Modification of the specificity of non-coding RNA molecules for silencing gene expression in eukaryotic cells

By modifying non-coding RNA molecules in eukaryotic cells using genome editing agents, the method addresses inefficiencies in gene therapy and RNA interference, achieving stable and targeted gene silencing for various diseases.

JP7873214B2Inactive Publication Date: 2026-06-11TROPIC BIOSCI UK LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2023137627
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2017-11-23
Filing Date
2023-08-25
Publication Date
2026-06-11
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Current gene therapy and RNA interference technologies face limitations such as mutagenesis, transient gene suppression, and inefficient RNA delivery, making them unsuitable for a wide range of diseases requiring complete gene function suppression.

Method used

A method involving genome editing agents to modify non-coding RNA molecules in eukaryotic cells, redirecting their silencing specificity to target RNAs of interest, without the need for classical molecular genetic tools, enabling stable and heritable gene silencing.

Benefits of technology

Enhances the efficacy and specificity of gene suppression, allowing targeted treatment of diseases like monogenic recessive disorders, autoimmune diseases, and cancers, and improving chemotherapeutic agent effectiveness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007873214000016
    Figure 0007873214000016
  • Figure 0007873214000017
    Figure 0007873214000017
  • Figure 0007873214000018
    Figure 0007873214000018
Patent Text Reader

Abstract

To provide a method of modifying a gene encoding or processed into a non-coding RNA molecule having no RNA silencing activity in an eukaryotic cell.SOLUTION: Provided is a method of modifying a gene encoding or processed into a non-coding RNA molecule having no RNA silencing activity in an eukaryotic cell, with the proviso that the eukaryotic cell is not a plant cell, the method comprising introducing into the eukaryotic cell a DNA editing agent conferring a silencing specificity of the non-coding RNA molecule to a target RNA of interest, and thereby modifying the gene encoding or processed into the non-coding RNA molecule.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] In some embodiments, the present invention relates to modifying genes that encode or are processed by non-coding RNA molecules, including RNA silencing molecules, and more particularly to their use for silencing the expression of desired endogenous or exogenous target RNA in eukaryotic cells other than plant cells, but is not limited thereto. [Background technology]

[0002] Of the approximately 25,000 annotated genes in the human genome, mutations in more than 3,000 genes have already been linked to disease phenotypes, and many more disease-associated gene mutations are being identified at an astonishingly rapid pace. Novel therapeutic strategies that can modify nucleic acids in disease-affected cells and tissues have promise for treating highly penetrating monogenic diseases such as severe combined immunodeficiency (SCID), hemophilia, and certain enzyme deficiencies, due to their clear genetics and, in many cases, the lack of safe and effective alternative treatments. Two of the most powerful genetic therapeutic technologies developed to date are gene therapy, which enables the repair of lost gene function through the expression of viral transgenes, and RNA interference (RNAi), which mediates the suppression of deficiency genes by knocking down targeted mRNA.

[0003] Gene therapy has been used to successfully treat hematopoietic-affecting monogenic recessive genetic disorders such as SCID and Wiscott-Aldrich syndrome by semi-randomly incorporating functional genes into the genomes of hematopoietic stem cells / progenitor cells [Gaspar et al., Sci.Transl.Med.(2011) 3:97ra79; Howe et al., J.Clin.Invest.(2008) 118:3143-3150]. RNAi has been used, particularly in clinical trials, to suppress the function of genes involved in cancer, age-related macular degeneration, and transthyretin (TTR)-associated amyloidosis. Despite their potential and recent successes, gene therapy and RNAi have limitations that prevent their use for a wide range of diseases. For example, viral gene therapy can induce mutagenesis at the integration site, leading to dysregulated transgene expression [Howe et al. (2008), ibid.]. On the other hand, the use of RNAi is limited to targets where gene knockdown is beneficial. Furthermore, RNAi often fails to adequately suppress gene expression due to the transient nature of delivered siRNA and the lack of silencing amplification mechanisms, as seen in plants or nematodes. Therefore, it is unlikely to be beneficial for diseases requiring complete suppression of gene function for therapeutic purposes. A major current obstacle to RNA-based therapies is efficient and effective RNA delivery to cells. While some delivery agents can enhance therapeutic RNA endocytosis, a very small percentage—less than 0.01%—escape from endosomes and retain bioactivity [Steven F Dowdy, Nature Biotechnol (2017) 35,222-229].

[0004] Recent advances in genome editing technology have made it possible to alter the DNA sequence in living cells by editing just a few nucleotides out of billions of nucleotides in a human patient's cells. Over the past decade, the tools and expertise for using genome editing in human somatic and pluripotent cells have grown to the point where this approach is now widely developed as a strategy for treating human diseases. The basic process relies on creating site-specific double-strand DNA breaks (DSBs) in the genome and then fixing those breaks in the cell's endogenous DSB repair mechanisms (e.g., by non-homologous end joining (NHEJ) or homologous recombination (HR)), with homologous recombination (HR) allowing precise nucleotide changes to be made to the DNA sequence [Porteus, Annu Rev Pharmacol Toxicol. (2016) 56:163-90].

[0005] Three main approaches utilize mutagenic genome editing (NHEJ) as a promising therapeutic science: (a) knocking out functional genetic factors by creating spatially precise insertions or deletions; (b) creating insertions or deletions that counteract underlying frameshift mutations; thus reactivating partially functional or non-functional genes; and (c) creating distinct gene deletions. While several different therapeutic applications utilize editing by NHEJ, the broadest application of therapeutic editing will likely be genome editing by homologous recombination (HR). However, rare occurrences are highly accurate because the correct sequence is copied during the repair process by relying on a template.

[0006] Currently, there are four main types of therapeutic applications of HR-mediated genome editing: (a) gene repair (i.e., modification of diseases caused by point mutations in a single gene), (b) functional gene repair (i.e., modification of diseases caused by mutations scattered throughout a gene), (c) safe harbor gene addition (i.e., when precise control is not required or when a hyperphysiological level of therapeutic transgene is desired), and (d) targeted transgene addition (i.e., when precise control is required) [Porteus (2016), cited above].

[0007] Previous studies on genome editing of RNA molecules in various eukaryotes (e.g., mice, humans, shrimp, plants) have focused, for example, on knocking out miRNA gene activity or altering its binding site on target RNA.

[0008] Regarding genome editing in human cells, Jiang et al. [Jiang et al., RNA Biology (2014) 11(10):1243-9] depleted human miR-93 from clusters in HeLa cells by targeting the 5' region of those clusters using CRISPR / Cas9. Various small indels were induced in the target region, including the Drosha processing site (i.e., the site where Drosha, a double-stranded RNA-specific RNase III enzyme, binds to and cleaves primary miRNA (pri-miRNA), thereby processing it into pre-miRNA in the nucleus of the host cell) and the seed sequence (i.e., a conserved 7-nucleotide sequence typically located 2-7 positions from the 5' end of miRNA, essential for miRNA binding to mRNA). According to Jiang et al., even the deletion of a single nucleotide resulted in complete knockout of the target miRNA with high specificity.

[0009] Regarding genome editing in mouse species, Zhao et al. [Zhao et al., Scientific Reports (2014) 4:3943] provided a miRNA inhibition strategy using the CRISPR system in mouse cells. Using specially designed gRNAs, Zhao cleaved miRNA genes at a single site using Cas9, resulting in miRNA knockdown in mouse cells.

[0010] Regarding plant genome editing, Bortesi and Fischer [Bortesi and Fischer, Biotechnology Advances (2015) 33:41-52] discuss the use of CRISPR-Cas technology in plants compared to ZFNs and TALENs, and Basak and Nithin [Basak and Nithin, Front Plant Sci. (2015) 6:1001] teach the application of CRISPR-Cas9 technology for knockdown of protein-coding genes in model plants such as Arabidopsis and tobacco, as well as crops such as wheat, maize, and rice.

[0011] In addition to disrupting miRNA activity or target binding sites, gene silencing using artificial microRNA (amiRNA)-mediated gene silencing of endogenous and exogenous target genes has been employed [Tiwari et al., Plant Mol Biol (2014) 86:1]. Similar to microRNAs, amiRNAs are single-stranded molecules approximately 21 nucleotides (nt) long and are designed by substituting a double-stranded mature miRNA sequence within a pre-miRNA [Tiwari et al. (2014), cited above]. These amiRNAs are introduced as transgenes into artificial expression cassettes (including promoters, terminators, etc.) [Carbonell et al., Plant Physiology (2014) 113.234989], and are processed via small RNA biosynthesis and silencing mechanisms to downregulate target expression. According to Schwab et al. [Schwab et al., The Plant Cell (2006) Vol. 18, 1121-1133], amiRNAs are active when expressed under tissue-specific or inducible promoters and can be used for specific gene silencing in plants, particularly when it is necessary to downregulate several related but non-identical target genes.

[0012] Senis et al. [Senis et al., Nucleic Acids Research (2017) Vol. 45(1):e3] disclose a promoter-free antiviral RNAi hairpin manipulation at endogenous miRNA loci. Specifically, Senis et al. insert an amiRNA precursor transgene (hairpin pri-amiRNA) adjacent to a naturally occurring miRNA gene (e.g., miR122) by homologous directing DNA recombination induced by sequence-specific nucleases such as Cas9 or TALEN. This approach utilizes transcriptionally active DNA expressing the natural miRNA (miR122) to use amiRNA without promoters and terminators; that is, endogenous promoters and terminators drive and regulate the transcription of the inserted amiRNA transgene.

[0013] Various DNA-free methods for introducing RNA and / or proteins into cells have been previously described. For example, RNA transfection using electroporation and lipofection is described in U.S. Patent Application Publication No. 20160289675. Direct delivery of the Cas9 / gRNA ribonucleoprotein (RNP) complex to cells by microinjection of the Cas9 protein and gRNA complex was described by Cho [Cho et al., "Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins," Genetics (2013) 195:1177-1180]. Delivery of the Cas9 protein / gRNA complex by electroporation was described by Kim [Kim et al., "Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins," Genome Res. (2014) 24:1012-1019]. The delivery of Cas9 protein-binding gRNA complexes via liposomes was reported by Zuris et al. ["Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo", Nat Biotechnol. (2014) doi:10.1038 / nbt.3081]. [Prior art documents] [Patent Documents]

[0014] [Patent Document 1] U.S. Patent Application Publication No. 20160289675 [Non-patent literature]

[0015]

Non-licensed literature 1

Non-licensed Document 2

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed Document 8

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 22

Non-licensed Document 12

Non-licensed Document 13

[0016] According to one aspect of several embodiments of the present invention, a method is provided for modifying a gene that codes for or is processed by a non-coding RNA molecule that does not have RNA silencing activity in a eukaryotic cell, wherein the eukaryotic cell is not a plant cell, and the method includes the step of introducing a DNA editing agent into a eukaryotic cell that confers silencing specificity of the non-coding RNA molecule to a target RNA of interest, thereby modifying the gene that codes for or is processed by the non-coding RNA molecule.

[0017] According to one aspect of several embodiments of the present invention, a method is provided for modifying a gene that encodes or is processed by a non-coding RNA molecule that does not have RNA silencing activity in a eukaryotic cell, wherein the eukaryotic cell is not a plant cell, and the method includes the step of introducing a DNA editing agent into the eukaryotic cell that confers silencing specificity of the non-coding RNA molecule to a target RNA of interest.

[0018] According to one aspect of several embodiments of the present invention, a method is provided for modifying a gene encoding or being processed by an RNA silencing molecule for a target RNA in a eukaryotic cell, wherein the eukaryotic cell is not a plant cell, and the method comprises the steps of introducing a DNA editing agent into the eukaryotic cell that redirects the silencing specificity of the RNA silencing molecule toward a second target RNA, thereby modifying the gene encoding the RNA silencing molecule, wherein the target RNA and the second target RNA are different.

[0019] According to one aspect of several embodiments of the present invention, a method is provided for modifying a gene that encodes an RNA silencing molecule for a target RNA or is processed by it in a eukaryotic cell, wherein the eukaryotic cell is not a plant cell, and the method comprises the step of introducing a DNA editing agent into the eukaryotic cell that redirects the silencing specificity of the RNA silencing molecule toward a second target RNA, wherein the target RNA and the second target RNA are different.

[0020] According to one aspect of several embodiments of the present invention, a method is provided for treating an infectious disease in a subject of interest, comprising the step of modifying a gene that encodes or is processed by a non-coding RNA molecule or an RNA silencing molecule or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with the onset or progression of the infectious disease.

[0021] According to one aspect of several embodiments of the present invention, a method is provided for treating a monogene recessive genetic disorder in a subject of interest, comprising the step of modifying a gene that encodes or is processed by a non-coding RNA molecule or encodes or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with the monogene recessive genetic disorder.

[0022] According to one aspect of several embodiments of the present invention, a method is provided for treating an autoimmune disease in a subject of interest, comprising the step of modifying a gene that encodes or is processed by a non-coding RNA molecule or an RNA silencing molecule or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with the autoimmune disease.

[0023] According to one aspect of several embodiments of the present invention, a method is provided for treating a cancerous disease in a subject of interest, comprising the step of modifying a gene that codes for or is processed by a non-coding RNA molecule or a gene that codes for or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with the cancerous disease.

[0024] According to one aspect of several embodiments of the present invention, a method is provided for enhancing the efficacy and / or specificity of a chemotherapeutic agent in a target subject of interest, comprising the step of modifying a gene that encodes or is processed by a non-coding RNA molecule or an RNA silencing molecule or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with enhancing the efficacy and / or specificity of the chemotherapeutic agent.

[0025] According to one aspect of several embodiments of the present invention, a method is provided for inducing cellular apoptosis in a target subject, comprising the steps of modifying a gene that encodes or is processed by a non-coding RNA molecule or encodes or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with the apoptosis.

[0026] According to one aspect of several embodiments of the present invention, a method is provided for generating a eukaryotic non-human organism, wherein the organism is not a plant, and at least some of the cells of the organism contain a modified gene that encodes or processes a non-coding RNA molecule having silencing specificity for a target RNA of interest, the method comprising the step of modifying the gene according to the method of several embodiments of the present invention, thereby generating the eukaryotic non-human organism.

[0027] According to some embodiments of the present invention, the gene encoding or processing the non-coding RNA molecule is endogenous to eukaryotic cells.

[0028] According to some embodiments of the present invention, the gene encoding the RNA silencing molecule is endogenous to eukaryotic cells.

[0029] According to some embodiments of the present invention, modifying a gene that codes for or processes a non-coding RNA molecule includes conferring at least 45% complementarity to the non-coding RNA molecule with respect to a target RNA of interest.

[0030] According to some embodiments of the present invention, modifying a gene encoding an RNA silencing molecule involves conferring at least 45% complementarity to the RNA silencing molecule with respect to the second target RNA.

[0031] According to some embodiments of the present invention, the silencing specificity of a non-coding RNA molecule is determined by measuring the RNA level (concentration) or protein level (concentration) of the target RNA of interest.

[0032] According to some embodiments of the present invention, the silencing specificity of the RNA silencing molecule is determined by measuring the RNA level (concentration) or protein level (concentration) of the second target RNA.

[0033] According to some embodiments of the present invention, the silencing specificity of a non-coding RNA molecule or RNA silencing molecule is determined phenotypically.

[0034] According to some embodiments of the present invention, phenotypic determination is brought about by determining at least one phenotype selected from the group consisting of cell size, growth rate / inhibition, cell shape, cell membrane integrity, tumor size, tumor shape, pigmentation of the organism, infection parameters, and inflammation parameters.

[0035] According to some embodiments of the present invention, the silencing specificity of a non-coding RNA molecule or RNA silencing molecule is determined genotype-wise.

[0036] According to some embodiments of the present invention, the phenotype is determined before the genotype.

[0037] According to some embodiments of the present invention, the genotype is determined before the phenotype.

[0038] According to some embodiments of the present invention, non-coding RNA molecules or RNA silencing molecules are processed from precursors.

[0039] According to some embodiments of the present invention, the non-coding RNA molecule or RNA silencing molecule is an RNA interference (RNAi) molecule.

[0040] According to some embodiments of the present invention, the RNAi molecule is selected from the group consisting of small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), Piwi-interacting RNA (piRNA), and trans-acting siRNA (tasiRNA).

[0041] According to some embodiments of the present invention, the non-coding RNA molecule is selected from the group consisting of nuclear small RNA (snRNA), nucleolar small RNA (snoRNA), long non-coding RNA (lncRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), repeat-derived RNA, and transfer factor RNA.

[0042] According to some embodiments of the present invention, the RNAi molecule is modified to preserve its structural originality and to be recognized by cellular RNAi factors.

[0043] According to some embodiments of the present invention, gene modification is performed by modifications selected from the group consisting of deletions, insertions, point mutations, and combinations thereof.

[0044] According to some embodiments of the present invention, the modification is located in the stem region of a non-coding RNA molecule or an RNA silencing molecule.

[0045] According to some embodiments of the present invention, the modification is located in the loop region of a non-coding RNA molecule or an RNA silencing molecule.

[0046] According to some embodiments of the present invention, the modification is located in the unstructured region of a non-coding RNA molecule or an RNA silencing molecule.

[0047] According to some embodiments of the present invention, the modifications are located in the stem and loop regions of a non-coding RNA molecule or an RNA silencing molecule.

[0048] According to some embodiments of the present invention, the modifications are in the stem region and loop region, as well as the unstructured region, of a non-coding RNA molecule or RNA silencing molecule.

[0049] According to some embodiments of the present invention, the modification is an insertion.

[0050] According to some embodiments of the present invention, modifications are deletions.

[0051] According to some embodiments of the present invention, the modification is a point mutation.

[0052] According to some embodiments of the present invention, modifications include modifications of up to 200 nucleotides.

[0053] According to some embodiments of the present invention, the method further includes the step of introducing a donor oligonucleotide into eukaryotic cells.

[0054] According to some embodiments of the present invention, the DNA editing agent comprises at least one gRNA operably linked to a plant expression promoter.

[0055] According to some embodiments of the present invention, the DNA editing agent does not contain an endonuclease.

[0056] According to some embodiments of the present invention, the DNA editing agent comprises an endonuclease.

[0057] According to some embodiments of the present invention, the DNA editing agent comprises a DNA editing system selected from the group consisting of meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR.

[0058] According to some embodiments of the present invention, the endonuclease comprises Cas9.

[0059] According to some embodiments of the present invention, the DNA editing agent is applied to cells as DNA, RNA, or RNP.

[0060] According to some embodiments of the present invention, a DNA editing agent is linked to a reporter for monitoring expression in eukaryotic cells.

[0061] According to some embodiments of the present invention, the reporter is a fluorescent protein.

[0062] According to some embodiments of the present invention, the target RNA of interest or the second target RNA is endogenous to eukaryotic cells.

[0063] According to some embodiments of the present invention, the target RNA of interest or the second target RNA is associated with cancer.

[0064] According to some embodiments of the present invention, the target RNA of interest or the second target RNA is exogenous to eukaryotic cells.

[0065] According to some embodiments of the present invention, the target RNA of interest or the second target RNA is associated with infectious diseases.

[0066] According to some embodiments of the present invention, eukaryotic cells are obtained from eukaryotes selected from the group consisting of mammals, insects, nematodes, birds, reptiles, fish, crustaceans, fungi, and algae.

[0067] According to some embodiments of the present invention, eukaryotic cells are mammalian cells.

[0068] According to some embodiments of the present invention, mammalian cells include human cells.

[0069] According to some embodiments of the present invention, eukaryotic cells are totipotent stem cells.

[0070] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present invention relates. Similar or equivalent methods and materials to those described herein may be used in carrying out or testing embodiments of the present invention, but exemplary methods and / or materials are described below. In case of any conflict, the patent specification, including the definitions, shall prevail. Furthermore, the materials, methods, and examples are illustrative and not necessarily intended to be limiting. [Brief explanation of the drawing]

[0071] Some embodiments of the present invention are described herein merely as examples with reference to the accompanying drawings. With particular reference here to the drawings, it is emphasized that the details shown are for illustrative purposes and for the purpose of illustrative discussion of embodiments of the present invention. In this regard, the description with reference to the drawings will make it clear to those skilled in the art how embodiments of the present invention may be carried out.

