 to 80. In certain embodiments, the compound or composition comprises a modified oligonucleotide with a binding nucleoside length of 10 to 30. In certain embodiments, the compound or composition comprising the modified oligonucleotide may be single-stranded. In certain embodiments, the compound or composition comprising the modified oligonucleotide may be double-stranded.

[0162] Specific embodiments relate to the use of compounds or compositions for the manufacture or preparation of pharmaceuticals Specific embodiments relate to the use of compounds or compositions in the manufacture or preparation of pharmaceuticals for the reduction, prevention, or treatment of dementia in subjects. Specific embodiments relate to the use of compounds or compositions in the manufacture or preparation of pharmaceuticals for the alleviation of speech disorders in subjects. Specific embodiments relate to the use of compounds or compositions in the manufacture or preparation of pharmaceuticals for the reduction, prevention, or treatment of hallucinations in subjects. Specific embodiments relate to the use of compounds or compositions in the manufacture or preparation of pharmaceuticals for the treatment, reduction, or prevention of progressive neurodegeneration in subjects. Specific embodiments relate to the use of compounds or compositions in the manufacture or preparation of pharmaceuticals for the treatment, reduction, or prevention of damage to nerves controlling bladder function in subjects. Specific embodiments relate to the use of compounds or compositions in the manufacture or preparation of pharmaceuticals for the treatment, reduction, or prevention of hypotonia in subjects. Specific embodiments relate to the use of compounds or compositions in the manufacture or preparation of pharmaceuticals for the improvement of muscle tone in subjects.Specific embodiments relate to the use of compounds or compositions in the manufacture or preparation of pharmaceuticals for the reduction of ataxia in a subject. In specific embodiments, the cell is a neuron. In specific embodiments, the compound or composition comprises nucleic acids, peptides, antibodies, small molecules, or other activators that can inhibit the expression or activity of SCN2A. In specific embodiments, the compound or composition comprises an antisense compound or oligomeric compound targeted to SCN2A. In specific embodiments, the compound or composition comprises an oligonucleotide targeted to SCN2A. In specific embodiments, the compound or composition comprises a modified oligonucleotide with a binding nucleoside length of 8 to 80. In specific embodiments, the compound or composition comprises a modified oligonucleotide with a binding nucleoside length of 10 to 30. In specific embodiments, the compound or composition comprising the modified oligonucleotide may be single-stranded. In specific embodiments, the compound or composition comprising the modified oligonucleotide may be double-stranded.

[0163] In any of the methods or uses described above, the compound or composition may contain an antisense compound targeted to SCN2A. In certain embodiments, the compound comprises an oligonucleotide, e.g., an oligonucleotide consisting of 8 to 80 bonded nucleosides, 10 to 30 bonded nucleosides, 12 to 30 bonded nucleosides, or 20 bonded nucleosides. In certain embodiments, the oligonucleotide comprises at least one modified nucleoside bond, at least one modified sugar, and / or at least one modified nucleic acid base. In certain embodiments, the modified nucleoside bond is a phosphorothioate nucleoside bond, the modified sugar is a bicyclic sugar or 2'-O-methoxyethyl, and the modified nucleic acid base is 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of a bound deoxynucleoside; a 5' wing segment consisting of a bound nucleoside; and a 3' wing segment consisting of a bound nucleoside, wherein the gap segment is located directly adjacent to the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment contains a modified sugar. In certain embodiments, the compound may include a modified oligonucleotide with a bound nucleoside length of 12 to 80. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide has a bound nucleoside length of 12 to 30. In certain embodiments, the compounds or compositions disclosed herein further comprise a pharmaceutically acceptable carrier or diluent.

[0164] In any of the methods or uses described above, the compound or composition comprises or consists of a modified oligonucleotide having a bonded nucleoside length of 12 to 30, wherein the modified oligonucleotide is A gap segment consisting of a bound 2'-deoxynucleoside; A 5' wing segment consisting of a bound nucleoside; and A 3' wing segment consisting of a bound nucleoside; The gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment contains a modified sugar.

[0165] In any of the methods or uses described above, the compound or composition may be administered parenterally. For example, in certain embodiments, the compound or composition may be administered by injection or infusion. Parenteral administration includes subcutaneous, intravenous, intramuscular, intra-arterial, intraperitoneal, or intracranial administration. In certain embodiments, the compound or composition may be co-administered with a second activator. In certain embodiments, the compound and the second activator may be administered simultaneously. In any of the methods or uses described above, the compound or composition may be administered intrathecally. In any of the methods or uses described above, the compound or composition may be administered intrathecally. In any of the methods or uses described above, the compound or composition may be administered intravenously.

[0166] Specific compounds In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleic acid base sequence complementary to that of the target nucleic acid.

[0167] In certain embodiments, the compounds described herein include or consist of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleic acid base sequence complementary to that of the target nucleic acid.

[0168] In certain embodiments, the compound or antisense compound is single-stranded. Such a single-stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of the single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleic acid base sequence.

[0169] In certain embodiments, the compound is double-stranded. Such a double-stranded compound comprises a first modified oligonucleotide having a region complementary to the target nucleic acid, and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nucleic acid bases in the modified oligonucleotide are replaced by uracil nucleic acid bases. In certain embodiments, the compound contains a conjugate group. In certain embodiments, each modified oligonucleotide has a binding nucleoside length of 12 to 30.

[0170] In certain embodiments, the compound is double-stranded. Such a double-stranded compound comprises a first oligomeric compound having a region complementary to the target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of such a double-stranded compound typically includes or consists of a modified oligonucleotide. The oligonucleotide of the second oligomeric compound of such a double-stranded compound may be modified or unmodified. The oligomeric compound of the double-stranded compound may include a non-complementary overhang nucleoside.

[0171] Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, siRNAs, oligonucleotide-targeting microRNAs, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimetics.

[0172] In certain embodiments, the compounds described herein have a nucleic acid sequence comprising the reverse complement of the target segment of a target nucleic acid that is targeted when written in the 5' to 3' direction.

[0173] In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 10 to 30. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 12 to 30. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 12 to 22. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 14 to 30. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 14 to 20. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 15 to 30. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 15 to 20. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 16 to 30. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 16 to 20. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 17 to 30. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 17 to 20. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 18 to 30. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 18 to 21. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 18 to 20. In certain embodiments, the compounds described herein include oligonucleotides with binding subunit lengths of 20 to 30.In other words, such oligonucleotides are each of the following: 12-30 bonded subunits, 14-30 bonded subunits, 14-20 subunits, 15-30 subunits, 15-20 subunits, 16-30 subunits, 16-20 subunits, 17-30 subunits, 17-20 subunits, 18-30 subunits, 18-20 subunits, 18-21 subunits, 20-30 subunits, or 12-22 bonded subunits. In certain embodiments, the compounds described herein include oligonucleotides with a bonded subunit length of 14. In certain embodiments, the compounds described herein include oligonucleotides with a bonded subunit length of 16. In certain embodiments, the compounds described herein include oligonucleotides with a bonded subunit length of 17. In certain embodiments, the compounds described herein include oligonucleotides with a bonded subunit length of 18. In certain embodiments, the compounds described herein include oligonucleotides with a bonded subunit length of 19. In certain embodiments, the compounds described herein include oligonucleotides with a bonded subunit length of 20. In other embodiments, the compounds described herein include oligonucleotides with bonded subunits of 8-80, 12-50, 13-30, 13-50, 14-30, 14-50, 15-30, 15-50, 16-30, 16-50, 17-30, 17-50, 18-22, 18-24, 18-30, 18-50, 19-22, 19-30, 19-50, or 20-30.In such particular embodiments, the compounds described herein include oligonucleotides within a range defined by a binding subunit length of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80, or any two of the above values. In some embodiments, the bound subunit is a nucleotide, nucleoside, or nucleic acid base.

[0174] In certain embodiments, the compound may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation) or from the 3' end (3' truncation). A shortened or truncated compound targeted to the SCN2A nucleic acid may have two subunits deleted from the 5' end of the compound, or two subunits deleted from the 3' end. Alternatively, the deleted nucleoside may be dispersed throughout the compound.

[0175] When a single additional subunit is present in an extended compound, the additional subunit may be located at the 5' end or the 3' end of the compound. When two or more additional subunits are present, for example, in a compound where two subunits are attached to the 5' end (5'-addition) or to the 3' end (3'-addition), the attached subunits may be adjacent to each other. Alternatively, the attached subunits may be dispersed throughout the compound.

[0176] It is possible to increase or decrease the length of compounds such as oligonucleotides and / or introduce mismatched bases without eliminating their activity (Woolf et al. (Proc.Natl.Acad.Sci.USA 89:7305-7309,1992; Gautschi et al. J.Natl.Cancer Inst.93:463-471,March 2001; Maher and Dolnick Nuc.Acid.Res.16:3341-3358,1988). However, small changes in oligonucleotide sequence, chemical properties, and motifs seem to result in one or more significant differences in many properties required for clinical development (Seth et al. J.Med.Chem.,52,10,2009; Egli et al. J.Am.Chem.Soc.,133,16642,2011).

[0177] In certain embodiments, the compounds described herein are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also called small interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds work at least partially through the RISC pathway to degrade and / or sequestrate target nucleic acids (thus including microRNA / microRNA mimetic compounds). As used herein, the term siRNA is equivalent to other terms used to describe nucleic acid molecules that can mediate sequence-specific RNAi, such as small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), small hairpin RNA (shRNA), small interfering oligonucleotides, small interfering nucleic acids, small interfering modified oligonucleotides, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is equivalent to other terms used to describe sequence-specific RNA interference such as post-transcriptional gene silencing, translation inhibition, or epigenetics.

