RNAi agents, compositions, and methods of use thereof for treating transthyretin (TTR)-related diseases
RNAi agents with specific chemical modifications target the TTR gene to inhibit expression and treat TTR-related diseases by reducing amyloid deposition, providing effective treatment for conditions like senile systemic amyloidosis and familial amyloid cardiomyopathy.
Patent Information
- Application Number
- JP2021114868
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2012-08-06
- Filing Date
- 2021-07-12
- Publication Date
- 2026-04-30
- Estimated Expiration
- 2032-11-16
AI Technical Summary
There is a need for effective treatments for transthyretin (TTR)-related diseases, which are characterized by amyloid deposition due to misfolded TTR proteins, including cardiac amyloidosis, familial polyneuropathy, and familial amyloid cardiomyopathy, as existing treatments are inadequate.
The use of RNAi agents, specifically double-stranded RNAi agents with specific chemical modifications, including alternating patterns and motifs near the cleavage site, to inhibit TTR expression by targeting the TTR gene, thereby reducing amyloid deposition.
The RNAi agents effectively inhibit TTR expression by 10-90% in cells, reducing amyloid deposition and treating or preventing TTR-related diseases such as senile systemic amyloidosis, familial amyloidosis, and familial amyloid cardiomyopathy.
Smart Images

Figure 0007853769000070 
Figure 0007853769000071 
Figure 0007853769000072
Abstract
Description
[Technical Field]
[0001] Related applications This application claims priority to U.S. Provisional Patent Application No. 61 / 561,710 filed November 18, 2011, No. 61 / 615,618 filed March 26, 2012, and No. 61 / 680,098 filed August 6, 2012, all of which are incorporated herein by reference in their entirety.
[0002] Sequence List This application includes a sequence listing submitted in ASCII format via EFS-Web, which is incorporated herein by reference in its entirety. The ASCII copy, created on November 13, 2012, is named 121301WO.txt and has a size of 541,508 bytes. [Background technology]
[0003] Transthyretin (TTR), also known as prealbumin, is present in serum and cerebrospinal fluid (CSF). TTR transports retinol-binding protein (RBP) and thyroxine (T4), and also functions as a carrier of retinol (vitamin A) by binding to RBP in blood and CSF. The name transthyretin derives from its transport (trans) of thyroxine (thy) and retinol (retinol). TTR also functions as a protease and can cleave proteins including apoAI (major HDL apolipoprotein), amyloid-beta peptide, and neuropeptide Y. See Non-Patent Literature 1.
[0004] TTR is a tetramer composed of four identical 127-amino acid subunits (monomers) rich in β-sheet structures. Each monomer has two quadruple-chain β-sheets and a flattened ellipsoid shape. The interaction of the antiparallel β-sheets links the monomers together to form a dimer. The short loops of each monomer form the major dimer-to-dimer interaction. These two pairs of loops separate the opposing convex β-sheets of the dimer to form internal channels.
[0005] The liver is a major site of TTR expression. Other important sites of expression include the choroid plexus, retina (particularly the retinal pigment epithelium), and pancreas.
[0006] Transthyretin is one of at least 27 proteins that are precursor proteins in amyloid fibrils. See Non-Patent Literature 2. Extracellular deposition of amyloid fibrils in organs and tissues is characteristic of amyloidosis. Amyloid fibrils consist of misfolded protein aggregates that can result from the overproduction of precursor proteins or specific mutations in precursor proteins. The amyloid formation potential of TTR may be associated with a broad β-sheet structure; X-ray crystallographic studies have suggested that specific amyloid-forming mutations destabilize the protein's tetrameric structure. See, for example, Non-Patent Literature 3.
[0007] Amyloidosis is a general term for a group of amyloid diseases characterized by amyloid deposition. Amyloid diseases are classified based on their precursor proteins; for example, the names begin with "A" from amyloid, followed by an abbreviation of the precursor protein, such as ATTR, which stands for amloidogenic transthyretin, with "a" from amloidogenic and "t," "t," and "r" from transthyretin. (Same document, same page.)
[0008] Numerous TTR-related diseases exist, most of which are amyloid disorders. TTR with a normal sequence is associated with cardiac amyloidosis in the elderly and is called senile systemic amyloidosis (SSA) (also known as senile cardiac amyloidosis (SCA) or cardiac amyloidosis). SSA is often accompanied by microdeposits in many other organs. TTR amyloidosis manifests in various forms. When it is more pronounced in the peripheral nervous system, the disease is called familial polyneuropathy (FAP). When it mainly affects the heart but not the nervous system, the disease is called familial amyloid cardiomyopathy (FAC). A third major type of TTR amyloidosis is leptomeningeal amyloidosis, also known as leptomeningeal or meningovascular amyloidosis, central nervous system (CNS) amyloidosis, or amyloidosis type VII. Mutations in TTR can also cause amyloid vitreous opacity, carpal tunnel syndrome, and normal-thyroid hyperthyroidism. This normal-thyroid hyperthyroidism is a non-amyloid disorder thought to develop due to increased binding of thyroxine to TTR by mutant TTR molecules with high affinity for thyroidosine. See, for example, Non-Patent Document 4.
[0009] Abnormal amyloid-forming proteins can be hereditary or acquired through somatic mutations. (Non-Patent Literature 2.) Transthyretin-associated ATTR is the most frequent form of hereditary systemic amyloidosis. (Non-Patent Literature 5.) TTR mutations accelerate the process of TTR amyloid formation and are the most important risk factors for the development of ATTR. More than 85 amyloid-forming TTR variants are known to cause systemic familial amyloidosis. TTR mutations usually cause systemic amyloid deposition, particularly in the peripheral nervous system, but some mutations are associated with cardiomyopathy or vitreous opacity. (Same document, same page.)
[0010] The V30M mutation is the most common TTR mutation. See, for example, Non-Patent Document 5. The V122I mutation is carried by 3.9% of the African American population and is the most common cause of FAC. See Non-Patent Document 6. SSA is estimated to affect more than 25% of the population over 80 years of age. See Non-Patent Document 7.
[0011] Therefore, there is a need in this field for effective treatments for TTR-related diseases. [Prior art documents] [Non-patent literature]
[0012] [Non-Patent Document 1] Liz, MAet al. (2010) IUBMB Life,62(6):429-435 [Non-Patent Document 2] Guan,J.et al.(Nov.4,2011)Current perspectives on cardiac amyloidosis,Am J Physiol Heart Circ Physiol,doi:10.1152 / ajpheart.00815.2011 [Non-Patent Document 3] Saraiva MJM(2002)Expert Reviews in Molecular Medicine,4(12):1-11 [Non-Patent Document 4] Moses et al.(1982)J.Clin.Invest.,86,2025-2033 [Non-Patent Document 5] Lobato, L. (2003) J. Nephrol., 16:438-442 [Non-Patent Document 6] Jacobson, DRet al. (1997) N. Engl. J. Med. 336(7):466-73 [Non-Patent Document 7] Westermark, P. et al. (1990) Proc. Natl. Acad. Sci. USA87(7):2843-5 [Overview of the project] [Means for solving the problem]
[0013] The present invention provides RNAi agents, such as double-stranded RNAi agents, that target the transthyretin (TTR) gene. The present invention also provides methods for inhibiting TTR expression and methods for treating or preventing a target TTR-related disease using the RNAi agents of the present invention, such as double-stranded RNAi agents. The present invention is at least in part based on the discovery that RNAi agents having specific chemical modifications exhibit a superior ability to inhibit TTR expression. It is shown herein that agonists having a specific pattern of chemical modifications (e.g., alternating patterns) and ligands are effective in silencing the activity of the TTR gene. Furthermore, agonists comprising one or more motifs consisting of three identical modifications in three consecutive nucleotides, with one such motif located at or near the cleavage site of the agonist, exhibit remarkably strong TTR gene silencing activity. If one such chemical motif is present in the agonist, it is preferable that such chemical motif be located at or near the cleavage site to enhance gene silencing activity. The cleavage region is the region surrounding the cleavage site, i.e., the site in the target mRNA where cleavage occurs.
[0014] Accordingly, in one embodiment, the present invention relates to RNAi agents for inhibiting the expression of transthyretin (TTR), such as double-stranded RNAi agents. A double-stranded RNAi agent comprises a sense strand complementary to an antisense strand. The antisense strand contains a region complementary to a portion of the mRNA encoding transthyretin. Each strand has 14 to 30 nucleotides, and a double-stranded RNAi agent is represented by the following formula: Sense chain: 5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense strand: 3’n p ’-N a ’-(X’X’X’) k -N b ’-Y’Y’Y’-N b ’-(Z’Z’Z’) l -N a ’-n q ’5’ (III).[[ID=@19]] In formula III, i, j, k, and l are each independently 0 or 1; p, p’, q, and q’ are each independently 0 to 6; each N a and N a ’ represents an oligonucleotide sequence containing 0 to 25 nucleotides that are independently modified, unmodified, or a combination thereof, and each sequence contains at least two differently modified nucleotides; each N b and N b ’ represents an oligonucleotide sequence containing 0 to 10 nucleotides that are independently modified, unmodified, or a combination thereof; each n p , n p , n q , and n q ’ each independently represents an overhang nucleotide; XXX, YYY, ZZZ, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif consisting of three identical modifications in three consecutive nucleotides; the modification of N b is different from the modification of Y, and the modification of N b ’ is different from the modification of Y’. In one embodiment, the sense strand is conjugated to at least one ligand, for example, at least one ligand attached to the 3’ end of the sense strand. In other embodiments, the ligand may be conjugated to the antisense strand.
[0015] In some embodiments, i is 1; j is 1; or both i and j are 1.
[0016] In some embodiments, k is 1; l is 1; or both k and l are 1.
[0017] In some embodiments, i is 0 and j is 1.
[0018] In some embodiments, i is 1 and j is 0.
[0019] In some embodiments, k is 0 and l is 1.
[0020] In some embodiments, k is 1 and l is 0.
[0021] In some embodiments, XXX is complementary to X'X'X', YYY is complementary to Y'Y'Y', and ZZZ is complementary to Z'Z'Z'.
[0022] In some embodiments, the YYY motif is located at or near the break site of the sense chain.
[0023] In some embodiments, the Y'Y'Y' motif is located at positions 11, 12, and 13 from the 5' end of the antisense chain.
[0024] In some embodiments, Y' is 2'-O-methyl.
[0025] In some embodiments, Y' is 2'-fluoro.
[0026] In some embodiments, equation (III) is expressed as equation (IIIa): Sense chain: 5'n p -N a -YYY-N b -ZZZ-N a -n q 3' Antisense chain: 3'n p '-N a '-Y'Y'Y'-N b '-Z'Z'Z'-N a 'n q '5' (IIIa). In equation IIIa, each Nb and N b The ' represents an oligonucleotide sequence containing 1 to 5 modified nucleotides independently.
[0027] In some embodiments, equation (III) is expressed as equation (IIIb): Sense chain: 5'n p -N a -XXX-N b -YYY-N a -n q 3' Antisense chain: 3'n p '-N a '-X'X'X'-N b '-Y'Y'Y'-N a '-n q '5' (IIIb). In equation IIIb, each N b and N b The ' represents an oligonucleotide sequence containing 1 to 5 modified nucleotides independently.
[0028] In some embodiments, equation (III) is expressed as equation (IIIc): Sense chain: 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' Antisense chain: 3'n p '-N a '-X'X'X'-N b '-Y'Y'Y'-N b '-Z'Z'Z'-N a '-n q '5' (IIIc). In equation IIIc, each N b and -N b ' independently represents an oligonucleotide sequence containing 1 to 5 modified nucleotides, each N a and N a The ' represents an oligonucleotide sequence containing 2 to 10 modified nucleotides independently.
[0029] In many embodiments, the double-stranded region is 15–30 nucleotide pairs long. In some embodiments, the double-stranded region is 17–23 nucleotide pairs long, 17–25 nucleotide pairs long, 23–27 nucleotide pairs long, 19–21 nucleotide pairs long, or 21–23 nucleotide pairs long.
[0030] In certain embodiments, each chain has 15 to 30 nucleotides.
[0031] In some embodiments, the nucleotide modification is selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof. In some preferred embodiments, the nucleotide modification is 2'-O-methyl or 2'-fluoro.
[0032] In some embodiments, the ligand is one or more N-acetylgalactosamine (GalNAc) derivatives attached by a divalent or trivalent branched linker. In certain embodiments, this ligand is [ka] That is the case.
[0033] In some embodiments, the ligand is attached to the 3' end of the sense chain.
[0034] In some embodiments, the RNAi agent is conjugated to a ligand shown in the following formula: [ka] In the equation, X is either O or S.
[0035] In some embodiments, the RNAi agent is expressed by the following formula [ka] It is conjugated to the ligand shown.
[0036] In some embodiments, the RNAi agent further comprises an internucleotide bond of at least one phosphorothioate or methylphosphonate. In some embodiments, the internucleotide bond of phosphorothioate or methylphosphonate is located at the 3' end of one of the strands. In some embodiments, this strand is an antisense strand. In some embodiments, this strand is a sense strand.
[0037] In certain embodiments, the base pair at position 1 of the 5' end of the double helix is the AU base pair.
[0038] In some embodiments, the Y nucleotide includes a 2'-fluoro modification.
[0039] In some embodiments, the Y' nucleotide includes a 2'-O-methyl modification.
[0040] In some embodiments, p'>0. In some embodiments, each n is complementary to the target mRNA. In other such embodiments, each n is not complementary to the target mRNA. In some embodiments, p, p', q, and q' are 1 to 6. In some preferred embodiments, p'=1 or 2. In some preferred embodiments, p'=2. In some such embodiments, q'=0, p=0, q=0, and the p' overhang nucleotide is complementary to the target mRNA. In other such embodiments, q'=0, p=0, q=0, and the p' overhang nucleotide is not complementary to the target mRNA.
[0041] In some embodiments, the sense strand has a total of 21 nucleotides, and the antisense strand has a total of 23 nucleotides.
[0042] In a particular embodiment, n pThe linkage between them contains a phosphorothioate. In some such embodiments, this n p The linkage between them is a phosphorothioate linkage.
[0043] In some embodiments, the RNAi agent is selected from the group of RNAi agents listed in Table 1.
[0044] In preferred embodiments, the RNAi agent is selected from the group consisting of AD-51544, AD-51545, AD-51546, and AD-51547.
[0045] In a more preferred embodiment, the RNAi agent is AD-51547 having the following structure: Sense chain: 5'-UfgGfgAfuUfuCfAfUfgUfaacCfaAfgAfL96-3'(Sequence ID: 2) Antisense chain: 5'-uCfuUfgGfUfUfaCfaugAfaAfuCfcCfasUfsc-3' (Sequence ID: 3) In the sequence, lowercase nucleotides (a, u, g, c) represent 2'-O-methylnucleotides; Nf (e.g., Af) represents 2'-fluoronucleotides; s represents phosphothiolate linkages; and L96 represents GalNAc3 ligands.
[0046] In another aspect, the present invention relates to cells containing an RNAi agent for inhibiting TTR expression.
[0047] In further embodiments, the present invention relates to pharmaceutical compositions comprising RNAi agents for inhibiting TTR expression. In some embodiments, the pharmaceutical composition is a solution comprising the RNAi agent. In some embodiments, this solution comprising the RNAi agent is a non-buffer, such as saline or water. In other embodiments, this solution is a buffer, such as a solution of phosphate-buffered saline (PBS). In other embodiments, the pharmaceutical composition is a liposome or a lipid formulation. In some embodiments, the lipid formulation comprises XTC or MC3.
[0048] In another embodiment, the present invention relates to a method for inhibiting the expression of transthyretin (TTR) in cells. This method includes the step of contacting cells with an RNAi agent, such as a double-stranded RNAi agent, in an amount effective to inhibit the expression of TTR in the cells, thereby inhibiting the expression of TTR in the cells.
[0049] In some embodiments, TTR expression is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%.
[0050] In other embodiments, cells are brought into contact with the RNAi agent in vitro. In other embodiments, cells are present in the body of the subject. In preferred embodiments, the subject is human.
[0051] In further embodiments, the subjects are those suffering from TTR-related disease, and the effective dose is a therapeutically effective dose. In other embodiments, the subjects are those at risk of developing TTR-related disease, and the effective dose is a prophylactically effective dose. In some embodiments, the subjects at risk of developing TTR-related disease are those with mutations in the TTR gene associated with the development of TTR-related disease.
[0052] In certain embodiments, TTR-related diseases are selected from the group consisting of senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial polyneuropathy (FAP), familial amyloid cardiomyopathy (FAC), leptomeningeal / central nervous system (CNS) amyloidosis, and hyperthyrocinemia.
[0053] In some embodiments, the subject has TTR-associated amyloidosis, and this method reduces amyloid TTR deposition in the subject.
[0054] In other embodiments, the RNAi agent is administered to the subject by a method of administration selected from the group consisting of subcutaneous, intravenous, intramuscular, intratracheal, intrapleural, intraperitoneal, intra-arterial, lymphatic, cerebrospinal, and any combination thereof. In certain embodiments, the RNAi agent is administered to the subject by subcutaneous or intravenous administration. In preferred embodiments, the RNAi agent is administered to the subject by subcutaneous administration. In some such embodiments, subcutaneous administration includes administration by a subcutaneous pump or subcutaneous depot.
[0055] In certain embodiments, the RNAi agent is administered to the subject so as to be delivered to a specific site of the subject. In some embodiments, this site is selected from the group consisting of the liver, choroid plexus, retina, and pancreas. In preferred embodiments, this site is the liver. In some embodiments, the delivery of the RNAi agent is mediated by the asialoglycoprotein receptor (ASGP-R) present in hepatocytes.
[0056] In some embodiments, the RNAi agent is administered in doses ranging from approximately 0.25 mg / kg to approximately 50 mg / kg, for example, approximately 0.25 mg / kg to approximately 0.5 mg / kg, approximately 0.25 mg / kg to approximately 1 mg / kg, approximately 0.25 mg / kg to approximately 5 mg / kg, approximately 0.25 mg / kg to approximately 10 mg / kg, approximately 1 mg / kg to approximately 10 mg / kg, approximately 5 mg / kg to approximately 15 mg / kg, approximately 10 mg / kg to approximately 20 mg / kg, approximately 15 mg / kg to approximately 25 mg / kg, approximately 20 mg / kg to approximately 30 mg / kg, approximately 25 mg / kg to approximately 35 mg / kg, or approximately 40 mg / kg to approximately 50 mg / kg.
[0057] For some applications, RNAi agents are available in doses of approximately 0.25 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, and 24 mg / kg. It is administered in doses of approximately 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, or 50 mg / kg.
[0058] In some embodiments, the RNAi agent is administered in two or more doses. In certain embodiments, the RNAi agent is administered at time intervals selected from the group consisting of approximately every 2 hours, every 3 hours, every 4 hours, every 6 hours, every 8 hours, every 12 hours, every 24 hours, every 48 hours, every 72 hours, every 96 hours, every 120 hours, every 144 hours, every 168 hours, every 240 hours, every 336 hours, every 504 hours, every 672 hours, and every 720 hours.
[0059] In other embodiments, the method further includes the step of evaluating the level of TTR mRNA expression or TTR protein expression in a sample derived from the subject.
[0060] In a preferred embodiment, administration of the RNAi agent does not induce an inflammatory response in the subject, as assessed based on the levels of cytokines or chemokines selected from the group consisting of G-CSF, IFN-γ, IL-10, IL-12(p70), IL-1β, IL-1ra, IL-6, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, TNFα, and any combination thereof, in a sample derived from the subject.
[0061] In some embodiments, the RNAi agent is administered using a pharmaceutical composition.
[0062] In preferred embodiments, the RNAi agent is administered dissolved in a solution. In some embodiments, the siRNA is administered dissolved in a non-buffer solution. In one embodiment, the siRNA is administered dissolved in water. In other embodiments, the siRNA is administered using a buffer, such as acetate buffer, citrate buffer, prolamin buffer, carbonate buffer, phosphate buffer, or any combination thereof. In some embodiments, the buffer is phosphate-buffered saline (PBS).
[0063] In another embodiment, the pharmaceutical composition is a liposome or lipid formulation comprising SNALP or XTC. In one embodiment, the lipid formulation comprises MC3.
[0064] In another aspect, the present invention provides a method for treating or preventing a target TTR-related disease. This method includes the step of administering a therapeutically effective or prophylactically effective amount of an RNAi agent, such as a double-stranded RNAi agent, to a target to treat or prevent a target TTR-related disease.
[0065] In some embodiments, TTR expression in samples derived from the subject is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%.
[0066] In some embodiments, the subject is human.
[0067] In some embodiments, the subjects are individuals suffering from TTR-related diseases. In other embodiments, the subjects are individuals at risk of developing TTR-related diseases.
[0068] In some embodiments, the subjects are individuals who have TTR gene mutations associated with the development of TTR-related diseases.
[0069] In certain embodiments, TTR-related diseases are selected from the group consisting of senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial polyneuropathy (FAP), familial amyloid cardiomyopathy (FAC), leptomeningeal / central nervous system (CNS) amyloidosis, and hyperthyrocinemia.
[0070] In some embodiments, the subject has TTR-associated amyloidosis, and this method reduces amyloid TTR deposition in the subject.
[0071] In some embodiments, the RNAi agent is administered to the subject by a method of administration selected from the group consisting of subcutaneous, intravenous, intramuscular, intratracheal, intrapleural, intraperitoneal, intra-arterial, lymphatic, cerebrospinal, and any combination thereof. In certain embodiments, the RNAi agent is administered to the subject by subcutaneous or intravenous administration. In preferred embodiments, the RNAi agent is administered to the subject by subcutaneous administration. In some embodiments, subcutaneous administration includes administration by a subcutaneous pump or subcutaneous storage unit.
[0072] In certain embodiments, the RNAi agent is administered to the subject so as to be delivered to a specific site of the subject. In some such embodiments, this site is selected from the group consisting of the liver, choroid plexus, retina, and pancreas. In preferred embodiments, this site is the liver. In some embodiments, the delivery of the RNAi agent is mediated by the asialoglycoprotein receptor (ASGP-R) present in hepatocytes.
[0073] In some embodiments, the RNAi agent is administered in doses ranging from approximately 0.25 mg / kg to approximately 50 mg / kg, for example, approximately 0.25 mg / kg to approximately 0.5 mg / kg, approximately 0.25 mg / kg to approximately 1 mg / kg, approximately 0.25 mg / kg to approximately 5 mg / kg, approximately 0.25 mg / kg to approximately 10 mg / kg, approximately 1 mg / kg to approximately 10 mg / kg, approximately 5 mg / kg to approximately 15 mg / kg, approximately 10 mg / kg to approximately 20 mg / kg, approximately 15 mg / kg to approximately 25 mg / kg, approximately 20 mg / kg to approximately 30 mg / kg, approximately 25 mg / kg to approximately 35 mg / kg, or approximately 40 mg / kg to approximately 50 mg / kg.
[0074] For some applications, RNAi agents are available in doses of approximately 0.25 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, and 24 mg / kg. It is administered in doses of approximately 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, or 50 mg / kg.
[0075] In some embodiments, the RNAi agent is administered in two or more doses. In certain embodiments, the RNAi agent is administered at time intervals selected from the group consisting of approximately every 2 hours, every 3 hours, every 4 hours, every 6 hours, every 8 hours, every 12 hours, every 24 hours, every 48 hours, every 72 hours, every 96 hours, every 120 hours, every 144 hours, every 168 hours, every 240 hours, every 336 hours, every 504 hours, every 672 hours, and every 720 hours.
[0076] In other embodiments, the method further includes the step of evaluating the level of TTR mRNA expression or TTR protein expression in a sample derived from the subject.
[0077] In a preferred embodiment, administration of the RNAi agent does not induce an inflammatory response in the subject, as assessed based on the levels of cytokines or chemokines selected from the group consisting of G-CSF, IFN-γ, IL-10, IL-12(p70), IL-1β, IL-1ra, IL-6, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, TNFα, and any combination thereof, in a sample derived from the subject.
[0078] In some embodiments, the RNAi agent is administered using a pharmaceutical composition, such as liposomes.
[0079] In some embodiments, the RNAi agent is administered dissolved in a solution. In some embodiments, the siRNA is administered dissolved in a non-buffer solution. In one embodiment, the siRNA is administered dissolved in physiological saline or water. In other embodiments, the siRNA is administered using a buffer, such as acetate buffer, citrate buffer, prolamin buffer, carbonate buffer, phosphate buffer, or any combination thereof. In some embodiments, the buffer is phosphate-buffered saline (PBS).
[0080] In another embodiment, the present invention provides a method for inhibiting the expression of transthyretin (TTR) in cells, comprising the step of contacting cells with an RNAi agent, such as a double-stranded RNAi agent, in an amount effective to inhibit the expression of TTR in the cells. In one embodiment, the double-stranded RNAi agent is selected from the group of activators listed in Table 1, thereby inhibiting the expression of transthyretin (TTR) in cells.