[0072] [Figure 1] Figure 1 is a flowchart of an embodiment of a computational pipeline for generating genome editing-induced gene silencing (GEiGS) templates. The computational GEiGS pipeline enables the automated generation of GEiGS DNA templates used to apply biological metadata and minimally edit miRNA genes, leading to the acquisition of new functions, namely the redirection of their silencing capabilities to target sequences of interest. [Figure 2]Figure 2 is a flowchart of an embodiment in which miRNA is substituted with GEiGS using siRNA targeting green fluorescent protein (GFP) to generate silencing of the GFP gene that is stably expressed in human cell lines. [Figure 3] Figures 3A and 3B show images illustrating the knockdown of GFP expression levels in human cells. Control cells (Figure 3A) stably express GFP at a higher level compared to cells that stably express siGFP (Figure 3B), where GFP expression is silenced. [Figure 4] Figure 4 is a flowchart illustrating an embodiment of GEiGS cells that stably express siGFP. All positive transfection events are red fluorescent protein (RFP) + GFP. However, because GEiGS cells stably express siGFP, positive transfection cells show only red fluorescence expression. [Figure 5] Figure 5 is a flowchart of an embodiment of GEiGS cells stably expressing p53-targeted siRNA. All positive transfection events are GFP and escape chemotherapy or hDM2 inhibitor Nutlin3-induced cell death. [Figure 6] Figure 6 is a flowchart illustrating an embodiment of GEiGS cells that stably express siRNA targeting pro-apoptotic genes in the human cancer cell line U2OS. All positive transfection events are RFPs, thus avoiding chemotherapy-induced cell death. [Figure 7] Figure 7 is a flowchart of an embodiment of GEiGS cells generated to be resistant to lentiviral infection (in which GFP is used as a viral marker gene or as an exogenous gene). [Figure 8] Figure 8 is a flowchart illustrating an embodiment of GEiGS cells generated to be resistant to viral infection (i.e., immunized cells against foreign viral genes). [Figure 9] Figure 9 is an embodiment illustrating the main steps required to design an RNA silencing molecule using minimally edited miRNA gene bases. [Figure 10] Figure 10 is a graph showing the diverse types of non-coding RNAs actively involved in RNA interference (RNAi). This list provides non-coding RNA types (y-axis) that are dicers (known to be bound by dicers) and processed into small silencing RNAs (these small RNAs are known to be bound by Argonaut proteins). Each type has several slightly different subtypes (x-axis). [Figure 11] Figures 11A–E show examples of embodiments of human non-coding RNA, illustrating non-coding RNA precursors and their induced Ago-binding small RNAs. AGO2-binding small RNAs and AGO3-binding small RNAs are shown mapped to dicer-binding non-coding RNA precursors. (Figure 11A) shows let7 microRNA and its primary (marked by blue lines) and secondary mature miRNA sites (represented by gray bars). (Figures 11B–E) show examples of other biotypes where small RNA mappings indicate coded analogues to those found in microRNAs. [Figure 12A] Figures 12A-E show examples of embodiments of GEiGS oligo design. Selected non-coding RNA precursors that produce mature small RNA molecules are highlighted in green. Sequence differences between GEiGS oligos and wild-type sequences are highlighted in red. (Figure 12A) An example of an embodiment of GEiGS oligo design in which the GEiGS precursor preserves the same secondary structure as wild-type (wt) non-coding RNA. Design based on human microRNA-100. From left to right: wild-type microRNA, GEiGS design with matching structure and minimal sequence modification, and GEiGS design with matching structure and maximum sequence modification. This GEiGS design was based on 21nt siRNA targeting human heparin-binding vascular endothelial growth factor (VEGF). [Figure 12B]Figures 12A-E show examples of embodiments of GEiGS oligo design. Selected non-coding RNA precursors that produce mature small RNA molecules are highlighted in green. Sequence differences between GEiGS oligos and wild-type sequences are highlighted in red. (Figure 12B) An example of an embodiment of GEiGS oligo design in which the GEiGS precursor does not preserve the secondary structure as wt non-coding RNA. Design based on human microRNA-100. From left to right: wild-type microRNA, GEiGS design with mismatched structure and minimal sequence change, and GEiGS design with mismatched structure and maximum sequence change. This GEiGS design was based on 21nt siRNA targeting human heparin-binding vascular endothelial growth factor (VEGF). [Figure 12C] Figures 12A-E show examples of GEiGS oligo design embodiments. Selected non-coding RNA precursors that produce mature small RNA molecules are highlighted in green. Sequence differences between GEiGS oligos and wild-type sequences are highlighted in red. (Figure 12C) An example of a GEiGS oligo design embodiment in which the GEiGS precursor preserves the same secondary structure as the wt non-coding RNA. Design based on CID_001033 tRNA. From left to right: wild-type tRNA, GEiGS design with matching structure and minimal sequence modification, and GEiGS design with matching structure and maximum sequence modification. This GEiGS design was based on a 21nt siRNA targeting the bcr / abl e8a2 fusion protein gene. [Figure 12D] Figures 12A-E show examples of embodiments of GEiGS oligo design. Selected non-coding RNA precursors that produce mature small RNA molecules are highlighted in green. Sequence differences between GEiGS oligos and wild-type sequences are highlighted in red. (Figure 12D) An example of an embodiment of GEiGS oligo design in which the GEiGS precursor does not preserve secondary structure as wt non-coding RNA. Design based on CID_001033 tRNA. From left to right: wild-type tRNA, GEiGS design with mismatched structure and minimal sequence change, and GEiGS design with mismatched structure and maximum sequence change. This GEiGS design was based on a 21nt siRNA targeting the bcr / abl e8a2 fusion protein gene. [Figure 12E] Figures 12A-E show examples of GEiGS oligo design embodiments. Selected non-coding RNA precursors that produce mature small RNA molecules are highlighted in green. Sequence differences between GEiGS oligos and wild-type sequences are highlighted in red. (Figure 12E) An example of a GEiGS oligo design embodiment in which the precursor structure does not play a role in biosynthesis and therefore does not need to be maintained. Design based on Brassica rapa bnTAS3B tasiRNA. From left to right: wild-type tasiRNA, GEiGS design with minimal sequence change, and GEiGS design with maximum sequence change. Note that the circular structure is not unique to this molecule and was used for convenience; unlike miRNA and tRNA, tasiRNA biosynthesis does not depend on the above precursor secondary structure (as discussed in detail in Borges and Martienssen (2015) Nature Reviews Molecular Cell Biology|AOP, published online November 4, 2015; doi:10.1038 / nrm4085). Below the whole molecule, there are details of the section including modifications. This GEiGS design was based on 21nt siRNAS targeting the bcr / abl e8a2 fusion protein gene. [Figure 13] Figure 13 shows the PDS3 phenotype / genotype. To verify the presence of a donor versus the wild-type sequence, desaturated phenotypic plants were selected and their genotype was determined by internal amplicon PCR followed by restriction digestion analysis with BtsαI (NEB). Lane 1: Plants treated without a donor, restricted; Lanes 2-4: PDS3-treated plants with a donor, restricted; Lane 5: Positive plasmid donor control, unrestricted; Lane 6: Water control without a template; Lane 7: Positive plasmid donor, restricted; Lane 8: Plants impacted with a negative donor, restricted; Lane 9: Untreated control plants, restricted. Subsequent external PCR amplification of the amplicons was processed and sequenced to confirm the insertion. [Figure 14]Figure 14 shows the ADH1 phenotype / genotype. To verify the presence of a donor, plants were selected for allyl alcohol resistance, and genotypes were determined by internal amplicon PCR followed by BccI(NEB) restriction digestion. Lane 1: Allyl alcohol-sensitive control plant, restricted; Lanes 2-4: Allyl alcohol-resistant plants including donor restriction; Lane 5: Positive plasmid donor control, unrestricted; Lane 6: No template control; Lane 7: Positive plasmid donor, restricted; Lane 8: Plants impacted with a nonspecific donor, restricted; Lane 9: Non-allyl alcohol treated control, restricted. [Figure 15] Figure 15 is a graph showing gene expression analysis in miR-173-modified plants targeting the AtPDS3 transcript. AtPDS3 expression was analyzed by qRT-PCR when regenerating plants impregnated with GEiGS#4 and SWAP3 compared to plants impregnated with GEiGS#5 and SWAP1 and 2 (GFP). Notably, when miR-173 was modified to target AtPDS3 compared to control plants, a mean 82% decrease in gene expression levels was observed (error bars indicate SD; p-value calculated using Ct value < 0.01). [Figure 16] Figure 16 is a graph showing gene expression analysis in miR-390 modified plants targeting the AtPDS3 transcript. AtADH1 expression was analyzed by qRT-PCR when regenerating plants impregnated with GEiGS#1 and SWAP11, compared with plants impregnated with GEiGS#5 and SWAP1 and 2 (GFP). Notably, when miR-390 was modified to target AtADH1 compared to control plants, a mean 82% decrease in gene expression levels was observed (error bars represent SD; p-value calculated using Ct value < 0.01). [Modes for carrying out the invention]

[0073] In some embodiments, the present invention relates to modifying genes that encode or are processed by non-coding RNA molecules, including RNA silencing molecules, and more particularly to their use for silencing endogenous or exogenous target RNAs of interest in eukaryotic cells other than plant cells, but is not limited thereto.

[0074] The principles and operation of this invention can be better understood by referring to the drawings and accompanying description.

[0075] Before describing in detail at least one embodiment of the present invention, it should be understood that the present invention is not necessarily limited in its application to the details described below or illustrated by the examples. Other embodiments of the present invention are possible, and it can be carried out or performed in a variety of ways. Furthermore, it should be understood that the language and terminology used herein are for illustrative purposes only and should not be considered limiting.

[0076] Two of the most powerful genetic therapeutic technologies developed to date are gene therapy, which enables the repair of lost gene function through the expression of viral transgenes, and RNAi, which mediates the suppression of a deficient gene by knocking down a target mRNA. Recent advances in genome editing technology have made it possible to alter the DNA sequence in living cells by editing a few nucleotides in the cells of a human patient, for example, by genome editing (NHEJ and HR) following the induction of site-directed double-strand breaks (DSBs) at desired locations in the genome.

[0077] In implementing the present invention, the inventors have devised gene editing techniques that utilize non-coding RNA molecules designed to target and interfere with any desired target gene (endogenous or exogenous to eukaryotic cells). The gene editing techniques described herein do not require classical molecular genetic gene transfer tools, including expression cassettes having promoters, terminators, and selection markers. Furthermore, the gene editing techniques of some embodiments of the present invention involve genome editing of non-coding RNA molecules (e.g., endogenous), but the genome editing is stable and heritable.

[0078] As shown hereafter in this specification and in the subsequent Examples section, the inventors have designed a genome editing-inducible gene silencing (GEiGS) platform that can utilize and modify endogenous non-coding RNA molecules in eukaryotic cells, including, for example, RNA silencing molecules (e.g., siRNA, miRNA, piRNA, tasiRNA, tRNA, rRNA, antisense RNA, etc.), to target any RNA target of interest (see illustrative flowchart in Figure 2). Using GEiGS, the method enables screening of promising non-coding RNA molecules, editing several nucleotides in these endogenous RNA molecules, thereby redirecting their activity and / or specificity to effectively and specifically target any RNA of interest, including, for example, endogenous RNA encoding a mutant protein (e.g., oncogenes in cancer) or exogenous RNA encoded by a pathogen (see illustrative flowchart in Figure 1). In summary, GEiGS can be used as a novel technology for regulating the expression of endogenous genes, and also to immunize organisms against various biological and abiotic stresses such as cancer, viruses, insects, fungi, nematodes, heat, drought, and starvation.

[0079] Accordingly, according to one aspect of the present invention, a method is provided for modifying a gene that codes for or is processed by a non-coding RNA molecule that does not have RNA silencing activity in a eukaryotic cell, wherein the eukaryotic cell is not a plant cell, and the method includes the step of introducing a DNA editing agent into a eukaryotic cell that confers silencing specificity of the non-coding RNA molecule to a target RNA of interest, thereby modifying the gene that codes for or is processed by the non-coding RNA molecule.

[0080] According to another aspect of the present invention, a method is provided for modifying a gene encoding or being processed by an RNA silencing molecule for a target RNA in a eukaryotic cell, wherein the eukaryotic cell is not a plant cell, and the method comprises the step of introducing a DNA editing agent into the eukaryotic cell that redirects the silencing specificity of the RNA silencing molecule toward a second target RNA, thereby modifying the gene encoding the RNA silencing molecule, wherein the target RNA and the second target RNA are different.

[0081] As used herein, the term “eukaryotic cell” refers to any cell of a eukaryote. Eukaryotes include unicellular and multicellular organisms. Unicellular eukaryotes include, but are not limited to, yeasts, protozoa, slime molds, and algae. Multicellular eukaryotes include, but are not limited to, animals (e.g., mammals, insects, nematodes, birds, fish, reptiles, and crustaceans), fungi, and algae (e.g., brown algae, red algae, and green algae).

[0082] According to one embodiment, eukaryotic cells are not plant cells.

[0083] According to one embodiment, eukaryotic cells are animal cells.

[0084] According to one embodiment, eukaryotic cells are cells of vertebrates.

[0085] According to one embodiment, eukaryotic cells are cells of invertebrates.

[0086] According to certain embodiments, invertebrate cells are cells of insects, snails, clams, octopuses, starfish, sea urchins, jellyfish, and parasites.

[0087] According to certain embodiments, the invertebrate cells are crustacean cells. Exemplary crustaceans include, but are not limited to, shrimp, prawns, crabs, lobsters, and crayfish.

[0088] According to certain embodiments, the invertebrate cells are fish cells. Exemplary fish include, but are not limited to, salmon, tuna, Alaska pollock, catfish, cod, pygmy cod, shrimp, sea bass, tilapia, Arctic char, and carp.

[0089] According to one embodiment, eukaryotic cells are mammalian cells.

[0090] According to certain embodiments, mammalian cells are cells of non-human organisms, such as rodents, rabbits, pigs, goats, ruminants (e.g., cattle, sheep, antelopes, deer, and giraffes), dogs, cats, horses, and non-human primates (but not limited to these).

[0091] According to certain embodiments, eukaryotic cells are human cells.

[0092] According to one embodiment, eukaryotic cells include primary cultured cells, cell lines, somatic cells, embryonic cells, stem cells, embryonic stem cells, adult stem cells, hematopoietic stem cells, mesenchymal stem cells, induced pluripotent stem cells (iPS), gamete cells, zygote cells, blastocyst cells, embryos, fetal cells, and / or donor cells.

[0093] As used herein, the term "stem cell" refers to cells that can remain undifferentiated for extended periods in culture until they are induced to differentiate into other cell types with specific, specialized functions (e.g., fully differentiated cells) (e.g., totipotent stem cells, pluripotent stem cells, or multipotent stem cells). Totipotent cells, such as embryonic cells in the first pair of cells divided after fertilization, are the only cells that can differentiate into embryonic and extraembryonic cells and develop into viable human cells. Preferably, the term "pluripotent stem cell" refers to cells that can differentiate into all three embryonic layers, namely the ectoderm, endoderm, and mesoderm, or that remain undifferentiated. Examples of pluripotent stem cells include embryonic stem cells (ESCs) and induced pluripotent stem cells (iPS cells). Examples of multipotent stem cells include adult stem cells and hematopoietic stem cells.

[0094] The term “embryonic stem cell” refers to embryonic cells that can differentiate into cells of all three embryonic layers (i.e., endoderm, ectoderm, and mesoderm) or remain undifferentiated. The term “embryonic stem cell” may include cells obtained from embryonic tissue formed after pregnancy (e.g., blastocyst) (i.e., preimplantation blastocyst) before implantation of the embryo, expanded blastocyst cells (EBCs) obtained from blastocysts at the postimplantation / pregastrogenesis stage (see International Publication No. 2006 / 040763), embryonic germ (EG) cells obtained from fetal reproductive tissue at any time during pregnancy, preferably before 10 weeks of gestation, and cells derived from unfertilized eggs stimulated by parthenogenesis (parthenogenetic organisms).

[0095] Embryonic stem cells of some embodiments of the present invention can be obtained using well-known cell culture methods. For example, human embryonic stem cells can be isolated from human blastocysts. Human blastocysts are typically obtained from human in vivo preimplantation embryos or from in vitro fertilization (IVF) embryos. Alternatively, single-cell human embryos can be expanded to the blastocyst stage.

[0096] It will be found that commercially available stem cells can also be used according to some embodiments of the present invention. Human ES cells can be purchased from the NIH Human Embryonic Stem Cell Registry [www(dot)grants(dot)nih(dot)gov / stem_cells / registry / current(dot)htm].

[0097] In addition, embryonic stem cells have been found in mice (Mills and Bradley, 2001), golden hamsters [Doetschman et al., 1988, Dev Biol. 127:224-7], rats [Iannaccone et al., 1994, Dev Biol. 163:288-92], rabbits [Giles et al. 1993, Mol Reprod Dev. 36:130-8; Graves and Moredith, 1993, Mol Reprod Dev. 1993, 36:424-33], and several domesticated species [Notarianni et al., 1991, J Reprod Fertil Suppl. 43:255-60; Wheeler 1994, Reprod Fertil Dev. 6:563-8; Mitalipova et al., 2001, Cloning. It can be obtained from various species, including non-human primate species (rhesus macaques and marmosets) [Thomson et al., 1995, Proc Natl Acad Sci USA. 92:7844-8; Thomson et al., 1996, Biol Reprod. 55:254-9].

[0098] Induced pluripotent stem cells (iPS; embryo-like stem cells) refer to cells obtained by dedifferentiation of adult somatic cells that are conferred pluripotency (i.e., the ability to differentiate into the three embryonic layers, namely the endoderm, ectoderm, and mesoderm). According to some embodiments of the present invention, such cells are obtained from differentiated tissue (e.g., somatic cell tissue such as skin) and undergo dedifferentiation by genetic engineering to reprogram the cells to acquire the characteristics of embryonic stem cells. According to some embodiments of the present invention, induced pluripotent stem cells are formed by inducing the expression of Oct-4, Sox2, Kfl4, and c-Myc in somatic stem cells.

[0099] Induced pluripotent stem cells (iPS) (embryonic stem cells) can be generated from somatic cells by genetic manipulation, for example, by introducing retroviral transduction into somatic cells such as fibroblasts, hepatocytes, and gastric epithelial cells using transcription factors such as Oct-3 / 4, Sox2, c-Myc, and KLF4 [see, for example, Park et al., Reprogramming of human somatic cells to pluripotency with defined factors. Nature (2008) 451:141-146].

[0100] The term “adult stem cells” (also called “tissue stem cells” or “somatic tissue-derived stem cells”) refers to any stem cells derived from somatic tissue [of an animal (especially a human)], either postnatal or prenatal. Adult stem cells are generally considered to be pluripotent stem cells capable of differentiating into multiple cell types. Adult stem cells can originate from any adult tissue, such as adipose tissue, skin, kidney, liver, prostate, pancreas, intestines, bone marrow, and placenta, as well as neonatal or fetal tissue.

[0101] According to one embodiment, the stem cells used in some embodiments of the present invention are bone marrow (BM)-derived stem cells, including hematopoietic stem cells, stromal stem cells, or mesenchymal stem cells [Dominici, M et al., (2001) J. Biol. Regul. Homeost. Agents. 15:28-37]. BM-derived stem cells may be obtained from the iliac crest, femur, tibia, vertebra, rib, or other medullary cavity.

[0102] Hematopoietic stem cells (HSCs), also known as adult tissue stem cells, include stem cells obtained from the blood or bone marrow tissue of an individual of any age, or from the umbilical cord blood of a neonatal individual. Preferred stem cells according to this aspect of some embodiments of the present invention are preferably human or primate (e.g., monkey) embryonic stem cells.

[0103] Placental stem cells and umbilical cord blood stem cells may also be called "young stem cells."

[0104] Mesenchymal stem cells (MSCs), or pluripotent blast cells, can give rise to tissues other than those derived from the embryonic mesoderm (e.g., nerve cells) in response to various influences from one or more mesenchymal tissues (e.g., adipose tissue, bone tissue, cartilage tissue, elastic tissue, and fibrous connective tissue, myoblasts) and physiologically active factors such as cytokines. Such cells can be isolated from the embryonic yolk sac, placenta, umbilical cord, fetal (fetus) and adolescent skin, blood, and other tissues, but their abundance in mesenchymal blastoma (BM) far exceeds their abundance in other tissues, and therefore isolation from BM is currently preferred.

[0105] Adult tissue stem cells can be isolated using various methods known in the art, such as those disclosed by Alison, MR [J Pathol. (2003) 200(5):547-50]. Fetal stem cells can be isolated using various methods known in the art, such as those disclosed by Eventov-Friedman S, et al. [PLoS Med. (2006) 3:e215].

[0106] Hematopoietic stem cells can be isolated using various methods known in the art, such as those disclosed in "Handbook of Stem Cells" edited by Robert Lanze, Elsevier Academic Press, 2004, Vol. 54, pp. 609-614, and in "Isolation and Characterization of Hematopoietic Stem Cells" by Gerald J Spangrude and William B Stayton.

[0107] Methods for isolating, purifying, and expanding mesenchymal stem cells (MSCs) are publicly known in the art, including, for example, U.S. Patent No. 5,486,359 by Caplan and Haynesworth and Jones EA et al., 2002, Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells, Arthritis Rheum. 46(12):3349-60.

[0108] According to one embodiment, eukaryotic cells are isolated from their natural environment (e.g., the human body).

[0109] According to one embodiment, eukaryotic cells are healthy cells.

[0110] According to one embodiment, eukaryotic cells are pathological cells or disease-prone cells.

[0111] According to one embodiment, eukaryotic cells are cancer cells.

[0112] According to one embodiment, eukaryotic cells are immune cells (e.g., T cells, B cells, macrophages, NK cells, etc.).

[0113] According to one embodiment, eukaryotic cells are cells infected with a pathogen (for example, a bacterial, viral, or fungal pathogen).

[0114] As used herein, the term “non-coding RNA molecule” refers to an RNA sequence that is not translated into an amino acid sequence and does not code for a protein.

[0115] According to one embodiment, non-coding RNA molecules typically undergo RNA silencing processing mechanisms or activation. However, this specification also intends for slight nucleotide changes (e.g., up to 24 nucleotides) that can induce processing mechanisms resulting in RNA interference or translation inhibition.

[0116] According to certain embodiments, non-coding RNA molecules are endogenous (natural, e.g., undenatured) to the cell.

[0117] It is also understood that non-coding RNA molecules can be exogenous to cells (i.e., they are added from outside and do not naturally exist in cells).

[0118] According to some embodiments, non-coding RNA molecules possess intrinsic translation inhibitory activity.

[0119] According to some embodiments, non-coding RNA molecules possess intrinsic RNAi activity.

[0120] According to some embodiments, non-coding RNA molecules do not possess intrinsic translational inhibitory activity or intrinsic RNAi activity (i.e., non-coding RNA molecules do not have RNA silencing activity).

[0121] According to one embodiment of the present invention, a non-coding RNA molecule is specific to a target RNA (e.g., a natural target RNA) and, as determined at the RNA or protein level by, for example, RT-PCR, Western blotting, immunohistochemistry and / or flow cytometry, exhibits less than 100% overall homology to the target gene, e.g., less than 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, or less than 81% overall homology to the target gene, unless it is designed to cross-inhibit or silence a second target RNA or a target RNA of interest (as discussed below).

[0122] According to one embodiment, the non-coding RNA molecule is an RNA silencing molecule or an RNA interference (RNAi) molecule.

[0123] The term "RNA silencing" or "RNAi" refers to a cellular regulatory mechanism in which non-coding RNA molecules ("RNA silencing molecules" or "RNAi molecules") mediate sequence-specific simultaneous transcription (at transcription) or post-transcriptional inhibition of gene expression or translation.

[0124] According to one embodiment, RNA silencing molecules can mediate RNA repression during transcription (simultaneous transcription gene silencing).

[0125] According to certain embodiments, simultaneous transcription gene silencing includes epigenetic silencing (e.g., a chromatic state that inhibits gene expression).

[0126] According to one embodiment, RNA silencing molecules can mediate post-transcriptional RNA repression (post-transcriptional gene silencing).

[0127] Post-transcriptional gene silencing (PTGS) typically refers to the degradation or cleavage of messenger RNA (mRNA) molecules, which reduces their activity by interfering with translation. For example, and as will be discussed in detail below, the guide strand of an RNA silencing molecule pairs with a complementary sequence in the mRNA molecule and induces cleavage by, for example, Argonaut 2 (Ago2).

[0128] Simultaneous transcription gene silencing typically refers to the inactivation of gene activity (i.e., transcriptional repression) and usually occurs within the cell nucleus. Such gene repression is mediated by epigenetic factors such as methyltransferases that methylate target DNA or histones. Therefore, in simultaneous transcription gene silencing, the binding of small RNA to target RNA (small RNA-transcript interaction) recruits DNA-modifying enzymes and histone-modifying enzymes (i.e., epigenetic factors) that destabilize the target nascent transcript and induce chromatin rearrangement into a structure that represses gene activity and transcription. Furthermore, in simultaneous transcription gene silencing, chromatin-related long non-coding RNA backbone may recruit chromatin modification complexes independently of small RNA. These simultaneous transcription silencing mechanisms form an RNA surveillance system that detects and silences inappropriate transcription events, and provide memory of these events via a self-reinforcing epigenetic loop [described in D. Hoch and D. Moazed, RNA-mediated epigenetic regulation of gene expression, Nat Rev Genet. (2015) 16(2):71-84].

[0129] According to one embodiment of the present invention, the RNAi biosynthesis / processing mechanism generates RNA silencing molecules.

[0130] According to one embodiment of the present invention, the RNAi biosynthesis / processing mechanism generates RNA silencing molecules, but specific targets have not been identified.

[0131] According to one embodiment, non-coding RNA molecules can induce RNA interference (RNAi).

[0132] The following is a detailed description of non-coding RNA molecules (e.g., RNA silencing molecules) containing unique RNAi activity that may be used according to specific embodiments of the present invention.

[0133] According to one embodiment, a non-coding RNA molecule or an RNA silencing molecule is processed from a precursor.

[0134] According to one embodiment, a non-coding RNA molecule or RNA silencing molecule is processed from a single-stranded RNA (ssRNA) precursor.

[0135] According to one embodiment, a non-coding RNA molecule or RNA silencing molecule is processed from a double-stranded single-stranded RNA precursor.

[0136] According to one embodiment, a non-coding RNA molecule or RNA silencing molecule is processed from a dsRNA precursor (including, for example, complete and incomplete base pairings).

[0137] According to one embodiment, a non-coding RNA molecule or RNA silencing molecule is processed from an unstructured RNA precursor.

[0138] According to one embodiment, a non-coding RNA molecule or an RNA silencing molecule is processed from a protein-coding RNA precursor.

[0139] According to one embodiment, a non-coding RNA molecule or an RNA silencing molecule is processed from a non-coding RNA precursor.

[0140] According to one embodiment, dsRNA can be derived from two different complementary RNAs, or from a single RNA that folds itself to form dsRNA.

[0141] Complete and incomplete base-paired RNA (i.e., double-stranded RNA; dsRNA), siRNA, and shRNA – the presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme called dicer. Dicer (also known as endoribonuclease dicer or RNase-motif helicase) is an enzyme encoded by the DICER1 gene in humans. Dicer is involved in the processing of dsRNA into short fragments known as short interfering RNA (siRNA). siRNAs derived from dicer activity are typically about 21–23 nucleotides long and contain a double helix of about 19 base pairs with two 3' nucleotide overhangs.

[0142] Accordingly, some embodiments of the present invention are intended to modify the gene encoding the dsRNA to redirect its silencing specificity (including silencing activity) towards a second target RNA (i.e., the RNA of interest).