[0178] In certain embodiments, the double-stranded compound comprises a first chain containing a nucleic acid base sequence complementary to the target region of the SCN2A nucleic acid, and a second chain. In certain embodiments, the double-stranded compound comprises a ribonucleotide, wherein the first chain has uracil (U) instead of thymine (T) and is complementary to the target region. In certain embodiments, the double-stranded compound comprises (i) a first chain containing a nucleic acid base sequence complementary to the target region of the SCN2A nucleic acid, and (ii) a second chain. In certain embodiments, the double-stranded compound comprises one or more modified nucleotides in which the 2' position of the sugar contains a halogen (such as a fluorine group; 2'-F) or an alkoxy group (such as a methoxy group; 2'-OMe). In certain embodiments, the double-stranded compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, at least one 2'-F glycosylation and at least one 2'-OMe glycosylation are arranged in an alternating pattern with respect to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleic acid bases along the strand of the dsRNA compound. In certain embodiments, the double-stranded compound contains one or more bonds between adjacent nucleotides other than naturally occurring phosphodiester bonds. Examples of such bonds include phosphoramide, phosphorothioate, and phosphorodithioate bonds. The double-stranded compound may also be a chemically modified nucleic acid molecule, as taught in U.S. Patent No. 6,673,661. In other embodiments, the dsRNA contains one or two cap strands, as disclosed, for example, in WO00 / 63364 filed April 19, 2000. In certain embodiments, the first strand of the double-stranded compound is an siRNA guide strand, and the second strand of the double-stranded compound is an siRNA passenger strand. In certain embodiments, the second strand of the double-stranded compound is complementary to the first strand. In certain embodiments, each strand of the double-stranded compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 bound nucleosides.

[0179] In certain embodiments, the single-stranded compounds described herein may include any of the SCN2A-targeted oligonucleotide sequences described herein. In certain embodiments, such single-stranded compounds are single-stranded RNAi (ssRNAi) compounds. In certain embodiments, the ssRNAi compound comprises a nucleic acid base sequence complementary to the target region of the SCN2A nucleic acid. In certain embodiments, the ssRNAi compound comprises a ribonucleotide in which uracil (U) is present instead of thymine (T). In certain embodiments, the ssRNAi compound comprises a nucleic acid base sequence complementary to the target region of the SCN2A nucleic acid. In certain embodiments, the ssRNAi compound comprises one or more modified nucleotides in which the 2' position of the sugar contains a halogen (such as a fluorine group; 2'-F) or an alkoxy group (such as a methoxy group; 2'-OMe). In certain embodiments, the ssRNAi compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In certain embodiments, at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are arranged in an alternating pattern with respect to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleic acid bases along the chain of the ssRNAi compound. In yet another embodiment, the ssRNAi compound contains one or more bonds between adjacent nucleotides other than naturally occurring phosphodiester bonds. Examples of such bonds include phosphoramide, phosphorothioate, and phosphorodithioate bonds. The ssRNAi compound may also be a chemically modified nucleic acid molecule, as taught in U.S. Patent No. 6,673,661. In another embodiment, the ssRNAi contains a cap chain, for example, as disclosed in WO00 / 63364 filed April 19, 2000. In a particular embodiment, the ssRNAi compound consists of nucleosides bound to 16, 17, 18, 19, 20, 21, 22, or 23.

[0180] In certain embodiments, the compounds described herein include modified oligonucleotides. Certain modified oligonucleotides have one or more chiral centers, thus resulting in enantiomers, diastereoisomers, and other stereoisomer configurations that can be defined in terms of absolute stereochemistry, such as (R) or (S), α or β for sugar anomers, or (D) or (L) for amino acids. The modified oligonucleotides provided herein include all such conceivable isomers, including their racemates and optically pure forms, unless otherwise specified. Similarly, all cis and trans isomers, as well as tautomers, are also included.

[0181] Specific mechanisms In certain embodiments, the compounds described herein include or consist of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, such antisense compounds include oligomeric compounds. In certain embodiments, the compounds described herein can hybridize to a target nucleic acid to yield at least one antisense activity. In certain embodiments, the compounds described herein selectively affect one or more target nucleic acids. Such selective compounds include nucleic acid sequences that hybridize to one or more target nucleic acids to yield one or more desired antisense activities, and do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids to yield a substantial amount of undesirable antisense activity.

[0182] In certain antisense activities, when the compounds described herein hybridize to a target nucleic acid, proteins that cleave the target nucleic acid are recruited. For example, certain compounds described herein result in ribonuclease H-mediated cleavage of the target nucleic acid. Ribonuclease H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA double helix. The DNA in such an RNA:DNA double helix does not need to be unmodified DNA. In certain embodiments, the compounds described herein are sufficiently "DNA-like" to induce ribonuclease H activity. Furthermore, in certain embodiments, one or more non-DNA-like nucleosides are tolerated within the gap of the gapmer.

[0183] In certain antisense activities, the compounds described herein, or portions thereof, are incorporated into the RNA-induced silencing complex (RISC), ultimately leading to the cleavage of the target nucleic acid. For example, certain compounds described herein result in the cleavage of the target nucleic acid by Argonaut. The compounds incorporated into the RISC are RNAi compounds. The RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

[0184] In certain embodiments, when the compounds described herein hybridize to a target nucleic acid, proteins that cleave the target nucleic acid are not recruited. In such certain embodiments, when the compounds hybridize to a target nucleic acid, the splicing of the target nucleic acid is modified. In certain embodiments, when the compounds hybridize to a target nucleic acid, binding interactions between the target nucleic acid and proteins or other nucleic acids are inhibited. In such certain embodiments, when the compounds hybridize to a target nucleic acid, the translation of the target nucleic acid is modified.

[0185] Antisense activity may be observed directly or indirectly. In certain embodiments, observation or detection of antisense activity includes observing or detecting changes in the amount of target nucleic acid or protein encoded by such target nucleic acid, changes in the ratio of splice variants of nucleic acid or protein, and / or changes in phenotype in cells or animals.

[0186] Target nucleic acid, target region, and nucleotide sequence In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide containing a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In such certain embodiments, the target nucleic acid is selected from mRNA and premRNA, including introns, exons, and untranslated regions. In certain embodiments, the target nucleic acid is premRNA. In such certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0187] The human gene sequence encoding SCN2A has been documented in the Art (HGNC:10588;Entrez Gene:6326;Ensembl:ENSG00000136531;OMIM:182390;UniProtKB:Q99250). Therefore, SCN2A mRNA transcripts, including premRNA, can be called SCN2A mRNA or NAV1.2 mRNA. SCN2A mRNA includes not only the sequence encoding, for example, GenBank NP_066287.2 (e.g., GenBank NM_021007.2, GI:93141209), but also other mRNA splice / transcript variants (e.g., GenBank accession number:NM_001040143.1, GI:93141213;NM_001040142.1, GI:93141211; or other known variants). Therefore, SCN2A mRNA transcripts, including premRNA, can be called SCN2A mRNA or NAV2.1 mRNA.

[0188] The human gene sequence encoding SCN1A has been described in the art (HGNC:10585;Entrez Gene 6323;Ensembl:ENSG00000144285;OMIM:182389;UniProtKB:P35498). Therefore, the mRNA transcript of SCN1A, including the premRNA, can be called SCN1A mRNA or NAV1.1 mRNA.

[0189] Hybridization In some embodiments, hybridization occurs between the compounds disclosed herein and SCN2A nucleic acids. The most common hybridization mechanism involves hydrogen bonding between complementary nucleic acid bases of the nucleic acid molecule (e.g., Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding).

[0190] Hybridization can occur under a variety of conditions. Hybridization conditions are sequence-dependent and are determined by the properties and composition of the nucleic acid molecules being hybridized.

[0191] Methods for determining whether a sequence can specifically hybridize to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein can specifically hybridize to the SCN2A nucleic acid.

[0192] Complementarity An oligonucleotide is said to be complementary to another nucleic acid if, when two nucleic acid base sequences are aligned in opposite directions, the nucleic acid base sequence of one or more regions of such oligonucleotide or nucleic acid matches the nucleic acid base sequence of one or more regions of another oligonucleotide or nucleic acid. Nucleic acid base matches or complementary nucleic acid bases, as described herein, are limited to adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G), unless otherwise specified. Complementary oligonucleotides and / or nucleic acids do not need to have nucleic acid base complementarity at each nucleoside and may contain one or more nucleic acid base mismatches. If such oligonucleotides have nucleic acid base matches at each nucleoside without nucleic acid base mismatches, the oligonucleotides are perfectly complementary or 100% complementary.

[0193] In certain embodiments, the compounds described herein include or consist of modified oligonucleotides. In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, the compounds include oligomeric compounds. Non-complementary nucleic acid bases between the compound and the SCN2A nucleic acid may be acceptable if the compound can hybridize specifically to the target nucleic acid as is. Furthermore, the compound can hybridize across one or more segments of the SCN2A nucleic acid (e.g., loop structures, mismatches, or hairpin structures) such that intervening or adjacent segments do not participate in the hybridization event.

[0194] In certain embodiments, the compounds or specific portions thereof provided herein are at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to the SCN2A nucleic acid, target region, target segment, or specific portion thereof. The percentage of compound complementarity to the target nucleic acid can be determined using conventional methods.