[0081] In another embodiment, the present invention provides a method for inhibiting the expression of transthyretin (TTR) in cells, comprising the step of contacting cells with an RNAi agent, such as a double-stranded RNAi agent, in an amount effective to inhibit the expression of TTR in cells. In one embodiment, the double-stranded RNAi agent is selected from the group consisting of AD-51544, AD-51545, AD-51546, and AD-51547, thereby inhibiting the expression of transthyretin (TTR) in cells.
[0082] In a further embodiment, the present invention provides a method for treating or preventing a target TTR-related disease, comprising the step of administering a therapeutically effective or prophylactically effective amount of an RNAi agent, such as a double-stranded RNAi agent, to the target. In one embodiment, the double-stranded RNAi agent is selected from the group of activators listed in Table 1, thereby treating or preventing the target TTR-related disease.
[0083] In another embodiment, the present invention provides a method for treating or preventing a target TTR-related disease, comprising the step of administering a therapeutically effective or prophylactically effective amount of an RNAi agent, such as a double-stranded RNAi agent, to the target. In one embodiment, the double-stranded RNAi agent is selected from the group consisting of AD-51544, AD-51545, AD-51546, and AD-51547, thereby treating or preventing the target TTR-related disease.
[0084] In a further embodiment, the present invention provides a kit for carrying out the method of the present invention. In one embodiment, the present invention provides a kit for carrying out a method for inhibiting the expression of transthyretin (TTR) in cells, comprising the step of contacting the cells with an RNAi agent, for example, a double-stranded RNAi agent, in an amount effective to inhibit the expression of TTR in the cells, thereby inhibiting the expression of TTR in the cells. The kit comprises the RNAi agent, instructions for use, and optionally means for administering the RNAi agent to a target.
[0085] The present invention is further illustrated by the following detailed description and drawings. [Brief explanation of the drawing]
[0086] [Figure 1] This graph shows that a single subcutaneous administration of a GalNAc conjugate RNAi agent targeting TTR results in dose-dependent suppression of TTR mRNA in mice. [Figure 2] This graph shows that a single subcutaneous administration of a GalNAc conjugate RNAi agent targeting TTR at a dose of 7.5 mg / kg or 30 mg / kg to mice results in sustained suppression of TTR mRNA. [Figure 3] The sequence of human TTR mRNA is shown. [Figure 4] This graph shows the improved silencing activity of RNAi agents modified against the parent AD-45163. [Figure 5] This graph shows the improved silencing activity of RNAi agents modified against the parent AD-45165. [Figure 6] This graph shows improved free uptake silencing after incubation for 4 hours with an RNAi agent modified against the parent AD-45163. [Figure 7] This graph shows improved free uptake silencing after incubation for 24 hours with an RNAi agent modified against the parent AD-45163. [Figure 8]This graph shows improved free uptake silencing after incubation for 4 hours with an RNAi agent modified against the parent AD-45165. [Figure 9] This graph shows improved free uptake silencing after incubation for 24 hours with an RNAi agent modified against the parent AD-45165. [Figure 10A] This graph shows the silencing of TTR mRNA in transgenic mice expressing hTTR V30M after a single subcutaneous administration of the RNAi agents AD-51544, AD-51545, AD-45163, AD-51546, AD-51547, or AD-45165. [Figure 10B] This graph shows the silencing of TTR mRNA in transgenic mice expressing hTTR V30M after a single subcutaneous administration of the RNAi agents AD-51544, AD-51545, AD-45163, AD-51546, AD-51547, or AD-45165. [Figure 11] This graph shows the suppression of TTR protein in transgenic mice expressing hTTR V30M after a single subcutaneous administration of the RNAi agent AD-51544, AD-51545, or AD-45163 at a dose of 5 mg / kg or 1 mg / kg. [Figure 12] 47, or a graph showing the suppression of TTR protein in transgenic mice expressing hTTR V30M after a single subcutaneous administration of AD-45165. [Figure 13] This shows a protocol for post-administration blood sampling in monkeys that received either 5 mg / kg of RNAi agent five times (upper line) or 25 mg / kg of RNAi agent once (lower line). [Figure 14] These graphs show the suppression of TTR protein in non-human primates after five subcutaneous administrations of 5 mg / kg (upper graph) or 25 mg / kg (lower graph) of AD-45163, AD-51544, AD-51545, AD-51546, or AD-51547. [Figure 15]This graph shows the suppression of TTR protein in non-human primates after subcutaneous administration of AD-51547 at doses of 2.5 mg / kg (white squares), 5 mg / kg (black squares), or 10 mg / kg (patterned squares) per dose, or after administration of PBS (gray squares) as a negative control. [Modes for carrying out the invention]
[0087] The present invention provides RNAi agents, such as double-stranded RNAi agents and compositions, that target the transthyretin (TTR) gene. The present invention also provides methods for inhibiting TTR expression and methods for treating or preventing a target TTR-related disease using the RNAi agents of the present invention, such as double-stranded RNAi agents. The present invention is at least in part based on the discovery that RNAi agents having specific chemical modifications exhibit a superior ability to inhibit TTR expression. It is shown herein that agonists having a specific pattern of chemical modifications (e.g., alternating patterns) and ligands are effective in silencing the activity of the TTR gene. Furthermore, agonists comprising one or more motifs consisting of three identical modifications in three consecutive nucleotides, with one such motif located at or near the cleavage site of the agonist, exhibit remarkably strong TTR gene silencing activity. If one such chemical motif is present in the agonist, it is preferable that such chemical motif be located at or near the cleavage site to enhance the gene silencing activity. The cleavage region is the region surrounding the cleavage site, i.e., the site in the target mRNA where cleavage occurs.
[0088] I. Definition Each of the following terms used herein has the meaning related to the terms in this section.
[0089] As used herein, the word "including" means the phrase "including, but not limited to, ~" and is used interchangeably with this phrase.
[0090] As used herein, the word "or" means "and / or" unless otherwise specified, and is used interchangeably.
[0091] As used herein, “transthyretin” (“TTR”) refers to a well-known gene and protein. TTR is also known as prealbumin, HsT2651, PALB, and TBPA. TTR functions as a transporter for retinol-binding protein (RBP), psychrocin (T4), and retinol, and also acts as a protease. The liver secretes TTR into the bloodstream, and the choroid plexus secretes TTR into the cerebrospinal fluid. TTR is also expressed in the pancreas and retinal pigment epithelium. The greatest clinical relevance of TTR is that both normal and mutant TTR can aggregate to form amyloid fibrils, which are extracellular deposits that cause amyloidosis. For example, see Saraiva MJM (2002) Expert Reviews in Molecular Medicine, 4(12):1-11 for consideration. The molecular cloning, nucleotide sequence, and mRNA expression distribution of rat transthyretin are described in Dickson, P. Wet al. (1985) J. Biol. Chem. 260(13) 8214-8219. The X-ray crystal structure of human TTR is described in Blake, CC et al. (1974) J Mol Biol 88, 1-12. The sequence of human TTR mRNA transcript can be accessed at the National Center for Biotechnology Information (NCBI) using RefSeq accession number: NM_000371. The sequence of mouse TTR mRNA can be accessed using RefSeq accession number: NM_013697.2, and the sequence of rat TTR mRNA can be accessed using RefSeq accession number: NM_012681.1.
[0092] As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a TTR gene, including mRNA, which is the product of RNA processing of the primary transcript.
[0093] As used herein, the term “sequence-containing chain” refers to an oligonucleotide containing the nucleotide chain indicated by this sequence, as referenced using standard nucleotide nomenclature.
[0094] "G," "C," "A," and "U" are abbreviations for nucleotides that generally contain guanine, cytosine, adenine, and uracil as bases, respectively. "T" and "dT" are used interchangeably herein and refer to deoxyribonucleotides whose nucleic acid base is thymidine, e.g., deoxyribothymine, 2'-deoxythymidine, or thymidine. However, it should be understood that the terms "ribonucleotide," "nucleotide," or "deoxyribonucleotide" may also refer to modified nucleotides or surrogate replacement moieties, which will be discussed in detail later. Those skilled in the art will be well aware that guanine, cytosine, adenine, and uracil can be substituted by other moieties without substantially altering the base-pairing properties of oligonucleotides containing such substitution moieties. For example, but not limited to, nucleotides containing inosine as a base can base-pair with nucleotides containing adenine, cytosine, or uracil. Therefore, nucleotides containing uracil, guanine, or adenine can be substituted in the nucleotide sequence of the present invention, for example, with a nucleotide containing inosine. Sequences containing such substitutions are embodiments of the present invention.
[0095] As used interchangeably herein, "double-stranded RNAi agents," also called "dsRNA agents," "siRNA," and "iRNA agents," refer to a complex of ribonucleic acid molecules having a double-strand structure containing two antiparallel and substantially complementary nucleic acid strands, as defined below. Generally, most of the nucleotides in each strand are ribonucleotides, but as described in detail herein, each or both strands may also contain one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. In addition, as used herein, "RNAi agents" may contain chemically modified ribonucleotides; RNAi agents may have a considerable number of modifications to a large number of nucleotides. Such modifications may include all kinds of modifications disclosed herein or known in the art. Any such modifications used on siRNA-type molecules are encompassed by "RNAi agents" for the purposes of this specification and the claims.
[0096] In another embodiment, the RNAi agent may be a single-stranded siRNA introduced into a cell or organ to inhibit a target mRNA. The single-stranded RNAi agent binds to the RISC endonuclease Argonaute 2, which subsequently cleaves the target mRNA. Single-stranded siRNAs are typically 15–30 nucleotides and are chemically modified. Designs and tests of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al., (2012) Cell 150:883–894, respectively, which are incorporated herein by reference. Any antisense nucleotide sequence described herein may be used as a single-stranded siRNA as described herein, or may be chemically modified by the methods described in Lima et al., (2012) Cell 150:883–894.
[0097] The two strands forming a double-stranded structure may be different parts of one larger RNA molecule or separate RNA molecules. If the two strands are part of one larger molecule and are therefore connected by a contiguous chain of nucleotides between the 3' end of one strand and the 5' end of the other, the connecting RNA strands are called a "hairpin loop." If the two strands are covalently connected by means other than a contiguous chain of nucleotides between the 3' end of one strand and the 5' end of the other, this connecting structure is called a "linker." RNA strands may have the same or different numbers of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of dsRNA minus all overhangs present in the double-stranded structure. In addition to the double-stranded structure, RNAi agents may contain one or more nucleotide overhangs. The term "siRNA" as used herein also refers to RNAi agents as described above.
[0098] In another embodiment, the RNAi agent is a single-stranded antisense RNA molecule. The antisense RNA molecule is complementary to a sequence in the target mRNA. The antisense RNA can inhibit translation stoichiometrically by forming base pairs with the mRNA and physically interfering with the translation mechanism. See Dias, N. et al., (2002) Mol Cancer Ther 1:347-355. The antisense RNA molecule may have approximately 15 to 30 nucleotides complementary to the target mRNA. For example, the antisense RNA molecule may have a sequence of at least 15, 16, 17, 18, 19, 20, or more consecutive nucleotides of one antisense sequence in Table 1.
[0099] As used herein, "nucleotide overhang" refers to a nucleotide that does not form a base pair, or a nucleotide that protrudes from the double-stranded structure of an RNAi agent, when the 3' end of one strand of an RNAi agent extends beyond the 5' end of the other strand, or vice versa. "Bluish" or "blunt-ended" means that there are no nucleotides that do not form a base pair at the ends of a double-stranded RNAi agent, i.e., there are no nucleotide overhangs. A "blunt-ended" RNAi agent is a dsRNA that is double-stranded throughout its entire length, i.e., has no nucleotide overhangs at either end of the molecule. The RNAi agents of the present invention include RNAi agents having a nucleotide overhang at one end (i.e., one end is an overhang and the other is a blunt end), or RNAi agents having nucleotide overhangs at both ends.
[0100] The term "antisense strand" refers to the strand of a double-stranded RNAi agent that contains a region substantially complementary to the target sequence (e.g., human TTR mRNA). As used herein, the term "region complementary to a portion of the transthyretin-encoding mRNA" refers to a region of the antisense strand that is substantially complementary to a portion of the TTR mRNA sequence. If the complementary region is not perfectly complementary to the target sequence, the mismatch is most acceptable in the terminal region, and if present, is generally in the terminal region, or, for example, a region of 6, 5, 4, 3, or 2 nucleotides or less at the 5' and / or 3' ends.
[0101] As used herein, the term "sense strand" refers to a strand of dsRNA that contains a region substantially complementary to the antisense strand region.
[0102] As used herein, the term “cleavage region” refers to a region located immediately adjacent to a cleavage site. A cleavage site is a site on the target where cleavage occurs. In some embodiments, the cleavage region includes one end of the cleavage site and three bases immediately adjacent to this cleavage site. In some embodiments, the cleavage region includes one end of the cleavage site and two bases immediately adjacent to this cleavage site. In some embodiments, the cleavage site is specifically located at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region includes nucleotides 11, 12, and 13.
[0103] Unless otherwise specified, the term “complementary” as used herein, when used to describe the relationship between a first nucleotide sequence and a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide containing a first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing a second nucleotide sequence under certain conditions to form a double-stranded structure, as will be understood by those skilled in the art. Such conditions may, for example, be stringent conditions, which are: 400 mM NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA, 50 o C or 70 o This may include 12–16 hours in C, followed by washing. Other conditions, such as physiologically appropriate conditions that may be encountered in living organisms, can be applied. Those skilled in the art can determine the most appropriate set of conditions for testing the complementarity of two sequences according to the final application of the hybridized nucleotides.
[0104] If base pairs exist between nucleotides of the first and second nucleotide sequences along their entire length, the sequences may be "fully complementary" to each other. However, where it is stated herein that the first sequence is "substantially complementary" to the second sequence, the two sequences may be fully complementary, or they may form one or more mismatched base pairs, not more than four, three, or two, during hybridization while maintaining their ability to hybridize under conditions best suited to the final application. However, if two oligonucleotides are designed to form one or more single-stranded overhangs during hybridization, such overhangs should not be considered mismatches for the purpose of complementarity determination. For example, a dsRNA containing one 21-nucleotide oligonucleotide and another 23-nucleotide oligonucleotide, where the longer oligonucleotide contains a 21-nucleotide sequence that is fully complementary to the shorter oligonucleotide, can still be said to be "fully complementary" for the purposes described herein.
[0105] As used herein, “complementary” sequences may include base pairs formed from non-Watson-Crick base pairs and / or non-naturally modified nucleotides, or may be entirely formed from base pairs formed from Watson-Crick base pairs and / or non-naturally modified nucleotides, provided that the above requirements regarding the ability of complementary sequences to hybridize are met. Such non-Watson-Crick base pairs include, but are not limited to, G:U fluctuation base pairing or Hoogstein base pairing.
[0106] The terms “complementary,” “fully complementary,” and “substantially complementary” as used herein can be used for base matches between the sense strand and antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as can be seen from the context of their use.
[0107] As used herein, a polynucleotide "substantially complementary to at least a portion" of messenger RNA (mRNA) means a polynucleotide substantially complementary to a contiguous portion of the mRNA of interest (e.g., the mRNA encoding TTR) including the 5'UTR, open reading frame (ORF), or 3'UTR. For example, a polynucleotide is complementary to at least a portion of TTR mRNA if its sequence is substantially complementary to a contiguous portion of the mRNA encoding TTR.
[0108] As used herein, the term “inhibit” is used interchangeably with “reduce,” “silence,” “downcontrol,” “suppress,” and other similar terms, and includes all levels of inhibition.
[0109] As used herein, the phrase “inhibit TTR expression” includes the inhibition of expression of any TTR gene (e.g., mouse TTR gene, rat TTR gene, monkey TTR gene, or human TTR gene) and variants or mutants of the TTR gene. Thus, the TTR gene may be a wild-type TTR gene, a mutant TTR gene (e.g., a mutant TTR gene resulting in systemic amyloid deposition), or a genetically modified cell, cell population, or recombinant TTR gene in the context of an organism.
[0110] "Inhibiting TTR gene expression" includes any level of inhibition of the TTR gene, e.g., at least partial suppression of TTR gene expression, e.g., inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
[0111] TTR gene expression can be assessed based on the levels of any variable associated with TTR gene expression, such as TTR mRNA levels, TTR protein levels, retinol-binding protein levels, vitamin A levels, or the number or extent of amyloid deposits. Inhibition can be assessed by a decrease in the absolute level of one or more of these variables, or by a decrease in the relative level of one or more of these variables compared to a control level. The control level can be any type of control level used in this art, such as a pre-administration baseline level, or a level determined from similar subjects, cells, or samples that have been untreated or treated with a control (e.g., a buffer-only control or an inactivator control).
[0112] As used herein, the phrase “bringing cells into contact with an RNAi agent” includes bringing cells into contact by any possible means. Bringing cells into contact with an RNAi agent, for example, a double-stranded RNAi agent, includes bringing in vitro cells into contact with an RNAi agent, or bringing in vivo cells into contact with an RNAi agent. This contact can be direct or indirect. For example, the RNAi agent may be brought into physical contact with cells by the person performing this method, or the RNAi agent may be brought into contact with cells in a situation in which contact with cells is possible or possible at a later date.
[0113] In vitro cell contact can be performed, for example, by incubating cells with an RNAi agent. In vivo cell contact can be performed, for example, by injecting the RNAi agent into or near the tissue where the cells are located, or by injecting the RNAi agent into another region, such as the bloodstream or subcutaneous space, so that the RNAi agent subsequently reaches the tissue where the cells to be contacted are located. For example, the RNAi agent may contain and / or bind to a ligand that guides the RNAi agent to a target site, such as the liver, such as GalNAc3 ligand. A combination of in vitro and in vivo contact methods is also possible. In relation to the method of the present invention, cells can be contacted with an RNAi agent in vitro and subsequently transplanted into a subject.
[0114] As used herein, “patient” or “subject” shall include human or non-human animals, preferably mammals, such as monkeys. Most preferably, the subject or patient is human.
[0115] As used herein, “TTR-related disorders” include all disorders associated with the TTR gene or TTR protein. Such disorders may be caused, for example, by excessive production of the TTR protein, mutations in the TTR gene, abnormal cleavage of the TTR protein, or abnormal interactions between TTR and other proteins or other endogenous or exogenous substances. “TTR-related disorders” include all types of TTR amyloidosis (ATTR), in which TTR plays a role in the formation of abnormal extracellular aggregates or amyloid deposits. Examples of TTR-related disorders include senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial polyneuropathy (FAP), familial amyloid cardiomyopathy (FAC), leptomeningeal / central nervous system (CNS) amyloidosis, amyloid vitreous opacity, carpal tunnel syndrome, and hyperthyrocinemia. Symptoms of TTR amyloidosis include sensory neuropathy (e.g., paresthesia and hypoesthesia in the distal extremities), autonomic neuropathy (e.g., gastrointestinal disorders, e.g., gastric ulcers, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic dysfunction, cardiomyopathy, vitreous opacity, renal failure, nephropathy, substantial decrease in mBMI (modified body mass index), cranial neuropathy, and lattice keratopathy.
[0116] As used herein, “therapeutic dose” refers to an amount of RNAi agent sufficient to treat a TTR-related disease (e.g., to alleviate, improve, or maintain the symptoms of a pre-existing disease or one or more symptoms of a disease) when administered to a patient. “Therapeutic dose” may vary depending on the RNAi agent, the method of administration of the RNAi agent, the disease and its severity and history, age, weight, family history, genetic structure, stage of the pathological process mediated by TTR expression, type of previous treatment or combination therapy (if any), and other personal characteristics of the patient being treated.
[0117] As used herein, “prophylactic effective dose” includes an amount of RNAi agent sufficient to prevent or improve TTR-related disease or one or more of its symptoms when administered to a patient who is not currently suffering from or showing symptoms of TTR-related disease but is likely to develop the disease. Symptoms that may be improved include sensory neuropathy (e.g., paresthesia, hypoesthesia in the distal extremities), autonomic neuropathy (e.g., gastrointestinal disorders, e.g., gastric ulcers, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic dysfunction, cardiomyopathy, vitreous opacity, renal failure, nephropathy, substantial reduction in mBMI (modified body mass index), cranial neuropathy, and lattice keratopathy. Improving the disease includes delaying disease progression or reducing the severity of the disease as it develops. The “effective prophylactic dose” may vary depending on the RNAi agent, the method of administration of the RNAi agent, the degree of disease risk, and the patient’s medical history, age, weight, family history, genetic makeup, type of previous treatment or combination therapy (if any), and other personal characteristics of the patient being treated.
[0118] The “therapeutic effective dose” or “preventive effective dose” also includes the amount of RNAi agent that yields a reasonable efficacy / risk ratio applicable to any treatment and provides a certain degree of desirable local or systemic effect. The RNAi agent used in the method of the present invention can be administered in sufficient quantities to produce a reasonable efficacy / risk ratio applicable to such treatments.
[0119] As used herein, the term “sample” includes similar fluid, cell, or tissue samples isolated from a subject, and fluids, cells, or tissues present within the body of the subject. Examples of biological fluids include blood, serum, and serous fluid, plasma, cerebrospinal fluid, ocular fluid, lymph, urine, and saliva. Tissue samples may include samples from tissues, organs, or local areas. For example, a sample may originate from a specific organ, a part of an organ, or fluids or cells within those organs. In certain embodiments, a sample may originate from the liver (e.g., the whole liver, a specific part of the liver, or a specific type of cells of the liver, e.g., hepatocytes), the retina or a part of the retina (e.g., retinal pigment epithelium), the central nervous system or a part of the central nervous system (e.g., the ventricles or choroid plexus), or the pancreas or specific cells or parts of the pancreas. In some embodiments, “sample derived from subject” refers to cerebrospinal fluid taken from the subject. In preferred embodiments, “sample derived from subject” refers to blood or plasma taken from the subject. In further embodiments, “sample derived from subject” refers to liver tissue (or a sub-component thereof) or retinal tissue (or a sub-component thereof) derived from the subject.
[0120] II. RNAi agents The present invention provides an RNAi agent having excellent gene silencing activity. Excellent results can be obtained by introducing one or more motifs consisting of three identical modifications in three consecutive nucleotides to the sense and / or antisense strands of the RNAi agent, particularly at or near the cleavage site, as shown herein and in U.S. Provisional Patent Application No. 61 / 561,710 (this application claims priority). The sense and / or antisense strands of the RNAi agent may be otherwise completely modified. The introduction of such motifs inhibits the modification pattern present in the sense and / or antisense strands, if such a pattern exists. The RNAi agent may also be optionally conjugated to, for example, a GalNAc derivative ligand of the sense strand. The resulting RNAi agent exhibits excellent gene silencing activity.
[0121] To our surprise, we have found that when the sense strand and / or antisense strand of an RNAi agent are completely modified, the gene silencing activity of the RNAi agent is significantly enhanced by having one or more motifs consisting of three identical modifications in three consecutive nucleotides at or near the cleavage site of at least one strand of the RNAi agent.
[0122] Accordingly, the present invention provides an RNAi agent, such as a double-stranded RNAi agent, that can inhibit the expression of a target gene (i.e., a TTR gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent can be in the range of 12 to 30 nucleotide lengths. For example, each strand can be in the range of 14 to 30 nucleotide lengths, 17 to 30 nucleotide lengths, 25 to 30 nucleotide lengths, 27 to 30 nucleotide lengths, 17 to 23 nucleotide lengths, 17 to 21 nucleotide lengths, 17 to 19 nucleotide lengths, 19 to 25 nucleotide lengths, 19 to 23 nucleotide lengths, 19 to 21 nucleotide lengths, 21 to 25 nucleotide lengths, or 21 to 23 nucleotide lengths.
[0123] The sense strand and antisense strand typically form a double-stranded RNA ("dsRNA"), also referred to herein as the "RNAi agent." The double-stranded region of the RNAi can be 12–30 nucleotide pairs long. For example, the double-stranded region can be 14–30 nucleotide pairs long, 17–30 nucleotide pairs long, 27–30 nucleotide pairs long, 17–23 nucleotide pairs long, 17–21 nucleotide pairs long, 17–19 nucleotide pairs long, 19–25 nucleotide pairs long, 19–23 nucleotide pairs long, 19–21 nucleotide pairs long, 21–25 nucleotide pairs long, or 21–23 nucleotide pairs long. In another example, the double-stranded region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotide pairs long.