[0143] According to one embodiment, a dsRNA precursor longer than 21 bp is used. Various studies demonstrate that long dsRNAs can be used to silence gene expression without inducing a stress response or causing significant off-target effects. See, for example, [Strat et al., Nucleic Acids Research, 2006, vol. 34, no. 13, 3803-3810; Bhargava A et al., Brain Res. Protoc. 2004; 13:115-125; Diallo M et al., Oligonucleotides. 2003; 13:381-392; Paddison PJ et al., Proc. Natl Acad. Sci. USA. 2002; 99:1443-1448; Tran N et al., FEBS Lett. 2004; 573:127-134].

[0144] The term "siRNA" refers to small inhibitory RNA double helix molecules (generally 18-30 base pairs) that induce the RNA interference (RNAi) pathway. Typically, siRNA is chemically synthesized as a 21-mer (base length) with a central 19-bp double helix region and symmetrical 2-base 3'-overhangs at the ends. However, it has recently been reported that chemically synthesized RNA double helix of 25-30 base lengths can exhibit up to a 100-fold increase in potency compared to a 21-mer at the same position. The observed increased potency obtained by using longer RNA when inducing RNAi is thought to result from providing the substrate (27-mer) to the dicer instead of the product (21-mer), and this is suggested to improve the rate or efficiency of siRNA double helix entry into RISC.

[0145] It has been found that the location of the 3'-overhang affects the potency of siRNA, but the composition does not, and that asymmetric double helix with a 3'-overhang on the antisense strand is generally more potent than those with a 3'-overhang on the sense strand (Rose et al., 2005).

[0146] The strands of double-stranded interfering RNA (e.g., siRNA) can be ligated to form a hairpin or stem-loop structure (e.g., shRNA). Thus, as mentioned, the RNA silencing molecule in some embodiments of the present invention may be a short hairpin RNA (shRNA).

[0147] The term "shRNA," as used herein, refers to an RNA molecule having a stem-loop structure containing first and second regions of complementary sequences, the degree of complementarity and orientation of these regions being sufficient for base-pairing to occur between them, the first and second regions being linked by a loop region, the loop resulting from the absence of base-pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is 3–23, or 5–15, or 7–13, or 4–9, or 9–11 (including the numbers at both ends). Some of the nucleotides in the loop may be involved in base-pairing interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that may be used to form loops include 5'-CAAGAGA-3' and 5'-UUACAA-3' (International Publication No. 2013126963 and International Publication No. 2014107763). Those skilled in the art will recognize that the resulting single-stranded oligonucleotides form a stem-loop or hairpin structure containing a double-stranded region capable of interacting with the RNAi mechanism.

[0148] The RNA silencing molecules of some embodiments of the present invention are not limited to molecules containing only RNA, but further encompass chemically modified nucleotides and non-nucleotides.

[0149] Various types of siRNA, including trans-acting siRNA (Ta-siRNA), repeat-associated siRNA (Ra-siRNA), and siRNA derived from natural antisense transcripts (Nat-siRNA), are intended by the present invention.

[0150] According to one embodiment, the silencing RNA includes "piRNAs," which are a class of Piwi-interacting RNAs approximately 26 and 31 nucleotides in length. PiRNAs typically form RNA-protein complexes through interaction with Piwi proteins; that is, antisense piRNAs are typically loaded (incorporated) into Piwi proteins (e.g., Piwi, Ago3, and Aubergine (Aub)).

[0151] miRNA - According to another embodiment, the RNA silencing molecule may be a miRNA.

[0152] The terms "microRNA," "miRNA," and "miR" are synonymous and refer to a group of non-coding single-stranded RNA molecules, approximately 19–28 nucleotides in length, that regulate gene expression. miRNAs are found in a wide range of organisms (e.g., viruses) and have been shown to play a role in development, homeostasis, and disease pathogenesis.

[0153] Initially, pre-miRNA exists as a long, incomplete double-stranded stem-loop RNA, which is a maturation guide strand (miRNA) and a passenger strand (miRNA). * Further processed by a dicer into siRNA-like double helix containing fragments of similar size known as miRNA and miRNA * These may originate from the opposing arms of pri-miRNA and pre-miRNA. * The sequence can be found in libraries of cloned miRNAs, but typically at a lower frequency than miRNAs.

[0154] Initially, miRNA * Although they exist as double-stranded RNAs, miRNAs eventually become single-stranded RNAs incorporated into a ribonucleoprotein complex known as the RNA-induced silencing complex (RISC). Various proteins can form RISC, thereby miRNA / miRNA * Specificity for double helix, binding site of target gene, miRNA activity (repression or activation), and miRNA / miRNA * There may be variability in which strand of the double hemisphere is loaded into RISC.

[0155] gRNA:miRNA * When a double-stranded miRNA strand is loaded into RISC, the miRNA *is removed and degraded. miRNA:miRNA loaded onto RISC * The strand of the double-strand is the one with a less tightly paired 5' end. miRNA:miRNA * If both ends have approximately equivalent 5' pairing, both miRNA and miRNA * may have gene silencing activity.

[0156] RISC identifies target nucleic acids based on a high level of complementarity between miRNA and mRNA, particularly nucleotides 2 - 8 of miRNA (referred to as the "seed sequence").

[0157] Numerous studies have focused on the requirement for base pairing between miRNA and its mRNA target to achieve efficient inhibition of translation (review by Bartel 2004, Cell 116 - 281). Computational studies analyzing miRNA binding across the genome have suggested a specific role for nucleotides 2 - 8 on the 5' side of miRNA (also called the "seed sequence") in target binding, but the role of the first nucleotide, which is usually "A", has also been recognized (Lewis et al. 2005 Cell 120 - 15). Similarly, targets were identified and confirmed by Krek et al. (2005, Nat Genet 37 - 495) using nucleotides 1 - 7 or 2 - 8. The target site on mRNA may be in the 5' UTR, 3' UTR, or coding region. Interestingly, multiple miRNAs may regulate the same mRNA target by recognizing the same or multiple sites. The presence of multiple miRNA binding sites in most genetically identified targets may indicate that the cooperative action of multiple RISCs leads to the most efficient inhibition of translation.

[0158] miRNAs can induce RISC to downregulate gene expression through one of two mechanisms: mRNA cleavage or translational repression. If the mRNA is somewhat complementary to the miRNA, the miRNA may also dictate mRNA cleavage. When miRNA induces cleavage, the cleavage is typically between nucleotides pairing with residues 10 and 11 of the miRNA. Alternatively, if the miRNA is not sufficiently complementary to the miRNA, it can repress translation. Translational repression may be more common in animals because the degree of complementarity between miRNA and its binding site may be lower.

[0159] miRNA and miRNA * It should be noted that there may be variability (variation) in either pair of the 5' and 3' ends. This variability may be due to variability in the enzymatic processing (processing) of the dicers and dicers with respect to the cleavage site. miRNA and miRNA * The variability at the 5' and 3' ends may be due to mismatches in the stem structures of pri-miRNA and pre-miRNA. Stem mismatches can result in different hairpin structures. Stem structure variability can also lead to variability in cleavage products by drotherapists and dicers.

[0160] It is understood that pre-miRNA sequences may contain 45-90, 60-80, or 60-70 nucleotides, while pri-miRNA sequences may contain 45-30,000, 50-25,000, 100-20,000, 1,000-1,500, or 80-100 nucleotides.

[0161] According to one embodiment, the miRNA includes miR-150 (for example, human miR-150 as shown in, for example, SEQ ID NO: 13).

[0162] According to one embodiment, the miRNA includes miR-210 (for example, human miR-210 as shown in, for example, SEQ ID NO: 14).

[0163] According to one embodiment, the miRNA includes Let-7 (for example, human Let-7 as shown in Sequence ID No. 15).

[0164] According to one embodiment, the miRNA includes miR-184 (for example, human miR-184 as shown in, for example, SEQ ID NO: 16).

[0165] According to one embodiment, the miRNA includes miR-204 (for example, human miR-204 as shown in, for example, SEQ ID NO: 17).

[0166] According to one embodiment, the miRNA includes miR-25 (for example, human miR-25 as shown in, for example, SEQ ID NO: 18).

[0167] According to one embodiment, the miRNA includes miR-34 (for example, human miR-34a / b / c as shown in SEQ ID NOs. 19 to 21, respectively).

[0168] Further miRNAs are presented in Table 1B below in this specification.

[0169] Antisense - Antisense is a single-stranded RNA designed to block or inhibit the expression of a gene by specifically hybridizing with the gene's mRNA. Downregulation of a target RNA can be achieved using antisense polynucleotides that can specifically hybridize with the mRNA transcript encoding the target RNA.

[0170] As mentioned, non-coding RNA molecules do not necessarily have canonical (endogenous) RNAi activity (for example, they are not canonical RNA silencing molecules, or their targets are not identified). Such non-coding RNA molecules include the following:

[0171] According to one embodiment, the non-coding RNA molecule is transfer RNA (tRNA). The term "tRNA" refers to an RNA molecule that acts as a physical link between the nucleotide sequence of a nucleic acid and the amino acid sequence of a protein, and was formerly called soluble RNA or sRNA. tRNA is typically about 76 to 90 nucleotides long.

[0172] According to one embodiment, the non-coding RNA molecule is ribosomal RNA (rRNA). The term "rRNA" refers to the RNA component of ribosomes, i.e., either the ribosomal small subunit or the ribosomal large subunit.

[0173] According to one embodiment, the non-coding RNA molecule is a nuclear small RNA (snRNA or U-RNA). The terms "sRNA" or "U-RNA" refer to small RNA molecules found in splicing spots and Cajal bodies in the cell nucleus of eukaryotic cells. snRNA is typically about 150 nucleotides long.

[0174] According to one embodiment, the non-coding RNA molecule is a nucleolar small RNA (snoRNA). The term "snoRNA" primarily refers to a class of small RNA molecules that lead to chemical modifications of other RNAs, such as rRNA, tRNA, and snRNA. SnoRNAs are typically classified into one of two classes: C / D box snoRNAs are typically about 70–120 nucleotides long and are associated with methylation, while H / ACA box snoRNAs are typically about 100–200 nucleotides long and are associated with pseudouridylation.

[0175] Similar to snoRNAs, scaRNAs (i.e., Small Cajal body RNA genes) also play a role in RNA maturation, but their target is spliceosome snRNA, and scaRNAs perform site-specific modifications of the spliceosome snRNA precursor (in the nuclear Cajal body).

[0176] According to one embodiment, the non-coding RNA molecule is extracellular RNA (exRNA). The term "exRNA" refers to RNA species (e.g., exosomal RNA) that exist outside the cell where transcription takes place.

[0177] According to one embodiment, the non-coding RNA molecule is a long non-coding RNA (lncRNA). The term "lncRNA" or "long ncRNA" typically refers to a non-protein-coding transcript longer than 200 nucleotides.

[0178] According to one embodiment, non-coding RNA molecules include, but are not limited to, microRNA (miRNA), piwi-interacting RNA (piRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), trans-acting siRNA (tasiRNA), nuclear small RNA (snRNA or URNA), nucleolar small RNA (snoRNA), small Cajal RNA (scaRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), extracellular RNA (exRNA), repeat-derived RNA, transposable element RNA, and long non-coding RNA (lncRNA).

[0179] According to one embodiment, non-limiting examples of RNAi molecules include, but are not limited to, small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNAs), Piwi-interacting RNAs (piRNAs), and trans-acting siRNAs (tasiRNAs).

[0180] As described above, the methods of some embodiments of the present invention are used to redirect the silencing activity and / or specificity of a non-coding RNA molecule toward a second target RNA or a target RNA of interest (or to generate silencing activity and / or specificity if the non-coding RNA molecule does not have the inherent ability to silence RNA molecules).

[0181] According to one embodiment, the target RNA and the second target RNA are different.

[0182] According to one embodiment, a method for modifying a gene encoding or being processed by an RNA silencing molecule for a target RNA in a eukaryotic cell, wherein the eukaryotic cell is not a plant cell, comprises the step of introducing a DNA editing agent into a eukaryotic cell that redirects the silencing activity and / or specificity of the RNA silencing molecule toward a second target RNA, thereby modifying the gene encoding the RNA silencing molecule, wherein the target RNA and the second target RNA are different.

[0183] As used herein, the terms “redirecting silencing specificity” and “redirecting silencing specificity” refer to reprogramming the original specificity of a non-coding RNA (e.g., an RNA silencing molecule) toward a non-natural target of the non-coding RNA (e.g., an RNA silencing molecule). Thus, the original specificity of the non-coding RNA is destroyed (i.e., loss of function), and the new specificity is toward an RNA target different from the natural target (i.e., the RNA of interest) (i.e., acquisition of function). It will be understood that if the non-coding RNA does not possess silencing activity, only acquisition of function occurs.

[0184] As used herein, the term “target RNA” refers to an RNA sequence that is naturally bound by a non-coding RNA molecule. Therefore, target RNA is considered by those skilled in the art as a substrate for non-coding RNA.

[0185] As used herein, the term “secondary target RNA” refers to an RNA sequence (coding or non-coding) that is not naturally bound by a non-coding RNA molecule. Therefore, the secondary target RNA is not a natural substrate of the non-coding RNA.

[0186] As used herein, the term “target RNA” means the RNA sequence (coding or noncoding) that is to be silenced by the designed non-coding RNA molecule.

[0187] As used herein, the term “silencing a target gene” means the absence or observable reduction (e.g., by co-transcription and / or post-transcriptional gene silencing) of the protein and / or mRNA product from the target gene. Accordingly, the silencing of a target gene may be 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the target gene compared to the target gene not targeted by the non-coding RNA molecule designed in the present invention.

[0188] The results of silencing can be confirmed by testing the outward characteristics of eukaryotic cells or eukaryotes, or by biochemical techniques (as discussed below).

[0189] It will be understood that non-coding RNA molecules designed in some embodiments of the present invention may have several off-target specific effects, provided that they do not affect the growth, differentiation, or function of eukaryotic cells or eukaryotes.

[0190] According to one embodiment, the second target RNA or target RNA of interest is endogenous to eukaryotic cells. Exemplary endogenous second target RNA or target RNA of interest includes, but is not limited to, the products of genes associated with cancer and / or apoptosis. Exemplary cancer-related target genes include, but are not limited to, the p53, BAX, PUMA, NOXA, and FAS genes, as will be discussed later herein.

[0191] According to one embodiment, the second target RNA or target RNA of interest is exogenous (also referred to herein as heterologous) to the eukaryotic cell. In such cases, the second target RNA or target RNA of interest is the product of a gene that is not part of the natural eukaryotic cell genome (i.e., the gene that expresses non-coding RNA). Exemplary exogenous target RNAs include, but are not limited to, products of infectious disease-related genes, such as genes of pathogens (e.g., insects, viruses, bacteria, fungi, nematodes), as will be discussed further below herein. The exogenous target RNA (coding or non-coding) may include a nucleic acid sequence that shares sequence identity with an endogenous RNA sequence of a eukaryote (e.g., which may be partially homologous to an endogenous nucleic acid sequence).

[0192] The specific binding of endogenous non-coding RNA molecules to target RNA can be determined by computer algorithms (e.g., BLAST) and verified by methods including, for example, Northern blotting, in situ hybridization, and QuantiGene Plex assays.

[0193] The use of the terms “complementarity” or “complementary” means that a non-coding RNA molecule (or at least a portion of a non-coding RNA molecule existing in the form of a small RNA molecule being processed, or at least one strand of a double-stranded polynucleotide or a portion thereof, or a portion of a single-stranded polynucleotide) hybridizes with a target RNA or its fragment under physiological conditions to result in the regulation, function, or repression of a target gene. For example, in some embodiments, the non-coding RNA molecule is one of the following in the target RNA (or a family member of a given target gene): 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 5 It has 100% sequence identity or at least about 30%, 40%, 45%, 500, 60%, 80%, 90%, 100, 150, 200, 300, 400, 500 or more consecutive nucleotide sequences.

[0194] As used herein, a non-coding RNA molecule, or the small RNA morphology into which it is processed, is said to exhibit "perfect complementarity" if all nucleotides in one sequence, when read from 5' to 3', are complementary to all nucleotides in the other sequence, when read from 3' to 5'. A nucleotide sequence that is perfectly complementary to a reference nucleotide sequence will exhibit the same sequence as the reverse complementary sequence of the reference nucleotide sequence.

[0195] Methods for determining sequence complementarity are well known in the art, and include, but are not limited to, bioinformatics tools well known in the art (e.g., BLAST, multiple sequence alignment).

[0196] According to one embodiment, when a non-coding RNA molecule is an siRNA or is processed into an siRNA, the complementarity is in the range of 90-100% (e.g., 100%) with respect to its target sequence.

[0197] According to one embodiment, when a non-coding RNA molecule is a miRNA or piRNA, or is processed into a miRNA or piRNA, the complementarity is in the range of 33-100% with respect to its target sequence.

[0198] According to one embodiment, if the non-coding RNA molecule is a miRNA, the seed sequence complementarity (i.e., nucleotides 2-8 from 5') is in the range of 85-100% (e.g., 100%) with respect to its target sequence.

[0199] According to one embodiment, non-coding RNA can be further processed into a small RNA morphology (e.g., pre-miRNA is processed into mature miRNA). In such cases, homology is measured based on the small RNA morphology being processed (e.g., mature miRNA sequence).

[0200] As used herein, the term "small RNA morphology" means mature small RNA capable of hybridizing with target RNA (or a fragment thereof). According to one embodiment, the small RNA morphology has silencing activity.

[0201] According to one embodiment, complementarity to the target sequence is at least about 33% (e.g., 33% of 21-24 nt) of the small RNA morphology being processed. Therefore, for example, if the non-coding RNA molecule is a miRNA, 33% of the mature miRNA sequence (e.g., 21 nt) contains seed complementarity (e.g., 7 nt of 21 nt).

[0202] According to one embodiment, complementarity to the target sequence is at least about 45% (e.g., 45% of 21-28 nt) of the small RNA morphology being processed. Therefore, for example, if the non-coding RNA molecule is a miRNA, 45% of the mature miRNA sequence (e.g., 21 nt) contains seed complementarity (e.g., 9-10 nt of 21 nt).

[0203] According to one embodiment, the non-coding RNA (i.e., the unmodified RNA) is typically selected to have up to 10%, 20%, 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementarity to the sequence of the second target RNA or the target RNA of interest.

[0204] According to certain embodiments, the non-coding RNA molecule (i.e., the pre-modification molecule) is typically selected to have less than 99% complementarity to the sequence of the second target RNA or the target RNA of interest.

[0205] According to certain embodiments, the non-coding RNA molecule (i.e., the pre-modification molecule) is typically selected to have less than 98% complementarity to the sequence of the second target RNA or the target RNA of interest.

[0206] According to certain embodiments, the non-coding RNA molecule (i.e., the pre-modification molecule) is typically selected to have less than 97% complementarity to the sequence of the second target RNA or the target RNA of interest.

[0207] According to certain embodiments, the non-coding RNA molecule (i.e., the pre-modification molecule) is typically selected to have less than 96% complementarity to the sequence of the second target RNA or the target RNA of interest.

[0208] According to certain embodiments, the non-coding RNA molecule (i.e., the pre-modification molecule) is typically selected to have less than 95% complementarity to the sequence of the second target RNA or the target RNA of interest.

[0209] According to certain embodiments, the non-coding RNA molecule (i.e., the pre-modification molecule) is typically selected to have less than 90% complementarity to the sequence of the second target RNA or the target RNA of interest.

[0210] According to a particular embodiment, the non-coding RNA molecule (i.e., the pre-modification molecule) is typically selected to have less than 85% complementarity to the sequence of the second target RNA or the target RNA of interest.

[0211] According to certain embodiments, the non-coding RNA molecule (i.e., the pre-modification molecule) is typically selected to have less than 50% complementarity to the sequence of the second target RNA or the target RNA of interest.

[0212] According to certain embodiments, the non-coding RNA molecule (i.e., the pre-modification molecule) is typically selected to have less than 33% complementarity to the sequence of the second target RNA or the target RNA of interest.

[0213] According to one embodiment, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least about 33%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% complementarity with respect to the sequence of a second target RNA or the target RNA of interest.

[0214] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have a minimum of 33% complementarity (e.g., 85-100% seed match) to a second target RNA or the target RNA of interest.

[0215] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have a minimum of 40% complementarity to a second target RNA or the target RNA of interest.

[0216] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have a minimum of 45% complementarity to a second target RNA or the target RNA of interest.

[0217] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have a minimum of 50% complementarity to a second target RNA or the target RNA of interest.

[0218] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have a minimum of 60% complementarity to a second target RNA or the target RNA of interest.

[0219] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 70% complementarity to a second target RNA or the target RNA of interest.

[0220] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 80% complementarity to a second target RNA or the target RNA of interest.

[0221] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have a minimum of 85% complementarity to a second target RNA or the target RNA of interest.

[0222] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 90% complementarity to a second target RNA or the target RNA of interest.

[0223] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 95% complementarity to a second target RNA or the target RNA of interest.

[0224] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have a minimum of 96% complementarity to a second target RNA or the target RNA of interest.

[0225] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have a minimum of 97% complementarity to a second target RNA or the target RNA of interest.

[0226] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have a minimum of 98% complementarity to a second target RNA or the target RNA of interest.

[0227] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have at least 99% complementarity to a second target RNA or the target RNA of interest.

[0228] According to certain embodiments, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to have 100% complementarity with a second target RNA or the target RNA of interest.

[0229] To generate silencing activity and / or specificity of a non-coding RNA molecule, or to redirect the silencing activity and / or specificity of a non-coding RNA molecule (e.g., an RNA silencing molecule) toward a second target RNA or a target RNA of interest, the gene encoding the non-coding RNA molecule (e.g., an RNA silencing molecule) is modified using a DNA editing agent.

[0230] The following describes various non-limiting examples of methods and DNA editing agents used to introduce nucleic acid modifications into genes encoding non-coding RNA molecules (e.g., RNA silencing molecules), as well as agents for carrying them out, which may be used according to specific embodiments of this disclosure.

[0231] Genome editing using modified endonucleases – This approach typically refers to a reverse genetic method that uses artificially modified nucleases to cleave and create specific double-strand breaks (DSBs) at desired locations in the genome, which are then repaired by intracellular processes such as homologous recombination (HR) or non-homologous end joining (NHEJ). NHEJ directly joins DNA ends at double-strand breaks (DSBs) with or without minimal end trimming, while HR utilizes a homologous donor sequence as a template (i.e., a sister chromatid formed in S phase) to regenerate / copy the deleted DNA sequence at the cleavage site. To introduce a specific nucleotide modification into genomic DNA, a donor DNA repair template containing the desired sequence must be present during HR (extrinsically provided single-stranded or double-stranded DNA).

[0232] Most restriction enzymes recognize a few base pairs as targets on DNA, and since these sequences are often found at many locations throughout the genome, resulting in multiple breaks not limited to the desired location, genome editing cannot be performed using conventional restriction endonucleases. To overcome this challenge and produce site-specific single-strand or double-strand breaks (DSBs), several different classes of nucleases have been discovered and bioengineered to date. These include meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas9 (and all their variations) systems.

[0233] Meganucleases – Meganucleases are generally classified into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family. These families are characterized by structural motifs that affect catalytic activity and recognition sequences. For example, members of the LAGLIDADG family are characterized by having either one or two copies of the conserved LAGLIDADG motif. The four families of meganucleases are largely separated from each other in terms of conserved structural elements, and therefore DNA recognition sequence specificity and catalytic activity. Meganucleases are commonly found in microbial species and have the unique characteristic of having very long recognition sequences (>14 bp), which therefore makes them naturally very specific for cleavage at desired locations.

[0234] This can be used to create site-directed double-strand breaks (DSBs) in genome editing. Those skilled in the art can use these naturally occurring meganucleases, but the number of such naturally occurring meganucleases is limited. To overcome this challenge, unique sequence-recognizing meganuclease mutants have been created using mutagenesis and high-throughput screening methods. For example, various meganucleases have been fused to create hybrid enzymes that recognize novel sequences.