[0195] For example, if 18 of the 20 nucleic acid bases in a compound are complementary to the target region and therefore specifically hybridize, then there will be 90 percent complementarity. In this example, the remaining non-complementary nucleic acid bases may be clustered or have complementary nucleic acid bases scattered among them, and do not need to be contiguous with each other or with complementary nucleic acid bases. Therefore, a compound with an 18-nucleotide length having two regions that are perfectly complementary to the target nucleic acid and four adjacent non-complementary nucleic acid bases will have 77.8% total complementarity to the target nucleic acid and will therefore be included within the scope of the present invention. The percentage of complementarity between a compound and a target nucleic acid region can conventionally be determined using BLAST (Basic Local Alignment Search Tool) and PowerBLAST programs (Altschul et al., J.Mol.Biol., 1990, 215, 403, 410; Zhang and Madden, Genome Res., 1997, 7, 649, 656), which are known in the art. The percentage of homology, sequence identity, or sequence complementarity can be determined, for example, using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix®, Genetics Computer Group, University Research Park, Madison) which employs the Smith and Waterman algorithm (Adv.Appl.Math., 1981, 2, 482, 489). This can be determined using the default settings (Wis.).

[0196] In certain embodiments, the compounds or specific portions thereof described herein are fully complementary (i.e., 100% complementary) to the target nucleic acid or specific portion thereof. For example, a compound may be fully complementary to the SCN2A nucleic acid, or its target region, target segment, or target sequence. As used herein, “fully complementary” means that each nucleic acid base of the compound can precisely base-pair with the corresponding nucleic acid base of the target nucleic acid. For example, a 20-nucleotide compound is fully complementary to a 400-nucleotide target sequence, provided that there is a corresponding 20-nucleotide portion of the target nucleic acid that is fully complementary to the compound. Fully complementary can also be used with respect to specific portions of a first and / or second nucleic acid. For example, a 20-nucleotide portion of a 30-nucleotide compound may be “fully complementary” to a 400-nucleotide target sequence. A 20-nucleotide portion of a 30-nucleotide compound is fully complementary to the target sequence if the target sequence has a corresponding 20-nucleotide portion (where each nucleic acid base is complementary to the 20-nucleotide portion of the compound). At the same time, the entire 30-nucleotide compound may or may not be perfectly complementary to the target sequence, depending on whether the remaining 10 nucleotides of the compound are also complementary to the target sequence.

[0197] In certain embodiments, the compounds described herein contain one or more mismatched nucleic acid bases relative to the target nucleic acid. In such certain embodiments, such mismatches reduce antisense activity against the target, but more significantly reduce activity against non-targets. Thus, in such certain embodiments, the selectivity of the compound is improved. In certain embodiments, the mismatches are specifically located within oligonucleotides having a gapmer motif. In such certain embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In such certain embodiments, the mismatches are located at positions 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3' end of the gap region. In such certain embodiments, the mismatches are located at positions 1, 2, 3, or 4 from the 5' end of the wing region. In such certain embodiments, the mismatches are located at positions 4, 3, 2, or 1 from the 3' end of the wing region. In certain embodiments, the mismatches are specifically located within oligonucleotides that do not have a gapmer motif. In such specific embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In such specific embodiments, the mismatch is located at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

[0198] The location of the non-complementary nucleic acid base may be at the 5' end or the 3' end of the compound. Alternatively, the non-complementary nucleic acid base(s) may be located internally within the compound. If two or more non-complementary nucleic acid bases are present, they may be contiguous (i.e., bonded) or discontinuous. In one embodiment, the non-complementary nucleic acid bases are located within the wing segment of the gapmer oligonucleotide.

[0199] In certain embodiments, the compounds described herein having a nucleic acid base length of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, comprise four or fewer, three or fewer, two or fewer, or one or fewer non-complementary nucleic acid bases with respect to a target nucleic acid or a specific portion thereof, such as SCN2A nucleic acid.

[0200] In certain embodiments, the compounds described herein, having a nucleic acid base length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, or up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, comprise six or fewer, five or fewer, four or fewer, three or fewer, two or fewer, or one or fewer non-complementary nucleic acid bases with respect to a target nucleic acid or a specific portion thereof, such as SCN2A nucleic acid.

[0201] In certain embodiments, the compounds described herein include those complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a predetermined number of consecutive (i.e., bound) nucleic acid bases within a region or segment of a target nucleic acid. “Portion” may also refer to a predetermined number of consecutive nucleic acid bases of a compound. In certain embodiments, the compound is complementary to at least eight nucleic acid base portions of a target segment. In certain embodiments, the compound is complementary to at least nine nucleic acid base portions of a target segment. In certain embodiments, the compound is complementary to at least ten nucleic acid base portions of a target segment. In certain embodiments, the compound is complementary to at least eleven nucleic acid base portions of a target segment. In certain embodiments, the compound is complementary to at least twelve nucleic acid base portions of a target segment. In certain embodiments, the compound is complementary to at least thirteen nucleic acid base portions of a target segment. In certain embodiments, the compound is complementary to at least fourteen nucleic acid base portions of a target segment. In certain embodiments, the compound is complementary to at least fifteen nucleic acid base portions of a target segment. In certain embodiments, the compound is complementary to at least 16 nucleic acid base portions of a target segment. Compounds complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleic acid base portions or more of a target segment, or a range defined by any two of these values, are also intended.

[0202] identity The compounds provided herein may also have a predetermined percentage of identity (%) with a compound represented by a specific nucleotide sequence, sequence number, or Isis number, or a portion thereof. In certain embodiments, the compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, the compounds described herein are modified oligonucleotides. When used herein, a compound is identical to a sequence disclosed herein if it has the same nucleic acid base pairing ability. For example, since both uracil and thymidine pair with adenine, an RNA containing uracil instead of thymidine in a disclosed DNA sequence will be considered identical to that DNA sequence. Shortened and extended forms of the compounds described herein, as well as compounds having non-identical bases to the compounds provided herein, are also intended. Non-identical bases may be adjacent to each other or dispersed throughout the compound. The percentage of identity (%) of a compound is calculated according to the number of bases that have the same base pairing with the sequence being compared.

[0203] In certain embodiments, a compound or portion thereof described herein is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more compounds or sequence numbers or portions thereof disclosed herein. In certain embodiments, a compound or portion thereof described herein is identical to a compound or portion thereof represented by a particular nucleotide sequence, sequence number, or particular Isis number to about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or any percentage between such values, wherein the compound comprises an oligonucleotide having one or more mismatched nucleic acid bases. In such specific embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In such specific embodiments, the mismatch is located at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.

[0204] In certain embodiments, the compounds described herein are antisense compounds. In certain embodiments, a portion of the compound is compared to an isolength portion of a target nucleic acid. In certain embodiments, the 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleic acid base portions are compared to an isolength portion of a target nucleic acid.

[0205] In certain embodiments, the compounds described herein are oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared to an isolength portion of the target nucleic acid. In certain embodiments, the 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleic acid base portions are compared to an isolength portion of the target nucleic acid.

[0206] Specific modified compounds In certain embodiments, the compounds described herein include or consist of an oligonucleotide comprising a bound nucleoside. The oligonucleotide may be an unmodified oligonucleotide (RNA or DNA) or a modified oligonucleotide. The modified oligonucleotide includes at least one modification to the unmodified RNA or DNA (i.e., at least one modified nucleoside (including a modified sugar moiety and / or a modified nucleic acid base) and / or at least one modified nucleoside bond).

[0207] A. Modified nucleosides Modified nucleosides contain either a modified sugar moiety, a modified nucleic acid base, or both.

[0208] 1. Modified sugar moiety In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar substitute. Such a sugar substitute may include one or more substitutions corresponding to substitutions of other types of modified sugar moieties.

[0209] In certain embodiments, the modified sugar moiety is an acyclic modified sugar moiety comprising a furanosyl ring having one or more acyclic substituents, including (but not limited to) substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more acyclic substituents of the acyclic modified sugar moiety are branched. Examples of 2'- substituents suitable for the acyclic modified sugar moiety include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'- substituents are halo, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1~C 10 Alkoxy, O-C1~C 10 Substitutive alkoxy, O-C1~C 10 Alkyl, O-C1~C 10 Substitutive alkyl, S-alkyl, N(R m)-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, O-alkaryl, O-arylalkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n (where each R m and R n is independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 alkyl), and are selected from among the 2'-substituents described in Cook et al., U.S. 6,531,584; Cook et al., U.S. 5,859,221; and Cook et al., U.S. 6,005,087. Specific embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for the linear acyclic modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO2015 / 106128. Examples of suitable 5'-substituents for the acyclic modified sugar moiety include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the acyclic modified sugar includes two or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0210] In certain embodiments, 2'-substituted nucleosides or 2'-non-bicyclic modified nucleosides are F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(R m )(R n ))(In the formula, each R m and R n These are independently H, an amino protecting group, or substituted or unsubstituted C1-C1. 10 It contains a sugar moiety comprising a linear 2'-substituted group selected from alkyl groups.

[0211] In certain embodiments, the 2'-substituted nucleoside or 2'-non-bicyclic modified nucleoside comprises a sugar moiety containing a linear 2'-substituted selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0212] In certain embodiments, the 2'-substituted nucleoside or 2'-non-bicyclic modified nucleoside comprises a sugar moiety containing a linear 2'-substituted selected from F, OCH3, and OCH2CH2OCH3.

[0213] Nucleosides containing modified sugar moieties, such as non-bicyclic modified sugar moieties, are referred to by the position(s) of the substitution(s) in the sugar moiety of the nucleoside. For example, nucleosides containing 2'-substituted or 2-modified sugar moieties are called 2'-substituted nucleosides or 2-modified nucleosides.