[0124] In one embodiment, the RNAi agent may contain one or more overhang regions and / or capping groups at the 3' end, 5' end, or both ends of the strand. The overhang can be 1 to 6 nucleotides long, e.g., 2 to 6 nucleotides, 1 to 5 nucleotides, 2 to 5 nucleotides, 1 to 4 nucleotides, 2 to 4 nucleotides, 1 to 3 nucleotides, 2 to 3 nucleotides, or 1 to 2 nucleotides. The overhang may result from one strand being longer than the other, or from a shift between two strands of the same length. The overhang may form a mismatch with the target mRNA, or it may be complementary to the targeted gene sequence, or it may be a different sequence. The first and second strands can be joined, for example, by additional bases forming a hairpin, or by other non-base linkers.
[0125] The RNAi agents provided by the present invention include, for example, activators having chemical modifications disclosed in U.S. Provisional Patent Application No. 61 / 561,710 filed November 18, 2011, International Application PCT / US2011 / 051597 filed September 15, 2010, and PCT International Publication WO2009 / 073809, the full disclosures thereof of which are incorporated herein by reference.
[0126] In one embodiment, the nucleotides in the overhang region of the RNAi agent may be modified nucleotides, including, but not limited to, 2'-sugar modifications such as 2-F, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof, or they may be unmodified nucleotides. For example, TT may be an overhang sequence at the end of any of the strands. The overhang may form a mismatch with the target mRNA, or it may be complementary to the targeted gene sequence, or it may be another sequence.
[0127] The 5' or 3' overhangs on the sense strand, antisense strand, or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang region comprises two nucleotides with a phosphorothioate between them, which may be the same nucleotide or different nucleotides. In one embodiment, the overhang is located at the 3' end of the sense strand, antisense strand, or both strands. In one embodiment, this 3' overhang is located on the antisense strand. In one embodiment, this 3' overhang is located on the sense strand.
[0128] RNAi agents may contain only one overhang that can enhance their interference activity without affecting overall stability. For example, a single-stranded overhang may be located at the 3' end of the sense strand or the 3' end of the antisense strand. RNAi agents may also have a blunt end located at the 5' end of the antisense strand (or the 3' end of the sense strand), or vice versa. Generally, the antisense strand of an RNAi agent has a nucleotide overhang at the 3' end and a blunt end at the 5' end. The applicant is not bound by theory, but theoretically, an asymmetrical arrangement of a blunt end at the 5' end of the sense strand and a 3' end overhang on the antisense strand would favor the guide strand added to the RISC process.
[0129] In one embodiment, the RNAi agent is a 19-nucleotide-length double-ended bluntmer, where the sense strand contains at least one motif consisting of three 2'-F modifications at three consecutive nucleotides at positions 7, 8, and 9 of the 5' end. The antisense strand contains at least one motif consisting of three 2'-O-methyl modifications at three consecutive nucleotides at positions 11, 12, and 13 of the 5' end.
[0130] In one embodiment, the RNAi agent is a blunt-ended double-stranded molecule with a length of 20 nucleotides, wherein the sense strand contains at least one motif consisting of three 2'-F modifications at three consecutive nucleotides at positions 8, 9, and 10 of the 5' end. The antisense strand contains at least one motif consisting of three 2'-O-methyl modifications at three consecutive nucleotides at positions 11, 12, and 13 of the 5' end.
[0131] In one embodiment, the RNAi agent is a blunt-ended double-stranded molecule with a length of 21 nucleotides, wherein the sense strand contains at least one motif consisting of three 2'-F modifications at three consecutive nucleotides at positions 9, 10, and 11 of the 5' end. The antisense strand contains at least one motif consisting of three 2'-O-methyl modifications at three consecutive nucleotides at positions 11, 12, and 13 of the 5' end.
[0132] In one embodiment, the RNAi agent comprises a sense strand of 21 nucleotides (nt) length and an antisense strand of 23 nucleotides (nt) length, wherein the sense strand comprises at least one motif consisting of three 2'-F modifications at three consecutive nucleotides at positions 9, 10, and 11 of the 5' end; the antisense strand comprises at least one motif consisting of three 2'-O-methyl modifications at three consecutive nucleotides at positions 11, 12, and 13 of the 5' end, and one end of the RNAi agent is blunt, while the other end has a two-nucleotide overhang. Preferably, the two-nucleotide overhang is at the 3' end of the antisense strand. Optionally, the RNAi agent further comprises a ligand (preferably GalNAc3).
[0133] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, the sense strand being 25-30 nucleotide residues long, starting with a nucleotide at the 5' end (position 1), and containing at least 8 ribonucleotides at positions 1-23 of the first strand; the antisense strand being 36-66 nucleotide residues long, starting with a nucleotide at the 3' end, and containing at least 8 ribonucleotides at positions that pair with positions 1-23 of the sense strand to form a double helix; at least 3' nucleotides of the antisense strand do not pair with the sense strand, and up to 6 consecutive 3' nucleotides do not pair with the sense strand, thereby forming a 3' single-stranded overhang of 1-6 nucleotides; the 5' end of the antisense strand contains 10-30 consecutive nucleotides that do not pair with the sense strand. The sense strand contains nucleotides, thereby forming a single-stranded 5' overhang of 10-30 nucleotides; at least the nucleotides at the 5' and 3' ends of the sense strand form base pairs with the nucleotides of the antisense strand when the sense and antisense strands are aligned to achieve maximum complementarity, thereby forming a substantially double-stranded region between the sense and antisense strands; the antisense strand is sufficiently complementary to the target RNA along at least 19 ribonucleotides of the length of the antisense strand to reduce the expression of the target gene when the double-stranded nucleic acid is introduced into mammalian cells; the sense strand contains at least one motif consisting of three 2'-F modifications in three consecutive nucleotides, the at least one motif located at or near the cleavage site; the antisense strand contains at least one motif consisting of three 2'-O-methyl modifications in three consecutive nucleotides at or near the cleavage site.
[0134] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, the RNAi agent comprising a first strand having a nucleotide length of at least 25 and a maximum of 29 nucleotides, and a second strand having a nucleotide length of up to 30 nucleotides, having at least one motif consisting of three 2'-O-methyl modifications in three consecutive nucleotides located at positions 11, 12, and 13 from the 5' end; the 3' end of the first strand and the 5' end of the second strand form blunt ends, the second strand is 1 to 4 nucleotides longer than the first strand at its 3' end, and the double-stranded region is at least 25 nucleotides long, the second strand is sufficiently complementary to the target mRNA along at least 19 nucleotides of the length of the second strand so that when the RNAi agent is introduced into mammalian cells, it reduces the expression of the target gene, and dicer cleavage of the RNAi agent preferentially yields an siRNA containing the 3' end of the second strand, thereby reducing the expression of the target gene in mammals. Optionally, RNAi agents may further contain ligands.
[0135] In one embodiment, the sense strand of the RNAi agent includes at least one motif consisting of three identical modifications in three consecutive nucleotides, one of which is located at a cleavage site on the sense strand.
[0136] In one embodiment, the antisense strand of the RNAi agent may also contain at least one motif consisting of three identical modifications in three consecutive nucleotides, one of which is located at or near the cleavage site of the antisense strand.
[0137] In RNAi agents with a double-stranded region of 17–23 nucleotides in length, the cleavage sites on the antisense strand are typically near positions 10, 11, and 12 from the 5' end. Thus, the motif consisting of three identical modifications may also be located at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; and 13, 14, 15 of the antisense strand, with these positions counting from the first nucleotide from the 5' end of the antisense strand, or from the nucleotide forming the first pair within the double-stranded region at the 5' end of the antisense strand. The cleavage sites on the antisense strand can also vary depending on the length of the double-stranded region of the RNAi agent at the 5' end.
[0138] The sense strand of an RNAi agent may contain at least one motif consisting of three identical modifications on three consecutive nucleotides at a cleavage site on the strand; the antisense strand may have at least one motif consisting of three identical modifications on three consecutive nucleotides at or near a cleavage site on the strand. If the sense strand and antisense strand form a dsRNA double helix, the sense strand and antisense strand may be aligned such that one motif of three nucleotides on the sense strand and one motif of three nucleotides on the antisense strand overlap at least one nucleotide, i.e., at least one of the three nucleotides of the motif on the sense strand forms a base pair with at least one of the three nucleotides of the motif on the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.
[0139] In one embodiment, the sense strand of an RNAi agent may contain two or more motifs consisting of three identical modifications of three consecutive nucleotides. The first motif should be located at or near the cleavage site of the sense strand, and the other motif may be a wing modification. The term “wing modification” as used herein refers to a motif located in a different part of the same strand, away from the motif at or near the cleavage site of the strand. The wing modification is either near the first motif or separated by at least one nucleotide. If the motifs are closer to each other than their herbivorous properties, they are different; if the motifs are separated by one or more nucleotides than their chemical properties, they are either the same or different. There may be two or more wing modifications. For example, if there are two wing modifications, each wing modification may be located at one end relative to the first motif at or near the cleavage site, or on either side of the lead motif.
[0140] Similar to the sense strand, the antisense strand of an RNAi agent may contain at least two motifs consisting of three identical modifications of three consecutive nucleotides, with at least one motif located at or near the cleavage site of the antisense strand. This antisense strand may also contain one or more wing modifications in a sequence similar to the wing modifications present on the sense strand.
[0141] In one embodiment, the wing modification of the sense or antisense strand of the RNAi agent typically does not include the first one or two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.
[0142] In another embodiment, the wing modification of the sense or antisense strand of the RNAi agent typically does not include the first one or two base-pairing nucleotides in the double-stranded region at the 3' end, 5' end, or both ends of the strand.
[0143] If the sense strand and antisense strand of the RNAi agent each contain at least one wing modification, this wing modification may be located at the same end of the double-stranded region and have an overlap of one, two, or three nucleotides.
[0144] If the sense strand and antisense strand of an RNAi agent each contain at least two wing modifications, the sense strand and antisense strand can be aligned such that: two modifications on one strand are located at one end of the double-stranded region and have an overlap of one, two, or three nucleotides; two modifications on one strand are located at the other end of the double-stranded region and have an overlap of one, two, or three nucleotides; or two modifications on one strand are located on each side of the read motif and have an overlap of one, two, or three nucleotides in the double-stranded region.
[0145] In one embodiment, each nucleotide in the sense and antisense strands of the RNAi agent may be modified, including a nucleotide that is part of a motif. Each nucleotide may be modified with the same or different modifications, which may include changes to one or more of the unbound phosphate oxygen and / or one or more bound phosphate oxygens; changes to the components of the ribose sugar, e.g., the 2' hydroxyl of the ribose sugar; massive substitutions of the phosphate moiety with a “dephospho” linker; modifications or substitutions of native bases; and substitutions or modifications of the ribose-phosphate backbone.
[0146] Because nucleic acids are polymers of subunits, many modifications, such as modifications of bases, phosphate moieties, or unbound oxygen of phosphate moieties, are located at repeating positions within the nucleic acid. In some cases, modifications are present at all desired positions within the nucleic acid, but often this is not the case. For example, modifications may be present only at the 3' or 5' end, or only in the terminal region, e.g., at the terminal nucleotide, or at the last two, three, four, five, or ten nucleotides of the strand. Modifications may be present in the double-stranded region, the single-stranded region, or both. Modifications may be present only in the double-stranded region of RNA, or only in the single-stranded region of RNA. For example, phosphorothioate modifications at unbound oxygen positions may be present only at one or both ends, or only in the terminal region, e.g., at the terminal nucleotide, or at the last two, three, four, five, or ten nucleotides of the strand, or in both the double-stranded and single-stranded regions, especially at the ends. The 5' end or both ends may be phosphorylated.
[0147] For example, it may be possible to enhance stability, include specific bases in the overhangs, or include modified nucleotides or nucleotide substitutes in single-stranded overhangs, e.g., 5' or 3' overhangs, or both overhangs. For example, it may be desirable to include purine nucleotides in the overhangs. In some embodiments, all or some of the bases in the 3' or 5' overhangs may be modified, for example, with modifications described herein. Modifications may include, for example, the use of modifications at the 2' position of ribose sugars using modifications known in the art, e.g., the use of deoxyribonucleotides, 2'-deoxy-2'-fluoro(2'-F), or 2'-O-methyl modifications instead of ribosaccharides of nucleic acid bases, and modifications of phosphate groups, e.g., phosphothioate modifications. The overhangs do not need to be homologous to the target sequence.
[0148] In one embodiment, each residue in the sense chain and antisense chain is independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro. The sense chain and antisense chain may include two or more modifications. In one embodiment, each residue in the sense chain and antisense chain is independently modified with 2'-O-methyl or 2'-fluoro.
[0149] At least two different modifications are typically present on the sense and antisense chains. These two modifications may be 2'-O-methyl, 2'-fluoro, or other.
[0150] In one embodiment, N a and / or N b This includes alternating pattern modifications. As used herein, the term “alternating motif” refers to a motif having one or more modifications present in alternating nucleotides on a single chain. Alternating nucleotides may have one modification every other nucleotide, one modification every three nucleotides, or similar patterns. For example, if A, B, and C each represent one type of modification to a nucleotide, the alternating motifs may be “ABABABABABAB…”, “AABBAABBAABB…”, “AABAABAABAAB…”, “AAABAAABAAAB…”, “AAABBBAAABBB…”, or “ABCABCABCABC…”.
[0151] The types of modifications included in an alternating motif may be the same or different. For example, if A, B, C, and D each represent one type of modification of a nucleotide, the alternating pattern, i.e., the modifications of every other nucleotide, may be the same, but the sense strand or antisense strand can each be selected from several possibilities of the internal modifications of the alternating motif, such as "ABABAB...", "ACACAC...", "BDBDBD...", or "CDCDCD...".
[0152] In one embodiment, the RNAi agent of the present invention includes a modification pattern of alternating motifs on the sense strand that is shifted relative to the modification pattern of alternating motifs on the antisense strand. This shift may be such that the modifying groups of the nucleotides on the sense strand correspond to different modifying groups of the nucleotides on the antisense strand, or vice versa. For example, when the sense strand forms a base pair with the antisense strand in a dsRNA double helix, the alternating motif on the sense strand may begin with "ABABAB" from 5' to 3' on the sense strand, and the alternating motif on the antisense strand may begin with "BABABA" from 5' to 3' on the antisense strand within the double helix region. As another example, the alternating motif on the sense strand may begin with "AABBAABB" from 5' to 3' on the sense strand, and the alternating motif on the antisense strand may begin with "BBAABBAA" from 5' to 3' on the antisense strand within the double helix region, thus representing a complete or partial shift in the modification patterns between the sense strand and the antisense strand.
[0153] In one embodiment, the RNAi agent initially has a pattern of alternating motifs of 2'-O-methyl and 2'-F modifications in the sense strand, which has a shift relative to the pattern of alternating motifs of 2'-O-methyl and 2'-F modifications in the antisense strand; that is, a 2'-O-methyl modified nucleotide in the sense strand forms a base pair with a 2'-F modified nucleotide in the antisense strand, and vice versa. Position 1 of the sense strand may begin with a 2'-F modification, and position 1 of the antisense strand may begin with a 2'-O-methyl modification.
[0154] The introduction of one or more motifs consisting of three identical modifications in three consecutive nucleotides into the sense and / or antisense strands disrupts the initial modification pattern present in the sense and / or antisense strands. This disruption of the initial modification pattern present in the sense and / or antisense strands, by the introduction of one or more motifs consisting of three identical modifications in three consecutive nucleotides into the sense and / or antisense strands, dramatically increases gene silencing activity against the target gene.
[0155] In one embodiment, a motif consisting of three identical modifications in three consecutive nucleotides is introduced into any of the chains, and the modification of the nucleotide following the motif is different from the modification of the motif. For example, a portion of the sequence containing the motif is "...N a YYYN b ..." and "Y" represents a motif modification consisting of three identical modifications in three consecutive nucleotides, and "N a " and "N b " represents a modification of the nucleotide following the motif "YYY", which is different from the modification of Y, and N a and N b This can be the same modifier or a different modifier. Or, N a and / or N b The wing modifier may or may not be present if it exists.
[0156] RNAi agents may further include at least one phosphorothioate or methylphosphonate internucleotide bond. Modifications to the phosphorothioate or methylphosphonate internucleotide bonds may be present on any nucleotide at any position in the sense strand or antisense strand, or in either strand. For example, the internucleotide bond modification may be present on any nucleotide in both the sense and antisense strands; each internucleotide bond modification may be present in an alternating pattern in the sense or antisense strand; or the sense or antisense strand may contain modifications to both internucleotide bonds in an alternating pattern. The alternating pattern of internucleotide bond modifications in the sense strand may be the same as or different from that of the antisense strand, and the alternating pattern of internucleotide bond modifications in the sense strand may have a shift relative to the alternating pattern of internucleotide bond modifications in the antisense strand.
[0157] In one embodiment, the RNAi agent includes modification of the overhang region with a phosphorothioate or methylphosphonate internucleotide bond. For example, the overhang region may include two nucleotides having a phosphorothioate or methylphosphonate internucleotide bond between them. The internucleotide bond modification may also be formed to link the overhang nucleotide to a terminal base-pairing nucleotide in the double-stranded region. For example, at least two, three, four, or all of the overhang nucleotides may be linked by phosphorothioate or methylphosphonate internucleotide bonds, and optionally, additional phosphorothioate or methylphosphonate internucleotide bonds may be present to link the overhang nucleotide to the next base-pairing nucleotide. For example, at least two phosphothioate internucleotide bonds may be present between three terminal nucleotides, two of which are overhang nucleotides, and the third nucleotide is the base-pairing nucleotide following the overhang nucleotide. Preferably, these three terminal nucleotides may be located at the 3' end of the antisense strand.
[0158] In one embodiment, the RNAi agent includes mismatch(s) with the target, mismatch(s) within the double helix, or a combination thereof. Mismatches may occur in overhang regions or in the double helix region. Base pairs can be ranked based on their tendency to promote dissociation or dissolution (e.g., with respect to the free energy of binding or dissociation of a particular pair; the simplest approach is to evaluate base pairs on an individual base pair basis, although analogous or similar analyses may also be used). With respect to promoting dissociation, A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (where I = inosine). Mismatches, e.g., non-canonical or non-canonical pairings (as described in other parts of this specification), are preferred over canonical pairings (A:T, A:U, G:C); and base pairs containing universal bases are preferred over canonical pairings.
[0159] In one embodiment, the RNAi agent comprises at least one of the first one, two, three, four, or five base pairs in the double-stranded region from the 5' end of the antisense strand, which can be independently selected from the group A:U, G:U, and I:C, and a mismatch pairing to facilitate the dissociation of the antisense strand at the 5' end of the double helix, such as a non-canonical pairing, a non-canonical pairing, or a pairing containing a universal base.
[0160] In one embodiment, the nucleotide at position 1 in the double-stranded region from the 5' end of the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first one, two, or three base pairs in the double-stranded region from the 5' end of the antisense strand is an AU base pair. For example, the first base pair in the double-stranded region from the 5' end of the antisense strand is an AU base pair.
[0161] In one embodiment, the sense chain sequence can be represented by formula (I): 5'n p -N a -(XXX) i -Nb -YYY-N b -(ZZZ) j -N a -n q 3’ (I) Wherein i and j are each independently 0 or 1; p and q are each independently 0 to 6; Each N a represents an oligonucleotide sequence containing modified nucleotides from 0 to 25, and each sequence contains at least two differently modified nucleotides; Each N b represents an oligonucleotide sequence containing modified nucleotides from 0 to 10; Each n p and n q each independently represent overhang nucleotides; Nb and Y do not have the same modification; and XXX, YYY, and ZZZ each independently represent one motif consisting of three identical modifications in three consecutive nucleotides. Preferably, YYY is a 2'-F modified nucleotide.
[0162] In one embodiment, N a and / or N b contains an alternating pattern of modifications.
[0163] In one embodiment, the YYY motif is present at or near the cleavage site of the sense strand. For example, when the RNAi agent has a double-stranded region with a nucleotide length of 17 to 23, the YYY motif may be present at or near the cleavage site of the sense strand (e.g., at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12; or 11, 12, 13), and this position can be counted starting from the first nucleotide from the 5' end; or optionally, starting from the first base pair-forming nucleotide within the double-stranded region from the 5' end.
[0164] <0In one embodiment, i is 1 and j is 0, i is 0 and j is 1, or both i and j are 1. Therefore, the sense strand can be represented by the following formula: 5’n p -N a -YYY-N b -ZZZ-N a -n q 3’ (Ia) 5’n p -N a -XXX-N b -YYY-N a -n q 3’ (Ib); or 5’n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3’ (Ic).
[0165] When the sense strand is represented by formula (Ia), N b represents an oligonucleotide sequence containing modified nucleotides of 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0. Each N a can independently represent an oligonucleotide sequence containing modified nucleotides of 2 to 20, 2 to 15, or 2 to 10.
[0166] When the sense strand is represented by formula (Ib), N b represents an oligonucleotide sequence containing modified nucleotides of 0 to 10, 0 to 7, 0 to 10, 0 to 5, 0 to 4, 0 to 2, or 0. Each N a can independently represent an oligonucleotide sequence containing modified nucleotides of 2 to 20, 2 to 15, or 2 to 10.
[0167] When the sense strand is represented by formula (Ic), each N b independently represents an oligonucleotide sequence containing modified nucleotides of 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0. Preferably, N b is 0, 1, 2, 3, 4, 5, or 6. Each N aThis can independently represent an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.
[0168] X, Y, and Z may each be the same as or different from one another.
[0169] In one embodiment, the antisense strand sequence of the RNAi agent can be represented by formula (II): 5'n q’ -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -n p '3' (II) During the ceremony, k and l are independently either 0 or 1; p' and q' are independently between 0 and 6; each N a ' independently represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, where each sequence contains at least two differently modified nucleotides; each N b ' independently represents an oligonucleotide sequence containing 0 to 10 modified nucleotides; each n p 'and n q ' independently represents an overhanging nucleotide; N b 'and Y' do not have the same modifier; and X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent a single motif consisting of three identical modifications in three consecutive nucleotides.
[0170] In one embodiment, N a 'and / or N b ' includes alternating modification patterns.
[0171] The Y'Y'Y' motif is located at or near the cleavage site of the antisense strand. For example, an RNAi agent has a double-stranded region of 17-23 nucleotides in length, and the Y'Y'Y' motif may be located at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, where the position is counted from the 5' end, starting from the first nucleotide; or optionally, from the 5' end, starting from the first base-pairing nucleotide in the double-stranded region. Preferably, the Y'Y'Y' motif is located at positions 11, 12, 13.
[0172] In one embodiment, the Y'Y'Y' motif is a 2'-OMe modified nucleotide.
[0173] In one embodiment, k is 1 and l is 0, k is 0 and l is l, or both k and l are 1.
[0174] Therefore, the antisense chain can be expressed by the following equation: 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p '3' (IIa); 5'n q’ -N a '-Y'Y'Y'-N b '-X'X'X'-n p '3' (IIb); or 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N b '-X'X'X'-N a '-n p '3' (IIc).
[0175] If the antisense chain is represented by equation (IIa), then N b' represents an oligonucleotide sequence containing modified nucleotides of 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0. Each N a The ' independently represents an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.
[0176] If the antisense chain is represented by equation (IIb), then N b ' represents an oligonucleotide sequence containing modified nucleotides of 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0. Each N a The ' independently represents an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides.
[0177] If the antisense chain is represented by equation (IIc), then each N b ' independently represents oligonucleotide sequences containing modified nucleotides of 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0. Each N a ' independently represents an oligonucleotide sequence containing 2-20, 2-15, or 2-10 modified nucleotides. Preferably, N b It is 0, 1, 2, 3, 4, 5, or 6.
[0178] X', Y', and Z' may each be the same as or different from each other.
[0179] Each nucleotide in the sense and antisense strands can be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, 2'-deoxy, or 2'-fluoro. For example, each nucleotide in the sense and antisense strands can be independently modified with 2'-O-methyl or 2'-fluoro. In particular, X, Y, Z, X', Y', and Z' can each represent a 2'-O-methyl modification or a 2'-fluoro modification.
[0180] In one embodiment, the sense strand of the RNAi agent can include a YYY motif present at positions 9, 10, and 11 of the sense strand when the double-stranded region is 21 nucleotides, where this position is counted starting from the first nucleotide from the 5'-end, or optionally, starting from the first base-pairing nucleotide within the double-stranded region from the 5'-end; and Y represents a 2'-F modification. The sense strand can additionally include an XXX motif or a ZZZ motif as a wing modification at the opposite end of the double-stranded region; and XXX and ZZZ each independently represent a 2'-OMe modification or a 2'-F modification.
[0181] In one embodiment, the antisense strand can include a Y'Y'Y' motif present at positions 11, 12, and 13 of this sense strand, where this position is counted starting from the first nucleotide from the 5'-end, or optionally, starting from the first base-pairing nucleotide within the double-stranded region from the 5'-end; and Y' represents a 2'-O-methyl modification. The antisense strand can additionally include an X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the double-stranded region; and X'X'X' and Z'Z'Z' each independently represent a 2'-OMe modification or a 2'-F modification.