[0235] Alternatively, the DNA-interacting amino acids of a meganuclease can be modified to design a sequence-specific meganuclease (see, for example, U.S. Patent No. 8,021,867). Meganucleases can be designed using the methods described, for example, Certo, MT et al., Nature Methods (2012) 9:073-975; U.S. Patent No. 8,304,222; U.S. Patent No. 8,021,867; U.S. Patent No. 8,119,381; U.S. Patent No. 8,124,369; U.S. Patent No. 8,129,134; U.S. Patent No. 8,133,697; U.S. Patent No. 8,143,015; U.S. Patent No. 8,143,016; U.S. Patent No. 8,148,098; or U.S. Patent No. 8,163,514. The contents of each of these documents are incorporated herein by reference in their entirety. Alternatively, meganucleases with site-specific cleavage properties can be obtained using commercially available technologies (e.g., Precision Biosciences' Directed Nuclease Editor® genome editing technology).

[0236] ZFNs and TALENs – Two distinct classes of manipulated nucleases, zinc finger nucleases (ZFNs) and activator-like effector nucleases (TALENs), have both been proven effective in generating targeted double-strand breaks (DSBs) (Christian et al., 2010; Kim et al., 1996; Li et al., 2011; Mahfouz et al., 2011; Miller et al., 2010).

[0237] Essentially, ZFN and TALEN restriction endonuclease technologies utilize nonspecific DNA-cutting enzymes linked to specific DNA-binding domains (either a series of zinc finger domains or TALE repeats, respectively). Typically, restriction enzymes are selected in which the DNA recognition site and the cleavage site are separated from each other. By separating the cleavage sites and then linking them to the DNA-binding domains, an endonuclease with very high specificity for the desired sequence is produced. An exemplary restriction enzyme with such properties is Fok1. Furthermore, Fok1 has the advantage of requiring dimerization to have nuclease activity, which means that specificity is dramatically increased as each nuclease partner recognizes a unique DNA sequence. To enhance this effect, Fok1 nucleases that can only function as heterodimers and have increased catalytic activity have been engineered. Heterodimeric functional nucleases avoid the possibility of unwanted homodimeric activity and thus increase the specificity of double-strand breaks (DSBs).

[0238] Therefore, for example, to target a specific site, ZFNs and TALENs are constructed as nuclease pairs, with each member of the pair designed to bind to an adjacent sequence at the targeted site. During transient expression in cells, the nuclease binds to its target site, the FokI domain heterodimerizes, and a double-strand break (DSB) is created. Repair of these double-strand breaks (DSBs) via the non-homologous end joining (NHEJ) pathway often results in small deletions or small sequence insertions (indels). Since each repair performed by NHEJ is unique, the use of a single nuclease pair can generate a series of alleles with a range of different insertions or deletions at the target site.

[0239] Generally, NHEJs are relatively accurate (about 85% of DSBs in human cells are repaired by NHEJs within about 30 minutes of detection), and in gene editing, if the repair is accurate, the nuclease is relied upon as an incorrect NHEJ because the repair product is mutagenic and the recognition / cleavage site / PAM motif disappears / mutates, or the transiently introduced nuclease is no longer present.

[0240] Deletions typically range in length from a few base pairs to several hundred base pairs, but larger deletions have been successfully generated in cell culture by using two pairs of nucleases simultaneously (Carlson et al., 2012; Lee et al., 2010). Furthermore, when DNA fragments homologous to the target region are introduced together with a pair of nucleases, double-strand breaks (DSBs) can be repaired via homologous recombination (HR) to produce specific modifications (Li et al., 2011; Miller et al., 2010; Urnov et al., 2005).

[0241] While the nuclease moieties of both ZFNs and TALENs possess similar properties, the difference between these manipulated nucleases lies in their DNA-recognizing peptides. ZFNs rely on Cys2-His2 zinc fingers, while TALENs rely on TALE. Both of these DNA-recognizing peptide domains are characterized by their natural occurrence in combination within their proteins. Cys2-His2 zinc fingers are typically found in repeats separated by 3 bp and in diverse combinations across various nucleic acid-interacting proteins. TALE, on the other hand, is found in repeats with a 1:1 recognition ratio between the amino acid and the recognized nucleotide pair. Since both zinc fingers and TALE occur in repeat patterns, different combinations can be experimented with to create a wide variety of sequence specificities. Approaches for constructing site-specific zinc finger endonucleases include, for example, modular assembly (in which case zinc fingers correlating with triplet sequences are joined in columns to cover the required sequences), OPEN (low-stringency selection of peptide domains versus triplet nucleotides, followed by high-stringency selection of peptide combinations versus the final target in a bacterial system), and, among other things, bacterial one-hybrid screening of zinc finger libraries. ZFNs are also designed and commercially available, for example, from Sangamo Biosciences® (Richmond, California).

[0242] Methods for designing and obtaining TALENs are described, for example, in: Reyon et al., Nature Biotechnology May 2012;30(5):460-5; Miller et al., Nat Biotechnol.(2011) 29:143-148; Cermak et al., Nucleic Acids Research(2011)39(12):e82 and Zhang et al., Nature Biotechnology(2011) 29(2):149-53. A recently developed web-based program called Mojo Hand has been introduced by the Mayo Clinic for designing TAL and TALEN constructs for genome editing applications (accessible through www(dot)talendesign(dot)org). TALENs can also be designed and commercially available, for example, from Sangamo Biosciences™ (Richmond, California).

[0243] The T-GEE system (TargetGene's Genome Editing Engine) provides a programmable nucleoprotein molecular complex containing a polypeptide moiety and a specificity-constituting nucleic acid (SCNA) that assembles in vivo in target cells and can interact with a predetermined target nucleic acid sequence. The programmable nucleoprotein molecular complex can specifically modify and / or edit a target site within a target nucleic acid sequence and / or modify the function of the target nucleic acid sequence. The nucleoprotein composition comprises a polynucleotide molecule (a) encoding a chimeric polypeptide, (i) a functional domain capable of modifying a target site, and (ii) a ligation domain capable of interacting with a specificity-constituting nucleic acid, and (b) a specificity-constituting nucleic acid (SCNA) comprising a nucleotide sequence complementary to a region of the target nucleic acid adjacent to (i) the target site, and (ii) a recognition region capable of specifically binding to the ligation domain of the polypeptide. This composition enables the precise, reliable, and cost-effective modification of a predetermined nucleic acid sequence target through base pairing between the specificity-constituting nucleic acid and the target nucleic acid, with the high specificity and binding ability of the molecular complex to the target nucleic acid. This composition exhibits low genotoxicity, is modular in its assembly, utilizes a single platform without customization, is practical for independent use outside of specialized core facilities, and offers shorter development timelines and reduced costs.

[0244] The CRISPR-Cas system and all its variations (also referred to herein as "CRISPR") – Many bacteria and archaea contain an endogenous RNA-based adaptive immune system capable of degrading the nucleic acid molecules of invading phages and plasmids. These systems consist of clustered regularly interspaced short palindromic repeat (CRISPR) nucleotide sequences that produce RNA components and CRISPR-related (Cas) genes that encode protein components. CRISPR RNA (crRNA) contains short chains homologous to the DNA of specific viruses and plasmids and acts as a guide to instruct Cas nucleases to degrade the complementary nucleic acids of the corresponding pathogens. Studies of the type II CRISPR / Cas system in Streptococcus pyogenes have shown that three components form an RNA / protein complex sufficient to produce sequence-specific nuclease activity: Cas9 nuclease, a crRNA containing 20 base pairs homologous to the target sequence, and a transactivating crRNA (traccrRNA) (Jinek et al., Science (2012) 337:816-821).

[0245] Furthermore, it was demonstrated that synthetic chimeric guide RNA (gRNA), composed of a fusion of crRNA and tracrRNA, can induce Cas9 to cleave DNA targets complementary to crRNA in vitro. Transient expression of Cas9 combined with synthetic gRNA was also demonstrated to generate targeted double-strand breaks (DSBs) in various different species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al., 2013a, b; Jinek et al., 2013; Mali et al., 2013).

[0246] The CRISPR / Cas system for genome editing contains two distinct components: gRNA and an endonuclease, such as Cas9.

[0247] A gRNA (also referred to herein as a short guide RNA (sgRNA)) is typically a 20-nucleotide sequence encoding a combination of a target homologous sequence (crRNA) and an endogenous bacterial RNA (tracrRNA) that ligates the crRNA to the Cas9 nuclease in a single chimeric transcript. The gRNA / Cas9 complex is recruited to the target sequence by base pairing between the gRNA sequence and complementary genomic DNA. For successful Cas9 binding, the genomic target sequence must also contain the correct protospacer adjacent motif (PAM) sequence immediately following the target sequence. The binding of the gRNA / Cas9 complex localizes Cas9 to the genomic target sequence so that Cas9 can cleave both strands of DNA, resulting in a double-strand break (DSB). Like ZFNs and TALENs, double-strand breaks (DSBs) produced by CRISPR / Cas can undergo homologous recombination and NHEJ, making them susceptible to specific sequence modifications during DNA repair.

[0248] The Cas9 nuclease has two functional domains, RuvC and HNH, each of which cleave different DNA strands. When both of these domains are activated, Cas9 causes double-strand breaks (DSBs) in genomic DNA.

[0249] A key advantage of CRISPR / Cas is that the system's high efficiency is coupled with its ability to easily produce synthetic gRNAs. This allows for the creation of systems that can be easily modified to target alterations at different genomic sites and / or different alterations at the same site. Furthermore, protocols have been established that enable the simultaneous targeting of multiple genes. The majority of cells with mutations present biallelic mutations in target genes.

[0250] However, the apparent flexibility in the base-pairing interaction between the gRNA sequence and the genomic DNA target sequence allows Cas9 to cleave incomplete matches with the target sequence.

[0251] Modified versions of the Cas9 enzyme containing a single inactive catalytic domain (either the RuvC domain or the HNH domain) are called "nickases." With only one active nuclease domain, Cas9 nickase cleaves only one strand of target DNA, creating a single-strand break, or "nick." These single-strand breaks, or nicks, are mostly repaired by single-strand break repair mechanisms involving proteins such as PARP (sensor) and the XRCC1 / LIG III complex (linking), but not exclusively. If single-strand breaks (SSBs) are induced by topoisomerase I toxins or by drugs that capture PARP1 on naturally occurring SSBs, they persist, and when the cell enters S phase and the replication fork encounters such SSBs, they become one-end DSBs that can only be repaired by HR. However, two proximal opposite-strand nicks introduced by Cas9 nickase are often treated as double-strand breaks, sometimes referred to as the "double-nick" CRISPR system. Double nicks, which are essentially non-parallel DSBs, can be repaired by HR or NHEJ, like other DSBs, depending on the desired effect on the gene target, the presence of the donor sequence, and the cell cycle stage (HR is much less abundant and can only occur in the S and G2 phases of the cell cycle). Therefore, if specificity and reduction of off-target effects are extremely important, creating a double nick by designing two gRNAs with target sequences in the immediate vicinity and opposite strands of genomic DNA using Cas9 nickase will result in a nick where neither gRNA alone alters the genomic DNA, thus reducing off-target effects, if not making off-target events impossible.

[0252] Modified Cas9 enzymes containing two inactive catalytic domains (inactive Cas9 or dCas9) lack nuclease activity but can bind to DNA based on gRNA specificity. dCas9 can be used as a platform for DNA transcription regulators to activate or repress gene expression by fusing the inactive enzyme to a known regulatory domain. For example, binding of dCas9 alone to a target sequence in genomic DNA can disrupt gene transcription.

[0253] There are numerous publicly available tools to assist in the selection and / or design of target sequences, as well as several bioinformatically determined unique gRNA lists for different genes in different species, including, but not limited to, the Target Finder from the Feng Zhang lab, the Target Finder (E-CRISP) from the Michael Boutros lab, RGEN Tools: Cas-OFFinder, CasFinder: Flexible algorithm for identifying specific Cas9 targets in the genome, and CRISPR Optimal Target Finder.

[0254] For the use of the CRISPR system, both gRNA and Cas endonuclease (e.g., Cas9) should be expressed or present in the target cell (e.g., as a ribonucleoprotein complex). The insertion vector may contain both cassettes on a single plasmid, or the cassettes may be expressed from two separate plasmids. CRISPR plasmids are commercially available, such as the px330 plasmid from Addgene (75 Sidney St, Suite 550A·Cambridge, MA 02139). The use of clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA technology and Cas endonuclease for modifying mammalian genomes is also disclosed, at least by Bauer et al. [J Vis Exp. (2015) (95):e52118.doi:10.3791 / 52118] (which is specifically incorporated herein by reference in its entirety). Cas endonucleases that can be used for DNA editing with gRNA include, but are not limited to, Cas9, Cpf1 (Zetsche et al., 2015, Cell. 163(3):759-71), C2c1, C2c2, and C2c3 (Shmakov et al., Mol Cell. November 5, 2015; 60(3):385-97).

[0255] According to certain embodiments, CRISPR includes a short guide RNA (sgRNA) containing the nucleic acid sequence shown in SEQ ID NOs. 5-6 or SEQ ID NOs. 165-236.

[0256] The "hit and run" or "in-out" method involves a two-step recombination procedure. In the first step, the desired sequence modification is introduced using an insertion vector containing a dual positive / negative selection marker cassette. The insertion vector contains a single continuous region homologous to the target locus and is modified to carry the desired mutation. This targeted construct is linearized using restriction enzymes at one site within the homologous region, introduced into cells, and positive selection is performed to isolate the homologous recombination-mediated event. The DNA with the homologous sequence can be provided as a plasmid, single-stranded, or double-stranded oligonucleotide. These homologous recombinants contain local duplications separated by an intervening vector sequence containing the selection cassette. In the second step, the target clone is subjected to negative selection to identify cells that have lost the selection cassette via intrachromosomal recombination between the duplication sequences. The local recombination event removes the duplication, and depending on the recombination site, the allele either retains the introduced mutation or reverts to the wild type. The final result is the introduction of the desired modification without retaining the foreign sequence.

[0257] The "double substitution" or "tag and exchange" strategy involves a two-step selection procedure similar to the hit-and-run approach, but requires the use of two different targeting constructs. In the first step, a standard targeting vector with 3' and 5' homology arms is used to insert a dual positive / negative selectable cassette near the site where the mutation is to be introduced. After introducing the system component into cells and applying positive selection, the HR-mediated event can be identified. Next, a second targeting vector containing a region homologous to the desired mutation is introduced into the targeting clone, and negative selection is applied to remove the selection cassette and introduce the mutation. The final allele contains the desired mutation while excluding undesirable foreign sequences.

[0258] According to certain embodiments, the DNA editing agent comprises a DNA targeting module (e.g., gRNA).

[0259] According to certain embodiments, the DNA editing agent does not comprise an endonuclease.

[0260] According to certain embodiments, the DNA editing agent comprises a nuclease (e.g., an endonuclease) and a DNA targeting module (e.g., gRNA).

[0261] According to certain embodiments, the DNA editing agent is CRISPR / Cas, such as gRNA and Cas9.

[0262] According to certain embodiments, the DNA editing agent is TALEN.

[0263] According to certain embodiments, the DNA editing agent is ZFN.

[0264] According to certain embodiments, the DNA editing agent is a meganuclease.

[0265] According to one embodiment, the DNA editing agent is linked to a reporter for monitoring expression in eukaryotic cells.

[0266] According to one embodiment, the reporter is a fluorescent reporter protein.

[0267] The term "fluorescent protein" refers to a polypeptide that emits fluorescence and is typically detectable by flow cytometry, microscopy, or any fluorescence imaging system, and thus can be used as a basis for the selection of cells expressing such a protein.

[0268] Examples of fluorescent proteins that can be used as reporters include, but are not limited to, green fluorescent protein (GFP), blue fluorescent protein (BFP), and red fluorescent protein (e.g., dsRed, mCherry, RFP). A non-exclusive list of fluorescent or other reporters includes proteins detectable by luminescence (e.g., luciferase) or colorimetric assay (e.g., GUS). According to certain embodiments, the fluorescent reporter is a red fluorescent protein (e.g., dsRed, mCherry, RFP) or GFP.

[0269] A review of a new class of fluorescent proteins and their applications can be found in Trends in Biochemical Sciences [Rodriguez, Erik A.; Campbell, Robert E.; Lin, John Y.; Lin, Michael Z.; Miyawaki, Atsushi; Palmer, Amy E.; Shu, Xiaokun; Zhang, Jin; Tsien, Roger Y. "The Growing and Glowing Toolbox of Fluorescent and Photoactive Proteins", Trends in Biochemical Sciences.doi:10.1016 / j.tibs.2016.09.010].

[0270] According to another embodiment, the reporter is an antibiotic selection marker. Examples of antibiotic selection markers that can be used as reporters include, but are not limited to, neomycin phosphotransferase II (nptII) and hygromycin phosphotransferase (hpt). Further marker genes used and added in accordance with this instruction include, but are not limited to, gentamicin acetyltransferase (accC3) resistance genes and bleomycin and phleomycin resistance genes.

[0271] The enzyme NPTII is recognized as being inactivated by phosphorylating many aminoglycoside antibiotics such as kanamycin, neomycin, geneticin (or G418), and paromomycin. Of these, G418 is commonly used for the selection of transformed mammalian cells.

[0272] Regardless of the DNA editing agent used, the method of the present invention is used to modify a gene encoding a non-coding RNA molecule (e.g., an RNA silencing molecule) by at least one of deletion, insertion, or point mutation.

[0273] According to one embodiment, the modification is located in the structuring region of a non-coding RNA molecule or an RNA silencing molecule.

[0274] According to one embodiment, the modification is located in the stem region of a non-coding RNA molecule or an RNA silencing molecule.

[0275] According to one embodiment, the modification is located in the loop region of a non-coding RNA molecule or an RNA silencing molecule.

[0276] According to one embodiment, the modification is located in the stem region and loop region of a non-coding RNA molecule or an RNA silencing molecule.

[0277] According to one embodiment, the modification is located in the unstructured region of a non-coding RNA molecule or an RNA silencing molecule.

[0278] According to one embodiment, the modification is in the stem region and loop region, as well as the unstructured region, of a non-coding RNA molecule or RNA silencing molecule.

[0279] According to certain embodiments, the modification comprises a modification of about 10 to 250 nucleotides, about 10 to 200 nucleotides, about 10 to 150 nucleotides, about 10 to 100 nucleotides, about 10 to 50 nucleotides, about 1 to 50 nucleotides, about 1 to 10 nucleotides, about 50 to 150 nucleotides, about 50 to 100 nucleotides or about 100 to 200 nucleotides (compared to a native non-coding RNA molecule, such as an RNA silencing molecule).

[0280] According to one embodiment, the modification comprises a modification of up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or up to 250 nucleotides (compared to a native non-coding RNA molecule, such as an RNA silencing molecule).

[0281] According to one embodiment, the modification can be in a continuous nucleic acid sequence (e.g., at least 5, 10, 20, 30, 40, 50, 100, 150, 200 bases).

[0282] According to one embodiment, the modification can be in a non-continuous manner, e.g., in a pattern spanning 20, 50, 100, 150, 200, 500, 1000 nucleic acid sequences.

[0283] According to certain embodiments, the modification comprises a modification of up to 200 nucleotides.

[0284] According to certain embodiments, the modification comprises a modification of up to 150 nucleotides.

[0285] According to certain embodiments, the modification comprises a modification of up to 100 nucleotides.

[0286] According to certain embodiments, the modification comprises a modification of up to 50 nucleotides.

[0287] According to certain embodiments, modifications may include modifications of up to 25 nucleotides.

[0288] According to certain embodiments, modifications may include modifications of up to 20 nucleotides.

[0289] According to certain embodiments, modifications may include modifications of up to 15 nucleotides.

[0290] According to certain embodiments, modifications may include modifications of up to 10 nucleotides.

[0291] According to certain embodiments, modifications may include modifications of up to 5 nucleotides.

[0292] According to one embodiment, the modification depends on the structure of the RNA silencing molecule.

[0293] Therefore, if an RNA silencing molecule contains non-essential structures (i.e., secondary structures of the RNA silencing molecule that do not play a role in its proper biosynthesis and / or function) or is purely dsRNA (i.e., an RNA silencing molecule having complete or nearly complete dsRNA), several modifications (e.g., 20-30 nucleotides, e.g., 1-10 nucleotides, e.g., 5 nucleotides) are introduced to redirect the silencing specificity of the RNA silencing molecule.

[0294] According to another embodiment, if the RNA silencing molecule has an essential structure (i.e., the proper biosynthesis and / or activity of the RNA silencing molecule depends on its secondary structure), a larger modification (e.g., 10-200 nucleotides, e.g., 50-150 nucleotides, e.g., more than 30 nucleotides and less than or equal to 200 nucleotides, 30-200 nucleotides, 35-200 nucleotides, 35-150 nucleotides, 35-100 nucleotides) is introduced to redirect the silencing specificity of the RNA silencing molecule.

[0295] According to one embodiment, the modification involves altering the recognition / cleavage site / PAM motif of the RNA silencing molecule to disable the original PAM recognition site.

[0296] According to a particular embodiment, the modification is in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acids in the PAM motif.

[0297] According to one embodiment, the modification includes insertion.

[0298] According to a particular embodiment, the insertion includes insertions of approximately 10–250 nucleotides, approximately 10–200 nucleotides, approximately 10–150 nucleotides, approximately 10–100 nucleotides, approximately 10–50 nucleotides, approximately 1–50 nucleotides, approximately 50–150 nucleotides, approximately 50–100 nucleotides, or approximately 100–200 nucleotides (compared to a natural non-coding RNA molecule, e.g., an RNA silencing molecule).

[0299] According to a particular embodiment, the insertion includes insertions of about 10–250 nucleotides, about 10–200 nucleotides, about 10–150 nucleotides, about 10–100 nucleotides, about 10–50 nucleotides, about 1–50 nucleotides, about 1–10 nucleotides, about 50–150 nucleotides, about 50–100 nucleotides, or about 100–200 nucleotides (compared to a natural non-coding RNA molecule, e.g., an RNA silencing molecule).

[0300] According to one embodiment, the insertion includes insertions of up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or up to 250 nucleotides (compared to a natural non-coding RNA molecule, e.g., an RNA silencing molecule).

[0301] According to certain embodiments, the insertion may include an insertion of up to 200 nucleotides.

[0302] According to certain embodiments, the insertion may include an insertion of up to 150 nucleotides.

[0303] According to certain embodiments, the insertion may include an insertion of up to 100 nucleotides.

[0304] According to certain embodiments, the insertion may include an insertion of up to 50 nucleotides.

[0305] According to certain embodiments, the insertion may include an insertion of up to 25 nucleotides.

[0306] According to certain embodiments, the insertion may include an insertion of up to 20 nucleotides.

[0307] According to certain embodiments, the insertion may involve an insertion of up to 15 nucleotides.

[0308] According to certain embodiments, the insertion may involve an insertion of up to 10 nucleotides.

[0309] According to certain embodiments, the insertion may include an insertion of up to 5 nucleotides.

[0310] According to one embodiment, the modification includes deletions.

[0311] According to certain embodiments, the deletions include deletions of approximately 10–250 nucleotides, approximately 10–200 nucleotides, approximately 10–150 nucleotides, approximately 10–100 nucleotides, approximately 10–50 nucleotides, approximately 1–50 nucleotides, approximately 1–10 nucleotides, approximately 50–150 nucleotides, approximately 50–100 nucleotides, or approximately 100–200 nucleotides (compared to a natural non-coding RNA molecule, e.g., an RNA silencing molecule).

[0312] According to one embodiment, the deletion includes a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or up to 250 nucleotides (compared to a natural non-coding RNA molecule, e.g., an RNA silencing molecule).

[0313] According to certain embodiments, the deletion may include a deletion of up to 200 nucleotides.

[0314] According to certain embodiments, the deletion may include a deletion of up to 150 nucleotides.

[0315] According to certain embodiments, the deletion may include a deletion of up to 100 nucleotides.

[0316] According to certain embodiments, the deletion may include a deletion of up to 50 nucleotides.

[0317] According to certain embodiments, the deletion may include a deletion of up to 25 nucleotides.

[0318] According to certain embodiments, the deletion may include a deletion of up to 20 nucleotides.

[0319] According to certain embodiments, the deletion may include a deletion of up to 15 nucleotides.

[0320] According to certain embodiments, the deletion may include a deletion of up to 10 nucleotides.

[0321] According to certain embodiments, the deletion may include a deletion of up to 5 nucleotides.

[0322] According to one embodiment, the modification includes point mutation.