[0214] Certain modified sugar moieties include bridging sugar substituents that form a second ring, resulting in a bicyclic sugar moiety. In such specific embodiments, the bicyclic sugar moiety includes a bridge between the 4'-furanose ring atom and the 2'-furanose ring atom. Examples of such 4'-to-2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "restricted ethyl" or "cEt" when in the S configuration), and 4'-CH 2- O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)O-2' ("restricted MOE" or "cMOE") and their analogues (see, e.g., Seth et al., US7,399,845, Bhat et al., US7,569,686, Swayze et al., US7,741,457, and Swayze et al., US8,022,193), 4'-C(CH3)(CH3)-O-2' and its analogues (see, e.g., Seth et al., US8,278,283), 4'-CH2-N(OCH3)-2' and its analogues (see, e.g., Prakash et al., US8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al. See al., US7, 696, 345 and Allerson et al., US8, 124, 745), 4'-CH2-C(H)(CH3)-2' (see, for example, Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C-(=CH2)-2', and its analogues (see, for example, Seth et al., US8, 278, 426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2' (wherein each R, R a , and R bThese are independently H, protecting groups, or C1-C 12 Examples include, but are not limited to, alkyl groups (see, for example, Imanishi et al., US7, 427, 672).

[0215] In certain embodiments, such 4'-to-2' crosslinking independently comprises 1 to 4 bonding groups independently selected from:- C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-,-C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(= O) x- , and -N(R a )-; (In the formula, x is 0, 1, or 2. n is 1, 2, 3, or 4. Each R a and R b These are independently H, protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2~C 12 Alkenyl substitution C2~C 12 Alkenyl, C2~C 12 Alkinyl substitution C2~C 12 Alkinyl, C5~C 20 Aryl substitution C5~C 20 Aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); each J1 and J2 independently consists of H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2~C12 Alkenyl substitution C2~C 12 Alkenyl, C2~C 12 Alkinyl substitution C2~C 12 Alkinyl, C5~C 20 Aryl substitution C5~C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic group, substituted heterocyclic group, C1~C 12 Aminoalkyl, substituted C1-C 12 (An aminoalkyl group, or a protecting group).

[0216] The quantitative quantity of nucleic acids is given in the following table:Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443;Albaek et al.,J.Org.Chem.,2006,71,7731-7740;Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,20017,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,2,558-561;Braasch et al al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;Wengel et al.,US7,053,207; et al.,USRE44,779;Wengel et al.,US6,794,499;Wengel et al.,US6,670,461;Wengel et al.,US7,034,133;Wengel et al.,US8,080,644;Wengel et al.,US8,034,909; al.,US8,153,365;Wengel et al.,US7,572,582;and to Ramasamy et al.,US6,525,191;Torsten et al.,WO 2004 / 106356;Wengel et al.,WO91999 / 014226;Seth et al.See also WO2007 / 134181; Seth et al., US7,547,684; Seth et al., US7,666,854; Seth et al., US8,088,746; Seth et al., US7,750,131; Seth et al., US8,030,467; Seth et al., US8,268,980; Seth et al., US8,546,556; Seth et al., US8,530,640; Migawa et al., US9,012,421; Seth et al., US8,501,805; and the published US patent applications Allerson et al., US2008 / 0039618 and Migawa et al., US2015 / 0191727.

[0217] In certain embodiments, the bicyclic sugar moiety and the nucleoside incorporating such a bicyclic sugar moiety are further defined by their isomer configuration. For example, the LNA nucleoside (as described herein) may be in an α-L configuration or a β-D configuration. [ka]

[0218] α-L-methyleneoxy(4'-CH2-O-2') or α-L-LNA bicyclic nucleosides were incorporated into oligonucleotides and exhibited antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomer configurations. Where the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is identified in the exemplary embodiments herein, they are in the β-D configuration unless otherwise specified.

[0219] In certain embodiments, the modified sugar moiety comprises one or more non-crosslinked sugar substituents and one or more crosslinked sugar substituents (e.g., 5'-substituted and 4'-2' crosslinked sugars).

[0220] In certain embodiments, the modified sugar moiety is a sugar substitute. In such certain embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In such certain embodiments, such modified sugar moiety also includes crosslinked and / or non-crosslinked substituents as described herein. For example, certain sugar substitutes include substitutions at the 4'-sulfur atom and at the 2' position (see, e.g., Bhat et al., US7,875,733 and Bhat et al., US7,939,677) and / or at the 5' position.

[0221] In certain embodiments, the sugar substitute comprises a ring having more than five atoms. For example, in certain embodiments, the sugar substitute comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acids ("HNA"), anitol nucleic acids ("ANA"), mannitol nucleic acids ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] (See "F-HNA," e.g., Swayze et al., US8,088,904; Swayze et al., US8,440,803; Swayze et al.; and Swayze et al., US9,005,906; F-HNA can also be called F-THP or 3'-fluorotetrahydropyran), and nucleosides containing further modified THP compounds of the following formula: [ka] (In the formula, independently for each of the modified THP nucleosides: Bx is the nucleic acid base portion; T3 and T4 are independently nucleoside-binding groups that bind the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is a nucleoside-binding group that binds the modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a bound conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are Each is independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each of J1, J2, and J3 is independently H or C1-C6 alkyl).

[0222] In certain embodiments, modified THP nucleosides are provided in which q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided in which one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0223] In certain embodiments, the sugar substitute comprises a ring having six or more atoms and two or more heteroatoms. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US5, 698, 685; Summerton et al., US5, 166, 315; Summerton et al., US5, 185, 444; and Summerton et al., US5, 034, 506). As used herein, the term "morpholino" refers to a sugar substitute having the following structure:

[0224] [ka] In certain embodiments, morpholino may be modified, for example, by adding various substituents to the morpholino structure or by altering the substituents from the structure. Such sugar substitutes are referred to herein as “modified morpholino”.

[0225] In certain embodiments, the sugar substitute includes an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar substitutes include, but are not limited to, peptide nucleic acids ("PNA"), acyclic butyl nucleic acids (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.

[0226] Many other bicyclic and tricyclic sugars, as well as sugar substitutes, with cyclic systems that can be used in modified nucleosides are known in the art.

[0227] 2. Modified nucleic acid bases Modifications or substitutions of nucleic acid bases (or bases) are structurally distinguishable from naturally occurring or synthetically unmodified nucleic acid bases, but are also functionally interchangeable. Both natural and modified nucleic acid bases can participate in hydrogen bonding. Such nucleic acid base modifications can confer nuclease stability, binding affinity, or several other beneficial biological properties to the compounds described herein.

[0228] In certain embodiments, the compounds described herein include modified oligonucleotides. In certain embodiments, the modified oligonucleotide includes one or more nucleosides containing unmodified nucleic acid bases. In certain embodiments, the modified oligonucleotide includes one or more nucleosides containing modified nucleic acid bases. In certain embodiments, the modified oligonucleotide includes one or more nucleosides that do not contain nucleic acid bases, called debased nucleosides.

[0229] In certain embodiments, the modified nucleic acid base is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In certain embodiments, the modified nucleic acid bases are 2-aminopropyladenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl(C≡C-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azocymine, 5-ribosyluracil (pseudracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-az, and Other 8-substituted purines, 5-halos, in particular 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, universal bases, hydrophobic bases, eclectic bases, size-expanded bases, and fluorinated bases are selected. Further modified nucleic acid bases include tricyclic pyrimidines, such as 1,3-diazaphenoxadin-2-one, 1,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxadin-2-one (G-clamp). Modified nucleic acid bases may also include those in which a purine or pyrimidine base is replaced with another heterocyclic base, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further examples of nucleic acid bases include those disclosed in Merigan et al., US3, 687, 808; The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0230] The efficiency of the thermal conductivity of the manufacturer was compared with the specificity of the manufacturing process and Manoharan et al.,US2003 / 0158403、Manoharan et al.,US2003 / 0175906;Dinh et al.,US4,845,205;Spielvogel et al.,US5,130,302;Rogers et al.,US5,134,066;Bischofberger et al al.,US5,175,273;Urdea et al.,US5,367,066;Benner et al.,US5,432,272;Matteucci et al.,US5,434,257;Gmeiner et al.,US5,457,187;Cook et al.,US5,459,255;Froehler et al al.,US5,484,908;Matteucci et al.,US5,502,177;Hawkins et al.,US5,525,711;Haralambidis et al.,US5,552,540;Cook et al.,US5,587,469;Froehler et al.,US5,594,121;Switzer et al al.,US5,596,091;Cook et al.,US5,614,617;Froehler et al.,US5,645,985;Cook et al.,US5,681,941; al.,US5,948,903;Cook et al.,US5,587,470;Cook et al.,US5,457,191;Matteucci et al.,US5,763,588;Froehler et al.,US5,830,653;Cook et al.,US5,808,027;Cook et al al.,6,166,199;also available in Matteucci et al.,US6,005,096;

[0231] In certain embodiments, the compound targeted to the SCN2A nucleic acid comprises one or more modified nucleic acid bases. In certain embodiments, the modified nucleic acid base is 5-methylcytosine. In certain embodiments, each cytosine is 5-methylcytosine.

[0232] Inter-modified nucleoside bonding The naturally occurring nucleoside bond in RNA and DNA is a 3'-to-5' phosphodiester bond. In certain embodiments, compounds described herein having one or more modified (i.e., non-naturally occurring) nucleoside bonds are often preferred over compounds with naturally occurring nucleoside bonds for desirable properties such as enhanced cellular uptake, enhanced affinity for nucleic acid targets, and increased stability in the presence of nucleases.