[0182] The sense strands represented by any one of the above formulas (Ia), (Ib), and (Ic) each form a double strand with the antisense strand represented by any one of the formulas (IIa), (IIb), and (IIc).
[0183] Therefore, the RNAi agent of the present invention can include a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, and the RNAi double strand is represented by formula (III): Sense strand: 5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -nq 3' Antisense chain: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5' (III) During the ceremony, i, j, k, and l are each independently either 0 or 1; p, p', q, and q' are each independently between 0 and 6; each N a and N a ' independently represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, where each sequence contains at least two differently modified nucleotides; each N b and N b ' independently represents an oligonucleotide sequence containing 0 to 10 modified nucleotides; During the ceremony, each n p ',n p , n q ', and n q independently represents an overhang nucleotide; and XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent a single motif consisting of three identical modifications in three consecutive nucleotides.
[0184] In one embodiment, i is 1 and j is 0; i is 0 and j is 1; or both i and j are 1. In another embodiment, k is 1 and l is 0; k is 0 and l is 1; or both k and l are 1.
[0185] An example combination of sense and antisense strands that form an RNAi double helix includes the following formula: 5'n p -N a -YYY-N b-ZZZ-N a -n q 3' 3'n p '-N a '-Y'Y'Y'-N b '-Z'Z'Z'-N a 'n q '5' (IIIa) 5'n p -N a -XXX-N b -YYY-N a -n q 3' 3'n p '-N a '-X'X'X'-N b '-Y'Y'Y'-N a '-n q '5' (IIIb) 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' 3'n p '-N a '-X'X'X'-N b '-Y'Y'Y'-N b '-Z'Z'Z'-N a -n q '5' (IIIc)
[0186] If the RNAi agent is represented by formula (IIIa), then each N b Each N independently represents an oligonucleotide sequence containing 1-10, 1-7, 1-5, or 1-4 modified nucleotides. a Each independently represents an oligonucleotide sequence containing 2–20, 2–15, or 2–10 modified nucleotides.
[0187] If the RNAi agent is represented by formula (IIIb), then each N b , N b' independently represents oligonucleotide sequences containing modified nucleotides of 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0. Each N a Each independently represents an oligonucleotide sequence containing 2–20, 2–15, or 2–10 modified nucleotides.
[0188] If the RNAi agent is represented by formula (IIIc), then each N b , N b ' independently represents oligonucleotide sequences containing modified nucleotides of 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0. Each N a , N a ' independently represents oligonucleotide sequences containing 2-20, 2-15, or 2-10 modified nucleotides. a , N a ', N b , N b ' independently includes alternating modification patterns.
[0189] In equations (III), (IIIa), (IIIb), and (IIIc), X, Y, and Z may be the same as or different from each other.
[0190] If an RNAi agent is represented by formula (III), (IIIa), (IIIb), or (IIIc), then at least one Y nucleotide may form a base pair with one of the Y' nucleotides; or at least two Y nucleotides may form a base pair with the corresponding Y' nucleotide; or all three Y nucleotides may form a base pair with the corresponding Y' nucleotide.
[0191] If an RNAi agent is represented by formula (IIIa) or (IIIc), then at least one Z nucleotide may form a base pair with one of the Z' nucleotides; or at least two Z nucleotides may form a base pair with the corresponding Z' nucleotide; or all three Z nucleotides may form a base pair with the corresponding Z' nucleotide.
[0192] If an RNAi agent is represented by formula (IIIb) or (IIIc), then at least one X nucleotide may form a base pair with one of the X' nucleotides; or at least two X nucleotides may form a base pair with the corresponding X' nucleotide; or all three X nucleotides may form a base pair with the corresponding X' nucleotide.
[0193] In one embodiment, modification of the Y nucleotide is different from modification of the Y' nucleotide, modification of the Z nucleotide is different from modification of the Z' nucleotide, and / or modification of the X nucleotide is different from modification of the X' nucleotide.
[0194] In one embodiment, the RNAi agent is a multimer comprising at least two double helixes represented by formula (III), (IIIa), (IIIb), or (IIIc), the double helixes being linked by a linker. The linker may be cleavable or incleavable. Optionally, the multimer further comprises ligands. Each double helix may target the same gene or two different genes; or each double helix may target the same gene at two different target sites.
[0195] In some embodiments, the RNAi agent is a multimer comprising three, four, five, six or more double helixes represented by formula (III), (IIIa), (IIIb), or (IIIc), wherein the double helixes are linked by linkers. These linkers may be cleavable or incleavable. Optionally, the multimer further comprises ligands. Each double helix may target the same gene or two different genes; or each double helix may target the same gene at two different target sites.
[0196] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), or (IIIc) are bound to each other at their 5' ends, and one or both of their 3' ends are optionally conjugated with a ligand. Each RNAi agent may target the same gene or two different genes; or each RNAi agent may target the same gene at two different target sites.
[0197] Various publications describe multimeric RNAi agents. These publications include International Publication No. 2007 / 091269, U.S. Patent No. 7858769, International Publication No. 2010 / 141511, International Publication No. 2007 / 117686, International Publication No. 2009 / 014887, and International Publication No. 2011 / 031520, the full disclosures of which are incorporated herein by reference.
[0198] An RNAi agent comprising the conjugation of one or more carbohydrate moieties to the RNAi agent can optimize one or more properties of the RNAi agent. Often, the carbohydrate moiety attaches to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, for example, a non-carbohydrate carrier (preferably cyclic) to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit is thus replaced is referred herein to as a ribose-substituted modified subunit (RRMS). The cyclic carrier may be a carbocyclic system, i.e., a ring system in which all ring atoms are carbon atoms, or a heterocyclic system, i.e., a ring system in which one or more ring atoms may be heteroatoms, such as nitrogen, oxygen, and sulfur. The cyclic carrier may be a monocyclic system, or it may contain two or more rings, for example, a fusion ring. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
[0199] Ligands can be attached to polynucleotides by a carrier. The carrier comprises (i) at least one “backbone attachment point,” preferably two “backbone attachment points,” and (ii) at least one “tethering attachment point.” As used herein, “backbone attachment point” refers to a functional group, e.g., a hydroxyl group, or generally, a bond that is available and suitable for incorporating the carrier into a ribonucleic acid backbone, e.g., a phosphate backbone, or e.g., a sulfur-containing modified phosphate backbone. A “tethering attachment point” (TAP) refers, in some embodiments, to a constituent ring atom of a cyclic carrier that connects a selected moiety, e.g., a carbon atom or heteroatom (different from the atom providing the backbone attachment point). This selected moiety may be, for example, a carbohydrate, e.g., a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, and polysaccharide. Optionally, the selected moiety is connected to the cyclic carrier by an intervening tether. Therefore, cyclic carriers often contain functional groups, such as amino groups, or generally allow for bonding suitable for incorporation or tethering of other chemical substances, such as ligands, into the constituent ring.
[0200] The RNAi agent can be conjugated to the ligand by a carrier, which is a cyclic or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinil, pyrazolidinil, imidazolinil, imidazolidinil, piperidinil, piperazinil, [1,3]dioxolane, oxazolidinil, isoxazolidinil, morpholinil, thiazolidinil, isothiazolidinil, quinoxalinil, pyridadinil, tetrahydrofuryl, and decalin; preferably, the acyclic group is selected from a serinol skeleton or a diethanolamine skeleton.
[0201] In a particular embodiment, the RNAi agents of the present invention are listed in Table 1, D1000, D1001, D1002, D1003, D1004, D1005, D1006, D1007, D1008, D1009, D1010, D1011, D1012, D1013, D1014, D1015, D1016, D1017, D1018, D1019, D1020, D1021, D1022, D1023, D1024, D1025, D1026, D1027, D1028, D1029, D1030, D1031, D1032, D1033, D1034, D1035, D1 036, D1037, D1038, D1039, D1040, D1041, D1042, D1043, D1044, D1045, D104 6, D1047, D1048, D1049, D1050, D1051, D1052, D1053, D1054, D1055, D1056, D1057, D1058, D1059, D1060, D1061, D1062, D1063, D1064, D1065, D1066, D1 067, D1068, D1069, D1070, D1071, D1072, D1073, D1074, D1075, D1076, D1077 , D1078, D1079, D1080, D1081, D1082, D1083, D1084, D1085, D1086, D1087, D 1088, D1089, D1090, D1091, D1092, D1093, D1094, D1095, D1096, D1097, D10 98, D1099, D1100, D1101, D1102, D1103, D1104, D1105, D1106, D1107, D1108 , D1109, D1110, D1111, D1112, D1113, D1114, D1115, D1116, D1117, D1118, D1 119, D1120, D1121, D1122, D1123, D1124, D1125, D1126, D1127, D1128, D112 9, D1130, D1131, D1132, D1133, D1134, D1135, D1136, D1137, D1138, D1139, D 1140, D1141, D1142, D1143, D1144, D1145, D1146, D1147, D1148, D1149, D11 50, D1151, D1152, D1153, D1154, D1155, D1156, D1157, D1158, D1159, D1160,D1161、D1162、D1163、D1164、D1165、D1166、D1167、D1168、D1169、D1170、D1171、D1172、D1173、D1174、D1175、D1176、D1177、D1178、D1179、D1180、D1181、D1182、D1183、D1184、D1185、D1186、D1187、D1188、D1189、D1190、D1191、D1192、D1193、D1194、D1195、D1196、D1197、D1198、D1199、D1200、D1201、D1202、D1203、D1204、D1205、D1206、D1207、D1208、D1209、D1210、D1211、D1212、D1213、D1214、D1215、D1216、D1217、D1218、D1219、D1220、D1221、D1222、D1223、D1224、D1225、D1226、D1227、D1228、D1229、D1230、D1231、D1232、D1233、D1234、D1235、D1236、D1237、D1238、D1239、D1240、D1241、D1242、D1243、D1244、D1245、D1246、D1247、D1248、D1249、D1250、D1251、D1252、D1253、D1254、D1255、D1256、D1257、D1258、D1259、D1260、D1261、D1262、D1263、D1264、D1265、D1266、D1267、D1268、D1269、D1270、D1271、D1272、D1273、D1274、D1275、D1276、D1277、D1278、D1279、D1280、D1281、D1282、D1283、D1284、D1285、D1286、D1287、D1288、D1289、D1290、D1291、D1292、D1293、D1294、D1295、D1296、D1297、D1298、D1299、D1300、D1301、D1302、D1303、D1304、D1305、D1306、D1307、D1308、D1309、D1310、D1311、D1312、D1313、D1314、D1315、D1316、D1317、D1318、D1319、D1320、D1321、D1322、D1323、D1324、D1325、D1326、D1327、D1328、D1329、D1330、D1331、D1332、D1333、D1334、D1335、D1336、D1337、D1338、D1339、D1340、D1341、D1342、D1343、D1344、D1345、D1346、D1347、D1348、D1349、D1350、D1351、D1352、D1353、D1354、D1355、D1356、D1357、D1358、D1359、D1360、D1361、D1362、D1363、D1364、D1365、D1366、D1367、D1368、D1369、D1370、D1371、D1372、D1373、D1374、D1375、D1376、D1377、D1378、D1379、D1380、D1381、D1382、D1383、D1384、D1385、D1386、D1387、D1388、D1389、D1390、D1391、D1392、D1393、D1394、D1395、D1396、D1397、D1398、D1399、D1400、D1401、D1402、D1403、D1404、D1405、D1406、D1407、D1408、D1409、D1410、D1411、D1412、D1413、D1414、D1415、D1416、D1417、D1418、D1419、D1420、D1421、D1422、D1423、D1424、D1425、D1426、D1427、D1428、D1429、D1430、D1431、D1432、D1433、D1434、D1435、D1436、D1437、D1438、D1439、D1440、D1441、D1442、D1443、D1444、D1445、D1446、D1447、D1448、D1449、D1450、D1451、D1452、D1453、D1454、D1455、D1456、D1457、D1458、D1459、D1460、D1461、D1462、D1463、D1464、D1465、D1466、D1467、D1468、D1469、D1470、D1471、D1472、D1473、D1474、D1475、D1476、D1477、D1478、D1479、D1480、D1481、D1482、D1483、D1484、D1485、D1486、D1487、D1488、D1489、D1490、D1491、D1492、D1493、D1494、D1495、D1496、D1497、D1498、D1499、D1500、D1501、D1502、D1503、D1504、D1505、D1506、D1507、D1508、D1509、D1510、D1511、D1512、D1513、D1514、D1515、D1516、D1517、D1518、D1519、D1520、D1521、D1522、D1523、D1524、D1525、D1526、D1527、D1528、D1529、D1530、D1531、D1532、D1533、D1534、D1535、D1536、D1537、D1538、D1539、D1540、D1541、D1542、D1543、D1544、D1545、D1546、D1547、D1548、D1549、D1550、D1551、D1552、D1553、D1554、D1555、D1556、D1557、D1558、D1559、D1560、D1561、D1562、D1563、D1564、D1565、D1566、D1567、D1568、D1569、D1570、D1571、D1572、D1573、D1574、D1575、D1576、D1577、D1578、D1579、D1580、D1581、D1582、D1583、D1584、D1585、D1586、D1587、D1588、D1589、D1590、D1591、D1592、D1593、D1594、D1595、D1596、D1597、D1598、D1599、D1600、D1601、D1602、D1603、D1604、D1605、D1606、D1607、D1608、D1609、D1610、D1611、D1612、D1613、D1614、D1615、D1616、D1617、D1618、D1619、D1620、D1621、D1622、D1623、D1624、D1625、D1626、D1627、D1628、D1629、D1630、D1631、D1632、D1633、D1634、D1635、D1636、D1637、D1638、D1639、D1640、D1641、D1642、D1643、D1644、D1645、D1646、D1647、D1648、D1649、D1650、D1651、D1652、D1653、D1654、D1655、D1656、D1657、D1658、D1659、D1660、D1661、D1662、D1663、D1664、D1665、D1666、D1667、D1668、D1669、D1670、D1671、D1672、D1673、D1674、D1675、D1676、D1677、D1678、D1679、D1680、D1681、D1682、D1683、D1684、D1685、D1686、D1687、D1688、D1689、D1690、D1691、D1692、D1693、D1694、D1695、D1696、D1697、D1698、D1699、D1700、D1701、D1702、D1703、D1704、D1705、D1706、D1707、D1708、D1709、D1710、D1711、D1712、D1713、D1714、D1715、D1716、D1717、D1718、D1719、D1720、D1721、D1722、D1723、D1724、D1725、D1726、D1727、D1728、D1729、D1730、D1731、D1732、D1733、D1734、D1735、D1736、D1737、D1738、D1739、D1740、D1741、D1742、D1743、D1744、D1745、D1746、D1747、D1748、D1749、D1750、D1751、D1752、D1753、D1754、D1755、D1756、D1757、D1758、D1759、D1760、D1761、D1762、D1763、D1764、D1765、D1766、D1767、D1768、D1769、D1770、D1771、D1772、D1773、D1774、D1775、D1776、D1777、D1778、D1779、D1780、D1781、D1782、D1783、D1784、D1785、D1786、D1787、D1788、D1789、D1790、D1791、D1792、D1793、D1794、D1795、D1796、D1797、D1798、D1799、D1800、D1801、D1802、D1803、D1804、D1805、D1806、D1807、D1808、D1809、D1810、D1811、D1812、D1813、D1814、D1815、D1816、D1817、D1818、D1819、D1820、D1821、D1822、D1823、D1824、D1825、D1826、D1827、D1828、D1829、D1830、D1831、D1832、D1833、D1834、D1835、D1836、D1837、D1838、D1839、D1840、D1841、D1842、D1843、D1844、D1845、D1846、D1847、D、 1848、D1849、D1850、D1851、D1852、D1853、D1854、D1855、D1856、D1857、D1858、D1859、D1860、D1861、D1862、D1863、D1864、D1865、D1866、D1867、D1868、D1869、D1870、D1871、D1872、D1873、D1874、D1875、D1876、D1877、D1878、D1879、D1880、D1881、D1882、D1883、D1884、D1885、D1886、D1887、D1888、D1889、D1890、D1891、D1892、D1893、D1894、D1895、D1896、D1897、D1898、D1899、D1900、D1901、D1902、D1903、D1904、D1905、D1906、D1907、D1908、D1909、D1910、D1911、D1912、D1913、D1914、D1915、D1916、D1917、D1918、D1919、D1920、D1921、D1922、D1923、D1924、D1925、D1926、D1927、D1928、D1929、D1930、D1931、D1932、D1933、D1934、D1935、D1936、D1937、D1938、D1939、D1940、D1941、D1942、D1943、D1944、D1945、D1946、D1947、D1948、D1949、D1950、D1951、D1952、D1953、D1954、D1955、D1956、D1957、D1958、D1959、D1960、D1961、D1962、D1963、D1964、D1965、D1966、D1967、D1968、D1969、D1970、D1971、D1972、D1973、D1974、D1975、D1976、D1977、D1978、D1979、D1980、D1981、D1982、D1983、D1984、D1985、D1986、D1987、D1988、D1989、D1990、D1991、D1992、D1993、D1994、D1995、D1996、D1997、D1998、D1999、D2000、D2001、D2002、D2003、D2004、D2005、D2006、D2007、D2008、D2009、D2010、D2011、D2012、D2013、D2014、D2015, D2016, D2017, D2018, D2019, D2020, D2021, D2022, D2023, D2024, D2025, D2026, D2027, D2028, D2029, D2030, D2031, D2032, D2033, D2034, D 2035, D2036, D2037, D2038, D2039, D2040, D2041, D2042, D2043, D2044, D2 045, D2046, D2047, D2048, D2049, D2050, D2051, D2052, D2053, D2054, D20 The active agent is selected from the group of active agents consisting of 55, D2056, D2057, D2058, D2059, D2060, D2061, D2062, D2063, D2064, D2065, D2066, D2067, D2068, D2069, D2070, D2071, D2072, D2073, D2074, D2075, D2076, D2077, D2078, D2079, D2080, D2081, D2082, D2083, D2084, D2085, D2086, D2087, D2088, D2089, D2090, and D2091.
[0202] These activators may further contain ligands, such as GalNAc ligands.
[0203] Ligand The RNAi agent of the present invention, for example, a double-stranded RNAi agent, may optionally be conjugated to one or more ligands. This ligand may be attached to the sense strand, antisense strand, or both strands at the 3' end, 5' end, or both ends. For example, the ligand may be conjugated to the sense strand. In a preferred embodiment, the ligand is conjugated to the 3' end of the sense strand. In a preferred embodiment, the ligand is a GalNAc ligand. In a particularly preferred embodiment, the ligand is GalNAc3: [ka] That is the case.
[0204] A wide variety of substances can bind to the RNAi agent of the present invention. The preferred part is a ligand that is bound directly or indirectly via an intervening tether, preferably by covalent bond.
[0205] In a preferred embodiment, the ligand alters the distribution, targeting, or lifespan of the molecule into which it is taken up. In a preferred embodiment, the ligand increases the affinity for selected targets, such as molecules, cells or cell types, compartments, or receptors, such as compartments of cells or organs, tissues, organs, or regions of the body, compared to species in which such a ligand is absent. A ligand that increases affinity for selected targets is also called a targeted ligand.
[0206] Some ligands may possess endosomal lysis properties. Endosomal lysis ligands promote the lysis of endosomes and / or the transport of the composition or components of the present invention from endosomes to the cytoplasm of cells. Endosomal lysis ligands may also be polyanionic peptides or peptide mimetic molecules exhibiting pH-dependent membrane activity and fusionability. In one embodiment, the endosomal lysis ligand is presumed to adopt its active conformation at the pH of endosomes. The "active conformation" is the conformation in which the endosomal lysis ligand promotes the lysis of endosomes and / or the transport of the composition or components of the present invention from endosomes to the cytoplasm of cells. Examples of endosomal lysis ligands include GALA peptide (Subbarao et al., Biochemistry, 1987, 26:2964-2972), EALA peptide (Vogel et al., J.Am.Chem.Soc., 1996, 118:1581-1586), and their derivatives (Turk et al., Biochem.Biophys.Acta, 2002, 1559:56-68). In one embodiment, the endosomal lysis component may contain a chemical group (e.g., an amino acid) that undergoes a change in charge or protonation in response to a change in pH. The endosomal lysis component may be linear or branched.
[0207] Ligands can enhance transport, hybridization, and specificity properties, and can also enhance nuclease resistance of polymer molecules containing the resulting natural oligoribonucleotides or modified oligoribonucleotides, or any combination of monomers and / or natural ribonucleotides or modified ribonucleotides described herein.
[0208] Ligands can generally include, for example, therapeutic modifiers to enhance uptake; for example, diagnostic compounds or reporter groups to monitor distribution; crosslinking agents; and moieties that confer nuclease resistance. Common examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimetic compounds.
[0209] Ligands can be naturally occurring substances, such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or lipids. Ligands may also be recombinant or synthetic molecules, such as synthetic polymers, such as synthetic polyamino acids, or oligonucleotides (e.g., aptamers). Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphatidine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudo-peptide-polyamine, peptide-mimicking polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha-helix peptides.
[0210] Ligands may include targeting groups, such as cell-targeting or tissue-targeting agents, such as lectins, glycoproteins, lipids, or proteins that bind to specific cell types, such as kidney cells, as well as antibodies. Targeting groups may also be tyrotropin, melanotropin, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine (gulucosamine), polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamates, polyaspartates, lipids, cholesterol, steroids, bile acids, folates, vitamin B12, biotin, RGD peptides, RGD peptide mimes, or aptamers.
[0211] Other examples of ligands include dyes, inserts (e.g., acridine), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphylline, saffrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or chelating agents (e.g., EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetate, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-( Examples include oleoyl(colentic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., Antennapedia peptide, Tat peptide), alkylating agents, phosphates, amino acids, mercaptos, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino acids, alkyls, substituted alkyls, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacro rings), dinitrophenyl, HRP, or AP.
[0212] Ligands may be proteins, such as glycoproteins or peptides, such as molecules having a specific affinity for a co-ligand, or antibodies, such as antibodies that bind to specific cell types, such as cancer cells, endothelial cells, or osteocytes. Hormone and hormone receptors can also be cited as ligands. Non-peptide species can also be cited as ligands, such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent fucose, or aptamers. Ligands may also be, for example, lipopolysaccharides, p38 MAP kinase activators, or NF-κB activators.
[0213] The ligand may be a substance, such as a drug, that can increase the uptake of the iRNA agent into the cell by disrupting the cytoskeleton of the cell, for example, by disrupting the microtubules, microfilaments, and / or intermediate filaments of the cell. The drug may be, for example, taxone, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latruncrine A, phalloidin, swinford A, indanosine, or myoservin.
[0214] Ligands can increase the uptake of oligonucleotides into cells, for example, by activating inflammatory responses. Exemplary ligands that may have such effects include tumor necrosis factor α (TNFα), interleukin-1β, or gamma interferon.
[0215] In one embodiment, the ligand is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule preferably binds to a serum protein, such as human serum albumin (HSA). The HSA-binding ligand allows the conjugate to be distributed to a target tissue, such as a non-renal target tissue of the body. For example, the target tissue may be the liver, including the parenchymal cells of the liver. Other molecules that can bind to HSA can also be used as ligands. For example, naproxen or aspirin can be used. Lipid or lipid-based ligands can be used to (a) increase the resistance of the conjugate to degradation, (b) increase targeting or transport to target cells or cell membranes, and / or (c) modulate binding to a serum protein, such as HSA.
[0216] Lipid-based ligands can be used to modulate, for example, control the binding of a conjugate to a target tissue. For instance, a lipid or lipid-based ligand that binds more strongly to HSA is less likely to target the kidney and therefore less likely to be removed from the body. A lipid or lipid-based ligand that does not bind as strongly to HSA can be used to ensure the conjugate targets the kidney.
[0217] In a preferred embodiment, the lipid-based ligand binds to HSA. Preferably, the lipid-based ligand binds to HSA with sufficient affinity so that the conjugate is distributed, preferably to non-renal tissue. However, preferably, this affinity is not so strong that HSA-ligand binding cannot be reversed.
[0218] In another preferred embodiment, the lipid-based ligand binds weakly to or does not bind at all to the HSA, so that the conjugate is preferably distributed to the kidney. Other parts that target renal cells can also be used instead of or in addition to the lipid-based ligand.
[0219] In another embodiment, the ligand is a portion taken up by target cells, e.g., proliferating cells, e.g., a vitamin. These are particularly useful for treating disorders characterized by undesirable cell proliferation, e.g., malignant or non-malignant, e.g., cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include vitamin B, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. Also included are HAS, low-density lipoprotein (LDL), and high-density lipoprotein (HDL).