[0323] According to certain embodiments, point mutations include point mutations of approximately 10–250 nucleotides, approximately 10–200 nucleotides, approximately 10–150 nucleotides, approximately 10–100 nucleotides, approximately 10–50 nucleotides, approximately 1–50 nucleotides, approximately 1–10 nucleotides, approximately 50–150 nucleotides, approximately 50–100 nucleotides, or approximately 100–200 nucleotides (compared to a natural non-coding RNA molecule, e.g., an RNA silencing molecule).

[0324] According to one embodiment, a point mutation includes a point mutation of up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or up to 250 nucleotides (compared to a natural non-coding RNA molecule, e.g., an RNA silencing molecule).

[0325] According to certain embodiments, a point mutation may include a point mutation of up to 200 nucleotides.

[0326] According to certain embodiments, a point mutation may include a point mutation of up to 150 nucleotides.

[0327] According to certain embodiments, a point mutation may include a point mutation of up to 100 nucleotides.

[0328] According to certain embodiments, a point mutation may include up to 50 nucleotides.

[0329] According to certain embodiments, a point mutation may include a point mutation of up to 25 nucleotides.

[0330] According to certain embodiments, a point mutation may include a point mutation of up to 20 nucleotides.

[0331] According to certain embodiments, a point mutation may include a point mutation of up to 15 nucleotides.

[0332] According to certain embodiments, a point mutation may include a point mutation of up to 10 nucleotides.

[0333] According to certain embodiments, a point mutation may include a point mutation of up to 5 nucleotides.

[0334] According to one embodiment, the modification includes any combination of deletion, insertion, and / or point mutation.

[0335] According to one embodiment, the modification includes nucleotide substitution (e.g., nucleotide swapping).

[0336] According to a particular embodiment, the swapping involves the exchange of approximately 10–250 nucleotides, approximately 10–200 nucleotides, approximately 10–150 nucleotides, approximately 10–100 nucleotides, approximately 10–50 nucleotides, approximately 1–50 nucleotides, approximately 1–10 nucleotides, approximately 50–150 nucleotides, approximately 50–100 nucleotides, or approximately 100–200 nucleotides (compared to a natural non-coding RNA molecule, e.g., an RNA silencing molecule).

[0337] According to one embodiment, the nucleotide exchange includes nucleotide substitutions of up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or up to 250 nucleotides (compared to a natural non-coding RNA molecule, e.g., an RNA silencing molecule).

[0338] According to certain embodiments, nucleotide exchanges include nucleotide substitutions of up to 200 nucleotides.

[0339] According to certain embodiments, nucleotide exchanges include nucleotide substitutions of up to 150 nucleotides.

[0340] According to certain embodiments, nucleotide exchanges include nucleotide substitutions of up to 100 nucleotides.

[0341] According to certain embodiments, nucleotide exchanges include nucleotide substitutions of up to 50 nucleotides.

[0342] According to certain embodiments, nucleotide exchange involves nucleotide substitutions of up to 25 nucleotides.

[0343] According to certain embodiments, nucleotide exchanges include nucleotide substitutions of up to 20 nucleotides.

[0344] According to certain embodiments, nucleotide exchange involves nucleotide substitutions of up to 15 nucleotides.

[0345] According to certain embodiments, nucleotide exchange involves nucleotide substitutions of up to 10 nucleotides.

[0346] According to certain embodiments, nucleotide exchange involves nucleotide substitution of up to 5 nucleotides.

[0347] According to one embodiment, a gene encoding a non-coding RNA molecule (e.g., an RNA silencing molecule) is modified by replacing the sequence of an endogenous RNA silencing molecule (e.g., miRNA) with a selected RNA silencing sequence (e.g., siRNA).

[0348] According to a particular embodiment, the sequence of the siRNA used for gene exchange of an endogenous RNA silencing molecule (e.g., miRNA) includes a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 4, SEQ ID NOs: 93 to 164, or SEQ ID NOs: 243 to 252.

[0349] According to one embodiment, the guide strand of a non-coding RNA molecule (e.g., an RNA silencing molecule) is modified to preserve structural originality and maintain the same base-pairing profile.

[0350] According to one embodiment, the passenger strand of a non-coding RNA molecule (e.g., an RNA silencing molecule) is modified to preserve structural originality and maintain the same base pairing profile.

[0351] As used herein, the term “structural originality” refers to the secondary RNA structure (i.e., the base-pairing profile). Maintaining structural originality is important for the accurate and efficient biosynthesis / processing of non-coding RNAs (e.g., RNA silencing molecules such as siRNA or miRNA), which are structure-dependent and not purely sequence-dependent.

[0352] In one embodiment, a non-coding RNA (e.g., an RNA silencing molecule) is modified in the guide strand (silencing strand) to contain approximately 50-100% complementarity with the target RNA (as described above), while the passenger strand is modified to preserve the original (unmodified) non-coding RNA structure.

[0353] According to one embodiment, a non-coding RNA (e.g., an RNA silencing molecule) is modified such that its seed sequence (e.g., miRNA nucleotides 2-8 from the 5' end) is complementary to the target sequence.

[0354] According to certain embodiments, RNA silencing molecules (i.e., RNAi molecules) are designed such that the RNAi molecule's sequence is modified to preserve structural originality and to be recognized by cellular RNAi processing and execution factors.

[0355] The DNA editing agent of the present invention can be introduced into eukaryotic cells using a DNA delivery method (e.g., by an expression vector) or a DNA-free method.

[0356] According to one embodiment, gRNA (or any other DNA recognition module used, depending on the DNA editing system used) may be provided to the cell as RNA.

[0357] Therefore, it is understood that this technology relates to introducing DNA editing agents using DNA-free methods such as RNA transfection (e.g., mRNA+gRNA transfection) or ribonucleoprotein (RNP) transfection (e.g., protein-RNA complex transfection, e.g., Cas9 / gRNA RNP complex transfection, or any combination of DNA / RNA / protein).

[0358] For example, Cas9 can be introduced as a DNA expression plasmid, as an in vitro transcript (i.e., RNA), or as a recombinant protein bound to the RNA portion of a ribonucleoprotein particle (RNP). gRNA can be delivered, for example, as a DNA plasmid or as an in vitro transcript (i.e., RNA).

[0359] Any method known in the art for RNA or RNP transfection may be used in accordance with this instruction. Examples include, but are not limited to, microinjection [described in Cho et al., "Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins," Genetics (2013) 195:1177-1180 (incorporated herein by reference)], electroporation [described in Kim et al., "Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins," Genome Res. (2014) 24:1012-1019 (incorporated herein by reference)], or lipid-mediated transfection using liposomes, for example [described in Zuris et al., "Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo," Nat Biotechnol. (2014) doi:10.1038 / nbt.3081 (incorporated herein by reference)]. Further methods of RNA transfection are described in U.S. Patent Application Publication No. 20160289675, which is incorporated herein by reference in its entirety.

[0360] One advantage of the RNA transfection method of the present invention is that RNA transfection is inherently transient and vector-free. The RNA transgene can be delivered to cells and expressed there as a minimal expression cassette that does not require any further sequences (e.g., viral sequences).

[0361] According to one embodiment, for the expression of the exogenous DNA editing agent of the present invention in mammalian cells, a polynucleotide sequence encoding the DNA editing agent is ligated to a nucleic acid construct suitable for expression in mammalian cells. Such a nucleic acid construct includes a promoter sequence for constitutively or inductively guiding the transcription of the polynucleotide sequence in the cell.

[0362] Nucleic acid constructs of some embodiments of the present invention (also referred to herein as “expression vectors”) include further sequences that make the vector suitable for replication and integration in eukaryotes (e.g., shuttle vectors). In addition, a typical cloning vector may also include transcription and translation initiation sequences, transcription and translation terminators, and polyadenylation signals. For example, such constructs would typically include a 5'LTR, a tRNA binding site, a packaging signal, a starting point for second-strand DNA synthesis, and a 3'LTR or a portion thereof.

[0363] Eukaryotic promoters typically contain two recognition sequences: the TATA box and an upstream promoter sequence. The TATA box is located 25–30 base pairs upstream of the transcription start site and is thought to be involved in guiding RNA polymerase to initiate RNA synthesis. The other upstream promoter sequence determines the rate at which transcription begins.

[0364] Preferably, the promoters utilized by the nucleic acid constructs of some embodiments of the present invention are active in the specific cell population being transformed. Examples of cell type-specific and / or tissue-specific promoters include liver-specific albumin [Pinkert et al., (1987) Genes Dev. 1:268-277], lymphoid-specific promoters [Calame et al., (1988) Adv. Immunol. 43:235-275]; in particular, T cell receptor promoters [Winoto et al., (1989) EMBO J. 8:729-733] and immunoglobulin [Banerji et al. (1983) Cell 33729-740], neuronal filament promoters [Byrne et al. (1989) Proc.Natl.Acad.Sci.USA 86:5473-5477], and other neuronal cell-specific promoters, as well as pancreas-specific promoters [Edlunch et al. (1985) Science]. Examples of promoters include mammary gland-specific promoters such as whey promoters (U.S. Patent No. 4,873,316 and European Patent Application Publication No. 264,166).

[0365] Enhancer sequences can stimulate transcription up to 1,000-fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream of the transcription start site. Many virus-derived enhancer sequences have a broad host range and are active in various tissues. For example, the SV40 initial gene enhancer is suitable for many cell types. Other enhancer / promoter combinations suitable for some embodiments of the present invention include terminal repeat sequences derived from polyomaviruses, human or mouse cytomegalovirus (CMV), mouse leukemia virus, mouse or Rous sarcoma virus, and various retroviruses such as HIV. See Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, NY 1983. This document is incorporated herein by reference.

[0366] In constructing an expression vector, the promoter is preferably located at a distance from heterologous transcription start sites that is approximately the same distance from the transcription start site as the promoter is located at in its natural state. However, as is known in the art, some variation in this distance may be acceptable without loss of promoter function.

[0367] To enhance the efficiency of mRNA translation, polyadenylation sequences may also be added to the expression vector. Two distinct sequence elements are required for accurate and efficient polyadenylation: a GU or U-rich sequence located downstream of the polyadenylation site, and a highly conserved 6-nucleotide sequence, AAUAAA, located 11–30 nucleotides upstream. Suitable termination and polyadenylation signals for some embodiments of the present invention include those derived from SV40.

[0368] In addition to the sequences and elements already described, expression vectors in some embodiments of the present invention may also contain other specialized elements typically intended to enhance the level of expression of cloned nucleic acids or to facilitate the identification of cells containing recombinant DNA. For example, some animal viruses contain DNA sequences that promote extrachromosomal replication of the viral genome in tolerant cell types. Plasmids containing these viral replicons are replicated by episomes, provided that appropriate factors are provided by genes carried in the plasmid or present in the host cell genome.

[0369] The vector may or may not contain a eukaryotic replicon. If a eukaryotic replicon is present, the vector can be amplified in eukaryotic cells using an appropriate selection marker. If the vector does not contain a eukaryotic replicon, episomal amplification is not possible. Instead, recombinant DNA is integrated into the genome of the engineered cell, where a promoter guides the expression of the desired nucleic acid.

[0370] Expression vectors in some embodiments of the present invention may further include additional polynucleotide sequences that enable the translation of several proteins from a single mRNA, such as an internal ribosome entry site (IRES), and sequences for genomic integration of promoter-chimeric polypeptides.

[0371] It is understood that the individual sequences and elements contained in an expression vector may be arranged in various configurations. For example, enhancer sequences, promoters, and even polynucleotide sequences (or more) encoding DNA editing agents may be arranged in a "head-tail" structure, as inverted complements, or as antiparallel strands in a complementary configuration. Such diversity of configuration is more likely to occur with respect to the non-coding elements of an expression vector, but alternative configurations of coding sequences within an expression vector are also conceivable.

[0372] Examples of mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+ / -), pGL3, pZeoSV2(+ / -), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81 from Invitrogen, pCI from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV from Stratagene, pTRES from Clontech, and their derivatives.

[0373] Expression vectors containing regulatory elements derived from eukaryotic viruses such as retroviruses can also be used. Examples of SV40 vectors include pSVT7 and pMT2. Examples of bovine papillomavirus-derived vectors include pBV-1MTHA, and examples of Epstein-Barr virus-derived vectors include pHEBO and p2O5. Other exemplary vectors include pMSG and pAV009 / A. + pMTO10 / A + Examples include pMAMneo-5, baculovirus pDSVE, and any other vectors that enable protein expression under the induction of the SV-40 early promoter, SV-40 late promoter, metallothionein promoter, mouse mammary cancer virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or any other promoter that has been shown to be effective for expression in eukaryotic cells.

[0374] Viruses are highly specialized infectious pathogens that have often evolved to evade the host's defense mechanisms. Typically, viruses infect and replicate in specific cell types. The target specificity of a viral vector utilizes its innate specificity to specifically target a given cell type, thereby introducing recombinant genes into infected cells. Therefore, the type of vector used in some embodiments of the present invention will depend on the cell type being transformed. The ability to select a suitable vector according to the cell type being transformed is well within the capabilities of those skilled in the art, and therefore a general description of selection considerations is not presented herein. For example, bone marrow cells can be targeted using human T-cell leukemia virus type I (HTLV-I), and kidney cells may be targeted using heterologous promoters present in the baculovirus, Autographa californica nucleopolyhedrovirus (AcMNPV), as described by Liang CY et al., 2004 (Arch Virol. 149:51-60).

[0375] Recombinant viral vectors are useful for the in vivo expression of DNA editing agents because they offer advantages such as horizontal transmission and target specificity. Horizontal transmission is a process unique to the life cycle of retroviruses, for example, in which a single infected cell produces many progeny viral particles (virions) that budding and infect neighboring cells. As a result, large areas become rapidly infected, most of which were not initially infected by the original viral particle. This is in contrast to vertical transmission, where infectious pathogens spread only through their daughter offspring. Viral vectors that cannot spread horizontally can also be produced. This characteristic can be useful when the desired objective is to introduce a specific gene into a limited number of target cells.

[0376] According to one embodiment, if the cleavage module (nuclease) is not an integral part of the DNA recognition unit in order to express a functional DNA editing agent, the expression vector may encode both the cleavage module and the DNA recognition unit (e.g., gRNA in the case of CRISPR / Cas).

[0377] Alternatively, the cleavage module (nuclease) and the DNA recognition unit (e.g., gRNA) can be cloned into separate expression vectors. In such cases, at least two different expression vectors must be used to transform the same eukaryotic cells.

[0378] Alternatively, if a nuclease is not utilized (i.e., not administered to cells from an exogenous source), the DNA recognition unit (e.g., gRNA) can be cloned and expressed using a single expression vector.

[0379] According to one embodiment, the DNA editing agent comprises a nucleic acid agent encoding at least one DNA recognition unit (e.g., gRNA) operably linked to an active cis-acting regulatory element (e.g., promoter) in a eukaryotic cell.

[0380] According to one embodiment, a nuclease (e.g., an endonuclease) and a DNA recognition unit (e.g., gRNA) are encoded from the same expression vector. Such a vector may contain a single cis-acting regulatory element (e.g., a promoter) active in plant cells for the expression of both the nuclease and the DNA recognition unit. Alternatively, the nuclease and the DNA recognition unit may each be operably linked to a cis-acting regulatory element (e.g., a promoter) active in eukaryotic cells.

[0381] According to one embodiment, a nuclease (e.g., an endonuclease) and a DNA recognition unit (e.g., gRNA) are encoded from different expression vectors, thereby each being operably linked to a cis-acting regulatory element (e.g., a promoter) that is active in eukaryotic cells.

[0382] According to one embodiment, some embodiments of the present invention further include introducing a donor oligonucleotide into eukaryotic cells.

[0383] According to one embodiment, if the modification is an insertion, the method further includes introducing a donor oligonucleotide into eukaryotic cells.

[0384] According to one embodiment, if the modification is a deletion, the method further includes introducing a donor oligonucleotide into eukaryotic cells.

[0385] According to one embodiment, if the modification is a deletion and insertion (e.g., replacement), the method further includes introducing a donor oligonucleotide into a eukaryotic cell.

[0386] According to one embodiment, if the modification is a point mutation, the method further includes introducing a donor oligonucleotide into a eukaryotic cell.

[0387] As used herein, the term “donor oligonucleotide” or “donor oligo” means an exogenous nucleotide (i.e., one introduced from outside into a eukaryotic cell to produce a specific change in the genome). According to one embodiment, the donor oligonucleotide is synthesized.

[0388] According to one embodiment, the donor oligo is an RNA oligo.

[0389] According to one embodiment, the donor oligo is a DNA oligo.

[0390] According to one embodiment, the donor oligo is a synthetic oligo.

[0391] According to one embodiment, the donor oligonucleotide includes a single-stranded donor oligonucleotide (ssODN).

[0392] According to one embodiment, the donor oligonucleotide includes a double-stranded donor oligonucleotide (dsODN).

[0393] According to one embodiment, the donor oligonucleotide includes double-stranded DNA (dsDNA).

[0394] According to one embodiment, the donor oligonucleotide includes a double-stranded DNA-RNA double helix (DNA-RNA double helix).

[0395] According to one embodiment, the donor oligonucleotide comprises a double-stranded DNA-RNA hybrid.

[0396] According to one embodiment, the donor oligonucleotide includes a single-stranded DNA-RNA hybrid.

[0397] According to one embodiment, the donor oligonucleotide contains single-stranded DNA (ssDNA).

[0398] According to one embodiment, the donor oligonucleotide includes double-stranded RNA (dsRNA).

[0399] According to one embodiment, the donor oligonucleotide contains single-stranded RNA (ssRNA).

[0400] According to one embodiment, the donor oligonucleotide comprises a DNA or RNA sequence for exchange (as described above).

[0401] According to one embodiment, the donor oligonucleotide is provided in a non-expression vector format or as an oligo.

[0402] According to one embodiment, the donor oligonucleotide includes a DNA donor plasmid.

[0403] According to one embodiment, the donor oligonucleotides are approximately 50-5000, approximately 100-5000, approximately 250-5000, approximately 500-5000, approximately 750-5000, approximately 1000-5000, approximately 1500-5000, approximately 2000-5000, approximately 2500-5000, approximately 3000-5000, approximately 4000-5000, and approximately 50-4000, approximately 100-4000, approximately 250-4000, approximately 500-4000, approximately 750-4000, approximately 1000-4000, approximately 1500-4000, approximately 2000-4000, approximately 2500-4000, approximately 3000-4000, approximately 50-3000, approximately 100-3000, approximately 250-3000, approximately 500-300 0, approximately 750-3000, approximately 1000-3000, approximately 1500-3000, approximately 2000-3000, approximately 50-2000, approximately 100-2000, approximately 250-2000, approximately 500-2000, approximately 750-2000, approximately 1000-2000, approximately 1500-2000, approximately 50-1000, approximately 100-1000, approximately 250- Contains 1000, approximately 500-1000, approximately 750-1000, approximately 50-750, approximately 150-750, approximately 250-750, approximately 500-750, approximately 50-500, approximately 150-500, approximately 200-500, approximately 250-500, approximately 350-500, approximately 50-250, approximately 150-250, or approximately 200-250 nucleic acids.

[0404] According to a particular embodiment, the donor oligonucleotide containing ssODN (e.g., ssDNA or ssRNA) contains approximately 200 to 500 nucleotides.

[0405] According to a particular embodiment, the donor oligonucleotide containing dsODN (e.g., dsDNA or dsRNA) contains approximately 250 to 5000 nucleotides.

[0406] According to one embodiment, for gene exchange of an endogenous RNA silencing molecule (e.g., miRNA) with a selected RNA silencing sequence (e.g., siRNA), the expression vector, ssODN (e.g., ssDNA or ssRNA), or dsODN (e.g., dsDNA or dsRNA) does not need to be expressed in eukaryotic cells, but merely acts as a non-expression template. According to a particular embodiment, in such a case, only the DNA editing agent (e.g., Cas9 / sgRNA module) needs to be expressed if it is provided in DNA form.

[0407] According to some embodiments, DNA editing agents (e.g., gRNAs) may be introduced into eukaryotic cells with or without the use of donor oligonucleotides (as discussed herein) in order to gene edit endogenous non-coding RNA molecules (e.g., RNA silencing molecules) without the use of nucleases.

[0408] According to one embodiment, the introduction of donor oligonucleotides into eukaryotic cells is carried out using one of the above methods (for example, using an expression vector or RNP transfection).

[0409] According to one embodiment, gRNA and DNA donor oligonucleotides are co-introduced into eukaryotic cells. It is understood that any additional factors (e.g., nucleases) may be introduced together with them.

[0410] According to one embodiment, the gRNA is introduced into the eukaryotic cell before the DNA donor oligonucleotide (e.g., within minutes or hours). It is understood that any further factors (e.g., nucleases) may be introduced before, simultaneously with, or after the gRNA or DNA donor oligonucleotide.

[0411] According to one embodiment, the gRNA is introduced into the eukaryotic cell following the DNA donor oligonucleotide (e.g., within minutes or hours). It is understood that any further factors (e.g., nucleases) may be introduced before, simultaneously with, or after the gRNA or DNA donor oligonucleotide.

[0412] According to one embodiment, a composition is provided comprising at least one gRNA and a DNA donor oligonucleotide for genome editing.

[0413] According to one embodiment, a composition is provided comprising at least one gRNA for genome editing, a nuclease (e.g., an endonuclease), and a DNA donor oligonucleotide.

[0414] Various methods can be used to introduce expression vectors or donor oligos of some embodiments of the present invention into eukaryotic cells (e.g., stem cells). Such methods include those described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989); Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Michigan (1995); Vega et al., Gene Targeting, CRC Press, Ann Arbor, Michigan (1995); Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston, Massachusetts (1988); and Gilboa et al., [Biotechniques]. This is generally described in [4(6):504-512, 1986], and includes, for example, stable or transient transfection, lipofection, electroporation, and infection using recombinant viral vectors. In addition, for positive-negative selection methods, see U.S. Patent Nos. 5,464,764 and 5,487,992.

[0415] The introduction of nucleic acids through viral infection offers several advantages over other methods such as lipofection and electroporation, because higher transfection efficiency can be achieved due to the infectivity of the virus.

[0416] Currently preferred in vivo nucleic acid transfection techniques include transfection using viral or non-viral constructs such as adenoviruses, lentiviruses, herpes simplex virus I, or adeno-associated viruses (AAVs) and lipid-based systems. Useful lipids for lipid-mediated gene transfection include, for example, DOTMA, DOPE, and DC-Chol [Tonkinson et al., Cancer Investigation, 14(1):54-65 (1996)]. For gene therapy, preferred constructs are viruses, most preferably adenoviruses, AAVs, lentiviruses, or retroviruses. Viral constructs, such as retroviral constructs, include at least one transcription promoter / enhancer or locus-defining element (may include more), or other elements that control gene expression by other means such as alternative splicing, RNA nuclear export, or post-translational modification of messengers. Such vector constructs also include, unless the viral construct already contains a packaging signal, a terminal repeat sequence (LTR) or a portion thereof, and appropriate positive and negative primer binding sites for the virus used. In addition, such constructs typically include a signal sequence for peptide secretion from a host cell, the host cell containing this signal sequence. Preferably, the signal sequence for this purpose is a mammalian signal sequence or a signal sequence of a polypeptide variant of some embodiments of the present invention. Optionally, the construct may also include a signal leading to polyadenylation, as well as one or more restriction enzyme sites and a translation termination sequence. For example, such constructs typically include a 5'LTR, a tRNA binding site, a packaging signal, a starting point for second-strand DNA synthesis, and a 3'LTR or a portion thereof. Other nonviral vectors, such as cationic lipids, polylysine, and dendrimers, can be used.

[0417] In addition to containing the elements necessary for the transcription and translation of the inserted coding sequence, some embodiments of the present invention may also include sequences manipulated to enhance the stability, production, purification, yield, or toxicity of the expressed peptide.

[0418] According to certain embodiments, a shock method is used to introduce an exogenous gene into eukaryotic cells. According to one embodiment, this method is transient. Exemplary shock methods that can be used according to some embodiments of the present invention are discussed in the Examples section below. Shocks in eukaryotic cells (e.g., mammalian cells) are also taught in Uchida M et al., Biochim Biophys Acta. (2009) 1790(8):754-64, which is incorporated herein by reference.