[0233] In certain embodiments, the compound targeted to the SCN2A nucleic acid contains one or more modified nucleoside bonds. In certain embodiments, the modified nucleoside bonds are phosphorothioate bonds. In certain embodiments, each nucleoside bond of the compound is a phosphorothioate nucleoside bond.

[0234] In certain embodiments, the compounds described herein include oligonucleotides. Oligonucleotides having modified nucleoside bonds include not only nucleoside bonds that retain a phosphorus atom, but also nucleoside bonds that do not contain a phosphorus atom. Typical phosphorus-containing nucleoside bonds include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing bonds are well known.

[0235] In certain embodiments, the nucleosides of modified oligonucleotides may be joined together using any internucleoside bond. The two main classes of internucleoside bond groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside bonds include, but are not limited to, phosphates, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S") and phosphorodithioates ("HS-P=S") containing phosphodiester bonds ("P=O") (also called unmodified or naturally occurring bonds). Representative non-phosphorus-containing nucleoside bonds include, but are not limited to, methylene methylimino (-CH2-N(CH3)-O-CH2-), thiodiesters, thionocarbamates (-OC(=O)(NH)-S-), siloxanes (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified nucleoside bonds can be used to alter (usually increase) the nuclease resistance of oligonucleotides compared to natural phosphate bonds. In certain embodiments, nucleoside bonds having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Representative chiral nucleoside bonds include, but are not limited to, alkylphosphonates and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing nucleoside bonds are well known to those skilled in the art.

[0236] Examples of neutral nucleoside interbonding include, but are not limited to, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Further examples of neutral nucleoside bonds include nonionic bonds, such as siloxanes (dialkylsiloxanes), carboxylic acid esters, carboxamides, sulfides, sulfonic acid esters, and amides (see, for example, Carbohydrate Modifications in Antisense Research; YSSanghvi and PDCook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further examples of neutral nucleoside bonds include nonionic bonds containing mixed N, O, S, and CH2 component moieties.

[0237] In certain embodiments, the oligonucleotide includes modified nucleoside bonds arranged along the oligonucleotide or its region in a predetermined pattern or modified nucleoside bond motif. In certain embodiments, the nucleoside bonds are arranged in a gapped motif. In such embodiments, the nucleoside bonds in each of the two wing regions are different from the nucleoside bonds in the gap region. In certain embodiments, the nucleoside bonds in the wings are phosphodiesters, and the nucleoside bonds in the gap are phosphorothioates. Since the nucleoside motifs are independently selected, such oligonucleotides having a gapped nucleoside bond motif may or may not have the gapped nucleoside motif, and if the gapped nucleoside motif is present, the wing length and the gap length may or may not be the same.

[0238] In certain embodiments, the oligonucleotide comprises a region having alternating nucleoside-to-nucleoside bonding motifs. In certain embodiments, the oligonucleotide of the present invention comprises a region of uniformly modified nucleoside-to-nucleoside bonding. In such certain embodiments, the oligonucleotide comprises a region uniformly bonded by phosphorothioate nucleoside-to-nucleoside bonding. In certain embodiments, the oligonucleotide is uniformly bonded by phosphorothioates. In certain embodiments, each nucleoside-to-nucleoside bond of the oligonucleotide is selected from phosphodiesters and phosphorothioates. In certain embodiments, each nucleoside-to-nucleoside bond of the oligonucleotide is selected from phosphodiesters and phosphorothioates, and at least one nucleoside-to-nucleoside bond is a phosphorothioate.

[0239] In certain embodiments, the oligonucleotide contains at least six phosphorothioate nucleoside bonds. In certain embodiments, the oligonucleotide contains at least eight phosphorothioate nucleoside bonds. In certain embodiments, the oligonucleotide contains at least ten phosphorothioate nucleoside bonds. In certain embodiments, the oligonucleotide contains at least one block of at least six consecutive phosphorothioate nucleoside bonds. In certain embodiments, the oligonucleotide contains at least one block of at least eight consecutive phosphorothioate nucleoside bonds. In certain embodiments, the oligonucleotide contains at least one block of at least ten consecutive phosphorothioate nucleoside bonds. In certain embodiments, the oligonucleotide contains at least one block of at least twelve consecutive phosphorothioate nucleoside bonds. In such certain embodiments, at least one such block is located at the 3' end of the oligonucleotide. In such certain embodiments, at least one such block is located within three nucleosides from the 3' end of the oligonucleotide.

[0240] In certain embodiments, the oligonucleotide comprises one or more methylphosphonate bonds. In certain embodiments, the oligonucleotide having a gap manucleoside motif comprises a bonding motif containing all phosphorothioate bonds except for one or two methylphosphonate bonds. In certain embodiments, one methylphosphonate bond is located in the central gap of the oligonucleotide having a gap manucleoside motif.

[0241] In certain embodiments, it is desirable to adjust the number of phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds to maintain nuclease resistance. In certain embodiments, it is desirable to adjust the number and position of phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate nucleoside bonds can be reduced and the number of phosphodiester nucleoside bonds can be increased. In certain embodiments, the number of phosphorothioate nucleoside bonds can be reduced and the number of phosphodiester nucleoside bonds can be increased while maintaining nuclease resistance. In certain embodiments, it is desirable to reduce the number of phosphorothioate nucleoside bonds while maintaining nuclease resistance. In certain embodiments, it is desirable to increase the number of phosphodiester nucleoside bonds while maintaining nuclease resistance.

[0242] B. Specific motifs In certain embodiments, the compounds described herein include oligonucleotides. Oligonucleotides may have motifs, such as patterns of unmodified and / or modified sugar moieties, nucleic acid bases, and / or nucleoside bonds. In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides containing modified sugars. In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides containing modified nucleic acid bases. In certain embodiments, a modified oligonucleotide comprises one or more modified nucleoside bonds. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleic acid bases, and / or nucleoside bonds of the modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleic acid bases, and nucleoside bonds are each independent of each other. Thus, a modified oligonucleotide can be represented by its sugar motif, nucleic acid base motif, and / or nucleoside bond motif (as used herein, the nucleic acid base motif represents modifications to the nucleic acid bases independently of the sequence of the nucleic acid bases).

[0243] 1. Specific sugar motifs In certain embodiments, the compounds described herein include oligonucleotides. In certain embodiments, the oligonucleotide includes one or more types of modified sugars and / or unmodified sugar moieties arranged in a predetermined pattern or sugar motif along the oligonucleotide or a region thereof. In some cases, such sugar motifs include, but are not limited to, any of the sugar modifications considered herein.

[0244] In certain embodiments, the modified oligonucleotide includes or comprises a region having a gapmer motif, the gapmer motif including two outer regions or "wings" and a central or inner region or "gap". The three regions of the gapmer motif (5'-wing, gap, and 3'-wing) form a contiguous sequence of nucleosides, where at least a portion of the sugar moieties of each nucleoside in the wings is different from at least a portion of the sugar moieties of the nucleosides in the gap. Specifically, at least the sugar moieties of the nucleosides in each wing closest to the gap (the 3'-side nucleoside of the 5'-wing and the 5'-side nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to each other. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety different from that of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmer).

[0245] In certain embodiments, the gapmer wing contains nucleosides 1 to 5. In certain embodiments, the gapmer wing contains nucleosides 2 to 5. In certain embodiments, the gapmer wing contains nucleosides 3 to 5. In certain embodiments, all nucleosides of the gapmer are modified nucleosides.

[0246] In certain embodiments, the gap of the gapmer contains 7 to 12 nucleosides. In certain embodiments, the gap of the gapmer contains 7 to 10 nucleosides. In certain embodiments, the gap of the gapmer contains 8 to 10 nucleosides. In certain embodiments, the gap of the gapmer contains 10 nucleosides. In certain embodiments, each nucleoside in the gapmer is an unmodified 2'-deoxynucleoside.

[0247] In certain embodiments, the gapmer is a deoxygapmer. In such embodiments, the gap-side nucleoside of each wing / gap junction is an unmodified 2'-deoxynucleoside, and the wing-side nucleoside of each wing / gap junction is a modified nucleoside. In such particular embodiments, each nucleoside of the gap is an unmodified 2'-deoxynucleoside. In such particular embodiments, each nucleoside of each wing is a modified nucleoside.

[0248] In certain embodiments, the modified oligonucleotide has a fully modified sugar motif, where each nucleoside of the modified oligonucleotide contains a modified sugar moiety. In certain embodiments, the modified oligonucleotide includes or consists of a region having a fully modified sugar motif, where each nucleoside of the region contains a modified sugar moiety. In certain embodiments, the modified oligonucleotide includes or consists of a region having a fully modified sugar motif, where each nucleoside within the fully modified region contains the same modified sugar moiety, which is referred to herein as a uniformly modified sugar motif. In certain embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of the uniformly modified oligonucleotide contains the same 2'-modification.

[0249] 2. Specific nucleic acid base motifs In certain embodiments, the compounds described herein include oligonucleotides. In certain embodiments, the oligonucleotide includes modified and / or unmodified nucleobases arranged in a predetermined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine.

[0250] In certain embodiments, the modified oligonucleotide includes a block of modified nucleobases. In such certain embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5' end of the oligonucleotide.

[0251] In certain embodiments, an oligonucleotide having a gapmer motif includes a nucleoside comprising a modified nucleobase. In such certain embodiments, one nucleoside comprising a modified nucleobase is within the central gap of the oligonucleotide having a gapmer motif. In such certain embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynylpyrimidine.