[0220] In another embodiment, the ligand is a cell permeabilizer, preferably a helix-type cell permeabilizer. Preferably, the activator is amphiphilic. Exemplary activators are peptides, such as tat or antennopedia. If the activator is a peptide, it can be modified, including the use of peptidyl mimes, inversion isomers, non-peptide bonds or pseudopeptide bonds, and D-amino acids. Preferably, the helix-type cell permeabilizer is an alpha-helix-type activator having a lipophilic phase and an oleophobic phase.
[0221] The ligand may be a peptide or a peptide mimetic. A peptide mimetic (also referred to herein as an oligopeptide mimetic) is a molecule that can be folded into a defined three-dimensional structure similar to that of a natural peptide. The peptide or peptide mimetic moiety may have an amino acid length of about 5 to 50, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids. The peptide or peptide mimetic may be, for example, a cell-permeable peptide, a cationic peptide, an amphiphilic peptide, or a hydrophobic peptide (for example, mainly composed of Tyr, Trp, or Phe). The peptide moiety may be a dendrimeric peptide, a restrictive peptide, or a cross-linked peptide. Alternatively, the peptide moiety may contain a hydrophobic membrane transport sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 4). RFGF analogs containing hydrophobic MTS (e.g., amino acid sequence AALLPVLLAAP) (SEQ ID NO: 5) may also be the targeting region. The peptide portion may be a "delivery" peptide, which can transport large polar molecules, including peptides, oligonucleotides, and proteins, across the cell membrane. For example, sequences derived from HIV Tat protein (GRKKRRQRRRPPQ) (SEQ ID NO: 6) and Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK) (SEQ ID NO: 7) have been shown to function as delivery peptides. Peptides or peptide mimes, e.g., peptides identified from phage display libraries or one-bead-one-compound (OBOC) combinatorial libraries, may also be encoded by random sequences of DNA (Lam et al., Nature, 354:82-84, 1991). Preferably, the peptide or peptide mimetic linked to the iRNA agent via incorporated monomer units is a cell-targeting peptide, such as an arginine-glycine-aspartate (RGD) peptide or RGD mimetic. The peptide portion can range in length from about 5 amino acids to about 40 amino acids.The peptide portion may undergo structural changes, for example, to enhance stability or direct three-dimensional properties. Any of the following structural changes can be utilized. The RGD peptide portion can be used to target tumor cells such as endothelial tumor cells or breast cancer tumor cells (Zitzmann et al., Cancer Res., 62:5139-43, 2002). The RGD peptide can facilitate the targeting of iRNA agents against tumors in various other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Preferably, the RGD peptide facilitates the targeting of iRNA agents against the kidney. The RGD peptide may be linear or cyclic and can be modified to facilitate targeting against specific tissues, for example, by glycosylation or methylation. For example, glycosylated RGD peptides are α. v iRNA agents can be delivered to tumor cells expressing β3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001). Peptides targeting markers abundant in proliferating cells can be used. For example, RGD-containing peptides and RGD-containing peptide mimetic can target cancer cells, particularly those that present integrins. Therefore, RGD peptides, RGD-containing cyclic peptides, RGD peptides containing D-amino acids, and synthetic RGD mimetic can be used. In addition to RGD, other parts that target integrin ligands can also be used. In general, such ligands can be used to control proliferating cells and angiogenesis. Preferred conjugates of this type of ligand target PECAM-1, VEGF, or other oncogenes, e.g., oncogenes described herein.
[0222] A "cell-permeable peptide" can permeate cells, such as microbial cells, such as bacterial or fungal cells, or mammalian cells, such as human cells. Peptides that permeate microbial cells may be, for example, α-helix linear peptides (e.g., LL-37 or seropine P1), disulfide bond-containing peptides (e.g., α-defensin, β-defensin, or bactenesin), or peptides containing only one or two dominant amino acids (e.g., PR-39 or indolicidine). Cell-permeable peptides may also include nuclear localization signals (NLS). For example, a cell-permeable peptide may be a bipartite amphiphilic peptide derived from the HIV-1 gp41 fusion peptide domain and the NLS of the SV40 large T antigen, such as MPG (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).
[0223] In one embodiment, the targeted peptide may be an amphiphilic α-helix peptide. Examples of amphiphilic α-helix peptides include, but are not limited to, secropine, lycotoxin, paradaxin, buforin, CPF, bombinin-like peptide (BLP), cathelicidine, ceratotoxin, S. clava peptide, hummus intestinal antimicrobial peptide (HFIAP), magainin, brevinin-2, dermaceptin, melittin, pleurocidine, H2A peptide, African clawed frog peptide, esculentinis-1, and kaerin. Preferably, a number of factors are considered to maintain the integrity of helix stability. For example, the maximum number of helix-stabilizing residues (e.g., leu, ala, or lys) and the minimum number of helix-destabilizing residues (e.g., proline, or cyclic monomer units) may be used. Capping residues may also be considered (e.g., Gly is an exemplary N-capping residue, and / or C-terminal amidation may be used to stabilize the helix by achieving additional hydrogen bonds). Stabilization may be achieved by the formation of salt bridges between oppositely charged residues separated at positions i±3 or i±4. Cationic residues, such as lysine, arginine, homo-arginine, ornithine, or histidine, may form salt bridges with anionic residues such as glutamic acid or aspartic acid.
[0224] Examples of peptide ligands and peptide mimetic ligands include natural peptides or modified peptides, such as D-peptides or L-peptides; α-peptides, β-peptides, or γ-peptides; N-methyl peptides; azapeptides; peptides having one or more amide bonds, i.e., peptide bonds, substituted with one or more urea bonds, thiourea bonds, carbamic acid bonds, or sulfonylurea bonds; or ligands having cyclic peptides.
[0225] The targeted ligand may be any ligand capable of targeting a specific receptor. Examples include folate, GalNAc, galactose, mannose, mannose-6P, sugar clusters, e.g., GalNAc clusters, mannose clusters, galactose clusters, or aptamers. A cluster is a combination of two or more sugar units. Targeted ligands also include integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL ligands, and HDL ligands. The ligand may be nucleic acid-based, e.g., an aptamer. The aptamer may be unmodified or have any combination of the modifications disclosed herein.
[0226] Endosome-releasing agents include imidazoles, poly- or oligoimidazoles, PEIs, peptides, fusion peptides, polycaboxylates, polycations, masked oligo- or polycations or anions, acetals, polyacetals, ketals / polyketyals, orthoesters, polymers with masked or unmasked cationic or anionic charges, and dendrimers with masked or unmasked cationic or anionic charges.
[0227] A PK modulator is a pharmacokinetic modulator. Examples of PK modulators include lipophiles, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, and vitamins. Examples of PK modulators, though not limited to these, include cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, and biotin. Oligonucleotides containing numerous phosphorothioate links are also known to bind to serum proteins, and therefore, short-chain oligonucleotides containing numerous phosphorothioate links in their backbone, such as oligonucleotides of approximately 5, 10, 15, or 20 bases, can also be applied to the present invention as ligands (e.g., as PK-modulating ligands).
[0228] In addition, aptamers that bind to serum components (e.g., serum proteins) can also be applied to the present invention as PK-modulating ligands.
[0229] Other ligand conjugates applicable to the present invention are described in U.S. Patent Application No. 10 / 916,185 filed August 10, 2004; No. 10 / 946,873 filed September 21, 2004; No. 10 / 833,934 filed August 3, 2007; No. 11 / 115,989 filed April 27, 2005; and No. 11 / 944,227 filed November 21, 2007, the full disclosures of which are incorporated herein by reference.
[0230] When two or more ligands are present, the ligands may all have the same properties, or they may all have different properties, or some ligands may have the same properties while others have different properties. For example, a ligand may have targeting properties, endosomal activity, or PK regulatory properties. In a preferred embodiment, all ligands have different properties.
[0231] Ligands can be bound to oligonucleotides at various positions, e.g., the 3' end, the 5' end, and / or internal positions. In preferred embodiments, the ligand is bound to the oligonucleotide via an intervening tether, e.g., a carrier described herein. When a monomer is incorporated into a growing chain, the ligand or tether ligand may be present on this monomer. In some embodiments, the ligand can be incorporated after the “precursor” monomer has been incorporated into the growing chain, by binding to this “precursor” monomer. For example, a tether with an amino terminus (i.e., no ligand is bound), e.g., TAP-(CH2) n Monomers containing NH2 can be incorporated into a growing oligonucleotide chain. In a subsequent operation, after the precursor monomer has been incorporated into the chain, a ligand containing an electrophile, such as a pentafluorophenyl ester or aldehyde group, can then be attached to the precursor monomer by bonding the electrophile of the ligand to the terminal nucleophile of the tether of the precursor monomer.
[0232] In another example, a monomer having a chemical group suitable for participating in a click reaction can be incorporated into, for example, a tether / linker with an azide or alkyne terminal. In the subsequent operation, after the precursor monomer has been incorporated into the chain, a ligand having a complementary chemical group, such as an alkyne or azide, can be attached to the precursor monomer by binding both the alkyne and the azide together.
[0233] In the case of double-stranded oligonucleotides, the ligand can bind to one or both strands. In some embodiments, the double-stranded iRNA agent contains a ligand conjugated to the sense strand. In other embodiments, the double-stranded iRNA agent contains a ligand conjugated to the antisense strand.
[0234] In some embodiments, ligands can conjugate to nucleic acid bases, sugar moieties, or nucleoside bonds of nucleic acid molecules. Conjugation to purine nucleic acid bases or their derivatives can occur at any position, including intra-ring and extra-ring atoms. In some embodiments, the 2, 6, 7, or 8 positions of the purine nucleic acid base are bound to the conjugation moiety. Conjugation to pyrimidine nucleic acid bases or their derivatives can occur at any position. In some embodiments, the 2, 5, and 6 positions of the pyrimidine nucleic acid base can be substituted for the conjugation moiety. Conjugation to the sugar moiety of a nucleoside can occur at any carbon atom. Examples of carbon atoms in the sugar moiety that can bind to the conjugation moiety include the 2', 3', and 5' carbon atoms. The 1' position can also bind to the conjugation moiety, for example, a debasic residue. Nucleoside bonds can also retain the conjugation moiety. In the case of phosphorus-containing bonds (e.g., phosphodiesters, phosphorothioates, phosphorodithioates, and phosphoramidates), the conjugate moiety can bond directly to the phosphorus atom or to the O, N, or S atoms bonded to the phosphorus atom. In the case of nucleoside bonds containing amines or amides (e.g., PNAs), the conjugate moiety can bond to the nitrogen atom of the amine or amide, or to an adjacent carbon atom.
[0235] Any suitable ligand in the field of RNA interference can be used, but such ligands are typically carbohydrates, such as monosaccharides (e.g., GalNAc), disaccharides, trisaccharides, tetrasaccharides, and polysaccharides.
[0236] Linkers that conjugate ligands to nucleic acids include the linkers described above. For example, the ligand may be one or more GalNAc (N-acetylglucosamine) derivatives attached by a divalent or trivalent branched linker.
[0237] In one embodiment, the dsRNA of the present invention is conjugated to bivalent and trivalent branched linkers having a structure represented by any of the following formulas (V) to (VII): [ka] During the ceremony, q 2A , q 2B , q 3A , q 3B q4 A , q 4B , q 5A , q 5B , and q 5C Each instance independently represents a number between 0 and 20, and the repeating units may be the same or different; P 2A , P 2B , P 3A , P 3B , P 4A , P 4B , P 5A , P 5B , P 5C , T 2A , T 2B , T 3A , T 3B , T 4A , T 4B , T 4A , T 5B , T 5C Each of these independently represents either nonexistence, CO, NH, O, S, OC(O), NHC(O), CH2, CH2NH, or CH2O; Q 2A Q 2B Q 3A Q 3B Q 4A Q 4B Q 5A Q 5B Q 5C Each element independently represents either nonexistent, alkylene, or substituted alkylene, and one or more methylene groups are O, S, S(O), SO2, N(R) N It can be interrupted or terminated by one or more of the following: C(R')=C(R''), C≡C, or C(O); R 2A , R 2B, R 3A , R 3B , R 4A , R 4B , R 5A , R 5B , R 5C Each of these exists independently as NH, O, S, CH2, C(O)O, C(O)NH, and NHCH(R). a )C(O), -C(O)-CH(R a )-NH-, CO, CH=NO, [ka] , or representing heterocyclines; L 2A , L 2B , L 3A , L 3B , L 4A , L 4B , L 5A , L 5B , and L 5C represents a ligand; that is, each independently represents a monosaccharide (e.g., GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R a This is either H or an amino acid side chain.
[0238] Trivalent conjugate GalNAc derivatives, such as those of formula (VII), are particularly useful when used in conjunction with RNAi agents to inhibit the expression of target genes: [ka] In the formula, L 5A , L 5B , and L 5C This represents a monosaccharide, such as a GalNAc derivative. Suitable divalent and trivalent branched linker group conjugate GalNAc derivatives include, but are not limited to, the following compounds: [ka] [ka] Includes.
[0239] In other embodiments, the RNAi agent of the present invention is an activator selected from the group consisting of AD-45163, AD-45165, AD-51544, AD-51545, AD-51546, and AD-51547.
[0240] Mai. Pharmaceutical composition The RNAi agents of the present invention can be formulated for administration in any convenient manner used for drugs for humans or animals, due to their similarity to other pharmaceuticals. Pharmaceutical compositions comprising the RNAi agents of the present invention may be, for example, solutions with or without buffers, or compositions comprising a pharmaceutically acceptable carrier. Examples of such compositions include water-soluble or crystalline compositions, liposomal formulations, micelle formulations, emulsions, and gene therapy vectors.
[0241] In the method of the present invention, the RNAi agent can be administered dissolved in a solution. Free RNAi agents can be administered dissolved in a non-buffer, such as physiological saline or water. Alternatively, free siRNA may be administered dissolved in a suitable buffer. Examples of buffers include acetate, citrate, prolamin, carbonate, phosphate, or any combination thereof. In preferred embodiments, the buffer is phosphate-buffered saline (PBS). The pH and osmolality of the buffer containing the RNAi agent can be adjusted to be suitable for administration to the target.
[0242] In some embodiments, the buffer further includes an agent for controlling the osmolality of the solution so that the osmolality is maintained at a desired value, for example, the physiological value of human plasma. Solutes that can be added to the buffer to control the osmolality include, but are not limited to, proteins, peptides, amino acids, non-metabolic polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolality of the solution is a salt. In certain embodiments, the agent for controlling the osmolality of the solution is sodium chloride or potassium chloride.
[0243] In other embodiments, the RNAi agent is formulated as a composition comprising one or more RNAi agents and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable carrier” includes any solvent, dispersion medium, coating, antimicrobial agent, antifungal agent, isotonic agent, and absorption retarder suitable for drug administration. The use of such media and activators for pharmaceutically active substances is well known in the art. Any conventional media or activator is intended to be used in the composition unless it is incompatible with the active compound. Co-active compounds may be included in the composition.
[0244] In one embodiment, the RNAi preparation comprises at least a second therapeutic agent (e.g., an agent other than RNA or DNA). For example, an RNAi composition for the treatment of TTR-related diseases, such as transthyretin-associated hereditary amyloidosis (familial polyneuropathy (FAP)), could be a known drug for improving FAP, such as tafamidis (INN, or Fx-1006A or Vyndaqel).
[0245] RNAi formulations can exist in various states. In some cases, the composition is at least partially crystalline, homogeneously crystalline, and / or anhydrous (e.g., containing less than 80%, less than 50%, less than 30%, less than 20%, or less than 10% water). In other cases, the RNAi agent is dissolved in an aqueous phase, for example, a water-containing solution.
[0246] The aqueous and crystalline compositions can be contained in a delivery vehicle, e.g., liposomes (especially in the case of the aqueous phase) or particles (e.g., microparticles which may be suitable for the crystalline composition). Generally, RNAi agent compositions are formulated to conform to the intended administration method described herein. For example, in certain embodiments, the composition is prepared by at least one of the following methods: spray drying, freeze-drying, vacuum drying, evaporation, fluidized bed drying, or a combination of these techniques; or sonication, freeze-drying, condensation, and other self-assembly using lipids.
[0247] RNAi preparations can be formulated in combination with other activators, such as other therapeutic agents, or activators that stabilize RNAi agents, such as proteins that form complexes with RNAi agents to form iRNPs. Other activators include chelating agents, such as EDTA (e.g., divalent cations, e.g., Mg) 2+ Examples include salts (for removing), RNA-degrading enzyme inhibitors (e.g., broadly specific RNA-degrading enzyme inhibitors, e.g., RNAsin).
[0248] In one embodiment, the RNAi preparation includes another siRNA compound, for example, a second RNAi agent capable of mediating RNAi to a second gene or the same gene. Other preparations may include at least 3, 5, 10, 20, 50, or 100 or more different RNAi gene species. Such RNAi agents can mediate RNAi to a similar number of different genes.
[0249] The iRNA agents of the present invention can be formulated for pharmaceutical use. A pharmaceutically acceptable composition contains one or more dsRNA agents of any of the embodiments described above, either alone or with one or more pharmaceutically acceptable carriers (additives), excipients, and / or diluents, in a therapeutic or prophylactic effective amount.
[0250] A method for preparing the pharmaceutical composition of the present invention comprises the step of binding the RNAi agent of the present invention to a carrier and optionally one or more auxiliary components. Generally, the composition is prepared by uniformly binding the RNAi agent of the present invention to a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
[0251] Pharmaceutical compositions can be specially formulated to be administered in solid or liquid form, including the following adapted administrations: (1) oral administration of, for example, aqueous drugs (aqueous or non-aqueous solutions, or suspensions), tablets, e.g., buccal, sublingual, and tablets for internal absorption, boluses, powders, granules, and pastes for application to the tongue; (2) parenteral administration, for example, as sterile solutions or suspensions, or as sustained-release formulations, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection; (3) topical application, for example, as creams, ointments, or controlled-release patches or sprays applied to the skin; (4) intravaginal or rectal administration, for example, as pessaries, creams, or foams; (5) sublingual administration; (6) intraocular administration; (7) transdermal administration; or (8) intranasal administration. Subcutaneous or intravenous administration may be particularly advantageous.
[0252] The phrase "pharmaceutically acceptable" is used herein to refer to compounds, materials, compositions, and / or dosage forms that are within the bounds of reasonable medical judgment, suitable for contact with human and animal tissues without causing excessive toxicity, irritation, allergic reactions, or other problems or complications, commensurate with a reasonable efficacy-to-risk ratio.
[0253] As used herein, the phrase “pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition, or vehicle involved in the transport or transfer of a compound of interest from one organ or part of the body to another, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc, magnesium, calcium stearate, zinc stearate, or steric acid), or a solvent that encapsulates the material. Each carrier must be “acceptable” in that it is compatible with the other components of the composition and is not harmful to the patient. Some examples of materials that may serve as pharmaceutically acceptable carriers include: (1) sugars, e.g., lactose, glucose, and sucrose; (2) starches, e.g., corn starch and potato starch; (3) cellulose and its derivatives, e.g., sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants, e.g., magnesium state. (1) state, sodium lauryl sulfate, and talc; (8) excipients, e.g., cocoa butter and suppository wax; (9) oils, e.g., peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, e.g., polyethylene glycol; (11) polyols, e.g., glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters, e.g., ethyl oleate and ethyl laurate; (13) agar; (14) loose (15) Auxiliaries, e.g., magnesium hydroxide and aluminum hydroxide; (16) Alginic acid; (17) Pyrogen-free water; (18) Isotonic saline solution; (19) Ringer's solution; (10) Ethyl alcohol; (21) pH buffer; (22) Polyesters, polycarbonates, and / or polyanhydrides; (23) Fillers, e.g., polypeptides and amino acids; (24) Serum components, e.g., serum albumin, HDL, and LDL; and (25) Other non-toxic suitable substances used in pharmaceutical compositions.
[0254] This composition can be conveniently provided in unit dosage forms and can be prepared by any method well known in the field of pharmacy. The amount of RNAi agent that can be combined with a carrier material to produce a single dosage form varies depending on the patient and the specific method of administration. Generally, the amount of RNAi agent that can be combined with a carrier material to produce a single dosage form is the amount that yields the desired effect, e.g., a therapeutic or prophylactic effect. Generally, out of 100%, this amount is in the range of about 0.1% to about 99%, preferably about 5% to about 70%, and most preferably about 10% to about 30% of the RNAi agent.
[0255] In certain embodiments, the composition of the present invention may include excipients selected from the group consisting of cyclodextrin, cellulose, liposomes, micelle-forming agents such as bile acids, and polymer carriers such as polyesters and polyanhydrides; and the RNAi agent of the present invention. In certain embodiments, the above-described composition makes the RNAi agent of the present invention orally administrative.
[0256] In some cases, it is desirable to delay the absorption of RNAi agents administered by subcutaneous or intramuscular injection in order to prolong the effect of the RNAi agent. This can be achieved by using a liquid suspension of crystalline or amorphous material that is poorly soluble in water. The absorption rate of the RNAi agent is then determined by the dissolution rate, which may depend on the size and morphology of the crystals. Alternatively, delayed absorption of parenterally administered RNAi agents can be achieved by dissolving or suspending the RNAi agent in an oily vehicle.
[0257] Liposomes The RNAi agents of the present invention can be formulated for delivery in membrane molecular assemblies, such as liposomes or micelles. As used herein, the term “liposome” refers to a vesicle composed of amphiphilic lipids comprising at least one bilayer, e.g., one or more bilayers. Liposomes include monolayer and multilayer vesicles having a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the RNAi agent composition. The lipophilic material isolates the aqueous interior from the aqueous exterior, which typically does not contain the RNAi agent composition, but may in some examples. Liposomes are useful for the transport and delivery of the active ingredient to the site of action. Because the liposome membrane is structurally similar to that of biological membranes, when a liposome comes into contact with tissue, the liposome bilayer fuses with the bilayer of the cell membrane. As the integration of the liposome with the cell progresses, the internal aqueous component containing the RNAi agent is delivered into the cell, where the RNAi agent can specifically bind to the target RNA and mediate RNAi. In some cases, liposomes can be specifically targeted, for example, to induce RNAi agents into specific cell types.
[0258] Liposomes containing RNAi agents can be prepared in various ways. For example, the lipid component of the liposome is dissolved in a detergent, thereby forming micelles with the lipid component. For instance, the lipid component can be an amphiphilic cationic lipid or a lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholates, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent preparation is then added to the micelles containing the lipid component. The cationic groups on the lipid interact with the RNAi agent, condensing around it to form liposomes. After condensation, the detergent is removed, for example, by dialysis, to obtain the RNAi agent liposome preparation.
[0259] If necessary, a support compound to aid condensation can be added during the condensation reaction, for example, by controlled addition. For example, the support compound can be a polymer other than nucleic acid (e.g., spermine or spermidine). The pH can also be adjusted to suit condensation.
[0260] A method for forming a stable polynucleotide delivery vehicle that incorporates a polynucleotide / cationic lipid complex as a structural component of the delivery vehicle is further described in International Publication No. 96 / 37194, the full disclosure of which is incorporated herein by reference. Formation of liposomes is described by Felgner, PLet al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987; U.S. Pat. No. 4,897,355; U.S. Pat. No. 5,171,678; al.Biochim.Biophys.Acta 557:9,1979;Szoka,et al.Proc.Natl.Acad.Sci.75:4194,1978;Mayhew,et al.Biochim.Biophys.Acta 775:169,1984;Kim,et al.Biochim.Biophys.Acta 728:339,1983; and Fukunaga, et al. This may also include one or more embodiments of the exemplary methods described in al. Endocrinol. 115:757, 1984. Techniques commonly used to prepare lipid aggregates of a suitable size for use as a delivery vehicle include sonication and freeze-thaw and extrusion (see, e.g., Mayer, et al. Biochim. Biophys. Acta 858:161, 1986). If consistently small (50–200 nm) and relatively uniform aggregates are desired, microfluidization can be used (Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984). Such methods are readily adaptable for packaging RNAi preparations within liposomes.
[0261] pH-sensitive or negatively charged liposomes engulf nucleic acid molecules rather than form complexes with them. Because both the nucleic acid molecules and the lipids are similarly charged, repulsion occurs rather than complex formation. However, some nucleic acid molecules are taken up into the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding thymidine kinase genes to a cell monolayer in culture. Expression of the exogenous gene was detected in target cells (Zhou et al., Journal of Controlled Release, 19, (1992) 269-274).
[0262] One important type of liposome composition contains phospholipids other than naturally derived phosphatidylcholine. Neutral liposome compositions can be formed from, for example, dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome compositions are generally formed from dimyristoylphosphatidylglycerol, and anionic fusion liposomes are mainly formed from dioleoylphosphatidylethanolamine (DOPE). Another type of liposome composition is formed from phosphatidylcholine (PC), such as soy PC and egg PC. Yet another type is formed from a mixture of phospholipids and / or phosphatidylcholine and / or cholesterol.