[0419] Regardless of the transformation / infection method used, this instruction further selects transformed cells containing genome editing events.

[0420] According to certain embodiments, selection is carried out so that only cells containing successful and precise modifications (e.g., exchanges, insertions, deletions, point mutations) at specific loci are selected. Therefore, cells containing any unintended modifications (e.g., insertions, deletions, point mutations) at specific loci are not selected.

[0421] According to one embodiment, the selection of modified cells can be performed at the phenotypic level by detection of molecular events, by detection of a fluorescent reporter, or by growth in the presence of other selection markers (e.g., antibiotic or drug resistance, i.e., Nutlin3 in the case of TP53 silencing).

[0422] According to one embodiment, the selection of modified cells is performed by analyzing the biosynthesis and development of newly edited non-coding RNA molecules (e.g., the presence of novel miRNA versions, novel edited siRNAs, piRNAs, tasiRNAs, etc.).

[0423] According to one embodiment, the selection of modified cells is performed by analyzing the silencing activity and / or specificity of a non-coding RNA molecule (e.g., an RNA silencing molecule) to a second target RNA or a target RNA of interest, by confirming the phenotype of the eukaryote, e.g., cell size, growth rate / inhibition, cell shape, cell membrane integrity, tumor size, tumor shape, pigmentation of the organism, infection parameters in the organism (e.g., viral or bacterial load), or inflammation parameters in the organism (e.g., fever or redness).

[0424] According to one embodiment, the silencing specificity of a non-coding RNA molecule is determined genotypeically, for example, by the expression or lack of expression of a gene.

[0425] According to one embodiment, the silencing specificity of non-coding RNA molecules is determined phenotypically.

[0426] According to one embodiment, the phenotype of a eukaryotic cell or eukaryote is determined before the genotype.

[0427] According to one embodiment, the genotype of a eukaryotic cell or eukaryote is determined before the phenotype.

[0428] According to one embodiment, the selection of modified cells is performed by analyzing the silencing activity and / or specificity of a non-coding RNA molecule (e.g., an RNA silencing molecule) to the second target RNA or the target RNA of interest by measuring the RNA level of the second target RNA or the target RNA of interest. This can be carried out using any method known in the art, for example, by Northern blotting, nuclease protection assays, in situ hybridization, quantitative RT-PCR, or immunoblotting.

[0429] According to one embodiment, the selection of modified cells is performed by analyzing eukaryotic cells or clones containing DNA editing events, also referred to herein as “mutation” or “editing,” depending on the type of editing desired, such as insertion, deletion, insertion-deletion (indel), inversion, substitution, and combinations thereof.

[0430] Methods for detecting sequence alterations are well known in the art and include, but are not limited to, DNA and RNA sequencing (e.g., next-generation sequencing), electrophoresis, enzyme-based mismatch detection assays, and hybridization assays (e.g., PCR, RT-PCR, RNase protection, in situ hybridization, primer extension, Southern blot, Northern blot, and dot blot analysis). Various methods used for detecting single nucleotide polymorphisms (SNPs) (e.g., PCR-based T7 endonuclease, heteroduplex, and Sanger sequencing, or PCR followed by restriction digestion, for detecting the appearance or disappearance of unique restriction sites) may also be used.

[0431] Another method for confirming the presence of DNA editing events (e.g., indels) includes mismatch cleavage assays that utilize structurally selective enzymes (e.g., endonucleases) that recognize and cleave mismatched DNA.

[0432] According to one embodiment, the selection of transformed cells is performed by flow cytometry (FACS) to select transformed cells that exhibit fluorescence emitted by a fluorescent reporter. Following FACS sorting, a positively selected pool of transformed eukaryotic cells that display the fluorescent marker is collected, and aliquots may be used to test for DNA editing events as described above.

[0433] When using an antibiotic selection marker, after transformation, eukaryotic cell clones are cultured, for example, in a cell culture medium in the presence of the selected marker (e.g., an antibiotic). Then, a portion of the cells in the cell culture medium are analyzed (verified) for DNA editing events as described above.

[0434] According to one embodiment of the present invention, the method further includes verifying the complementarity of an endogenous non-coding RNA molecule (e.g., an RNA silencing molecule) to a second target RNA in transformed cells.

[0435] As described above, after modification of the gene encoding a non-coding RNA molecule (e.g., an RNA silencing molecule), the non-coding RNA molecule (e.g., an RNA silencing molecule) contains at least approximately 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% complementarity with the sequence of the second target RNA or the target RNA of interest.

[0436] The specific binding of the designed non-coding RNA molecule to the target RNA of interest can be determined by any method known in the art, such as computational algorithms (e.g., BLAST), and can be verified by methods including, for example, Northern blotting, in situ hybridization, and QuantiGene Plex assays.

[0437] It will be understood that positive eukaryotic cells can be homozygous or heterozygous with respect to DNA editing events. In the case of heterozygous cells, the cells may contain copies of the modified gene and copies of the unmodified gene, such as non-coding RNA molecules (e.g., RNA silencing molecules). Those skilled in the art will select cells for further culture / regeneration according to their intended use.

[0438] According to one embodiment, if a transient method is desired, eukaryotic cells exhibiting the presence of a desired DNA editing event are further analyzed and selected for the presence of the DNA editing agent, i.e., the loss of the DNA sequence encoding the DNA editing agent. This can be done, for example, by analyzing the loss of expression of the DNA editing agent (e.g., in mRNA, protein) by, for example, GFP fluorescence detection or q-PCR, HPLC.

[0439] According to one embodiment, if a transient method is desired, eukaryotic cells may be analyzed for the presence of nucleic acid constructs or portions thereof described herein (e.g., nucleic acid sequences encoding DNA editing agents). This can be confirmed by fluorescence microscopy, q-PCR, FACS, and / or any other method such as Southern blotting, PCR, sequencing, HPLC.

[0440] Positive eukaryotic cell clones may be preserved (e.g., cryopreserved).

[0441] Alternatively, eukaryotic cells may be cultured for a longer period to maintain, for example, an undifferentiated state, or induced to differentiate into other cell types, tissues, organs, or organisms as needed.

[0442] DNA editing agents and optionally donor oligos of some embodiments of the present invention can be administered to a single cell, a group of cells (e.g., primary cultured cells or cell lines as discussed above), or to an organism (e.g., mammals, birds, fish, and insects as discussed above).

[0443] Accordingly, DNA editing agents and optionally donor oligos (or expression vectors or RNP complexes containing them) of some embodiments of the present invention can be administered to an organism on their own or as pharmaceutical compositions in which they are mixed with suitable carriers or excipients.

[0444] As used herein, “pharmaceutical composition” refers to a preparation of one or more active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate the administration of a compound to a living organism.

[0445] In this specification, the term "active ingredient" refers to DNA editing agents and optionally donor oligos involved in biological effects.

[0446] Hereafter, the terms "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" may be used interchangeably and refer to carriers or diluents that do not cause significant irritation to organisms and do not negate the biological activity and properties of the administered compound. Adjuvants fall within the category of these terms.

[0447] In this specification, the term “excipient” refers to an inert substance added to a pharmaceutical composition to further facilitate the administration of the active ingredient. Examples of excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars and starches, cellulose derivatives, gelatin, vegetable oils and polyethylene glycol.

[0448] Techniques for compounding and administering drugs can be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pennsylvania, latest edition, and are incorporated herein by reference.

[0449] Suitable routes of administration may include, for example, oral delivery, rectal delivery, transmucosal delivery, especially transnasal delivery, intestinal delivery, or parenteral delivery, such as intramuscular injection, subcutaneous injection, and intrathecal injection, as well as intrathecal injection, direct intraventricular injection, intracardiac injection, such as injection into the right or left ventricular cavity, injection into the general coronary artery, intravenous injection, intraperitoneal injection, intranasal injection, or intraocular injection.

[0450] Conventional approaches to drug delivery to the central nervous system (CNS) include neurosurgical strategies (e.g., intracerebral injection or intraventricular infusion); molecular manipulation of drugs that attempts to utilize one of the endogenous transport pathways of the blood-brain barrier (e.g., the creation of chimeric fusion proteins containing transport peptides with affinity for endothelial cell surface molecules by combining drugs that cannot cross the blood-brain barrier on their own); pharmacological strategies designed to improve the lipid solubility of drugs (e.g., binding water-soluble drugs to lipid or cholesterol carriers); and transient disruption of BBB integrity by hyperosmotic disruption (resulting from injection of mannitol solution into the carotid artery or the use of bioactive agents such as angiotensin peptides). However, each of these strategies has its limitations. For example, there are inherent risks associated with invasive surgical procedures, size limitations imposed by constraints inherent in the endogenous transport system, potentially undesirable biological side effects associated with systemic administration of chimeric molecules composed of carrier motifs that can be active outside the CNS, and the potential risk of brain damage in brain regions where the blood-brain barrier is disrupted (which would make this pathway a suboptimal delivery method).

[0451] Alternatively, the pharmaceutical composition may be administered locally rather than systemically, for example, by directly injecting it into a tissue area of ​​the patient.

[0452] Pharmaceutical compositions of some embodiments of the present invention may be produced by processes well known in the art, for example, by conventional mixing, dissolution, granulation, dragee-making, micronization, emulsification, encapsulation, encapsulation, or freeze-drying processes.

[0453] Pharmaceutical compositions for use according to some embodiments of the present invention may be formulated in the conventional manner using one or more physiologically acceptable carriers, which thus facilitate the processing of the active ingredient into a compound that can be used as a pharmaceutical. The appropriate formulation depends on the chosen route of administration.

[0454] For injection, the active ingredient of the above pharmaceutical composition may be formulated in an aqueous solution, preferably in a physiologically compatible buffer such as Hanks' solution, Ringer's solution, or a physiological salt buffer. For transmucosal administration, a penetrating agent suitable for the barrier to be penetrated is used in the formulation. Such penetrating agents are generally known in the art.

[0455] For oral administration, pharmaceutical compositions can be readily formulated by combining an active compound with a pharmaceutically acceptable carrier known in the art. With such carriers, pharmaceutical compositions can be formulated as tablets, pills, drug-coated tablets, capsules, liquids, gels, syrups, slurries, suspensions, etc., for oral intake by patients. Pharmacological preparations for oral use can be prepared by using a solid excipient, optionally grinding the resulting mixture, adding suitable adjuvants as desired, and then processing the granular mixture to obtain tablets or drug-coated tablet cores. Suitable excipients include sugars, particularly lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as corn starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methylcellulose, hydroxypropyl methylcellulose, and sodium carbomethylcellulose; and / or fillers such as physiologically acceptable polymers like polyvinylpyrrolidone (PVP). If desired, disintegrants such as cross-linked polyvinylpyrrolidone, agar, or alginic acid or sodium alginate salts thereof may be added.

[0456] The core of the drug sugar-coated tablet is coated with a suitable coating. For this purpose, a concentrated sugar solution may be used, which may optionally contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solution, and a suitable organic solvent or solvent mixture. Dyes or pigments may be added to the tablet or drug sugar-coated tablet coating for specific purposes or to characterize different combinations of active compound doses.

[0457] Pharmaceutical compositions for oral administration include push-fit capsules made from gelatin, and soft-seal capsules made from gelatin and a plasticizer such as glycerol or sorbitol. Push-fit capsules may contain the active ingredient in a mixture with a filler such as lactose, a binder such as starch, a lubricant such as talc or magnesium stearate, and optionally a stabilizer. In soft capsules, the active ingredient may be dissolved or suspended in a suitable liquid such as fatty oil, liquid paraffin, or liquid polyethylene glycol. In addition, stabilizers may be added. All formulations for oral administration must be in a dosage suitable for the chosen route of administration.

[0458] For oral administration, the composition may take the form of tablets or lozenges prescribed in the conventional manner.

[0459] For administration by nasal inhalation, the active ingredients for use according to some embodiments of the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or nebulizer, using a suitable spray, such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve for delivering a measured amount. Capsules and cartridges for use in dispensers, such as gelatin capsules and cartridges, may be formulated to contain a powder mixture of the compound and a suitable powder base material such as lactose or starch.

[0460] The pharmaceutical compositions described herein may be formulated for parenteral administration, for example, bolus injection or continuous intravenous infusion. Formulations for injection may be presented in unit dosage forms, for example, ampoules optionally containing preservatives, or in multi-dose containers. The composition may be a suspension, liquid, or emulsion in an oily or aqueous vehicle (medium), and may contain formulation agents such as suspending agents, stabilizers, and / or dispersing agents.

[0461] Examples of pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in a water-soluble form. Furthermore, a suspension of the active ingredient may be prepared as a suitable oily or aqueous injectable suspension. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate, triglycerides, or liposomes. The aqueous injectable suspension may contain a substance that increases the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran. Optionally, the suspension may also contain a suitable stabilizer or an agent that increases the solubility of the active ingredient to enable the preparation of a very concentrated solution.

[0462] Alternatively, the active ingredient may be in powder form for preparation using a suitable vehicle, such as a sterile, pyrogenically decontaminated water-based solution, before use.

[0463] Some embodiments of the present invention may be formulated as suppositories or rectal compositions such as retained enemas, using conventional suppository bases such as cocoa butter or other glycerides.

[0464] Suitable pharmaceutical compositions for use according to some embodiments of the present invention include compositions containing an active ingredient in an effective amount to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of an active ingredient (DNA editing agent) that is effective in preventing, alleviating or relieving the symptoms of a disorder (e.g., cancer or infection) or in extending the survival of the subject being treated.

[0465] Determining a therapeutically effective dose is well within the capabilities of those skilled in the art, especially considering the detailed disclosures presented herein.

[0466] For any preparation used in the method of the present invention, the therapeutically effective amount or therapeutically effective dose can be initially estimated from in vitro and cell culture assays. For example, the dose can be formulated in an animal model to achieve the desired concentration or potency. Such information can be used to more accurately determine a useful dose in humans.

[0467] Animal models for cancerous diseases are described, for example, by Yee et al., Cancer Growth Metastasis. (2015) 8(Suppl 1):115-118. Animal models for infectious diseases are described, for example, by Shevach, Current Protocols in Immunology, published online: April 1, 2011, DOI:10.1002 / 0471142735.im1900s93.

[0468] The toxicity and therapeutic effects (therapeutic efficacy) of the active ingredients described herein can be determined in vitro, in cell culture medium, or in experimental animals by standard pharmaceutical procedures. Data obtained from these in vitro and cell culture medium assays and animal studies can be used when formulating dosage ranges for human use. Dosage may vary depending on the dosage form used and the route of administration utilized. The exact formulation, route of administration, and dosage may be selected by individual physicians taking into account the patient's condition. (See, for example, Fingl, et al., 1975, "The Pharmacological Basis of Therapeutics," Chapter 1, page 1).

[0469] Dosage and dosing intervals may be individually adjusted to provide a sufficient amount (minimum effective concentration, MEC) of the active ingredient to induce or inhibit the biological effect. While the MEC will vary from preparation to preparation, it can be estimated from in vitro data. The dosage required to achieve the MEC will depend on individual characteristics and the route of administration. Detection assays can be used to determine plasma concentrations.

[0470] Depending on the severity and responsiveness of the condition being treated, medication may be administered as a single or multiple doses, and the treatment process may last from several days to several weeks, or until a cure is achieved or the condition is alleviated.

[0471] The amount of the composition to be administered will naturally depend on the patient being treated, the severity of their pain, the method of administration, and the judgment of the attending physician.

[0472] Compositions of some embodiments of the present invention may, if desired, be presented in packs or dispenser devices, such as FDA-approved kits, which may contain one or more unit dosage forms containing the active ingredient. The packs may include, for example, metal foil or plastic foil, and may be blister packs. The packs or dispenser devices may be accompanied by instructions for administration. The packs or dispensers may be enclosed in a notice accompanying a container of a type designated by a government agency that regulates the manufacture, use, or sale of a pharmaceutical product, the notice reflecting the agency's approval of the form of the composition or for human or veterinary administration. Such notices may be, for example, labels or product inserts approved by the U.S. Food and Drug Administration for prescription drugs. Compositions containing preparations of the present invention formulated in a suitable pharmaceutical carrier may be further prepared, placed in appropriate containers, and labeled for treatment of the condition to be addressed, as described below.

[0473] DNA editing agents designed to include silencing specificity of non-coding RNA molecules against target RNAs can be used to treat various diseases and conditions described below.

[0474] The term "treatment" refers to inhibiting, preventing, or halting the onset of a pathological condition (disease, disorder, or state), and / or causing reduction, remission, or regression of the condition. Those skilled in the art will understand that various methodologies and assays can be used to assess the onset of a pathological condition, and similarly, various methodologies and assays can be used to assess reduction, remission, or regression of the condition.

[0475] As used herein, the term “prevention” means preventing a disease, disorder, or condition from occurring in a person who may be at risk of having the disease but has not yet been diagnosed with the disease.

[0476] As used herein, the term “subject” or “required subject” includes mammals, preferably humans, of any age or sex, that are suffering from a disease. Preferably, the term includes individuals at risk of developing the disease.

[0477] According to one aspect of the present invention, a method is provided for treating an infectious disease in a subject of interest, comprising the step of modifying a gene that encodes or is processed by a non-coding RNA molecule or an RNA silencing molecule or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with the onset or progression of the infectious disease.

[0478] According to one aspect of the present invention, a DNA editing agent is provided for use in treating an infectious disease in a target subject, which confers silencing specificity to a non-coding RNA molecule that does not have RNA silencing activity to a target RNA of interest, wherein the target RNA of interest is related to the onset or progression of an infectious disease.

[0479] According to one aspect of the present invention, a DNA editing agent is provided for use in treating an infectious disease in a target subject, which redirects the silencing specificity of a gene encoding or processed by an RNA silencing molecule to a target RNA toward a second target RNA, wherein the target RNA and the second target RNA are different, and the second target RNA is associated with the onset or progression of an infectious disease.

[0480] As used herein, the term "infectious disease" refers to any of the following: chronic infectious diseases, subacute infectious diseases, acute infectious diseases, viral diseases, bacterial diseases, protozoal diseases, parasitic diseases, fungal diseases, mycoplasma diseases, and prion diseases.

[0481] According to one embodiment, in order to treat an infectious disease in a subject, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to target a target RNA associated with the onset or progression of the infectious disease.

[0482] According to one embodiment, the target RNA for the above purpose includes the product of a gene of a eukaryotic cell that confers resistance to a pathogen (e.g., a virus, bacteria, fungus, etc.). Exemplary genes include, but are not limited to, CyPA- (cyclophyllin (CyP)), cyclophyllin A (e.g., for hepatitis C virus infection), CD81, scavenger receptor class BI (SR-BI), ubiquitin-specific peptidase 18 (USP18), phosphatidylinositol 4-kinase III alpha (PI4K-IIIα) (e.g., for HSV infection), and CCR5- (e.g., for HIV infection). According to one embodiment, the target RNA for the purpose includes the product of a gene of the above pathogen.

[0483] According to one embodiment, the virus is an arbovirus (e.g., vesicular stomatitis virus Indiana strain - VSV). According to one embodiment, the target RNA of interest includes products of the VSV gene, such as a G protein (G), an L protein (large protein) (L), a phosphorylated protein, a matrix protein (M), or a nucleoprotein.

[0484] According to one embodiment, the target RNA of interest may include, but is not limited to, the gag and / or vif gene (i.e., the conserved sequence in HIV-1); the P protein (i.e., the essential subunit of viral RNA-dependent RNA polymerase in RSV); the P mRNA (i.e., in PIV); the core, NS3, NS4B, and NS5B (i.e., in HCV); the VAMP-related protein (hVAP-A), the La antigen, and the polypyrimidine tract-binding protein (PTB) (i.e., for HCV).

[0485] According to a particular embodiment, when the organism is a human, the target RNA of interest may include, but is not limited to, the genes of malaria-causing pathogens; the genes of the HIV virus (e.g., listed in GenBank acceptance number: NC_001802.1); the genes of the HCV virus (e.g., listed in GenBank acceptance number: NC_004102.1); and the genes of parasites (e.g., listed in GenBank acceptance number: XM_003371604.1).

[0486] According to a particular embodiment, if the organism is a human, the target RNA of interest may be, but is not limited to, a gene associated with cancerous disease (e.g., Homo sapiens mRNA for the bcr / abl e8a2 fusion protein, GenBank acceptance number: AB069693.1) or a gene associated with myelodysplastic syndrome (MDS) and vascular disease (e.g., human heparin-binding vascular endothelial growth factor (VEGF) mRNA, GenBank acceptance number: M32977.1).

[0487] According to a particular embodiment, if the organism is a cattle, the target RNA of interest may be the gene of bovine rhinotracheitis virus (e.g., listed in GenBank acceptance number: AJ004801.1), for example, BRD (Bovine Respiratory Disease). Examples include, but are not limited to, the genes for bovine herpesvirus type 1 (BHV1), which causes bovine respiratory disease complex; the gene for blue tongue disease (BTV virus) (e.g., listed in GenBank acceptance number: KP821170.1); the gene for bovine viral diarrhea virus (BVD) (e.g., listed in GenBank acceptance number: NC_001461.1); the gene for picornavirus, which causes foot-and-mouth disease (e.g., listed in GenBank acceptance number: NC_004004.1); the gene for parainfluenza type 3 virus (PI3), which causes BRD (e.g., listed in GenBank acceptance number: NC_028362.1); and the gene for Mycobacterium bovis, which causes bovine tuberculosis (bTB) (e.g., listed in GenBank acceptance number: NC_037343.1).

[0488] According to a particular embodiment, if the organism is a sheep, the target RNA of interest may be the genes of pathogens that cause tapeworm disease (e.g., the life cycle of Echinococcus granulosus, Taenia ovis, Taenia hydatigena, and species of the genus Moniezia) (e.g., described in GenBank acceptance number: AJ012663.1); or pathogens that cause flatworm disease (Fasciola hepatica, Fasciola gigantica, Fascioloides magna, Dicrocoelium dendriticum, and Schistosoma bovis). Genes of bovis)) (e.g., listed in GenBank acceptance number: AY644459.1); genes of pathogens that cause blue tongue disease (BTV virus, e.g., listed in GenBank acceptance number: KP821170.1); and pathogens that cause ascariasis (parasitic bronchitis, also known as "hoose," Elaeopora schneideri, Haemonchus contortus, species of Trichostrongylus, Teladorsagia circumcincta, species of Cooperia, species of Nematodirus, Dictyocaulus filaria, Protostrongylus rufecens) Examples include, but are not limited to, the genes of *Oesophagostomum* species (*Oesophagus refescens*), *Chabertia ovina*, and *Trichuris ovis* (e.g., listed in GenBank entry number: NC_003283.11).

[0489] According to a particular embodiment, if the organism is a pig, the target RNA of interest may include, but is not limited to, the gene for African swine fever virus (ASFV) (e.g., the one that causes African swine fever) (e.g., listed in GenBank acceptance number: NC_001659.2); the gene for swine cholera virus (e.g., the one that causes swine cholera) (e.g., listed in GenBank acceptance number: NC_002657.1); and the gene for picornavirus (e.g., the one that causes foot-and-mouth disease) (e.g., listed in GenBank acceptance number: NC_004004.1).

[0490] According to a particular embodiment, if the organism is a chicken, the target RNA of interest may include, but is not limited to, the gene for avian influenza (or avian influenza), the gene for a variant of avian paramyxovirus type 1 (APMV-1) (for example, the one that causes Newcastle disease), or the gene for the pathogen that causes Marek's disease.

[0491] According to a particular embodiment, if the organism is a tadpole shrimp, the target RNA of interest may be, but is not limited to, the gene for white spot disease virus (WSSV), the gene for yellow head virus (YHV), or the gene for Taura syndrome virus (TSV).

[0492] In certain embodiments, when the organism is a salmon, the target RNAs of interest include, but are not limited to, the genes for infectious salmon anemia (ISA), infectious hematopoietic necrosis (IHN), and sea lice (e.g., ectoparasitic copepods of the genera Lepeophtheirus and Caligus).