[0252] 3. Specific internucleoside linkage motifs In certain embodiments, the compounds described herein include oligonucleotides. In certain embodiments, the oligonucleotide includes modified and / or unmodified nucleoside bonds arranged in a predetermined pattern or motif along the oligonucleotide or its region. In certain embodiments, each nucleoside bond is essentially a phosphate nucleoside bond (P=O). In certain embodiments, each nucleoside bond of the modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each nucleoside bond of the modified oligonucleotide is independently selected from phosphorothioate and phosphate nucleoside bonds. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all nucleoside bonds within the gap are modified. In such certain embodiments, some or all of the nucleoside bonds within the wings are unmodified phosphate bonds. In certain embodiments, the terminal nucleoside bonds are modified.

[0253] C. Specific modified oligonucleotides In certain embodiments, the compounds described herein include modified oligonucleotides. In certain embodiments, the modifications (sugars, nucleic acid bases, nucleoside bonds) are incorporated into the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is characterized by its modifications, motif, and full length. In certain embodiments, such parameters are independent of each other. Thus, unless otherwise specified, each nucleoside bond of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of the sugar modification. For example, the nucleoside bonds in the wing region of a sugar gapmer may be the same or different from each other, and may be the same or different from the nucleoside bonds in the gap region of the sugar motif. Similarly, such a sugar gapmer oligonucleotide may contain one or more modified nucleic acid bases independently of the gapmer pattern of the sugar modification. Furthermore, in some cases, the oligonucleotide is expressed by its full length or range, and the length or range of lengths of two or more regions (e.g., regions of nucleosides having a specified sugar modification), in which case it may be possible to select a number of oligonucleotides with full length outside the specified range in each range. In such cases, both conditions must be met. For example, in a particular embodiment, the modified oligonucleotide consists of 15 to 20 bonded nucleosides and has a sugar motif consisting of three regions, A, B, and C, where region A consists of 2 to 6 bonded nucleosides having a specified sugar motif, region B consists of 6 to 10 bonded nucleosides having a specified sugar motif, and region C consists of 2 to 6 bonded nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides in which A and C each consist of 6 bonded nucleosides and B consists of 10 bonded nucleosides (even though the number of these nucleosides is permissible within the requirements for A, B, and C). This is because the total length of such an oligonucleotide is 22, which exceeds the upper limit (20) for the total length of modified oligonucleotides.In this specification, if the representation of an oligonucleotide is not described with respect to one or more parameters, such parameters are not limited. Thus, a modified oligonucleotide that is only represented as having a gapmer sugar motif can have any length, internucleoside linkage motif, and nucleobase motif. Unless otherwise indicated, all modifications are independent of the nucleobase sequence.

[0254] Compositions and methods for formulating pharmaceutical compositions The compounds described herein may be mixed with pharmaceutically acceptable active or inactive substances to prepare pharmaceutical compositions or formulations. Compositions and methods for formulating pharmaceutical compositions depend on several criteria including, but not limited to, the route of administration, the degree of the disease, or the dose to be administered.

[0255] In certain embodiments, the present invention provides a pharmaceutical composition comprising one or more compounds or salts thereof. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. In such certain embodiments, the pharmaceutical composition comprises a suitable diluent or carrier that is pharmaceutically acceptable. In certain embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more compounds. In certain embodiments, such a pharmaceutical composition consists of a sterile saline solution and one or more compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises one or more compounds and sterile water. In certain embodiments, the pharmaceutical composition consists of one or more compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises one or more compounds and phosphate-buffered saline (PBS). In certain embodiments, the pharmaceutical composition consists of one or more compounds and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. The compositions and methods for formulating pharmaceutical compositions depend on several criteria, including (but not limited to) the route of administration, the severity of the disease, or the dose to be administered.

[0256] The compounds described herein that are targeted to the SCN2A nucleic acid can be used in pharmaceutical compositions by combining the compounds with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Thus, in one embodiment, the method described herein uses a pharmaceutical composition comprising a compound targeted to the SCN2A nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

[0257] The pharmaceutical compositions comprising the compounds provided herein include any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotides that, when administered to animals, including humans, can (directly or indirectly) provide a biologically active metabolite or residue thereof. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Thus, for example, this disclosure also relates to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents of the compounds. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium salts and potassium salts.

[0258] Prodrugs may include the incorporation of additional nucleosides at one or both ends of a compound that is cleaved in the body by endogenous nucleases to form an active compound.

[0259] In certain embodiments, the compound or composition further comprises a pharmaceutically acceptable carrier or diluent.

[0260] Advantages of a specific embodiment Provided herein are the first methods and compositions for modulating the SCN2A nucleic acid that can treat, delay, prevent, and / or improve SCN1A-related diseases or conditions (e.g., Dravet syndrome) or their physiological markers. In certain embodiments, SCN2A inhibitors (e.g., oligonucleotides targeting the nucleic acid encoding SCN2A) are provided for the first time in subjects having SCN1A-related diseases or conditions (e.g., Dravet syndrome) for reducing seizures, myoclonus or muscle spasms, alleviating gait difficulties, reducing dementia, preventing its onset, or treating it, alleviating speech disorders, reducing hallucinations, or preventing their onset, treating, reducing, or preventing the onset of progressive neurodegeneration, reducing ataxia, or a combination thereof. [Examples]

[0261] Non-exclusive disclosure and incorporation by reference While specific compounds, compositions, and methods described herein have been specifically described according to certain embodiments, the following examples are provided solely to illustrate the compounds described herein and are not intended to limit them. Each of the references cited herein is incorporated herein by reference in its entirety.

[0262] Example 1: SCN2A mRNA was reduced by LNA. LNA was dissolved in sterile distilled water at a concentration of 10 μg / μl and stored at -30°C until use. The sequences of the LNA used are shown in Tables 1 and 2 below. [Table 1] [Table 2]

[0263] Neonatal intraventricular (ICV) injection All studies were conducted in accordance with the Guide for the Care and Use of Laboratory Animals and approved by the Florey Institute Animal Ethics Committee. Pregnant ICR mice carrying offspring heterozygous for the Scn2a R1882Q mutation were generated by Cyagen. The mice were kept in a temperature-controlled room with a 12-hour light-on / off cycle and were given free access to food and fluids.

[0264] Prior to injection, the pups (P2) were visually examined to confirm the presence of milky white spots. Cryoanesthesia was induced by placing the pups in a small plastic container surrounded by crushed ice for 4-5 minutes, and the depth of anesthesia was determined using the pressure response to the fingers and toes. LNA (10 μg / μl) was loaded into a 10 μl syringe (Hamilton) equipped with a 32G needle. The pups' skin surface was sterilized with an 80% ethanol swab, and the injection site was marked with a marker approximately 0.7-1.0 mm lateral to the sagittal suture and 0.7-1.0 mm cranially from the lambda. The needle was inserted 2 mm below the skin surface at an angle perpendicular to the skull surface. 2 μl of LNA (20 μg) was slowly injected into the right ventricle. To allow recovery, the mice were left on a heat block (32 degrees Celsius) for 5-10 minutes until movement was observed. Before returning the pups to their home cages, I rubbed them with bedding straw to minimize the risk of infanticide.

[0265] The right cerebral hemispheres of LNA-treated mice were collected at P15 and P35 and then rapidly frozen in liquid nitrogen. Total RNA was isolated using TRIzol reagent (ThermoFisher Scientific). 1 ml of TRIzol was used per hemisphere for initial homogenization, and RNA isolation was performed according to the manufacturer's protocol. Subsequently, in a 50 μl reaction, up to 20 μg of total RNA per sample was treated with 1 μl of deoxyribonuclease (DNA-free deoxyribonuclease treatment and removal kit; ThermoFisher Scientific) according to the manufacturer's instructions for use, followed by deoxyribonuclease removal using the supplied inactivation reagent (DNA-free deoxyribonuclease treatment and removal kit; ThermoFisher Scientific). To produce cDNA, 500 ng of total RNA per sample was reverse transcribed using M-MLV reverse transcriptase (both Promega) with oligo(dT)15 primers according to the manufacturer's protocol. Next, 20 ng of cDNA per sample was used as a template for quantitative real-time PCR (qRT-PCR). The qRT-PCR reaction mixture was prepared using GoTaq qPCR MasterMix (Promega) according to the manufacturer's instructions, and the reaction was carried out using a ViiA 7 system (ThermoFisher Scientific) MicroAmp Fast-Optical The reaction was performed in a 96-well reaction plate (ThermoFisher Scientific). During qRT-PCR, an initial pre-incubation was performed at 95°C for 10 minutes, followed by 40 amplification cycles (15 seconds at 95°C, 60 seconds at 60°C). Finally, the melting point analysis was performed (15 seconds at 95°C, 60 seconds at 60°C, heating to 95°C at a rate of 0.05°C / sec) to determine the melting temperature of the amplified product. The primer sequences (5'-3') were as follows: TGCTGTGCGGAAATCTGCC (SCN2A forward primer) (SEQ ID NO: 7); CGGATGCTCAAGAGAGACTGG (SCN2A reverse primer) (SEQ ID NO: 8); GAGGTGCTGCTGATGTGC (RPL32 forward primer) (SEQ ID NO: 9); GGCGTTGGGATTGGTGACT (RPL32 reverse primer) (SEQ ID NO: 10). qRT-PCR data were analyzed using QuantStudio Real Time PCR software v1.3 (ThermoFisher Scientific). For quantitative expression analysis, SCN2A expression was normalized relative to the expression of the housekeeping gene RPL32 (2^ΔCT method; Pfafflet al., Nucl. Acids. Res. 29(9):e45, 2001). Then, the normalized SCN2A expression in ASO-treated mice was normalized relative to the SCN2A expression in age-matched untreated controls (2^ΔΔCT).