[0263] Other methods for introducing liposomes into cells in vitro and in vivo include U.S. Patent Nos. 5,283,185; 5,171,678; International Publication No. 94 / 00569; International Publication No. 93 / 24640; International Publication No. 91 / 16024; Felgner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and Strauss EMBO J. 11:417, 1992.
[0264] In one embodiment, cationic liposomes are used. Cationic liposomes have the advantage of being able to fuse with the cell membrane. Non-cationic liposomes cannot efficiently fuse with the plasma membrane, but they are taken up by macrophages in vivo and can therefore be used to deliver RNAi agents to macrophages.
[0265] Further advantages of liposomes include: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can encapsulate a variety of water-soluble and lipid-soluble drugs; and liposomes can protect RNAi agents encapsulated within their internal compartments from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposomal formulations include the charge of the lipid surface, vesicle size, and the volume of the liposome in water.
[0266] Using a positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), it is possible to form small liposomes that spontaneously interact with nucleic acids to form lipid-nucleic acid complexes. These lipid-nucleic acid complexes can then fuse with negatively charged lipids in the cell membrane of tissue culture cells, thereby delivering RNAi agents (see, for example, Felgner, Plet al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987, and U.S. Patent No. 4,897,355, which describes the use of DOTMA and its DNA).
[0267] DOTMA analogs, such as 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP), can be used in combination with phospholipids to form vesicles that complex with DNA. Lipofectin® (Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for delivering highly anionic nucleic acids to living tissue culture cells, which contain positively charged DOTMA liposomes that spontaneously interact with negatively charged polynucleotides to form complexes. When sufficiently positively charged liposomes are used, the net charge of the resulting complex is also positive. The positively charged complex thus prepared spontaneously adheres to negatively charged cell surfaces, fuses with the plasma membrane, and effectively delivers functional nucleic acids, for example, to tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Indiana), differs from DOTMA in that the oleoyl portion is linked by an ester rather than an ether linkage.
[0268] Other reported cationic lipid compounds include those conjugated to various parts of a lipid, such as carboxyspermine, including compounds such as 5-carboxyspermylglycine dioctaoleoylamide ("DOGS") (Transfectam®, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5-carboxyspermylamide ("DPPES") (see, for example, U.S. Patent No. 5,171,678).
[0269] Other cationic lipid conjugates include lipid derivatives of cholesterol ("DC-Chol") formulated by being incorporated into liposomes in combination with DOPE (see Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolylysine, formed by conjugating polylysine with DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). In certain cell lines, such liposomes containing conjugated cationic lipids are said to exhibit lower toxicity and achieve more efficient transfection than DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Maryland). Other cationic lipids suitable for oligonucleotide delivery are described in International Publication Nos. 98 / 39359 and 96 / 37194.
[0270] Liposome formulations are particularly well-suited for topical administration, and liposomes offer several advantages over other formulations. These advantages include reduced side effects associated with high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to deliver RNAi agents to the skin. In some applications, liposomes are also used to deliver RNAi agents to epithelial cells and to facilitate the penetration of RNAi agents into skin tissue, such as the skin. For example, liposomes can be applied topically. Local delivery of drugs formulated as liposomes to the skin has been demonstrated (e.g., Weiner et al., Journal of Drug Targeting, 1992, vol.2, 405-410 and du Plessis et al., Antiviral Research, 18, 1992, 259-265; Mannino, R. J. and Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T. et al. Gene 56:267-276, 1987; Nicolau, C. et al. Meth. Enz. 149:157-176, 1987; Straubinger, R. and Papahadjopoulos, D. Meth. Enz. 101:512-527, 1983; Wang, C. and See Huang, L., Proc. Natl. Acad. Sci. USA 84:7851-7855, 1987.
[0271] Nonionic liposome systems were also tested to determine their practicality in drug delivery to the skin, particularly in systems containing nonionic surfactants and cholesterol. Nonionic liposome formulations containing Novasome I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver drugs to the dermis of mouse skin. Such formulations containing RNAi agents are useful for treating skin disorders.
[0272] Liposomes containing RNAi agents can be formed to be highly deformable. Such deformability can allow liposomes to enter pores smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposome. Transfersomes can be prepared by adding surface edge activators, usually surfactants, to a standard liposome composition. Transfersomes containing RNAi agents can be delivered to keratinocytes in the skin, for example, by subcutaneous injection. To pass through intact mammalian skin, the lipid vesicles must pass through a series of micropores, each less than 50 nm in diameter, under the influence of a suitable transcutaneous gradient. In addition, due to the properties of lipids, such transfersomes can be self-optimizing (e.g., adapting to the shape of skin pores), self-repairing, and often reach their target without fragmentation, and are often self-loading.
[0273] Other formulations applicable to the present invention are described in U.S. Provisional Patent Application No. 61 / 018,616, filed January 2, 2008; No. 61 / 018,611, filed January 2, 2008; No. 61 / 039,748, filed March 26, 2008; No. 61 / 047,087, filed April 22, 2008; and No. 61 / 051,528, filed May 8, 2008. Formulations applicable to the present invention are also described in the brochure for International Application PCT / US2007 / 080331, filed October 3, 2007.
[0274] surfactant Surfactants have found a wide range of applications in formulations, such as emulsions (including microemulsions) and liposomes (as described above). RNAi agent (or precursor, e.g., larger dsiRNA that can be processed into siRNA, or DNA encoding siRNA or a precursor) compositions may contain surfactants. In one embodiment, siRNA is formulated as an emulsion containing a surfactant. The most common method for classifying and ranking the properties of numerous different types of both natural and synthetic surfactants is by the use of hydrophilic / lipophilic balance (HLB). The properties of the hydrophilic group are the most useful means of classifying different surfactants used in formulations (Rieger, in “Pharmaceutical Dosage Forms,” Marcel Dekker, Inc., New York, NY, 1988, p.285).
[0275] When a surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants have a wide range of applications in pharmaceutical products and can be used for a wide range of pH values. Generally, their HLB values range from 2 to about 18 depending on their structure. Examples of nonionic surfactants include nonionic esters, such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers, such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers, also belong to this class. Polyoxyethylene surfactants are the most common members of the nonionic surfactant class.
[0276] A surfactant molecule is classified as anionic if it has a negative charge when dissolved or dispersed in water. Examples of anionic surfactants include carboxylates, such as soaps, acyl lactates, acylamides of amino acids, sulfuric acid esters, such as alkyl sulfates and alkyl ethoxylated sulfates, sulfonates, such as alkylbenzene sulfonates, acyl isethionates, acyl taurates, and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are alkyl sulfates and soaps.
[0277] A surfactant molecule is classified as cationic if it has a positive charge when dissolved or dispersed in water. Examples of cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most commonly used members of this class.
[0278] A surfactant molecule is classified as amphoteric if it has the ability to possess either a positive or negative charge. Examples of amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkyl betaines, and phosphatides.
[0279] The use of surfactants in drug products, formulations, and emulsions is outlined (Rieger, in “Pharmaceutical Dosage Forms”, Marcel Dekker, Inc., New York, NY, 1988, p.285).
[0280] Micelles and other membrane formulations The RNAi agent of the present invention can also be provided as a micelle formulation. In this specification, "micelle" is defined as a specific type of molecular assembly in which the amphiphilic molecules are arranged in a spherical structure such that all hydrophobic portions of the amphiphilic molecules face inward and the hydrophilic portions are in contact with the surrounding aqueous phase. The opposite configuration exists when the environment is hydrophobic.
[0281] Mixed micelle formulations suitable for transdermal delivery include an aqueous solution of siRNA composition and alkali metals C8-C8. 22 These can be prepared by mixing alkyl sulfates with micelle-forming compounds. Exemplary micelle-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleate, monolaurate, borage oil, evening primrose oil, menthol, trihydroxyoxocolanyglycine and its pharmaceutically acceptable salts, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and their analogues, polydocanol alkyl ethers and their analogues, chenodeoxycholates, deoxycholates, and mixtures thereof. The micelle-forming compounds can be added simultaneously with or after the alkali metal alkyl sulfates. Mixed micelles are formed from a mixture of substantially any type of component, although vigorous mixing is performed to provide smaller sized micelles.
[0282] In one method, a first micelle composition containing an siRNA composition and at least an alkali metal alkyl sulfate is prepared. The first micelle composition is then mixed with at least three micelle-forming compounds to form a mixed micelle composition. In another method, the micelle composition is prepared by mixing the siRNA composition, an alkali metal alkyl sulfate, and at least one micelle-forming compound, and then adding the remaining micelle-forming compounds and mixing vigorously.
[0283] Phenol and / or m-cresol can be added to the mixed micelle composition to stabilize the formulation and protect it from bacterial growth. Alternatively, phenol and / or m-cresol may be added together with the micelle-forming components. An isotonic agent, such as glycerin, may be added after the formation of the mixed micelle composition.
[0284] To deliver micelle formulations as a spray, the formulation can be placed in an aerosol dispenser, and this dispenser is filled with the spray. Under pressurization, the spray is in liquid form within the dispenser. The component ratio is adjusted so that the aqueous phase and the spray phase become one, i.e., only one phase exists. If two phases are present, it is necessary to shake the dispenser before dispensing a portion of the contents, for example, through a metering valve. The amount of pharmaceutical product dispensed is sprayed in a fine mist from the metering valve.
[0285] Examples of spraying agents include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ethers, and diethyl ethers. In certain embodiments, HFA 134a (1,1,1,2-tetrafluoroethane) may be used.
[0286] The specific concentration of essential components can be determined through relatively simple experiments. For oral absorption, it is often desirable to increase the dosage administered by injection or via the gastrointestinal tract by, for example, at least two or three times.
[0287] particle In another embodiment, the RNAi agent of the present invention may be contained in particles, such as microparticles. The microparticles may be produced by spray drying, but may also be produced by other methods including freeze-drying, evaporation, fluidized bed drying, vacuum drying, or a combination of these techniques.
[0288] IV. Methods for inhibiting TTR expression The present invention also provides a method for inhibiting the expression of transthyretin (TTR) in cells. This method includes the step of contacting cells with an amount of RNAi agent effective in inhibiting the expression of TTR in cells, such as a double-stranded RNAi agent, to inhibit the expression of TTR in cells.
[0289] The step of contacting cells with an RNAi agent, such as a double-stranded RNAi agent, can be performed in vitro or in vivo. The in vivo step of contacting cells with an RNAi agent includes contacting cells or cell populations in the body of a subject, such as a human subject, with the RNAi agent. A combination of in vitro and in vivo methods of cell contact is also possible. The step of cell contact may be direct or indirect, as described above. Furthermore, the step of cell contact can be achieved via a targeted ligand, which may include any ligand described herein or known in the art. In preferred embodiments, the targeted ligand is a carbohydrate moiety, such as a GalNAc3 ligand, or any other ligand that directs the RNAi agent to a site of interest, such as the liver of the subject.
[0290] As used herein, the term “inhibit” is used interchangeably with “reduce,” “silence,” “downcontrol,” “suppress,” and other similar terms, and includes all levels of inhibition.
[0291] The phrase "inhibit TTR expression" refers to the inhibition of expression of any TTR gene (e.g., mouse TTR gene, rat TTR gene, monkey TTR gene, or human TTR gene) and variants or mutants of the TTR gene. Thus, the TTR gene may be a wild-type TTR gene, a mutant TTR gene (e.g., a mutant TTR gene resulting in systemic amyloid deposition), or a genetically modified cell, cell population, or recombinant TTR gene in the context of an organism.
[0292] "Inhibiting TTR gene expression" includes inhibition of TTR gene expression at any level, e.g., at least partial suppression of TTR gene expression. TTR gene expression can be assessed based on the level of any variable associated with TTR gene expression, e.g., the level of TTR mRNA, the level of TTR protein, or the number or extent of amyloid deposits. This level can be assessed, for example, in individual cells or cell populations, including samples derived from the subject.
[0293] Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables related to TTR expression relative to the control level. The control level may be any type of control level used in this art, e.g., a pre-treatment reference level, or a level determined from similar subjects, cells, or samples that have been untreated or treated with a control (e.g., a buffer-only control or an inactivator control).
[0294] In some embodiments of the method of the present invention, TTR gene expression is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
[0295] Inhibition of TTR gene expression can be indicated by a decrease in the amount of mRNA expressed by a first cell or cell group (such cells may be present, for example, in a sample derived from the subject). This first cell or cell group is treated such that the TTR gene is described and TTR gene expression is inhibited compared to a second cell or cell group (control cells) that are substantially identical to the first cell or cell group but untreated (for example, by contacting one or more cells with the RNAi agent of the present invention, or by administering the RNAi agent of the present invention to a subject in which or in which these cells are present). In a preferred embodiment, this inhibition is evaluated by expressing the level of mRNA in the treated cells as a percentage of the level of mRNA in the control cells using the following formula:
number
[0296] Alternatively, inhibition of TTR gene expression can be evaluated in terms of a reduction in parameters functionally related to TTR gene expression, such as TTR protein expression, retinol-binding protein levels, vitamin A levels, or the presence of amyloid deposition containing TTR. Silencing of the TTR gene can be determined in any cell expressing TTR constitutively or by genomic engineering using any assay known in the art. The liver is the primary site of TTR expression. Other prominent sites of expression include the choroid plexus, retina, and pancreas.
[0297] Inhibition of TTR protein expression can be indicated by a decrease in the level of TTR protein expressed by cells or cell populations (e.g., the level of protein expressed in a sample derived from the subject). As described above for the evaluation of mRNA suppression, inhibition of protein expression levels in treated cells or cell populations can similarly be expressed as a percentage of the protein level in control cells or control cell populations.
[0298] Control cells or groups of cells that can be used to evaluate the inhibition of TTR gene expression include cells or groups of cells that have not been exposed to the RNAi agent of the present invention. For example, control cells or groups of cells may be derived from individual subjects (e.g., human or animal subjects) before they are treated with the RNAi agent.
[0299] The level of TTR mRNA expressed by cells or cell populations, or the level of circulating TTR mRNA, can be determined using any method known in the art to assess mRNA expression. In one embodiment, the TTR expression level in a sample is determined by detecting a transcribed polynucleotide, such as the mRNA of the TTR gene, or a portion thereof. RNA can be extracted from cells using RNA extraction techniques, such as acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), the RNeasy RNA preparation kit (Qiagen), or PAXgene (PreAnalytix, Switzerland). Typical assays utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNA-degrading enzyme protection assays (Melton et al., Nuc. Acids Res. 12:7035), Northern blotting, in situ hybridization, and microassay analyses. Circulating TTR mRNA can be detected using the method described in international application PCT / US2012 / 043584, the full disclosure of which is incorporated herein by reference.
[0300] In one embodiment, the expression level of a TTR is determined using a nucleic acid probe. As used herein, the term "probe" refers to any molecule that can selectively bind to a particular TTR. Probes may be synthesized by those skilled in the art or derived from a suitable biological specimen. Probes may be specially designed to be labeled. Examples of molecules that can be used as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
[0301] Isolated mRNA can be used in hybridization or amplification assays, including, but not limited to, Southern blot analysis, Northern blot analysis, polymerase chain reaction (PCR) analysis, and probe assays. One method for determining mRNA levels involves contacting isolated mRNA with a nucleic acid molecule (probe) that can hybridize to TTR mRNA. In one embodiment, mRNA is immobilized on a solid surface and contacted with the probe, for example, by moving the isolated mRNA on an agarose gel to transfer the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, probe(s) are immobilized on a solid surface and mRNA is contacted with probe(s), for example, an Affymetrix gene chip array. Those skilled in the art can easily adapt known mRNA detection methods for use in determining TTR mRNA levels.
[0302] Alternative methods for determining TTR expression levels in a sample include processes such as nucleic acid amplification of mRNA and / or reverse transcriptase (for cDNA preparation) in the sample, e.g., RT-PCR (experimental embodiments described in Mullis, 1987, U.S. Patent No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), autonomous sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcription amplification systems (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), and Q-Beta Replicase (Lizardi et al. (1988) Bio / Technology). Amplification is performed by 6:1197), rolling circle replication (Lizardi et al., U.S. Patent No. 5,854,033), or any other nucleic acid amplification method, followed by detection of the amplified molecules using techniques well known to those skilled in the art. These detection schemes are particularly useful for detecting nucleic acid molecules when the number of such molecules is very small. In certain embodiments of the present invention, the expression level of TTR is determined by quantitative fluorescence RT-PCR (i.e., the TaqMan® system).
[0303] The expression level of TTR mRNA can be monitored using membrane blots (such as those used for hybridization analysis, e.g., Northern, Southern, and dot blots), or microwells, sample tubes, gels, beads, or fibers (or any solid support containing bound nucleic acids). See U.S. Patents No. 5,770,722, 5,874,219, 5,744,305, 5,677,195, and 5,445,934, which are incorporated herein by reference. Determination of TTR expression levels may also include the use of nucleic acid probes in solution.
[0304] In preferred embodiments, mRNA expression levels are evaluated using branched DNA (bDNA) assays or real-time PCR (qPCR). The use of such methods is described and illustrated in the examples provided herein.
[0305] The expression level of TTR protein can be determined using any method known in the art for measuring protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high-performance liquid chromatography (HPLC), thin-layer chromatography (TLC), high-diffusion chromatography, liquid or gel precipitation reactions, absorption spectroscopy, colorimetric analysis, spectroscopic quantification, flow cytometry, immunodiffusion (single or dual), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), immunofluorescence analysis, and electrochemiluminescence analysis.
[0306] In some embodiments, the effectiveness of the methods of the present invention can be monitored by detecting or monitoring a reduction in amyloid-TTR deposition. As used herein, a reduction in amyloid-TTR deposition includes any reduction in the size, number, or severity of TTR deposition in the organ or region of interest, or prevention or reduction of TTR deposition formation, which can be assessed in vitro or in vivo using any method known in the art. For example, several methods for assessing amyloid deposition are described in Gertz, MA & Rajukumar, SV (Editors) (2010), Amyloidosis: Diagnosis and Treatment, New York: Humana Press. Methods for assessing amyloid deposition include biochemical analysis and visual or computer assessment of amyloid deposition, which is performed, for example, using immunohistochemical staining, fluorescent labeling, light microscopy, electron microscopy, fluorescence microscopy, or other types of microscopy. Invasive or non-invasive imaging techniques, including, for example, CT, PET, or NMR / MRI imaging, can be used to assess amyloid deposition.
[0307] The methods of the present invention can reduce TTR deposition in various tissues or organs of the body, including, but are not limited to, the heart, liver, spleen, esophagus, stomach, intestines (ileum, duodenum, and colon), brain, sciatic nerve, dorsal root ganglia, kidneys, and retina.
[0308] As used herein, the term “sample” refers to a similar fluid, cell, or tissue isolated from a subject, and a collection of fluid, cell, or tissue present within the body of the subject. Examples of biological fluids include blood, serum and serous fluid, plasma, lymph, urine, cerebrospinal fluid, saliva, and ocular fluid. Tissue samples may include samples derived from tissue, organ, or local area. For example, a sample may originate from a specific organ, a part of an organ, or fluid or cells within such an organ. In certain embodiments, a sample may originate from the liver (e.g., the whole liver, a specific part of the liver, or a specific type of cell from the liver, e.g., hepatocytes), the retina or a part of the retina (e.g., retinal pigment epithelium), the central nervous system or a part of the central nervous system (e.g., the ventricles or choroid plexus), or the pancreas or cells or parts of pancreatic characteristics. In preferred embodiments, “sample derived from subject” refers to blood or plasma collected from the subject. In further embodiments, “sample derived from subject” refers to liver tissue or retinal tissue derived from the subject.
[0309] In some embodiments of the method of the present invention, an RNAi agent is administered to a subject so that the RNAi agent is delivered to a specific site within the subject's body. Inhibition of TTR expression can be evaluated by measuring the level or change in the level of TTR mRNA or TTR protein in a sample derived from a fluid or tissue from a specific site within the subject's body. In preferred embodiments, this site is selected from the group consisting of the liver, choroid plexus, retina, and pancreas. This site may also be a subdivision or subgroup of cells derived from any one of the aforementioned sites (e.g., hepatocytes or retinal pigment epithelium). This site may also include cells expressing a specific type of receptor (e.g., hepatocytes expressing the asialoglycoprotein receptor).
[0310] Methods for treating or preventing V.TTR-related diseases The present invention also provides a method for treating or preventing a target TTR-related disease. This method includes the step of administering a therapeutically effective or prophylactically effective amount of the RNAi agent of the present invention to the target.
[0311] As used herein, "subject" includes humans or non-human animals, preferably vertebrates, more preferably mammals. Subjects may include transgenic organisms. Most preferably, subjects are humans, for example, humans who have or are susceptible to TTR-related diseases.
[0312] In some embodiments, subjects have a TTR-related disease. In other embodiments, subjects are at risk of developing a TTR-related disease, for example, subjects with a TTR gene mutation associated with the development of a TTR-related disease, subjects with a family history of a TTR-related disease, or subjects with signs or symptoms indicating the development of TTR amyloidosis.
[0313] As used herein, “TTR-related disease” includes any disease caused by or associated with the formation of amyloid deposits consisting of mutant or wild-type TTR proteins as fibrillary precursors. Mutant and wild-type TTRs cause various forms of amyloid deposition (amyloidosis). Amyloidosis involves the formation and aggregation of misfolded proteins, resulting in extracellular deposition that impairs organ function. Clinical syndromes associated with TTR aggregation include, for example, senile systemic amyloidosis (SSA); familial amyloid polyneuropathy (FAP); familial amyloid cardiomyopathy (FAC); and leptomeningeal amyloidosis, also known as cerebrovascular amyloidosis, central nervous system (CNS) amyloidosis, or amyloidosis type VII.
[0314] In some embodiments of the methods of the present invention, the RNAi agent of the present invention is administered to subjects suffering from familial amyloid cardiomyopathy (FAC) and senile systemic amyloidosis (SSA). TTRs with normal sequences cause cardiac amyloidosis in the elderly, a condition known as senile systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis). SSA is often accompanied by microdeposits in many other organs. TTR mutations accelerate the process of TTR amyloidogenesis and are the most important risk factor for the development of clinically significant TTR amyloidosis (also known as ATTR (amyloidosis-transthyretin type)). More than 85 amyloidogenic TTR variants are known to cause systemic familial amyloidosis.
[0315] In some embodiments of the methods of the present invention, the RNAi agent of the present invention is administered to subjects suffering from transthyretin (TTR)-associated familial amyloid polyneuropathy (FAP). Such subjects may suffer from ocular symptoms, such as vitreous opacity and glaucoma. It is known to those skilled in the art that amyloidogenic transthyretin (ATTR), synthesized by the retinal pigment epithelium (RPE), plays a crucial role in the progression of ocular amyloidosis. Previous studies have shown that laser photocoagulation of the retina reduces RPE cells and prevents the progression of amyloid deposition in the vitreous humor, suggesting that effective suppression of ATTR expression in the RPE could be a novel therapy for ocular amyloidosis (see, e.g., Kawaji, T., et al., Ophthalmology. (2010) 117:552-555). The methods of the present invention are useful for treating ocular symptoms of TTR-associated FAP, such as ocular amyloidosis. RNAi agents can be delivered in a manner suitable for targeting specific tissues, such as the eye. Methods of ocular delivery include injection (or internal injection or infusion) into the posterior ocular space, subcutaneous eyelid, subconjunctival space, sub-Tenon's capsule, anterior chamber, or intravitreous space. Formulations specifically for ocular delivery include eye drops or ointments.
[0316] Another TTR-related disorder is hyperthyroxinemia, also known as "dystransthyretinemic hyperthyroxinemia" or "dysprealbuminemic hyperthyroxinemia." This type of hyperthyroxinemia can develop due to increased binding of thyroxine to TTR by mutant TTR molecules with a high affinity for thyroxine. See, for example, Moses et al. (1982) J. Clin. Invest., 86, 2025-2033.
[0317] The RNAi agent of the present invention can be administered by any method of administration known in the art, including, but not limited to, subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intra-arterial, lymphatic, cerebrospinal, and any combination thereof. In a preferred embodiment, the RNAi agent is administered subcutaneously.
[0318] In some embodiments, administration is performed by accumulation injection. Accumulation injection allows for consistent release of the RNAi agent over a long period. Therefore, accumulation injection can reduce the frequency of administration required to obtain the desired effect, such as the desired inhibition of TTR, or a therapeutic or prophylactic effect. Accumulation injection can also achieve a more consistent serum concentration. Accumulation injections can be subcutaneous or intramuscular injections. In preferred embodiments, the accumulation injection is subcutaneous.