[0493] Exemplary endogenous non-coding RNA molecules that can be modified to target a target RNA (e.g., a pathogen gene), exemplary gRNA (i.e., DNA editing agent) sequences that can be used to modify endogenous non-coding RNA molecules, and exemplary nucleotide sequences for redirecting the silencing specificity of endogenous non-coding RNA molecules to the target RNA are provided in Table 1B below.

[0494] [Table 1(1)]

[0495] [Table 1(2)]

[0496] [Table 1(3)]

[0497] [Table 1(4)]

[0498] [Table 1(5)]

[0499] [Table 1(6)]

[0500] [Table 1(7)]

[0501] [Table 1(8)]

[0502] [Table 1(9)]

[0503] [Table 1 (10)]

[0504] The effectiveness of the treatment may be evaluated using any method known in the art, for example, by assessing the physical health status of the subject, by blood tests, by assessing viral / bacterial load, etc.

[0505] According to one aspect of the present invention, a method is provided for treating a monogene recessive genetic disorder in a subject of interest, comprising the step of modifying a gene that encodes or is processed by a non-coding RNA molecule or an RNA silencing molecule or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with the monogene recessive genetic disorder.

[0506] According to one aspect of the present invention, a DNA editing agent is provided for use in treating a mono-recessive genetic disorder in a subject of interest, which confers silencing specificity to a non-coding RNA molecule that does not have RNA silencing activity to a target RNA of interest, wherein the target RNA of interest is related to a mono-recessive genetic disorder.

[0507] According to one aspect of the present invention, a DNA editing agent is provided for use in treating a monogene recessive genetic disorder in a subject of interest, which redirects the silencing specificity of a gene encoding or processed by an RNA silencing molecule to a target RNA toward a second target RNA, wherein the target RNA and the second target RNA are different, and the second target RNA is associated with a monogene recessive genetic disorder.

[0508] As used herein, the term “mono-recessive genetic disorder” refers to a disease or condition resulting from the deletion of a single gene located on an autosome.

[0509] According to one embodiment, a single-gene recessive genetic disorder is the result of a spontaneous mutation or a heritable mutation.

[0510] According to one embodiment, a single-gene recessive genetic disorder is autosomal dominant, autosomal recessive, or X-linked recessive.

[0511] Examples of monogenic recessive disorders include, but are not limited to, severe combined immunodeficiency (SCID), hemophilia, enzyme deficiencies, Parkinson's disease, Wiscott-Aldrich syndrome, cystic fibrosis, phenylketonuria, Friedreich ataxia, Duchenne muscular dystrophy, Hunter's disease, Eicardi syndrome, Klinefelter syndrome, and Leber's hereditary optic neuropathy (LHON).

[0512] According to one embodiment, in order to treat a monogenic recessive genetic disorder in a subject, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to target a target RNA associated with the monogenic recessive genetic disorder.

[0513] According to one embodiment, when the disorder is Parkinson's disease, the target RNA of interest includes the product of the SNCA (PARK1=4), LRRK2 (PARK8), Parkin (PARK2), PINK1 (PARK6), DJ-1 (PARK7), or ATP13A2 (PARK9) gene.

[0514] According to one embodiment, when the disorder is hemophilia or von Willebrand disease, the target RNA of interest includes, for example, the product of the antithrombin gene, the coagulation factor VIII gene, or the coagulation factor IX gene.

[0515] The effectiveness of the treatment may be evaluated using any method known in the art, for example, by blood tests or by evaluating the subject's physical health status using bone marrow fluid.

[0516] According to one aspect of the present invention, a method is provided for treating an autoimmune disease in a subject of interest, comprising the step of modifying a gene that encodes or is processed by a non-coding RNA molecule or an RNA silencing molecule or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with the autoimmune disease.

[0517] According to one aspect of the present invention, a DNA editing agent is provided for use in treating autoimmune diseases in a target population, which confers silencing specificity to a non-coding RNA molecule that does not have RNA silencing activity to a target RNA of interest, wherein the target RNA of interest is associated with autoimmune diseases.

[0518] According to one aspect of the present invention, a DNA editing agent is provided for use in treating autoimmune diseases in a target population, which redirects the silencing specificity of a gene encoding or processed by an RNA silencing molecule to a target RNA toward a second target RNA, wherein the target RNA and the second target RNA are different, and the second target RNA is associated with autoimmune diseases.

[0519] Non-exclusive examples of autoimmune diseases include, but are not limited to, cardiovascular diseases, rheumatic diseases, glandular diseases, gastrointestinal diseases, skin diseases, liver diseases, neurological diseases, muscle diseases, kidney diseases, reproductive disorders, connective tissue diseases (collagen diseases), and systemic diseases.

[0520] Examples of autoimmune cardiovascular diseases include atherosclerosis (Matsuura E. et al., Lupus. 1998;7 Suppl 2:S135), myocardial infarction (Vaarala O. Lupus. 1998;7 Suppl 2:S132), thrombosis (Tincani A. et al., Lupus 1998;7 Suppl 2:S107-9), Wegener's granulomatosis, Takayasu arteritis, Kawasaki disease (Praprotnik S. et al., Wien Klin Wochenschr Aug 25, 2000;112(15-16):660), anti-factor VIII autoimmune disease (Lacroix-Desmazes S. et al., Semin Thromb Hemost.2000;26(2):157), necrotizing small vasculitis, microscopic polyangiitis, Churg-Strauss syndrome, pauci-immune focal necrotizing and crescentic glomerulonephritis (Noel LH. Ann Med Interne(Paris). May 2000;151(3):178), antiphospholipid antibody syndrome (Flamholz R. et al., J Clin Apheresis 1999;14(4):171), antibody-induced heart failure (Wallukat G. et al., Am J Cardiol. Jun 17, 1999;83(12A):75H), thrombocytopenic purpura (Moccia F. Ann Ital Med Int. Apr-Jun 1999;14(2):114; Semple JW. et al., Blood May 15, 1996;87(10):4245), autoimmune hemolytic anemia (Efremov DG. et al., Leuk Lymphoma Jan 1998;28(3-4):285; Sallah S. et al., Ann Hematol Mar 1997;74(3):139), cardiac autoimmunity in Chagas disease (Cunha-Neto E. et al., J Clin Invest Oct 15, 1996;98(8):1709) and anti-helper T lymphocyte autoimmunity (Caporossi AP. et al., Viral Immunol 1998;11(1):9), but are not limited thereto.

[0521] Examples of autoimmune rheumatoid-like diseases include, but are not limited to, rheumatoid arthritis (Krenn V. et al., Histol Histopathol July 2000;15(3):791; Tisch R, McDevitt HO. Proc Natl Acad Sci units SA January 18, 1994;91(2):437) and ankylosing spondylitis (Jan Voswinkel et al., Arthritis Res 2001;3(3):189).

[0522] Examples of autoimmune gonadal disorders include, but are not limited to, pancreatic diseases, type 1 diabetes, thyroid diseases, Graves' disease, thyroiditis, spontaneous autoimmune thyroiditis, Hashimoto's thyroiditis, idiopathic myxedema, ovarian autoimmunity, autoimmune antispermia, autoimmune prostatitis, and type 1 polygonadal autoimmune syndrome. Diseases include pancreatic autoimmune disease, type 1 diabetes (Castano L. and Eisenbarth GS. Ann. Rev. Immunol. 8:647;Zimmet P. Diabetes Res Clin Pract October 1996;34 Suppl:S125), autoimmune thyroid disease, and Graves' disease (Orgiazzi J. Endocrinol Metab Clin North Am 2000 June;29(2):339;Sakata S. et al. Mol Cell Endocrinol 1993 March;92(1):77), spontaneous autoimmune thyroiditis (Braley-Mullen H. and Yu S, J Immunol 2000 December 15;165(12):7262), Hashimoto's thyroiditis (Toyoda N. et al., Nippon Rinsho Examples include, but are not limited to, idiopathic myxedema (Mitsuma T. Nippon Rinsho. August 1999; 57(8): 1759), ovarian autoimmunity (Garza KM. et al., J Reprod Immunol February 1998; 37(2): 87), autoimmune antispermia (Diekman AB. et al., Am J Reprod Immunol. March 2000; 43(3): 134), autoimmune prostatitis (Alexander RB. et al., Urology December 1997; 50(6): 893), and polyglandular autoimmune syndrome type I (Hara T. et al., Blood. March 1, 1991; 77(5): 1127).

[0523] Examples of autoimmune gastrointestinal diseases include, but are not limited to, chronic inflammatory bowel disease (Garcia Herola A. et al., Gastroenterol Hepatol. January 2000; 23(1):16), celiac disease (Landau YE. and Shoenfeld Y. Harefuah, January 16, 2000; 138(2):122), colitis (colitis), ileitis, and Crohn's disease.

[0524] Examples of autoimmune skin diseases include, but are not limited to, autoimmune bullous dermatopathies such as pemphigus vulgaris, bullous pemphigoid, and pemphigus foliaceus.

[0525] Examples of autoimmune liver diseases include, but are not limited to, hepatitis, autoimmune chronic active hepatitis (Franco A. et al., Clin Immunol Immunopathol March 1990; 54(3):382), primary biliary cirrhosis (Jones DE. Clin Sci(Colch) November 1996; 91(5):551; Strassburg CP. et al., Eur J Gastroenterol Hepatol. June 1999; 11(6):595), and autoimmune hepatitis (Manns MP. J Hepatol August 2000; 33(2):326).

[0526] Examples of autoimmune neurological diseases include multiple sclerosis (Cross AH. et al., J Neuroimmunol January 1, 2001;112(1-2):1), Alzheimer's disease (Oron L. et al., J Neural Transm Suppl. 1997;49:77), myasthenia gravis (Infante AJ. and Kraig E, Int Rev Immunol 1999;18(1-2):83; Oshima M. et al., Eur J Immunol December 1990;20(12):2563), neuropathy, motor neuropathy (Kornberg AJ. J Clin Neurosci. May 2000;7(3):191); Guillain-Barré syndrome and autoimmune neuropathy (Kusunoki S. Am J Med Sci. April 2000; 319(4):234), myasthenia gravis, Lambert-Eaton myasthenia gravis syndrome (Takamori M. Am J Med Sci. April 2000; 319(4):204); paraneoplastic neurological syndromes, cerebellar atrophy, paraneoplastic cerebellar atrophy and generalized rigidity syndrome (Hiemstra HS. et al., Proc Natl Acad Sci units SA March 27, 2001; 98(7):3988); non-paraneoplastic generalized rigidity syndrome, progressive cerebellar atrophy, encephalitis, Rasmussen encephalitis, amyotrophic lateral sclerosis, Sydenham chorea, Gilles de la Tourette syndrome and autoimmune polyglandular endocrine deficiency (Antoine JC. and Honnorat J. Rev Neurol (Paris) Examples include, but are not limited to, those listed below: January 2000; 156(1):23; immunodeficiency neuropathy (Nobile-Orazio E. et al., Electroencephalogr Clin Neurophysiol Suppl 1999; 50:419); acquired neurogenic myotonia, congenital multiple arthrocontractures (Vincent A. et al., Ann NY Acad Sci. May 13, 1998; 841:482); neuritis, optic neuritis (Soderstrom M. et al., J Neurol Neurosurg Psychiatry May 1994; 57(5):544); and neurodegenerative diseases.

[0527] Examples of autoimmune muscle diseases include, but are not limited to, myositis, autoimmune myositis and primary Sjögren's syndrome (Feist E. et al., Int Arch Allergy Immunol September 2000; 123(1):92) and smooth muscle autoimmune diseases (Zauli D. et al., Biomed Pharmacother June 1999; 53(5-6):234).

[0528] Examples of autoimmune kidney diseases include, but are not limited to, nephritis and autoimmune interstitial nephritis (Kelly CJ. J Am Soc Nephrol 1990 August;1(2):140).

[0529] Examples of reproductive autoimmune diseases include, but are not limited to, recurrent miscarriage (Tincani A. et al., Lupus 1998;7 Suppl 2:S107-9).

[0530] Examples of autoimmune connective tissue diseases include, but are not limited to, ear diseases, autoimmune ear diseases (Yoo TJ et al., Cell Immunol 1994 August;157(1):249), and autoimmune diseases of the inner ear (Gloddek B et al., Ann NY Acad Sci 1997 December 29;830:266).

[0531] Examples of autoimmune systemic diseases include, but are not limited to, systemic lupus erythematosus (Erikson J. et al., Immunol Res 1998;17(1-2):49) and systemic sclerosis (Renaudineau Y. et al., Clin Diagn Lab Immunol. March 1999;6(2):156); Chan OT. et al., Immunol Rev June 1999;169:107).

[0532] According to one embodiment, autoimmune diseases include systemic lupus erythematosus (SLE).

[0533] According to one embodiment, in order to treat an autoimmune disease in a subject, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to target a target RNA of interest associated with the autoimmune disease.

[0534] According to one embodiment, when the disease is lupus, the target RNA of interest includes antinuclear antibodies (ANAs), such as antinuclear antibodies (ANAs), which are pathologically produced by B cells.

[0535] The effectiveness of the treatment may be evaluated using any method known in the art, for example, by blood tests or by evaluating the subject's physical health status using bone marrow fluid.

[0536] According to one aspect of the present invention, a method is provided for treating a cancerous disease in a subject of interest, comprising the step of modifying a gene that encodes or is processed by a non-coding RNA molecule or an RNA silencing molecule or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with the cancerous disease.

[0537] According to one aspect of the present invention, a DNA editing agent is provided for use in treating cancerous diseases in a target population, which confers silencing specificity to a non-coding RNA molecule that does not have RNA silencing activity to a target RNA of interest, wherein the target RNA of interest is related to cancerous diseases.

[0538] According to one aspect of the present invention, a DNA editing agent is provided for use in treating cancerous diseases in a target subject, which redirects the silencing specificity of a gene encoding or processed by an RNA silencing molecule to a target RNA toward a second target RNA, wherein the target RNA and the second target RNA are different, and the second target RNA is related to cancerous diseases. Non-limiting examples of cancers that can be treated according to the methods of some embodiments of the present invention may be any solid or non-solid cancer and / or cancer metastases or precancerous conditions, such as tumors of the gastrointestinal tract (colonic cell tumor, rectal cell tumor, colorectal cell tumor, colorectal cancer, colorectal adenoma, hereditary nonpolyposis type 1, hereditary nonpolyposis type 2, hereditary nonpolyposis type 3, hereditary nonpolyposis type 6; colorectal cancer, hereditary nonpolyposis type 7, cell tumors of the small and / or large intestine, esophagus Cell tumors, calluses with esophageal cancer, gastric cell tumors, pancreatic cell tumors, pancreatic endocrine tumors), endometrial cell tumors, dermatofibrosarcoma protuberans, gallbladder cell tumors, biliary tract tumors, prostate cancer, prostate adenocarcinoma, renal cancer (e.g., Wilms tumor type 2 or 1), liver cancer (e.g., hepatoblastoma, hepatocellular carcinoma, hepatocellular carcinoma), bladder cancer, embryonal rhabdomyosarcoma, germ cell tumors, trophoblast tumors, testicular germ cell tumors, immature teratomas of the ovary, uterine tumors, ovarian epithelial tumors, sacrococcygeal tumors, choriocarcinoma, placental trophoblast tumors, adult epithelial tumors. Tumors), ovarian cell carcinoma, serous ovarian carcinoma, ovarian cord neoplasm, cervical cancer, cervical cell tumor, small cell and non-small cell lung cancer, nasopharyngeal cell carcinoma, mammary cell carcinoma (e.g., ductal carcinoma, invasive intraductal carcinoma, sporadic; breast cancer, increased susceptibility to breast cancer, type 4 breast cancer, breast cancer-1, breast cancer-3; breast cancer and ovarian cancer), squamous cell carcinoma (e.g., in the head and neck), neurogenic tumors, astrocytoma, ganglioblastoma, neuroblastoma, lymphoma (e.g., Hodgkin's disease, non-Hodgkin's lymphoma, B-cell lymphoma, Burkitt's lymphoma, cutaneous T-cell lymphoma, histiocytic lymphoma, lymphoblastic lymphoma, T-cell lymphoma, thymic lymphoma), glioma, adenocarcinoma, adrenal tumors, hereditary adrenocortical carcinoma, brain tumors, various other tumors Cystic tumors (e.g., bronchogenic large cell carcinoma, tubular carcinoma, Ehrlich-Lettre ascites carcinoma, epidermoid carcinoma, large cell carcinoma, Lewis lung carcinoma, medullary carcinoma, mucoepidermoid carcinoma, oat cell carcinoma, small cell carcinoma, spindle cell carcinoma, squamous cell carcinoma, transitional cell carcinoma, undifferentiated carcinoma, carcinosarcoma, choriocarcinoma, cystadenocarcinoma), ependymoblastoma, epithelioma, erythroleukemia (e.g., Friend leukemia, lymphoblastic leukemia), fibrosarcoma, giant cell tumor, glial cell tumor, glioblastoma (e.g., glioblastoma multiforme, astrocytoma), glioma hepatocytoma, heterohybridoma, heteromyeloma, histiocytoma, hybridoma (e.g., B cell), adrenal tumor (Gravitz tumor), insulinoma, islet tumor, keratoma,Leiomyomyoblastoma, leiomyosarcoma, leukemia (e.g., acute lymphoblastic leukemia, acute lymphoblastic leukemia, acute lymphoblastic pre-B cell leukemia, acute lymphoblastic T cell leukemia, acute megakaryoblastic, monocytic, acute myeloid, acute myeloid, acute myeloid with eosinophilia, B cell, basophilic, chronic myeloid, chronic, B cell, eosinophilic, Friend, granulocytic or myeloid, hairy cell, lymphocytic, megakaryoblastic, monocytic, monocytic macrophage, myeloblastic, myeloid, myelomonocytic, plasmacytic, pre-B cell, promyelocytic, subacute, T cell, lymphoid tumor, myeloid malignancy, acute nonlymphocytic leukemia), lymphosarcoma, melanoma, breast tumor, mast cell tumor, medulloblastoma, mesothelioma, metastatic tumor, mono Bubular tumors, multiple myeloma, myelodysplastic syndrome, myeloma, nephroblastoma, glial cell tumors of nerve tissue, neuronal cell tumors of nerve tissue, schwannoma, neuroblastoma, oligodendroglioma, osteochondroma, osteomyeloma, osteosarcoma (e.g., Ewing's osteosarcoma), papilloma, transitional cell tumor, pheochromocytoma, pituitary tumor (invasive), plasmacytoma, retinoblastoma, rhabdomyosarcoma, sarcoma (e.g., Ewing's sarcoma, histiocytic cell tumor, Jensen's sarcoma, osteogenic sarcoma, reticulosarcoma), schwannoma, subcutaneous tumors, teratoma (e.g., pluripotent), teratoma, testicular tumors, thymoma and follicular epithelioma, gastric cancer, fibrosarcoma, glioblastoma multiforme; multiple glomus tumors, Lie-Fraumeni syndrome, liposarcoma, Lynch carcinoma Examples of cancer-related conditions include, but are not limited to, familial rhabdoid tumor syndrome type II, male germ cell tumors, mast cell leukemia, medullary thyroid tumors, multiple meningiomas, endocrine tumors, myxosarcoma, paraganglioma, familial nonchromophilic tumors, pilomatoma, papilloma, familial and sporadic rhabdoid tumor syndrome, familial rhabdoid tumors, soft tissue sarcomas, and Turcott syndrome with glioblastoma.

[0539] According to one embodiment, cancers that can be treated by the methods of several embodiments of the present invention include hematological malignancies. Exemplary hematological malignancies include those involving malignant fusion of ABL tyrosine kinase to other chromosomes, where this malignant fusion produces what is called BCR-ABL, which then gives rise to a malignant fusion protein. Therefore, targeting the fusion site in mRNA may allow for the silencing of only the fusion mRNA for downregulation, while leaving essential normal proteins for the cell intact.

[0540] According to one embodiment, in order to treat a cancerous disease in a subject, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to target a target RNA associated with the cancerous disease.

[0541] According to one embodiment, the target RNA of interest includes the product of an oncogene (e.g., a mutated oncogene).

[0542] According to one embodiment, the target RNA of interest repairs the function of a tumor suppressor.

[0543] According to one embodiment, the target RNA of interest includes the product of the RAS, MCL-1, or MYC gene.

[0544] According to one embodiment, the target RNA of interest includes the product of the BCL-2 family of apoptosis-related genes.

[0545] Examples of target genes include, but are not limited to, the dominant-negative mutants TP53, Bcl-x, IAPs, Flip, Faim3, and SMS1.

[0546] According to one embodiment, when the cancer is melanoma, the target RNA of interest includes BRAF. Several forms of BRAF mutations, including, for example, V600E, V600K, V600D, V600G, and V600R, are contemplated herein.

[0547] According to one embodiment, the method is carried out by targeting non-coding RNA molecules within healthy immune cells such as white blood cells, for example T cells, B cells, or NK cells (for example, derived from a patient or a cell donor), to a target RNA of interest, so that these immune cells can (directly or indirectly) kill malignant cells (for example, cells of a hematological malignancy).

[0548] According to one embodiment, the method is carried out by targeting a non-coding RNA molecule to silence a protein manipulated by an oncogenic factor (i.e., the target RNA of the matter) so that the cancer can be recognized and eradicated by an unmodified immune system (i.e., to suppress the immune response from recognizing the malignant tumor).

[0549] The effectiveness of the treatment may be evaluated using any method known in the art, such as by assessing tumor growth or the number of neoplasms or metastases using MRI, CT, PET-CT, blood tests, ultrasound, or X-rays.

[0550] According to one aspect of the present invention, a method is provided for enhancing the efficacy and / or specificity of a chemotherapeutic agent in a target subject of interest, comprising the step of modifying a gene that encodes or is processed by a non-coding RNA molecule or an RNA silencing molecule or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with the enhancement of the efficacy and / or specificity of the chemotherapeutic agent.

[0551] According to one aspect of the present invention, a DNA editing agent is provided for use in increasing the efficacy and / or specificity of a chemotherapeutic agent in a target subject, which confers silencing specificity to a non-coding RNA molecule that does not have RNA silencing activity to a target RNA of interest, wherein the target RNA of interest is a DNA editing agent related to the increased efficacy and / or specificity of the chemotherapeutic agent.

[0552] According to one aspect of the present invention, a DNA editing agent is provided for use in increasing the efficacy and / or specificity of a chemotherapeutic agent in a target area, which redirects the silencing specificity of a gene encoding or processed by an RNA silencing molecule to a target RNA toward a second target RNA, wherein the target RNA and the second target RNA are different, and the second target RNA is associated with increasing the efficacy and / or specificity of the chemotherapeutic agent.

[0553] As used herein, the term “chemotherapeutic agent” means an agent that reduces, prevents, mitigates, limits and / or delays the growth of a neoplasm or metastasis, or directly kills neoplasmic cells by necrosis, apoptosis, or any other mechanism, or an agent that can be used in other pharmaceutically effective amounts to reduce, prevent, mitigate, limit and / or delay the growth of a neoplasm or metastasis in a subject with a neoplastic disease (e.g., cancer).

[0554] Chemotherapy agents include, but are not limited to, fluoropyrimidines; pyrimidine nucleosides; purine nucleosides; folic acid antimetabolites; platinum preparations; anthracyclines / anthracendions; epipodophyllotoxins; camptothecin (e.g., calenitecin); hormones; hormone complexes; antihormone drugs; enzymes, proteins, peptides, and polyclonal and / or monoclonal antibodies; immunotherapies; vinca alkaloids; taxanes; epotilones; antimicrotubule agents (tubulin polymerization inhibitors); alkylating agents; antimetabolites; topoisomerase inhibitors; antiviral drugs; and various other cytotoxic and cell division inhibitors.