[0266] All three LNAs (ASO 1, ASO 2, and ASO 3) reduced Scn2a mRNA levels by 2 to 3 times at 13 days post-injection (Figure 1A). Similar reductions were observed in P35 (Figure 1B), indicating that the LNAs are stable in CSF and effective in downregulating Scn2a mRNA for at least one month.

[0267] Example 2: Evaluation of survival rate and SCN2A ASO from seizures in SCN1A heterozygous mice

[0268] background The SCN1A R1407X mouse model (Scn1a RX) closely reflects the features of a major disorder of early-onset severe epilepsy known as Dravet syndrome. Mice that are heterozygous for the R1407X mutation have early death and spontaneous seizures. The Scn1a gene encodes the voltage-gated sodium channel, Nav1.1, which is mainly expressed in inhibitory neurons. Electrophysiological analysis has revealed that neurons expressing R1407X cannot maintain high-frequency action potential firing, leading to disinhibition and, as a result, enhanced brain excitability. Therefore, strategies that can reduce general brain hyperexcitability may be useful for the treatment of Dravet syndrome. An important regulator of brain excitability during early development is another voltage-gated sodium channel isoform, Nav1.2, encoded by the SCN2A gene.

[0269] A method to reduce the function of Nav1.2 is to target the SCN2A gene using antisense oligonucleotides (ASO). ASOs are single-stranded DNA / RNA oligonucleotides designed to control the expression of the target gene. An ASO specifically designed to downregulate the mouse SCN1A gene was applied to the SCN1A RX mouse model, and its efficacy was evaluated by survival rate, number of spontaneous seizures, and electroencephalogram (EEG).

[0270] Method Quantitative gene expression analysis (RT-qPCR) Total RNA was isolated from mouse brain tissue using Trizol reagent according to the manufacturer's protocol (Thermofisher, USA). Contaminating genomic DNA was removed by deoxyribonuclease treatment (DNA-free reagent, Ambion / Life Technologies, USA). Mouse (F:TGCTGTGCGGAAATCTGCC (SEQ ID NO: 7), R:CGGATGCTCAAGAGAGACTGG (SEQ ID NO: 8)) SCN2A targeting primers were designed to extend to introns to distinguish between genomic DNA and cDNA amplification. For RT-qPCR, oligo-dT primed cDNA was synthesized from 500 ng of total RNA using Murine Moloney Leukaemia Virus Reverse Transcriptase (Promega, USA). RT-qPCR was performed on a ViiA 7 Real-Time PCR System using GoTaq qPCR master mix (Promega, USA) according to the manufacturer's protocol. Relative gene expression levels were obtained by normalizing against the reference gene RPL32 using the 2DDCt method.

[0271] Neonatal intraventricular injection SCN1A RX offspring were administered either 5 μg of mouse SCN2A antisense oligonucleotide (mScn2a ASO) or 50 μg of scrambled ASO (a negative control) via the intraventricular (icv) pathway on postnatal day (P). The offspring were cryoanesthetic, and then a 32G Hamilton needle loaded with ASO was inserted midway between the lambda and the right eye. The injection depth was 2 mm below the skin surface, and a total of 2 μl of mScn2a ASO was administered into the right ventricle.

[0272] Seizure monitoring SCN1A RX mice were housed in groups in home cages and monitored under 24-hour video surveillance from P21 to P28. The video footage was reviewed by two researchers, and seizures with a Racine score of 4 or higher were recorded. The average number of seizures per group was calculated by dividing the total number of seizures per treatment group by the number of mice in the treatment group.

[0273] Electroencephalography (EEG) SCN1A RX mice (P30-35) were anesthetized with 1-3% isoflurane. The mice were placed in a stereotactic device (Kopf) with the skull surface horizontal between the lambda and bregma. Four epidural electrodes were placed on the brain surface and fixed in place with dental cement. The mice were allowed to recover for 4-7 days before EEG recording. Cerebral cortical activity was monitored 24 hours a day (Pinnacle Technology). During recording, the mice were allowed to move freely within the cage and were given free access to food and water.

[0274] result Reduction of Scn2a mRNA by ASO administration mScn2a ASO (5 μg) or scrambled ASO (50 μg) was injected into the right ventricle of Scn1a RX offspring at P1. Scn2a mRNA levels were assessed 14 days after ASO administration. As expected, scrambled ASO did not affect Scn2a mRNA expression. Brains collected from mice treated with mScn2a ASO showed a 78.15 ± 1.87% reduction in Scn2a mRNA levels (Figure 2). The survival rate at P21 was 76.47% in Scn1a RX mice treated with scrambled ASO. No deaths were observed by P21 in Scn1a RX mice treated with mScn2a ASO (Figure 3). Body weight at P21 and P45 was similar for scrambled ASO-treated and mScn2a ASO-treated Scn1a RX mice (Figures 4A-4B). At the experimental endpoint (P45), the survival rates were 29.41% and 94.44% for scrambled ASO and mScn2a ASO, respectively.

[0275] ASO improves the survival rate and seizure phenotype of the Scn1a RX mouse model. Frequent seizures are a debilitating characteristic of Dravet syndrome, and therefore seizure episodes are a crucial marker of therapeutic efficacy. Scn1a RX mice were grouped according to their treatment and kept under 24-hour video surveillance from P21 to P28 (Figure 5). Video was reviewed, and seizures with a Racine score of 4 or higher were recorded. Spontaneous seizures were significantly reduced with 5 μg of mScn2a ASO compared to Scn1a RX mice treated with scrambled ASO.

[0276] The results from this study demonstrated the remarkable therapeutic efficacy of mScn2a ASO in a mouse model of Dravet syndrome. Lifespan was extended and the spontaneous seizure phenotype was significantly improved in the diseased mouse models.

[0277] Example 3: Decreased translation of SCN2A in vitro using SCN2A ASO Human SH-SY5Y cells, which naturally express SCN2A, are maintained and cultured in appropriate cell culture conditions. SH-SY5Y cells are treated with a 20-mer antisense oligonucleotide targeting the SCN2A gene. RNA and protein levels are measured by separate concentration-response and time-course experiments. RNA levels can be measured by Northern blotting, RT-PCR, and / or quantitative PCR analysis. Protein levels are measured by Western blotting analysis.

[0278] Example 4: Treatment of Dravet syndrome by administration of SCN2A ASO Human patients with Dravet syndrome are selected for ASO treatment. A 20-mer antisense oligonucleotide targeting SCN2A mRNA is synthesized, having phosphorothioate bonds throughout and all sugar moieties being 2MOE modified. The ASO is dissolved in appropriate excipients suitable for human administration. A solution containing the dissolved ASO is injected into the patient's nerve cells so that the ASO solution interacts with the affected nerve cells. The ASO is transfected into the nerve cells, altering the translation of SCN2A in the target cells and reducing the SCN2A protein. A quantitative assay (e.g., Western blotting) is performed to measure the reduction in SCN2A protein. Immunohistochemical and immunogold staining are used to directly visualize the reduction of SCN2A in nerve cells. After administration of ASO treatment, patients undergo extensive regular examinations to measure the reduction of symptoms associated with Dravet syndrome.