[0319] In some embodiments, administration is performed by a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. The infusion pump can be used for intravenous, subcutaneous, arterial, or epidural injection. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the RNAi agent to the liver.
[0320] Other administration methods include epidural, intracerebral, intraventricular, nasal, intra-arterial, intracardiac, intraosseous, subarachnoid, intravitreous, and intrapulmonary administration. The administration method can be selected based on whether local or systemic treatment is preferred and the area to be treated. The route and site of administration can be selected to improve targeting.
[0321] In some embodiments, the RNAi agent is administered to the subject in an amount effective in inhibiting TTR expression in the subject's cells. The amount effective in inhibiting TTR expression in the subject's cells can be evaluated using the methods described above, including methods for evaluating TTR mRNA, TTR protein, or related variables, such as amyloid deposition inhibition.
[0322] In some embodiments, the RNAi agent is administered to the subject in a therapeutically effective or prophylactically effective dose.
[0323] As used herein, “therapeutic dose” refers to an amount of RNAi agent sufficient to treat a TTR-related disease (e.g., to alleviate, improve, or maintain the symptoms of a pre-existing disease or one or more symptoms of a disease) when administered to a patient. “Therapeutic dose” may vary depending on the RNAi agent, the method of administration of the RNAi agent, the disease and its severity and history, age, weight, family history, genetic structure, stage of the pathological process mediated by TTR expression, type of previous treatment or combination therapy (if any), and other personal characteristics of the patient being treated.
[0324] As used herein, “prophylactic effective dose” includes an amount of RNAi agent sufficient to prevent or improve TTR-related disease or one or more of its symptoms when administered to a patient who is not currently suffering from or showing symptoms of TTR-related disease but is likely to develop the disease. Symptoms that may be improved include sensory neuropathy (e.g., paresthesia, hypoesthesia in the distal extremities), autonomic neuropathy (e.g., gastrointestinal disorders, e.g., gastric ulcers, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic dysfunction, cardiomyopathy, vitreous opacity, renal failure, nephropathy, substantial reduction in mBMI (modified body mass index), cranial neuropathy, and lattice keratopathy. Improving the disease includes delaying disease progression or reducing the severity of the disease as it develops. The “effective prophylactic dose” may vary depending on the RNAi agent, the method of administration of the RNAi agent, the degree of disease risk, and the patient’s medical history, age, weight, family history, genetic makeup, type of previous treatment or combination therapy (if any), and other personal characteristics of the patient being treated.
[0325] The “therapeutic dose” or “preventive dose” also includes the amount of RNAi agent that provides a reasonable efficacy / risk ratio applicable to any treatment and yields a certain degree of desirable local or systemic effect. The RNAi agent used in the method of the present invention can be administered in sufficient quantities to provide a reasonable efficacy / risk ratio applicable to such treatments.
[0326] As used herein, the terms “therapeutic effective dose” and “preventive effective dose” also include any dose that is beneficial in treating, preventing, or managing a pathological process or symptoms of a pathological process mediated by TTR expression. Symptoms of TTR amyloidosis include sensory neuropathy (e.g., paresthesia, hypoesthesia in the distal extremities), autonomic neuropathy (e.g., gastrointestinal disorders, e.g., gastric ulcers, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic dysfunction, cardiomyopathy, vitreous opacity, renal failure, nephropathy, substantial decrease in mBMI (modified body mass index), cranial neuropathy, and lattice keratopathy.
[0327] The dose of RNAi agent administered to the target may be adjusted to balance the risks and benefits of a particular dose, for example, to avoid undesirable side effects while simultaneously obtaining the desired level of TTR gene suppression (e.g., evaluated based on suppression of TTR mRNA, expression of TTR protein, or reduction of amyloid deposition, as defined above) or the desired therapeutic or prophylactic effect.
[0328] In one embodiment, the RNAi agent is administered in doses of approximately 0.25 mg / kg to approximately 50 mg / kg, for example, approximately 0.25 mg / kg to approximately 0.5 mg / kg, approximately 0.25 mg / kg to approximately 1 mg / kg, approximately 0.25 mg / kg to approximately 5 mg / kg, approximately 0.25 mg / kg to approximately 10 mg / kg, approximately 1 mg / kg to approximately 10 mg / kg, approximately 5 mg / kg to approximately 15 mg / kg, approximately 10 mg / kg to approximately 20 mg / kg, approximately 15 mg / kg to approximately 25 mg / kg, approximately 20 mg / kg to approximately 30 mg / kg, approximately 25 mg / kg to approximately 35 mg / kg, or approximately 40 mg / kg to approximately 50 mg / kg.
[0329] For some applications, RNAi agents are available in doses of approximately 0.25 mg / kg, 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, and 24 mg / kg. It is administered in doses of approximately 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, or 50 mg / kg.
[0330] In some embodiments, the RNAi agent is administered in two or more doses. If it is desirable to facilitate repeated or frequent injections, a delivery device, such as a pump, a semi-permanent stent (e.g., intravenous, intraperitoneal, intracapsular, or intraarticular), or a reservoir implantation may be desirable. In some embodiments, the number or amount of subsequent doses is determined by the desired effect, e.g., achieving suppression of the TTR gene, or achieving a therapeutic or preventive effect, e.g., reducing amyloid deposition or alleviating symptoms of TTR-related disease. In some embodiments, the RNAi agent is administered according to a plan. For example, the RNAi agent may be administered twice, three, four, or five times per week. In some embodiments, this plan includes administration at regular intervals, e.g., every hour, every four hours, every six hours, every eight hours, every twelve hours, every day, every two days, every three days, every four days, every five days, every week, every two weeks, or every month. In other embodiments, the plan includes administration at short time intervals, followed by longer periods without RNAi administration. For example, the plan may include an initial series of administrations at relatively short time intervals (e.g., every 6 hours, every 12 hours, every 24 hours, every 48 hours, or every 72 hours), followed by relatively longer periods without RNAi administration (e.g., every 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, or 8 weeks). In one embodiment, the RNAi is initially administered hourly, and then at longer time intervals (e.g., daily, weekly, bi-weekly, or monthly). In another embodiment, the RNAi is initially administered daily, and then at longer time intervals (e.g., weekly, bi-weekly, or monthly). In a particular embodiment, the longer time intervals are determined based on lengthening over time or achieving the desired effect. In certain embodiments, the RNAi agent is administered once daily for the first week, and then once weekly from day 8 of administration. In other specific embodiments, the RNAi agent is administered every other day for the first week, and then once weekly from day 8 of administration.
[0331] Any of these plans may be optionally repeated one or more times. The number of repeats may vary depending on the achievement of the desired effect, such as suppression of the TTR gene, levels of retinol-binding protein, levels of vitamin A, and / or the achievement of a therapeutic or preventive effect, such as a reduction in amyloid deposition or alleviation of symptoms of TTR-related disease.
[0332] In some embodiments, RNAi agents are administered with other therapeutic agents or other treatments. For example, other agonists or other treatments suitable for treating TTR-related diseases include liver transplants that can reduce the level of mutant TTR in the body; tafamidis (Vyndaqel) that kinetically stabilizes the TTR tetramer and prevents the dissociation of the TTR tetramer necessary for TTR amyloidogenesis; and diuretics that can be used, for example, to reduce edema in TTR amyloidosis with cardiac impairment.
[0333] In one embodiment, the subject is administered an initial dose and one or more maintenance doses of the RNAi agent. The one or more maintenance doses may be the same as or less than the initial dose, for example, half of the initial dose. Maintenance therapy may include a step of treating the subject with one or more doses ranging from 0.01 μg to 15 mg per kg of body weight per day, for example, 10 mg, 1 mg, 0.1 mg, 0.01 mg, 0.001 mg, or 0.00001 mg per kg of body weight per day. The maintenance dose may be administered, for example, once every 2 days or less, once every 5 days or less, once every 7 days or less, once every 10 days or less, once every 14 days or less, once every 21 days or less, or once every 30 days or less. Furthermore, the treatment may be continued for a certain period of time, which may vary depending on the nature of the specific disease, its severity, and the patient's overall condition. In certain embodiments, the dose may be administered once or less per day, for example, once every 24, 36, 48 hours, or more, for example, once every 5 or 8 days. After treatment, the patient may be monitored for changes in their condition. The dose of the RNAi agent may be increased if the patient does not respond significantly to the current dose level, or it may be decreased if relief of symptoms of the disease state is observed, the disease state is reduced, or unwanted side effects are observed.
[0334] VI. Kit The present invention also provides kits for carrying out any method of the present invention. Such a kit may include one or more RNAi agents and instructions for use, for example, instructions for inhibiting TTR expression in cells by contacting cells with an amount of RNAi agent effective in inhibiting TTR expression. The kit may optionally further include means for contacting cells with the RNAi agent (e.g., an injection device) or means for measuring TTR inhibition (e.g., means for measuring inhibition of TTR mRNA or TTR protein). Such means for measuring TTR inhibition may include means for obtaining a sample, for example, a plasma sample, from the subject. The kit of the present invention may optionally further include means for administering the RNAi agent to the subject or means for determining a therapeutic or prophylactic dose.
[0335] The present invention is further illustrated by the following embodiments, which should not be construed as limiting. All references, published patent documents, and patent applications described herein are incorporated herein by reference. [Examples]
[0336] Example 1: Inhibition of TTR using TTR-GalNAc conjugate A single dose of the TTR RNAi agent AD-43527 was administered subcutaneously to mice, and the level of TTR mRNA was determined 72 hours after administration.
[0337] The mouse / rat cross-reactive GalNAc conjugate, AD-43527, was selected for in vivo evaluation in WT C57BL / 6 mice for its effect on silencing TTR mRNA in the liver. The sequences of each strand of AD-43527 are shown below.
[0338] [Table 1]
[0339] The ligand used was GalNAc3: [ka] That was the case. This GalNAc3 ligand has the following linker and tether: [ka] The sense strand was conjugated to its 3' end using [a specific method / tool]. The structure of the sense strand conjugated with the obtained GalNAc3 is given by the following formula: [ka] This is shown. Additional RNAi agents targeting TTR and having the following sequences and modifications were synthesized and assayed.
[0340] [Table 2]
[0341] Human / canine cross-reactive TTR RNAi agent; the parent duplex has the sense strand 5'-3' sequence of AD-18328[GuAAccAAGAGuAuuccAudTdT (SEQ ID NO: 12), and the antisense strand 5'-3' sequence of AUGGAAuACUCUUGGUuACdTdT (SEQ ID NO: 13) with alternating 2'F / 2'OMe w / 2 PS in AS.
[0342] [Table 3]
[0343] L96 = GalNAc3; lowercase nucleotides (a, u, g, c) are 2'-O-methylnucleotides, Nf (i.e., Af) is a 2'-fluoronucleotide; Q11 is cholesterol; and s is a phosphorothioate.
[0344] Female C57BL / 6 mice (5 mice per group for 6-10 weeks) were administered AD-43527 at doses of 30 mg / kg, 15 mg / kg, 7.5 mg / kg, 3.5 mg / kg, 1.75 mg / kg, or 0.5 mg / kg by subcutaneous injection at a dose of 10 μl / g. Control animals were administered PBS subcutaneously at the same dose.
[0345] Approximately 72 hours later, the mice were anesthetized with 200 μl of ketamine, and then the right caudal artery was severed to collect total blood. Liver tissue was collected, rapidly frozen, and stored at -80°C until treatment.
[0346] The efficacy of the treatment was evaluated by measuring TTR mRNA in the liver 72 hours after administration. Liver TTR mRNA levels were assayed using branched DNA assay-QuantiGene 1.0 (Panomics). Briefly, mouse liver samples were pulverized to prepare tissue lysates. A liver lysate mixture (1x lysate, 2x nuclease-free water, and 10 μl of protein kinase-K / ml with a final concentration of 20 mg / ml) was incubated at 65°C for 35 minutes. 5 μl of liver lysate and 95 μl of a working probe set (TTR probe for gene targeting and GAPDH for endogenous control) were added to a capture plate. The capture plate was incubated at 53°C ± 1°C (approximately 16-20 hours). The following day, the capture plate was washed three times with 1× wash buffer (nuclease-free water, buffer component 1, and wash buffer component 2), and then dried by centrifugation at 240 g for 1 minute. 100 μl of amplification probe mix per well was added to the capture plate, the capture plate was sealed with aluminum foil, and incubated at 46°C ± 1°C for 1 hour. After 1 hour of incubation, the washing step was repeated, and then 100 μl of labeled probe mix per well was added. The capture plate was incubated at 46°C ± 1°C for 1 hour. The capture plate was then washed with 1× washing buffer, dried, and 100 μl of substrate per well was added to the capture plate. The capture plate was incubated at 46°C for 30 minutes, and then incubated at room temperature for 30 minutes. The plates were read using a SpectraMax Luminometer after incubation. bDNA data were analyzed by subtracting the mean background from each pair of samples, averaging the resulting pair of GAPDH (control probe) and TTR (experimental probe) values, and then calculating the ratio: (experimental probe background) / (control probe background). The average TTR mRNA level was calculated for each group, and this value was normalized relative to the mean of the PBS group to obtain the relative TTR mRNA as a percentage of the PBS control group.
[0347] These results are shown in Figure 1. GalNAc conjugate RNAi agents targeting TTR were effective in reducing TTR mRNA with an ED of approximately 5 mg / kg. 50 These results demonstrate that GalNAc conjugate RNAi agents targeting TTR are effective in inhibiting TTR mRNA expression.
[0348] Example 2: Inhibition of TTR using the TTR-GalNAc conjugate is persistent. Mice were administered subcutaneously at doses of AD-43527 (7.5 mg / kg or 30.0 mg / kg) and a GalNAc conjugate RNAi agent targeting TTR. Liver levels of TTR mRNA were evaluated 1, 3, 5, 7, 10, 13, 15, 19, 26, 33, and 41 days after treatment using the method described in Example 1.
[0349] These results are shown in Figure 2. On day 19, administration of 30.0 mg / kg of GalNAc conjugate RNAi still showed approximately 50% silencing. Complete recovery of expression occurred on day 41.
[0350] These results indicate that the inhibition induced by TTR-targeting GalNAc conjugate siRNA is persistent, lasting up to 3, 5, 7, 10, 13, 15, 19, 26, and 33 days after treatment.
[0351] Example 3. RNA synthesis and double-strand annealing 1. Oligonucleotide synthesis Oligonucleotides were synthesized using an AKTAoligopilot synthesizer or an ABI 394 synthesizer. Unless otherwise specified, oligonucleotide synthesis was performed using a commercially available glass solid support with controlled pores (dT-CPG, 500 Å, Prime Synthesis) and RNA phosphoramidite with a standard protecting group, 5'-O-dimethoxytrityl. N6-benzoyl-2'-t-butyldimethylsilyl-adenosine-3'-ON,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'-t-butyldimethylsilyl-cytidine-3'-ON,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N2-isobutyryl-2'-t-butyldimethylsilyl-guanosine-3'-ON,N'-diisopropyl-2-cyanoethylphosphoramidite, and 5'-O-dimethoxytrityl-2'-t-butyldimethylsilyl-uridine-3'-ON,N'-diisopropyl-2-cyanoethylphosphoramidite (Pierce Nucleic Acids Technologies) were used. 2'-F phosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'-fluorocytidine-3'-ON,N'-diisopropyl-2-cyanoethyl-phosphoramidite, and 5'-O-dimethoxytrityl-2'-fluorouridine-3'-ON,N'-diisopropyl-2-cyanoethyl-phosphoramidite were purchased from Promega. All phosphoramidites were used at a concentration of 0.2 M in acetonitrile (CH3CN), except for guanosine, which was used at a concentration of 0.2 M in 10% THF / ANC (v / v). A coupling / recycling time of 16 minutes was used. The activator was 5-ethylthiotetrazole (0.75 M, American International Chemicals), with iodine / water / pyridine used for PO oxidation and PADS (2%) dissolved in 2,6-lutidine / ACN (1:1 v / v) used for PS oxidation.
[0352] Ligand conjugate chains were synthesized using solid supports containing the corresponding ligands. For example, the introduction of the 3'-terminal carbohydrate moiety / ligand (e.g., for GalNAc) was achieved by initiating synthesis on the corresponding carbohydrate solid support. Similarly, the 3'-terminal cholesterol moiety was introduced by initiating synthesis on a cholesterol support. Generally, the ligand moiety was linked to trans-4-hydroxyprolinol via a tether selected from those described in the previous examples to obtain the hydroxyprolinol-ligand moiety. The hydroxyprolinol-ligand moiety was then conjugated to a solid support via a succinic acid linker, or converted to a phosphoramidite under standard phosphytylation conditions to obtain the desired carbohydrate conjugate components. Fluorophore-labeled siRNAs were synthesized on the corresponding phosphoramidites or solid supports purchased from Biosearch Technologies. Oleyllithocholic acid (GalNAc) 3 polymer supports were prepared in-house with a loading of 38.6 μmol / gram. The mannose (Man)3 polymer support was also prepared in-house by adding 42.0 μmol / gram of mannose.
[0353] Conjugation of the selected ligand at the desired position, e.g., at the 5' end of the sequence, was achieved, unless otherwise specified, by conjugating the corresponding phosphoramidite to the growing chain under standard phosphoramidite binding conditions. Long-term conjugation of a 0.1 M phosphoramidite solution in anhydrous CH3CN in the presence of a 5-(ethylthio)-1H-tetrazole activator was performed for solid-bound oligonucleotides. Beaucage,SL(2008)Solid-phase synthesis of siRNA oligonucleotides.Curr.Opin.Drug Discov.Devel.,11,203-216;Mueller,S.,Wolf,J.and Ivanov,SA(2004)Current Strategies for the Synthesis of RNA.Curr.Org.Synth., 1, 293-307; Ribo-difluorotoluyl Nucleotide.ACS Internucleotide phosphates were oxidized to phosphates using standard iodized water or by treatment with tert-butyl hydroperoxide / acetonitrile / water (10:87:3) with an oxidation waiting time of 10 minutes, as reported in Chem. Biol., 1,176-183. Phosphothioates were introduced by oxidation from phosphate to phosphorothioate using sulfur transfer reagents, e.g., DDTT (purchased from AM Chemicals), PADS, and / or Beaucage reagents. Cholesterol phosphoramidite was synthesized in-house and used at a concentration of 0.1 M in dichloromethane. The binding time for cholesterol phosphoramidite was 16 minutes.
[0354] 2. Deprotection-I (Nucleobase deprotection) After the synthesis was complete, the support was transferred to a 100 ml glass bottle (VWR). Using an 80 ml ethanol-ammonia [ammonia:ethanol (3:1)] mixture, the base and phosphate groups were deprotected and the oligonucleotide was cleaved from the support at 55°C for 6.5 hours. The bottle was briefly cooled on ice, and then the ethanol-ammonia mixture was filtered and placed in a new 250 ml bottle. The CPG was washed with 2 × 40 ml parts ethanol / water (1:1 v / v). The volume of the mixture was then reduced to approximately 30 ml using a rotovap. The mixture was then frozen on dry ice and dried under vacuum using a speed bucker.
[0355] 3. Deprotection-II (Removal of 2'TBDMS group) The dried residue was resuspended in 26 ml of triethylamine, triethylamine hydrofluoric acid (TEA.3HF), or pyridine-HF with DMSO (3:4:6), and heated at 60°C for 90 minutes to remove the tert-butyldimethylsilyl (TBDMS) group at the 2' position. The reaction was then quenched with 50 ml of 20 mM sodium acetate to adjust the pH to 6.5, and stored in a freezer until purification.
[0356] 4.Analysis Oligonucleotides are analyzed by high-performance liquid chromatography (HPLC) before purification, and the choice of buffer and column depends on the properties of the sequence and / or conjugated ligands.
[0357] 5. Purification by HPLC Ligand-conjugated oligonucleotides were purified by reverse-phase preparative HPLC. Unconjugated oligonucleotides were purified by anion-exchange HPLC on in-house packed TSK gel columns. Buffers were 20 mM sodium phosphate (pH 8.5) in 10% CH3CN (Buffer A) and 20 mM sodium phosphate (pH 8.5) in 10% CH3CN and 1 M NaBr (Buffer B). The fractions containing full-length oligonucleotides were pooled, desalted, and lyophilized. Desalted oligonucleotides with an OD of approximately 0.15 were diluted with water to 150 μl and then pipetted into specialized vials for CGE and LC / MS analysis. Finally, the compounds were analyzed by LC-ESMS and CGE.
[0358] 6. Preparation of RNAi agents For the preparation of RNAi agents, equimolar amounts of sense and antisense strands were heated in 1×PBS at 95°C for 5 minutes and slowly cooled to room temperature. Double-strand integrity was confirmed by HPLC analysis. Table 1 below shows RNAi agents targeting human or rodent TTR mRNA.
[0359] [Table 4]
[0360] [Table 5]
[0361] [Table 6]
[0362] [Table 7]
[0363] [Table 8]
[0364] Table 9
[0365] Table 10
[0366] Table 11
[0367] Table 12
[0368] Table 13
[0369] Table 14
[0370] Table 15
[0371] Table 16
[0372] Table 17
[0373] Table 18
[0374] Table 19
[0375] Table 20
[0376] Table 21
[0377] Table 22
[0378] Table 23
[0379] Table 24
[0380] Table 25
[0381] Table 26
[0382] Table 27
[0383] Table 28
[0384] Table 29
[0385] Table 30
[0386] Table 31
[0387] Table 32
[0388] Table 33
[0389] Table 34
[0390] Table 35
[0391] Table 36
[0392] Table 37
[0393] Table 38
[0394] Table 39
[0395] [Table 40]
[0396] [Table 41]
[0397] [Table 42]
[0398] [Table 43]
[0399] [Table 44]
[0400] Example 4: In vitro screening of RNAi agents Cell culture and transfection Human Hep3B cells or rat H.I.4.E cells (ATCC, Manassas, VA) were grown in RPMI (ATCC) supplemented with 10% FBS, streptomycin, and glutamine (ATCC) in a 5% CO2 atmosphere at 37°C until near confluence, and then detached from the plate by trypsin treatment. Transfection was performed by adding 14.8 μl of Opti-MEM and 0.2 μl of Lipofectamine RNAiMax (Invitrogen, Carlsbad CA. cat#13778-150) per well to each well of a 96-well plate containing 5 μl of siRNA double helix, and incubating at room temperature for 15 minutes. 80 μl of antibiotic-free complete growth medium containing approximately 2 × 10⁴ Hep3B cells was added to the siRNA mixture. The cells were incubated for 24 or 120 hours, and then RNA was purified. Single-dose experiments were performed at final double-chain concentrations of 10 nM and 0.1 nM, and dose-response experiments were conducted using 8-fold and 4-fold serial dilutions at the maximum dose of the final double-chain concentration of 10 nM.
[0401] Total RNA isolation using the DYNABEADS mRNA isolation kit (Invitrogen, part #:610-12) Cells were collected, lysed in 150 μl of lysis / binding buffer, and then mixed for 5 minutes at 850 rpm using an Eppendorf Thermomixer (the mixing rate was kept constant throughout the process). A mixture of 10 μl of magnetic beads and 80 μl of lysis / binding buffer was added to a round-bottom plate and mixed for 1 minute. The magnetic beads were captured using a magnetic stand, and the supernatant was removed without disturbing the beads. After removing the supernatant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing the supernatant, the magnetic beads were washed twice with 150 μl of wash buffer A and mixed for 1 minute. The beads were captured again, and the supernatant was removed. Next, the beads were washed with 150 μl of wash buffer B, captured, and the supernatant was removed. Next, the beads were washed with 150 μl of elution buffer, captured, and the supernatant was removed. Finally, the beads were washed with 150 μl of elution buffer, captured, and the supernatant was removed. The beads were dried for 2 minutes. After drying, 50 μl of elution buffer was added and mixed at 70°C for 5 minutes. The beads were trapped on a magnetic surface for 5 minutes. 40 μl of supernatant was removed and added to another 96-well plate.
[0402] cDNA synthesis using the ABI High-Performance cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, Cat#4368813) For each reaction, a master mix containing 1 μl of 10× buffer, 0.4 μl of 25× dTNP, 1 μl of random primer, 0.5 μl of reverse transcriptase, 0.5 μl of RNA-degrading enzyme inhibitor, and 1.6 μl of H2O was added to 5 μl of total RNA. cDNA was prepared using a Bio-Rad C-1000 or S-1000 thermal cycler by the following steps: 10 minutes at 25°C, 120 minutes at 37°C, 5 seconds at 85°C, and holding at 4°C.
[0403] Real-time PCR 2 μl of cDNA was added to a master mix containing 0.5 μl of GAPDH TaqMan probe (Applied Biosystems Cat#4326317E (human) Cat#4308313 (rodent)), 0.5 μl of TTR TaqMan probe (Applied Biosystems cat#HS00174914_m1 (human) cat#Rn00562124_m1 (rat)), and 5 μl of Lightcycler 480 probe master mix (Roche Cat#04887301001) in each well of a 384-well plate (Roche cat#04887301001). Real-time PCR was performed on a Roche LC 480 Real Time PCR instrument (Roche). Unless otherwise noted, each double helix was tested with at least two separate transfections, and each transfection was assayed in a double-strand configuration.
[0404] To calculate the relative multiplicative changes, real-time data were analyzed using the ΔΔCt method and normalized to assays performed using cells transfected with 10 nM AD-1955 or simulated transfected cells. 50 This was calculated using a 4-parameter fitted model with XLFit and normalized to the same dose range or its own lowest dose for cells transfected with AD-1955 (sense sequence: cuuAcGcuGAGuAcuucGAdTsdT (SEQ ID NO: 2202); antisense sequence: UCGAAGuCUcAGCGuAAGdTsdT (SEQ ID NO: 2203)) or untreated cells. IC 50 This is calculated for each individual transfection and combination, and for one IC 50 This was fitted to the data from both transfections.
[0405] The results of gene silencing of exemplary siRNA double helix structures having various motif modifications according to the present invention are shown in Table 1 above.
[0406] Example 5: In vitro silencing activity of chemically modified RNAi agents targeting TTR The following experiments demonstrated the beneficial effect of chemical modifications, including the introduction of a trinucleotide repeat motif along with a GalNAc3 ligand, on the silencing activity of RNAi agents targeting TTR. The sequences of the agents examined are shown in Table 2 below. The regions complementary to TTR mRNA are as follows: the complementary region for RNAi agents AD-45165, AD-51546, and AD-51547 is GGATGGGATTTCATGTAACCAAGA (SEQ ID NO: 2204), and the complementary region for RNAi agents AD-45163, AD-51544, and AD-51545 is TTCATGTAACCAAGAGTATTCCAT (SEQ ID NO: 2205).
[0407] Hep3B cell IC 50 Protocol for evaluation IC of each modified siRNA 50 This was determined in Hep3B cells (human hepatocellular carcinoma cell line) by standard reverse transfection using Lipofectamine RNAiMAX. Briefly, reverse transfection was performed by adding 5 μL of Opti-MEM to 5 μL of siRNA duplexes in each well of a 96-well plate, along with 10 μL of Opti-MEM and 0.5 μL of Lipofectamine RNAiMax (Invitrogen, Carlsbad CA. cat#13778-150), and incubating at room temperature for 15-20 minutes. After incubation, 100 μL of antibiotic-free complete growth medium containing 12,000-15,000 Hep3B cells was added to each well. The cells were incubated in 5% CO2 air at 37°C for 24 hours, then lysed, and TTR and GAPDH mRNA were analyzed by bDNA (Quantigene). Seven different siRNA concentrations ranging from 10 nM to 0.6 pM were used for IC50. 50 To determine the appropriate ratio, the TTR / GAPDH of siRNA-transfected cells was normalized to that of cells transfected with 10 nM Luc siRNA. The results are shown in Table 2.
[0408] Freely absorbable IC 50 Protocol for evaluation Silencing of free uptake in cynomolgus monkey primary hepatocytes was evaluated after incubation with TTR siRNA for 4 or 24 hours. Silencing was measured 24 hours after initial exposure. Briefly, 96-well culture plates were coated at room temperature with 0.05%–0.1% collagen (Sigma C3867-1VL) 24 hours before the start of the experiment. On the day of the assay, siRNA was diluted in pre-warmed plating medium consisting of DMEM supplemented with GIBCO's Maintenance Media Kit (Serum-Free, Life Technologies CM4000) and added to the collagen-coated 96-well culture plates. Cryopreserved cynomolgus monkey primary hepatocytes were rapidly thawed in a 37°C water bath and quickly diluted in plating medium to a concentration of 360,000 cells / mL. A fixed volume of cell suspension was gently pipetted onto the pre-plated siRNA to achieve a final cell count of 18,000 cells / well. The plates were gently rotated to mix and evenly distribute the cells throughout the wells. The cells were then placed in a 5% CO2 incubator at 37°C for 24 hours, after which the cells were lysed and TTR and GAPDH mRNA were analyzed by bDNA (Quantigene, Affymetrix). For 4-hour incubation with siRNA, the medium was decanted after 4 hours of cell exposure and replaced with fresh plating medium for the remaining 20 hours of incubation. Downstream analysis of TTR and GAPDH mRNA was performed as described above. To obtain typical dose-response curves, siRNA was serially diluted from 1 μM to 0.24 nM by 4-fold serial dilutions.
[0409] [Table 45]
[0410] These results, shown in Table 2, demonstrate that modified RNAi agents targeting TTR enhance silencing activity.
[0411] Results: Improved activity of modified RNAi agents. Parental RNAi agents and GalNAc3 ligands with alternating chemical modifications are used in ICs of Hep3B cells. 50 The concentration was adjusted to approximately 0.01 nM. As shown in Figures 4-5 and Table 2, RNAi agents modified relative to the parent RNAi agent by, for example, the addition of one or more repeating tribases of 2'-fluoro and 2'-methyl modifications showed unexpectedly high silencing activity and 5-8 times better IC than the corresponding parent RNAi agent. 50 The value was achieved in Hep3B cells.
[0412] Results: IC of free uptake in Hep3B cells 50 As shown in Table 2 and Figures 6-7, RNAi agents modified from the parent AD-45163 also showed increased free uptake silencing. The modified RNAi agents exhibited more than twice the silencing activity of the parent RNAi agent 24 hours after incubation, and nearly 10 times the silencing activity of the parent RNAi agent 4 hours after incubation.
[0413] As shown in Table 2 and Figures 8-9, RNAi agents modified from the parent AD-45165 also showed increased free uptake silencing. The modified RNAi agents showed 2-3 times the silencing activity of the parent RNAi agent 24 hours after incubation, and 5-8 times the silencing activity of the parent RNAi agent 4 hours after incubation.
[0414] In summary, these results demonstrate that all modified RNAi agents described herein, such as AD-51544, AD-51545, AD-51546, and AD-51547, exhibit unexpectedly superior inhibition of TTR mRNA in in vitro silencing experiments.
[0415] Example 6: Silencing of TTR mRNA and suppression of TTR protein in transgenic mice To evaluate the efficacy of the RNAi agents AD-45163, AD-51544, AD-51545, AD45165, AD-51546, and AD-51547, these RNAi agents were administered to transgenic mice expressing human transthyretin with the V30M mutation (see Santos, SD., Fernaandes, R., and Saraiva, MJ. (2010) Neurobiology of Aging, 31, 280-289). The V30M mutation is known to cause familial amyloid polyneuropathy type I in humans. See, for example, Lobato, L. (2003) J Nephrol., 16(3):438-42.
[0416] RNAi agents (in PBS buffer) or PBS controls were administered as a single subcutaneous dose of 5 mg / kg or 1 mg / kg to 18-24 month old mice (2 males and 2 females). Approximately 48 hours later, the mice were anesthetized with 200 μl of ketamine, and then the right caudal artery was transected to collect total blood. Whole blood and plasma were isolated and stored at -80°C until assay. Liver tissue was collected, rapidly frozen, and stored at -80°C until processing.
[0417] The efficacy of the treatment was evaluated by (i) measurement of TTR mRNA in the liver 48 hours after administration, and (ii) measurement of TTR protein in plasma before blood collection and 48 hours after administration. Liver TTR mRNA levels were assayed using branched DNA assay-QuantiGene 2.0 (Panomics cat #:QS0011). Briefly, mouse liver samples were pulverized to prepare tissue lysates. The liver lysate mixture (1x lysate, 2x nuclease-free water, and a final concentration of 20 mg / ml containing 10 μl of protein kinase-K / ml) was incubated at 65°C for 35 minutes. Then, 20 μl of a functional probe set (TTR probe for gene targeting and GAPDH for endogenous control) and 80 μl of tissue lysate were added to a capture plate. The capture plate was incubated at 55°C ± 1°C (approximately 16–20 hours). The following day, the capture plate was washed three times with 1× washing buffer (nuclease-free water, buffer component 1, and washing buffer component 2), and then dried by centrifugation at 240g for 1 minute. 100 μl of pre-amplifier working reagent was added to the capture plate, the plate was sealed with aluminum foil, and incubated at 55°C ± 1°C for 1 hour. After 1 hour of incubation, the washing step was repeated, and then 100 μl of pre-amplifier working reagent was added. After 1 hour, the washing and drying steps were repeated, and 100 μl of labeled probe was added. The capture plate was incubated at 50°C ± 1°C for 1 hour. The capture plate was then washed with 1× washing buffer, dried, and 100 μl of substrate was added to the capture plate. The capture plate was read using a SpectraMax Luminometer after incubation for 5–15 minutes. bDNA data were analyzed by subtracting the mean background from each triplicate sample, averaging the resulting triplicate GAPDH (control probe) and TTR (experimental probe) values, and then calculating the ratio: (experimental probe background) / (control probe background).
[0418] Plasma TTR levels were assayed using the commercially available "AssayMax Human Prealbumin ELISA Kit" (AssayPro, St. Charles, MO, Catalog#EP3010-1) according to the manufacturer's guidelines. Briefly, mouse plasma was diluted 1:10,000 with 1× mixed diluent, added to a pre-covered plate according to the kit's standards, incubated at room temperature for 2 hours, and then washed 5 times with the kit's wash buffer. 50 μl of biotinylated prealbumin antibody was added to each well, incubated at room temperature for 1 hour, and then washed 5 times with the kit's wash buffer. 50 μl of streptavidin-peroxidase conjugate was added to each well, the plate was incubated at room temperature for 30 minutes, and then washed as described above. The reaction was initiated by adding 50 μl / well of chromogenic substrate and stopped by adding 50 μl / well of stop solution, and then incubated at room temperature for 10 minutes. Absorbance at 450 nm was read using a Versamax microplate reader (Molecular Devices, Sunnyvale, CA), and the data was analyzed using the Softmax 4.6 software package (Molecular Devices).
[0419] These results are shown in Figures 10 to 12. Figure 10 shows that RNAi agents modified from the parent RNAi agents AD-45163 and AD-45165 exhibited RNA silencing activity equivalent to or greater than that of the parent RNAi agents. Figure 11 shows that RNAi agents AD-51544 and AD-51545 exhibited dose-dependent silencing activity, with the silencing activity of these RNAi agents at a dose of 5 mg / kg being similar to that of the corresponding parent AD-45163. Figure 12 shows that RNAi agents AD-51546 and AD-51547 also exhibited dose-dependent silencing activity. Furthermore, the silencing activity of AD-51546 and AD-51547 at a dose of 5 mg / kg was superior to that of the corresponding parent AD-45165.
[0420] Example 7: Serum and liver pharmacokinetic profiles of TTR-targeting RNAi agents in mice To evaluate the pharmacokinetic profiles of RNAi agents AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547, these RNAi agents were administered to C57BL / 6 mice in PBS buffer via a single IV bolus or subcutaneous (SC) administration. Plasma and liver concentrations of the RNAi agents were assessed at various time points after administration.
[0421] Plasma pharmacokinetic parameters are shown in Tables 3 and 4 below. The mean residence time (MRT) in plasma was approximately 0.2 hours after IV administration and approximately 1 hour after SC administration. At a dose of 25 mg / kg, the RNAi agents AD-51544, AD-51545, AD-51546, and AD-51547 showed similar plasma pharmacokinetic characteristics. Each of these RNAi agents had a bioavailability of over 75% in the subcutaneous space. These bioavailability levels were superior to those of the parent RNAi agent AD-45163 administered at a higher dose of 30 mg / kg. Subcutaneous bioavailability was approximately 100% for AD-51544 and AD-51547, approximately 90% for AD-51545, and approximately 76% for AD-51546.
[0422] [Table 46]
[0423] [Table 47]
[0424] These results also showed that the RNAi agents AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547 achieved equivalent or higher hepatic concentrations when administered subcutaneously than when administered by IV bolus. Hepatic pharmacokinetic parameters are shown in Tables 5 and 6 below. Compared to IV administration of the same dose of the same agonist, the peak hepatic concentration (C) was higher after subcutaneous administration. max ) and the area under the curve (AUC 0-last The ) was 2 to 3 times larger. Liver exposure was highest with AD-51547 and lowest with AD-51545. Mean residence time (MRT) and elimination half-life were longer with AD-51546 and AD-51547 compared with AD-51544 and AD-51545. After subcutaneous administration, the estimated MRT was 40 hours for AD-51546 and 25 hours for AD-51547, but the MRT for AD-51544 and AD-51545 was shorter (approximately 6 to 9 hours). The elimination half-life of AD-51546 and AD-51547 (41 to 53 hours) was longer than that of AD-51544 and AD-51545 (6 to 10 hours).
[0425] [Table 48]
[0426] [Table 49]
[0427] Example 8: In vitro stability of RNAi agents in monkey serum The serum stability of RNAi agents AD-51544, AD-51545, AD-51546, and AD-51547 was also evaluated in monkeys. The results demonstrated that the antisense and sense strands of AD-51544, AD-51545, and AD-51547 exhibited serum stability for approximately 24 hours (data not shown).
[0428] Example 9: RNAi agents sustain suppression of TTR protein in non-human primates. The RNA silencing activity of RNAi agents AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547 was evaluated by measuring the suppression of TTR protein in the serum of cynomolgus monkeys after five subcutaneous administrations of 5 mg / kg (once daily for 5 days) or one administration of 25 mg / kg. Pre-administration serum TTR protein levels were assessed by averaging the levels 11 days before the first administration, 7 days before the first administration, and 1 day before the first administration. Post-administration serum TTR protein levels were assessed by determining serum levels from 1 day after the last administration (i.e., day 5 of the study for the five 5 mg / kg groups and day 1 of the study for the one 25 mg / kg group) to 49 days after the last administration (i.e., day 53 of the study for the five 5 mg / kg groups and day 49 of the study for the one 25 mg / kg group). Please refer to Figure 13.
[0429] The levels of TTR protein were evaluated as described in Example 6. The results are shown in Figure 14 and in Tables 7 and 8.
[0430] Maximum suppression of TTR protein of up to approximately 50% was achieved in the groups administered 25 mg / kg of AD-45163, AD-51544, AD-51546, and AD-51547 (see Table 8). A greater maximum suppression of TTR protein of approximately 70% was achieved in the groups administered five doses of 5 mg / kg of AD-45163, AD-51544, AD-51546, and AD-51547 (see Table 7). The RNAi agent AD-51545 resulted in lower suppression in both administration protocols. Significant suppression of approximately 20% or more persisted until day 49 after the final dose of AD-51546 and AD-51547 in both the single 25 mg / kg and five 5 mg / kg protocols. In general, superior suppression was achieved with the five 5 mg / kg protocols compared to the single 25 mg / kg protocol.
[0431] [Table 50]
[0432] [Table 51]
[0433] Example 10: Tolerability of RNAi agents targeting TTR Cytokine evaluation using whole blood assays To evaluate the tolerability of TTR-targeting RNAi agents (including AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547), each RNAi agent was tested in a whole blood assay using blood from three human donors. RNAi agents were either transfected with 300 nM DOTAP or as 1 μM (free siRNA) without transfection. Less than twofold changes were observed for the following cytokines / chemokines: G-CSF, IFN-γ, IL-10, IL-12 (p70), IL-1β, IL-1ra, IL-6, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, and TNFα (results not shown).
[0434] In vivo evaluation To evaluate in vivo tolerability, RNAi agents were subcutaneously injected into CD1 mice at a dose of 125 mg / kg. No cytokine induction was observed at 2, 4, 6, 24, and 48 hours after subcutaneous injection of AD-45163. No significant cytokine induction was observed at 6 or 24 hours after subcutaneous injection of AD-51544, AD-51545, AD-51546, or AD-51547.
[0435] To further evaluate in vivo tolerability, several RNAi agents (including AD-45163, AD-51544, AD-51545, AD-51546, and AD-51547) were tested by subcutaneous injection of 5–25 mg into non-human primates (cynomolgus monkeys) using a dose volume of 1–2 ml per site. No erythema or edema was observed at the injection sites.
[0436] Tolerance study in rats using a single dose of SC To evaluate toxicity, rats were given a single subcutaneous injection of AD-45163 at doses of 100 mg / kg, 250 mg / kg, 500 mg / kg, or 750 mg / kg (see Table 9). The following evaluations were performed: clinical signs of toxicity, body weight, hematology, clinical chemistry and coagulation, organ weights (liver and spleen); macroscopic and microscopic evaluations (kidneys, liver, lungs, lymph nodes, spleen, testes, thymus, aorta, heart, intestines (small and large intestines).
[0437] [Table 52]
[0438] These results indicated that no clinical signs of toxicity associated with the test substance affected body weight, organ weight, or clinical chemistry. Histopathology was completely undetectable in the heart, kidneys, testes, spleen, liver, and thymus. A slight, non-harmful increase in WBC associated with the test substance was observed at 750 mg / kg (↑68%, primarily attributable to increases in NEUT and MONO). These results suggest that a single dose of up to 750 mg / kg is well-tolerated in rats.
[0439] Tolerance of repeated subcutaneous administration in rats To evaluate the tolerability of repeated subcutaneous administration of AD-45163, 300 mg / kg was administered subcutaneously daily for 5 days, and autopsy was performed on day 6. The study design is shown in Table 10.
[0440] [Table 53]
[0441] The following outcome factors were evaluated: clinical signs, body weight, hematology, clinical chemistry and coagulation, organ weight, macroscopic and microscopic evaluation (liver, spleen, kidney, lung, gastrointestinal tract, and first and last injection sites). The results showed no effect on clinical signs, body weight, or organ weight related to the test substance, and no findings related to the test substance were observed in clinical hematology and chemistry. The activated partial thromboplastin time (APTT) on day 6 may be slightly prolonged (20.4 seconds vs. 17.4 seconds). Histopathology revealed no findings related to the test substance in the liver, spleen, heart, and gastrointestinal tract. Minimal to mild tubular epithelial hypertrophy (not harmful) was observed in the kidneys. Minimal, non-harmful multiple mononuclear infiltration was observed at the last injection site. These results indicate that administration of the parent RNAi agent AD-45163 at 300 mg / kg five times daily is well tolerated in rats.
[0442] Example 11: RNAi agents sustain suppression of TTR protein in non-human primates. The RNA silencing activity of the RNAi agent AD-51547 was evaluated by measuring the suppression of TTR protein in the serum of cynomolgus monkeys after the "loading phase" of the RNAi agent: subcutaneous administration of 2.5 mg / kg, 5 mg / kg, or 10 mg / kg daily for 5 days (once daily for 5 days), followed by the "maintenance phase" of the RNAi agent: weekly administration of 2.5 mg / kg, 5 mg / kg, or 10 mg / kg for 4 weeks. Pre-administration serum levels of TTR protein were evaluated by averaging the levels 11 days before the first dose, 7 days before the first dose, and 1 day before the first dose. Post-administration serum levels of TTR protein were evaluated by determining the serum levels relative to previous doses from 1 day after the loading phase to 40 days after the final dose of the maintenance phase (i.e., day 70 of the study).
[0443] The levels of TTR protein were evaluated as described in Example 6. The results are shown in Figure 15.
[0444] Maximum suppression of TTR protein, up to approximately 80%, was achieved in all groups treated with AD-51547 at 2.5 mg / kg, 5 mg / kg, or 10 mg / kg. Nadir knockdown was achieved in all groups by approximately day 14, and suppression was maintained at nadir knockdown levels with weekly maintenance doses of AD-51547 at 2.5 mg / kg, 5 mg / kg, or 10 mg / kg. TTR levels did not return to normal levels more than 40 days after the last maintenance dose at the 5 mg / kg and 2.5 mg / kg dose levels.
[0445] Equivalents: Those skilled in the art will recognize various equivalents of the specific embodiments and methods described herein and will be able to verify such equivalents using only ordinary experiments. Such equivalents shall be included in the appended claims.
Claims
1. A double-stranded RNAi agent for inhibiting the expression of transthyretin (TTR) in cells, A double-stranded RNAi agent comprises a sense strand and an antisense strand that form a double-stranded region; The sense strand contains the nucleotide sequence 5'-UGGGGAUUUCAUGUAACCAAGA-3', and the antisense strand contains the nucleotide sequence 5'-UCUUGGUUACAUGAAAAUCCCCAUC-3'; The sense strand has a nucleotide length of 21, and the antisense strand has a nucleotide length of 23. All nucleotides in the sense strand contain modifications selected from the group consisting of 2'-O-methyl modifications and 2'-fluoro modifications; All nucleotides of the antisense strand contain modifications selected from the group consisting of 2'-O-methyl modifications and 2'-fluoro modifications; and The sense chain is conjugated to at least one ligand. Double-stranded RNA inhibitor.
2. The RNAi agent according to claim 1, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.
3. The RNAi agent according to claim 2, wherein the ligand is one or more GalNAc derivatives attached by a branched divalent or trivalent linker.
4. The ligand is 【Chemistry 1】 The RNAi agent according to claim 3.
5. The RNAi agent according to claim 1, wherein the ligand is attached to the 3' end of the sense strand.
6. The RNAi agent is defined by the following formula 【Chemistry 2】 Conjugate to the ligand shown, The RNAi agent according to claim 5, wherein X is O or S in the formula.
7. The RNAi agent according to claim 1, further comprising at least one internucleotide bond of phosphorothioate or methylphosphonate.
8. The RNAi agent according to claim 7, wherein the internucleotide bond of the phosphorothioate or methylphosphonate is located at the 3' end of one of the strands.
9. The RNAi agent according to claim 8, wherein the aforementioned chain is the antisense chain.
10. The sense strand comprises the nucleotide sequence 5'-UGGGGAUUUCAUGUAACCAAGA-3', and the antisense strand comprises the nucleotide sequence 5'-UCUUGGUUACAUGAAAAUCCCCAUC-3'; All nucleotides in the sense strand contain modifications selected from the group consisting of 2'-O-methyl modifications and 2'-fluoro modifications; All nucleotides of the antisense strand contain modifications selected from the group consisting of 2'-O-methyl modifications and 2'-fluoro modifications; and The sense strand has a nucleotide length of 21, and the antisense strand has a nucleotide length of 23. The sense chain is given by the following formula 【Transformation 3】 Conjugated to at least one ligand as shown, The RNAi agent according to claim 1.
11. Isolated cells comprising the RNAi agent according to any one of claims 1 to 10.
12. A pharmaceutical composition comprising an RNAi agent according to any one of claims 1 to 10.
13. The pharmaceutical composition according to claim 12, wherein the RNAi agent is present in a non-buffer solution.
14. The pharmaceutical composition according to claim 13, wherein the non-buffering agent is physiological saline or water.
15. The pharmaceutical composition according to claim 13, wherein the RNAi agent is present in the buffer solution.
16. The pharmaceutical composition according to claim 15, wherein the buffer solution comprises an acetate, a citrate, a prolamin, a carbonate, a phosphate, or any combination thereof.
17. The pharmaceutical composition according to claim 16, wherein the buffer solution is phosphate-buffered saline (PBS).
18. An in vitro method for inhibiting the expression of transthyretin (TTR) in cells, comprising the step of in vitro contacting the cells with an RNAi agent according to any one of claims 1 to 10 in an amount effective to inhibit the expression of the TTR in the cells, thereby inhibiting the expression of transthyretin (TTR) in the cells.
19. A pharmaceutical composition for use in treating a target TTR-related disease, comprising a therapeutically effective amount of the RNAi agent described in any one of claims 1 to 10.
20. The pharmaceutical composition according to claim 19, wherein the subject is a human.
21. The pharmaceutical composition according to claim 19, wherein the subject has a TTR gene mutation associated with the development of TTR-related diseases.
22. The pharmaceutical composition according to claim 19, wherein the TTR-related disease is selected from the group consisting of senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial polyneuropathy (FAP), familial amyloid cardiomyopathy (FAC), leptomeningeal / central nervous system (CNS) amyloidosis, and hyperthyrocinemia.
23. The pharmaceutical composition according to claim 19, wherein the subject has TTR-related amyloidosis, and the use reduces amyloid TTR deposition in the subject.
24. The pharmaceutical composition according to claim 19, wherein the RNAi agent is administered subcutaneously to the subject.
25. A kit for carrying out the method described in claim 18, (a) The RNAi agent and, (b) Instructions for use, A kit that includes this.
26. A kit for carrying out the method of claim 25, further comprising means for administering the RNAi agent to the subject.
27. A kit comprising the pharmaceutical composition according to any one of claims 19 to 24 and an instruction manual for use.
Citation Information
Patent Citations
Carbohydrate conjugates as oligonucleotide delivery agents
JP2011505425A
Sirna therapy for transthyretin (TTR) related ocular amyloidosis
WO2011123468A1