[0279] Example 5: Prevention of Dravet syndrome by administration of SCN2A ASO Human patients with the SCN1A mutation, a genetic marker for Dravet syndrome, are selected for ASO treatment. A 20-mer antisense oligonucleotide targeting SCN2A mRNA is synthesized, having phosphorothioate bonds throughout and all sugar moieties being 2MOE modified. The ASO is dissolved in appropriate excipients suitable for human administration. A solution containing the dissolved ASO is injected into the patient's nerve cells so that the ASO solution interacts with the affected nerve cells. The ASO is transfected into the nerve cells, altering the translation of SCN2A in the target cells and reducing the SCN2A protein. A quantitative assay (e.g., Western blotting) is performed to measure the reduction in SCN2A protein. Immunohistochemical and immunogold staining are used to directly visualize the reduction of SCN2A in nerve cells. Patients undergo extensive periodic examinations to observe whether there is any development of symptoms associated with the onset of Dravet syndrome after administration of ASO treatment. The present invention provides, for example, the following items: (Item 1) A method for treating SCN1A encephalopathy in a subject requiring treatment for SCN1A encephalopathy, comprising administering to the subject, in an amount and for a period sufficient to treat the SCN1A encephalopathy, a compound comprising a single-stranded oligonucleotide of 10 to 80 nucleosides having a nucleic acid sequence including a 10-consecutive nucleic acid base portion having at least 80% complementarity to an isolength portion of the premRNA transcript or target region of the mRNA transcript of the human SCN2A gene. (Item 2) The method according to item 1, which reduces the expression of the human SCN2A gene. (Item 3) The method according to item 1 or 2, wherein the oligonucleotide comprises a nucleic acid base sequence complementary to a portion of the SCN2A mRNA encoding the amino acid sequence of GenBank accession number NP_066287.2, or comprises the nucleic acid base sequence of GenBank accession number NM_021007.2. (Item 4) The method according to any one of items 1 to 3, wherein the oligonucleotide comprises one or more modified sugars, one or more modified nucleoside bonds, and / or one or more modified nucleic acid bases. (Item 5) The method according to item 4, wherein the oligonucleotide comprises one or more modified sugars. (Item 6) The method according to item 5, wherein each of the one or more modified sugars is independently selected from the group consisting of bicyclic sugars, 2'-O-methoxyethyl (2MOE) modified sugars, 2'-O-methoxy (2-OMe) modified sugars, 2'-methoxy modified sugars, 2'-O-alkyl modified sugars, restricted ethyl (cEt) modified sugars, immobilized sugars, and unimmobilized sugars. (Item 7) The method according to item 6, wherein the oligonucleotide has a 2MOE-modified sugar along its entire length. (Item 8) The method according to any one of items 4 to 7, wherein the oligonucleotide comprises one or more modified nucleoside interbonds. (Item 9) The method according to item 8, wherein one or more of the modified nucleoside bonds comprise a modified phosphate. (Item 10) The method according to item 9, wherein each of the modified phosphates is independently selected from the group consisting of phosphorothioate, phosphorodithioate, phosphoramidate, phosphorodiamidate, thiophosphoroamidate, thiophosphorodiamidate, methylphosphonate, phosphoromololate, and phosphoropiperadate. (Item 11) The method according to item 10, wherein the oligonucleotide has phosphorothioate nucleoside bonds along its entire length. (Item 12) The method according to item 11, wherein the oligonucleotide has a phosphorodiamidate morpholino nucleoside bond along its entire length. (Item 13) The method according to any one of items 4 to 12, wherein the oligonucleotide comprises one or more modified nucleic acid bases. (Item 14) The modified nucleic acid bases are 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propyladenine, 2-propylguanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azocymine, 5-uracil (pseudracil), 4-thiouracil, 8-halouradenine, 8-aminoadenine, 8-thioladeni The method according to item 13, selected from the group consisting of 8-thioalkyladenine, 8-hydroxyladenine, 8-haloguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxylguanine, 5-bromouracil, 5-trifluoromethyluracil, 5-bromocytosine, 5-trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 2-fluoroadenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine. (Item 15) The method according to item 14, wherein the modified nucleic acid base is 5-methylcytosine. (Item 16) The method according to item 15, wherein each cytosine is 5-methylcytosine. (Item 17) The modified oligonucleotide is, A gap segment consisting of a bound deoxynucleoside; A 5' wing segment consisting of a bound nucleoside; and A 3' wing segment consisting of a bound nucleoside; The method according to any one of items 4 to 17, wherein the gap segment is located directly adjacent to the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar. (Item 18) The method according to any one of items 1 to 16, wherein the oligonucleotide consists of 12 to 40 nucleic acid bases. (Item 19) The method according to item 18, wherein the oligonucleotide consists of 16 to 30 nucleic acid bases. (Item 20) The method according to any one of items 1 to 19, comprising inhibiting the expression of SCN2A in the target nerve cells. (Item 21) The method according to any one of items 1 to 20, wherein the SCN1A encephalopathy is selected from the group consisting of epilepsy, generalized epilepsy with febrile seizures, familial febrile seizures, early infantile epileptic encephalopathy6, and Dravet syndrome. (Item 22) The method described in item 21, wherein the aforementioned SCN1A encephalopathy is Dravet syndrome. (Item 23) The method according to any one of items 1 to 22, wherein the compound is administered intrathecally, intramedullarily, or intraventricularly. (Item 24) A method described in any one of items 1-23, wherein a decrease in SCN2A expression results in a therapeutic effect. (Item 25) The method according to any one of items 1 to 24 for reducing one or more symptoms of the aforementioned SCN1A encephalopathy. (Item 26) The method according to item 25, wherein one or more symptoms of the SCN1A encephalopathy are selected from the group consisting of prolonged seizures, frequent seizures, behavioral and developmental delays, motor and balance problems, orthopedic conditions, speech delays and phonation problems, growth and nutrition problems, sleep difficulties, chronic infections, sensory integration disorders, autonomic nervous system disorders, migraines, and sweating. (Item 27) The method according to any one of items 1 to 26, wherein the oligonucleotide is more selective to SCN2A premRNA or mRNA than to SCN1A premRNA or mRNA. (Item 28) A method according to any one of items 1 to 27, which does not substantially reduce SCN1A expression. (Item 29) The method described in any one of items 1 to 28, wherein the subject has a gain-of-function mutation in SCN1A. (Item 30) The method described in any one of items 1 to 29, wherein the subject has a loss-of-function mutation in SCN1A.

Claims

1. A composition for use in reducing seizures in subjects with SCN1A encephalopathy, The compound comprises a single-stranded oligonucleotide of 10 to 80 nucleosides having a nucleic acid sequence that includes a 10-consecutive nucleic acid base portion having at least 95% complementarity to the isolength portion of the premRNA transcript or target region of the mRNA transcript of the human SCN2A gene, wherein the oligonucleotide reduces the expression of the human SCN2A gene, and the SCN1A encephalopathy is selected from the group consisting of epilepsy, generalized epilepsy with febrile seizures, familial febrile seizures, early infantile epileptic encephalopathy, and Dravet syndrome. composition.

2. The composition for use according to claim 1, wherein the oligonucleotide has a nucleic acid base sequence that has 100% complementarity to the isolength portion of the premRNA transcript or target region of the mRNA transcript of the human SCN2A gene.

3. The composition for use according to claim 1, wherein the single-stranded oligonucleotide comprises a nucleic acid sequence complementary to the portion of SCN2A mRNA, which either encodes the amino acid sequence of GenBank accession number NP_066287.2 or includes the nucleic acid sequence of GenBank accession number NM_021007.

2.

4. The composition for use according to claim 1, wherein the single-stranded oligonucleotide comprises one or more modified sugars, one or more modified nucleoside bonds, and / or one or more modified nucleic acid bases.

5. The composition for use according to claim 4, wherein the single-chain oligonucleotide comprises one or more modified sugars.

6. The composition for use according to claim 5, wherein each of the one or more modified sugars is independently selected from the group consisting of bicyclic sugars, 2'-O-methoxyethyl (2MOE) modified sugars, 2'-O-methoxy (2-OMe) modified sugars, 2'-methoxy modified sugars, 2'-O-alkyl modified sugars, restricted ethyl (cEt) modified sugars, immobilized sugars, and unimmobilized sugars.

7. The composition for use according to claim 6, wherein the oligonucleotide has a 2MOE-modified sugar along the entire length of the oligonucleotide.

8. The composition for use according to claim 4, wherein the oligonucleotide comprises one or more modified nucleoside bonds.

9. The composition for use according to claim 8, wherein the one or more modified nucleoside bonds comprise a modified phosphate.

10. The composition for use according to claim 9, wherein each of the modified phosphates is independently selected from the group consisting of phosphorothioate, phosphorodithioate, phosphoramidate, phosphorodiamidate, thiophosphoroamidate, thiophosphorodiamidate, methylphosphonate, phosphoromolate, and phosphoropiperadate.

11. The composition for use according to claim 10, wherein the oligonucleotide has phosphorothioate nucleoside bonds along the entire length of the oligonucleotide.

12. The composition for use according to claim 11, wherein the oligonucleotide has a phosphorodiamidate morpholino nucleoside bond along the entire length of the oligonucleotide.

13. The composition for use according to claim 4, wherein the oligonucleotide comprises one or more modified nucleic acid bases.

14. Each of the one or more modified nucleic acid bases is 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propyladenine, 2-propylguanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azocymine, 5-uracil (pseudracil), 4-thiouracil, 8-haloadenine, 8-aminoadenine, 8-thiolade A composition for use according to claim 13, selected from the group consisting of nin, 8-thioalkyladenine, 8-hydroxyladenine, 8-haloguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxylguanine, 5-bromouracil, 5-trifluoromethyluracil, 5-bromocytosine, 5-trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 2-fluoroadenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

15. The composition for use according to claim 14, wherein at least one modified nucleic acid base is 5-methylcytosine.

16. The composition for use according to claim 15, wherein each cytosine is 5-methylcytosine.

17. The single-stranded oligonucleotide is A gap segment consisting of a bound deoxynucleoside; A 5' wing segment consisting of a bound nucleoside; and A 3' wing segment consisting of a bound nucleoside; The composition for use according to claim 4, comprising, wherein the gap segment is located directly adjacent to the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar.

18. The composition for use according to claim 1, wherein the single-stranded oligonucleotide comprises 12 to 40 nucleic acid bases.

19. The composition for use according to claim 18, wherein the oligonucleotide comprises 16 to 30 nucleic acid bases.

20. The composition for use according to claim 1, wherein the SCN1A encephalopathy is Dravet syndrome.

21. The composition for use according to claim 1, wherein the compound is administered intrathecally, intramedullarily, or intraventricularly.

22. The composition for use according to claim 1, wherein the seizures are mild or result in complete incapacitation.

23. The composition for use according to claim 1, wherein the seizure is selected from the group consisting of prolonged seizures, frequent seizures and spontaneous seizures.

24. A composition for use according to claim 1, which reduces seizures by alleviating physical changes that occur during a seizure, selected from the group consisting of difficulty speaking, difficulty swallowing, drooling, repetitive blinking, staring, lack of movement or muscle tone, worsening of tremors, single contractions or spasms, stiff or tense muscles, repetitive involuntary movements including the face, arms or legs, convulsions, loss of control of urine or feces, sweating, changes in skin color, dilated pupils, tongue biting, difficulty breathing, and palpitations.

25. The composition for use according to claim 1, wherein seizures are reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%.

26. The composition for use according to claim 1, wherein seizures are reduced for at least seven days.

27. The composition for use according to claim 1, wherein the subject has a loss-of-function mutation in SCN1A.

Citation Information

Patent Citations

  • Treatment of SCNA-related diseases by inhibiting natural antisense transcripts targeting sodium channels, voltage-gated α-subunits (SCNAs).

    JP2013535958A

  • Antisense oligomers for the treatment of autosomal dominant mental retardation-5 and Dravet syndrome

    JP2019501892A