[0555] According to a particular embodiment, the chemotherapeutic agent may be avalerix, aldesleukin, aldesleukin, alemtuzumab, alitretinoin, allopurinol, altretamine, amifostine, anastrozole, arsenic trioxide, asparaginase, azacitidine, bevacizumab, bexarotene, bleomycin, bortezomib, busulfan, calusterone, capecitabine, carboplatin, carmustine, se Lecoxib, cetuximab, cisplatin, cladribine, clofarabine, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, actinomycin D, darbepoetin alfa, darbepoetin alfa, daunorubicin liposome, daunorubicin, decitabine, denileukin difutox, dexrazoxane, dexrazoxane, docetaxel, doxorubicin, dromostanolone propionate, Elliott's B SolutionSolution) Epirubicin, Epoetin alfa, Erlotinib, Estramustine, Etoposide, Exemestane, Filgrastim, Furoxuridine, Fludarabine, Fluorouracil 5-FU, Fulvestrant, Gefitinib, Gemcitabine, Gemtuzumab Ozogamicin, Goserelin acetate, Histrelin acetate, Hydroxyurea, Ibritumomab tiuxetan, Idarubicin, Ifosfamide, Imatinib mesil Acids, interferon alpha-2a, interferon alpha-2b, irinotecan, lenalidomide, letrozole, leucovorin, leuprolide acetate, levamisol, lomustine, CCNU, mechloretamine, nitrogen mustard, megestrol acetate, melphalan, L-PAM, mercaptopurine 6-MP, mesna, methotrexate, mitomycin C, mitotane, mitoxantrone, nandrolone fenpropion Onate ester, nelarabine, nofetumomab, oprelbequin, oprelbequin, oxaliplatin, paclitaxel, parifermin, pamidronic acid, pegademase, pegaspargase, pegfilgrastim, pemetrexeddisodium, pentostatin, pipobromane, pricamycin mithramycin, porfimer sodium, procarbazine, quinacrine, rasburicase, rituximab, Examples include, but are not limited to, salglamostim, sorafenib, streptozosin, sunitinib maleate, tamoxifen, temozolomide, teniposide VM-26, testolactone, thioguanine 6-TG, thiotepa, thiotepa, topotecan, toremifene, tocitumomab, trastuzumab, tretinoin ATRA, uracil mustard, barrubicin, vinblastine, vinorelbine, zoledronic acid, and zoledronic acid.

[0556] According to one embodiment, the effect of the chemotherapeutic agent is enhanced by approximately 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% compared to the effect of the chemotherapeutic agent in a subject not treated with a DNA editing agent designed to confer silencing activity and / or specificity of a non-coding RNA molecule (e.g., an RNA silencing molecule) to a target RNA of interest.

[0557] The efficacy and / or specificity of a chemotherapeutic agent may be evaluated using any method known in the art, such as by evaluating tumor growth or the number of neoplasms or metastases using MRI, CT, PET-CT, blood tests, ultrasound, X-ray, etc.

[0558] According to one embodiment, the method is carried out by targeting non-coding RNA molecules within healthy immune cells such as white blood cells, for example T cells, B cells, or NK cells (e.g., patient-derived or cell-donor-derived), to a target RNA of interest, so that these immune cells can reduce the cancer's resistance to chemotherapy.

[0559] According to one embodiment, the method is carried out by targeting non-coding RNA molecules within healthy immune cells such as white blood cells, for example T cells, B cells, or NK cells (for example, derived from a patient or a cell donor), to a target RNA of interest, so that these immune cells become resistant to chemotherapy.

[0560] According to one embodiment, in order to enhance the efficacy and / or specificity of a chemotherapeutic agent in a subject, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to target an RNA of interest associated with the suppression of the efficacy and / or specificity of the chemotherapeutic agent.

[0561] According to one embodiment, the target RNA of interest includes the products of drug-metabolizing enzyme genes (e.g., cytochrome P450 [CYP]2C8, CYP2C9, CYP2C19, CYP2D6, CYP3A4, CYP3A5, dihydropyrimidine dehydrogenase, uridine diphosphate glucuronosyltransferase [UGT]1A1, glutathione S-transferase, sulfotransferase [SULT]1A1, N-acetyltransferase [NAT], thiopurine methyltransferase [TPMT]) and drug transporters (P-glycoprotein [multidrug resistance 1], multidrug resistance protein 2 [MRP2], breast cancer resistance protein [BCRP]).

[0562] According to one embodiment, the target RNA of interest includes an anti-apoptotic gene. Exemplary target genes include, but are not limited to, members of the Bcl-2 family, such as Bcl-x, IAPs, Flip, Faim3, and SMS1.

[0563] According to one aspect of the present invention, a method for inducing cellular apoptosis in a target subject is provided, comprising the step of modifying a gene that encodes or is processed by a non-coding RNA molecule or encodes or is processed by an RNA silencing molecule, in accordance with a method of several embodiments of the present invention, wherein the target RNA of interest is associated with apoptosis.

[0564] According to one aspect of the present invention, a DNA editing agent is provided for use in inducing cell apoptosis in a target subject, which confers silencing specificity to a non-coding RNA molecule that does not have RNA silencing activity to a target RNA of interest, wherein the target RNA of interest is a DNA editing agent associated with apoptosis.

[0565] According to one aspect of the present invention, a DNA editing agent is provided for use in inducing cell apoptosis in a target subject, which redirects the silencing specificity of a gene encoding or processed by an RNA silencing molecule to a target RNA toward a second target RNA, wherein the target RNA and the second target RNA are different, and the second target RNA is associated with apoptosis.

[0566] The term “cellular apoptosis,” as used herein, refers to the cellular process of programmed cell death. Apoptosis is characterized by distinct structural changes in the cytoplasm and nucleus, chromatin cleavage at regularly spaced sites, and nucleotide strand breaks in genomic DNA at sites between nucleosomes. These changes include vesicle formation, cell contraction, nuclear fragmentation, chromatin condensation, and chromosomal DNA fragmentation.

[0567] According to one embodiment, cellular apoptosis is enhanced by approximately 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% compared to cellular apoptosis in subjects not treated with a DNA editing agent that confers silencing activity and / or specificity of a non-coding RNA molecule (e.g., an RNA silencing molecule) to a target RNA of interest.

[0568] The evaluation of cell apoptosis may be carried out using any method known in the art, such as a cell proliferation assay or FACS analysis.

[0569] According to one embodiment, in order to induce cellular apoptosis in a target, a non-coding RNA molecule (e.g., an RNA silencing molecule) is designed to target a target RNA associated with apoptosis.

[0570] According to one embodiment, the target RNA for the above purpose includes the product of the BCL-2 family of apoptosis-related genes.

[0571] According to one embodiment, the target RNA of interest includes an anti-apoptotic gene. Exemplary genes include, but are not limited to, the dominant-negative mutants TP53, Bcl-x, IAPs, Flip, Faim3, and SMS1.

[0572] According to one aspect of the present invention, a method for generating a eukaryotic non-human organism is provided, wherein the organism is not a plant, and at least some of the cells of the eukaryotic non-human organism contain modified genes that encode or process a non-coding RNA molecule having silencing specificity for a target RNA of interest, the method comprising the step of introducing a DNA editing agent into at least one cell of the eukaryotic non-human organism that confers silencing specificity to the non-coding RNA molecule (e.g., an RNA silencing molecule) for a target RNA of interest.

[0573] The following information should be available: a) the target sequence to be silenced by gene editing-induced gene silencing (GEiGS) ("the target"); b) whether the GEiGS (i.e., the modified non-coding RNA) will be expressed ubiquitously (e.g., constitutively) or specifically (e.g., specifically in a particular tissue, developmental stage, stress, heat / cold shock, etc.).

[0574] To filter (i.e., select) only the relevant miRNAs that meet the input criteria, submit this information to a publicly available miRNA dataset (e.g., small molecule RNA sequencing, genome sequencing, microarrays, etc.): miRNAs expressed according to the above requirements.

[0575] Using publicly available tools, a list of effective target-specific siRNA sequences can be constructed. miRNAs are aligned to the effective siRNA sequences, and the most homologous miRNAs can be selected. Filtered miRNAs, like the effective siRNAs, may have sequences similar in the same direction.

[0576] A naturally matured miRNA sequence, scored as having high homology to a target-specific, potent siRNA, is modified to perfectly match the target sequence. This modification may occur on a single mature miRNA strand with the highest target homology (e.g., either the original miRNA guide or passenger strand). Such 100% complementarity to the target could potentially allow the miRNA sequence to be replaced with siRNA.

[0577] The smallest global aggregate (GE) can be achieved by filtering out miRNA sequences that have high natural homology (reverse complementarity) to the target.

[0578] Using a primary modified miRNA gene, ssDNA oligos (e.g., ssDNA lengths of 200-500 nt) and dsDNA fragments (e.g., only dsDNA fragments of 250-5000 nt or dsDNA fragments cloned within a plasmid) are generated based on the genomic DNA sequence adjacent to the modified miRNA precursor sequence (pre-miRNA). The guide strand (silencing strand) sequence of the modified miRNA can be designed to be 100% complementary to the target.

[0579] The sequences of other miRNA gene regions are modified to preserve the original (unmodified) miRNA precursor and mature structure by maintaining the same base pairing profile.

[0580] The sgRNA is designed to specifically target the original, unmodified miRNA gene (specific to the genomic miRNA locus) and not target the modified version (i.e., the oligo / fragment sequence).

[0581] This method analyzes restriction enzyme sites by comparing modified miRNA genes with the original miRNA genes, and groups the different restriction sites together. Such a detection system is based on PCR, which precedes restriction enzyme digestion and gel electrophoresis.

[0582] We will verify this as discussed in detail above.

[0583] When endogenous non-coding RNAs (e.g., miRNAs) exhibit high natural homology (e.g., 60-90%) to the target, in silico methods can be used to investigate the targeting of non-coding RNAs toward other targets (e.g., "off-target effects") in order to achieve specific silencing of the target of interest.

[0584] The goal is to enhance the effectiveness of silencing target molecules by minimally modifying endogenous non-coding RNAs (e.g., miRNAs).

[0585] We validate the GEiGS results of minimally edited primary miRNA genes and generate improved minimally edited candidate miRNAs. Experimentally valid primary GEiGS results (primary minimally edited miRNA genes) are considered to be miRNAs with a modified guide or passenger strand that fits the target 100%.

[0586] (As shown in Figure 9) Several guide strand sequences or passenger strand sequences are generated that gradually return to the original sequence.

[0587] The seed sequence is maintained such that at least five of the seven seed nucleotides (nucleotides 2-8 from the 5' end) match.

[0588] We will test various candidate "improved, minimally edited miRNA genes" for targeted silencing efficiency. We will select a gene GE-mediated knock-in that yields the highest silencing with minimal miRNA sequence modification.

[0589] This study tests the potential "off-target effects" of improved, minimally edited miRNA candidates. Significant predictions of "off-target effects" will influence the final evaluation of the improved, minimally edited miRNA genes.

[0590] Based on experimental validation, minimally edited miRNA gene candidates that have not been significantly improved will be tested.

[0591] As used herein, the term "approximately" refers to a range of ±10%.

[0592] The terms "comprises," "comprising," "includes," "including," and "having," as well as their compound words, all mean "including but not limited to."

[0593] The term "consisting of" means "including and limited to".

[0594] The phrase "consisting essentially of" means that a composition, method, or structure may include additional components, processes, and / or parts, but only if such additional components, processes, and / or parts do not substantially alter the basic and novel features of the claimed composition, method, or structure.

[0595] As used herein, the singular forms "a," "an," and "the" include multiple references unless the context explicitly indicates otherwise. For example, the terms "compound" or "at least one compound" may include multiple compounds and mixtures thereof.

[0596] Throughout this application, various embodiments of the present invention may be presented in range form. It should be understood that descriptions in range form are merely for convenience and brevity and should not be interpreted as inflexible limitations on the scope of the present invention. Therefore, a range description should be considered to specifically disclose all possible subranges and individual numerical values ​​within that range. For example, a range description such as 1-6 should be considered to specifically disclose subranges such as 1-3, 1-4, 1-5, 2-4, 2-6, 3-6, and individual numbers within that range, such as 1, 2, 3, 4, 5, and 6. This applies regardless of the width of the range.

[0597] Whenever a numerical range is indicated in this specification, that range is intended to include all cited numbers (fractions or integers) within the indicated range. The phrases “over / range” between the first indicated number and the second indicated number, and “over / range” from the first indicated number to the second indicated number (first indicated number to second indicated number) are used interchangeably in this specification and are intended to include the first and second indicated numbers and all fractions and integers between them.

[0598] As used herein, the term “method” means a way, means, technique and procedure for accomplishing a given task, which includes, but is not limited to, methods, means, techniques and procedures that are known to those skilled in the art of the fields of chemistry, pharmacology, biology, biochemistry and medicine, or that can be readily developed from methods, means, techniques and procedures known to those skilled in the fields of chemistry, pharmacology, biology, biochemistry and medicine.

[0599] For clarity, it should be understood that certain features of the Invention described in relation to separate embodiments may be provided in combination in a single embodiment. Conversely, for brevity, various features of the Invention described in relation to a single embodiment may be provided separately, in any preferred subcombination, or as appropriate in any other described embodiment of the Invention. Certain features described in relation to various embodiments should not be considered essential features of those embodiments unless the embodiment would be inoperable without those elements.

[0600] The various embodiments and aspects of the present invention described herein and claimed in the appended claims are experimentally supported in the following examples.

[0601] It is understood that any sequence number disclosed herein may refer to either a DNA sequence or an RNA sequence, depending on the context in which the sequence number is referred, even if the sequence number is expressed only in DNA sequence format or RNA sequence format. For example, sequence numbers 1 through 4 are expressed in DNA sequence format (e.g., T for thymine), but they may refer to either a DNA sequence corresponding to a gRNA nucleic acid sequence or an RNA sequence of an RNA molecule nucleic acid sequence. Similarly, some sequences are expressed in RNA sequence format (e.g., U for uracil), depending on the actual type of molecule being described, but they may refer to either a sequence of an RNA molecule containing dsRNA or a sequence of a DNA molecule corresponding to the indicated RNA sequence. In any case, both DNA and RNA molecules are assumed to have sequences disclosed with any of the substitutions. [Examples]

[0602] The following examples illustrate the present invention in a non-limiting manner, in conjunction with the above description.

[0603] In general, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular techniques, biochemical techniques, microbiological techniques, and recombinant DNA techniques. Such techniques are well described in the literature; see, for example, the following."Molecular Cloning: A Laboratory Manual," Sambrook et al., (1989); "Current Protocols in Molecular Biology," Volumes I-III, edited by Ausubel, RM (1994); Ausubel et al., "Current Protocols in Molecular Biology," John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning," John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA," Scientific American Books, New York; Birren et al. (eds.), "Genome Analysis: A Laboratory Manual Series," Volumes 1-4, Cold Spring Harbor Laboratory Press, New York Methodologies as shown in U.S. Patent No. 4,666,828 (1998); U.S. Patent No. 4,683,202; U.S. Patent No. 4,801,531; U.S. Patent No. 5,192,659 and U.S. Patent No. 5,272,057; "Cell Biology: A Laboratory Handbook," Vols. I-III, Cellis, JE. (eds.) (1994); "Current Protocols in Immunology," Vols. I-III, Coligan, JE. (eds.) (1994); Stites et al. (eds.), "Basic and Clinical Immunology" (8th edition), Appleton & Lange, Norwalk, Connecticut (1994); Mishell and Shiigi (eds.), "Selected Methods in Cellular Immunology," WH Freeman and Co., New York (1980); Available immunoassays are described in detail in the patent and scientific literature.For example, see U.S. Patent No. 3,791,932; U.S. Patent No. 3,839,153; U.S. Patent No. 3,850,752; U.S. Patent No. 3,850,578; U.S. Patent No. 3,853,987; U.S. Patent No. 3,867,517; U.S. Patent No. 3,879,262; U.S. Patent No. 3,901,654; U.S. Patent No. 3,935,074; U.S. Patent No. 3,984,533; U.S. Patent No. 3,996,345; U.S. Patent No. 4,034,074; U.S. Patent No. 4,098,876; U.S. Patent No. 4,879,219; U.S. Patent No. 5,011,771 and U.S. Patent No. 5,281,521; "Oligonucleotide Synthesis", Gait, MJ (ed.) (1984); "Nucleic Acid "Hybridization," Hames, BD, and Higgins, SJ (eds.) (1985); "Transcription and Translation," Hames, BD, and Higgins, SJ (eds.) (1984); "Animal Cell Culture," Freshney, RI (ed.) (1986); "Immobilized Cells and Enzymes," IRL Press, (1986); "A Practical Guide to Molecular Cloning," Perbal, B., (1984) and "Methods in Enzymology," Vols. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications," Academic Press, San Diego, California (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual," CSHL Press (1996); all of these are incorporated by reference as they are shown herein. Other general references are provided throughout this specification.The procedures described in these documents are considered to be well known in the art, but are provided for the convenience of the reader. All information contained in the above documents is incorporated herein by reference.

[0604] General materials and experimental procedures cell culture Tissue culture is performed using human cell lines or mouse embryonic stem cells. Human osteosarcoma epithelial cells (U2OS), human retinal pigment epithelial cells (RPE1), human alveolar basal epithelial adenocarcinoma cells (A549), cervical cancer cells (HeLa), or human colorectal cancer cells (HCT116) are cultured in tissue culture medium supplemented with essential nutrients (amino acids, carbohydrates, vitamins, minerals), growth factors, and hormones as needed. These cells are cultured in a CO2 humidified incubator at a controlled temperature (37°C) under appropriate physiological and chemical conditions (pH buffer, osmotic pressure).

[0605] Survival rate assay Chemosensitivity is determined by the previously described crystal violet assay [Taniguchi et al., Cell (2002) 109:459-72]. Cells are divided into 2 × 10⁶ cells. 4 Seeds were seeded in 12-well plates at a rate of one well per well and treated with cisplatin, camptothecin (Sigma), paclitaxel (Sigma), AZD2281 (Axon Medchem), or Nutlin3 (Selleckchem) at the indicated doses. After 3 days of incubation, the monolayer was fixed with 10% methanol containing 10% acetic acid. Adherent cells were stained with 0.5% crystal violet in methanol. The absorbed dye was redissolved in methanol containing 0.1% SDS, transferred to a 96-well plate, and measured photometrically (595 nm) using a microplate reader. Cell viability was calculated by normalizing the absorbance to that of the untreated control.

[0606] The same method as above is scaled up to a format of 6-well plates or more, and the formed colonies are then measured without redissolving the crystal violet; this format is called a clonal assay. This format is based on the ability of the treated cells to grow into colonies. Another assay to use is the metabolic activity-based cell viability assay XTT or any other metabolic viability assay. XTT is a colorimetric analysis used to assess cell viability as a function of cell number based on metabolic activity. This rapid, highly sensitive, non-radioactive assay is detected using a standard microplate absorbance reader. Cells are placed in a 96-well plate in 100 μL of medium containing the compound to be tested, and 10 4 ~10 5 Cells are grown at a density of cells / well and cultured in a CO2 incubator for 24-48 hours. A fresh buffer is prepared before each assay: 10 mM PMS solution and 4 mg of XTT are dissolved in phosphate-buffered saline in 4 mL of 37°C cell culture medium. 10 μL of the above PMS solution is added to 4 mL of XTT solution immediately before labeling the cells. 25 μL of the XTT / PMS solution is added directly to each well containing 100 μL of cell culture medium, incubated in a CO2 incubator at 37°C for 2 hours, and absorbance is measured at 450 nm.

[0607] Isolation of small RNAs and miRNAs Small RNA molecules, including miRNAs, are isolated using the miRvana RNA Isolation Kit (Ambion, Austin, Texas, USA) according to the manufacturer's protocol. The RNA is quantified using a Qubit or Nanodrop spectrophotometer (Thermo Fisher, Wilmington, Delaware, USA), and quality is determined by an Agilent 6000 nanochip (Agilent Technologies, Palo Alto, California, USA).

[0608] miRNA measurement Quantitative real-time PCR analysis is performed as follows: RNA is reverse transcribed and PCR amplified using the ABI 7500 real-time PCR system with the miScript reverse transcription kit and miScript SYBR PCR kit (Qiagen, Valencia, California, USA) according to the manufacturer's protocol. Values ​​from the two reactants are averaged and normalized to the level of U6 SnoRNA. Relative expression levels are calculated according to the comparative Ct method described previously [Schmittgen and Livak. Nat Protoc (2008) 3:1101-1108]. Alternatively, miRNAs can be detected and relatively quantified using small RNA sequencing analysis [www(dot)illumina(dot)com / techniques / sequencing / rna-sequencing / small-rna-seq(dot)html or Wake et al., BMC Genomics (2016) 17(1):1].

[0609] Computation pipeline for generating GEiGS templates The Computational Genome Editing-Induced Gene Silencing (GEiGS) pipeline enables the automated generation of GEiGS DNA templates used to apply biological metadata and minimally edit non-coding RNA genes (e.g., miRNA genes), resulting in novel gain-of-function, namely the redirection of silencing capabilities to target sequences of interest.

[0610] As shown in Figure 1, the pipeline begins by filling in a) the target sequence to be silenced by GEiGS; b) the host organism to be gene-edited and to express GEiGS; and c) whether or not GEiGS will be ubiquitous, and then submitting the input. If specific GEiGS expression is required, several options can be selected (expression specific to a particular tissue, developmental stage, stress, heat / cold shock, etc.).

[0611] Once all required inputs are submitted, the computation process begins with searching among miRNA datasets (e.g., small RNA sequencing, microarrays, etc.) and filtering (i.e., retaining) only the relevant miRNAs that meet the input criteria. Next, the selected mature miRNA sequences are aligned against the target sequence, and the miRNAs with the highest complementary levels are filtered out. These naturally occurring, target-complementary mature miRNA sequences are then modified to perfectly match the target sequence. The modified mature miRNA sequences are then passed through an algorithm to predict siRNA potency, and the top 20 with the highest silencing scores are filtered out. These final modified miRNA genes are then used to generate 200-500 nt ssDNA or 250-5000 nt dsDNA sequences as follows:

[0612] 200-500 nt ssDNA oligos and 250-5000 nt dsDNA fragments are designed based on the genomic DNA sequence adjacent to the modified miRNA. The pre-miRNA sequence is located at the center of the oligo. The guide strand (silencing) sequence of the modified miRNA is 100% complementary to the target. However, the sequence of the modified passenger miRNA strand is further modified to preserve the original (unmodified) miRNA structure and maintain the same base pairing profile.

[0613] Next, a different sgRNA is designed to specifically target the original, unmodified miRNA gene, rather than a modified replacement version. Finally, a comparative restriction enzyme site analysis is performed between the modified miRNA gene and the original miRNA gene, and the differences in restriction sites are summarized.

[0614] Therefore, the pipeline output includes the following: a) 200-500 nt ssDNA oligos or 250-5000 nt dsDNA fragment sequences having minimally modified miRNAs b) Two to three different sgRNAs that specifically target the original miRNA gene, rather than modified versions. c) A list of different restriction enzyme sites between the modified miRNA gene and the original miRNA gene.

[0615] Selection of GEiGS precursors A list of non-coding RNA types that serve as dicers and are processed into small molecule silencing RNAs was manually compiled from results previously published by Rybak-Wolf A. et al. [Rybak-Wolf A. et al., Cell (2014) 159, 1153, Ai1167]. PAR-CLIP technology was used to identify RNA molecules bound by dicers and Argonaut 2 and 3. Further filtering of the dicers was performed to eliminate regions overlapping with coding genes and to remove ambiguous annotations. To exclude sequencing adapters, AGO2 and AGO3 small molecule RNA sequences were processed using cutadapt v1.7 [Martin M., EMBnet.journal (2011) 17(1):10-12]. The processed reads were then aligned to the GRCh37 assembly of the human genome using STAR v2.6.1a [Dobin A. et al., Bioinformatics (2013) 29, 15, Ai21] with the parameters "--alignIntronMax 1 --alignEndsType EndToEnd --scoreDelOpen -10000 --scoreInsOpen -10000". The graph was obtained using Integrated Genomics Viewer software [Thorvaldsdottir H. et al., Brief Bioinform (2013) 14(2):178-92].

[0616] target genes miRNAs with a ubiquitous expression profile are selected (depending on the application, miRNAs with expression profiles specific to particular tissues, developmental stages, temperature, stress, etc., may also be selected).

[0617] For example, miRNAs can be modified into siRNAs that target the GFP, p53, BAX, PUMA, and NOXA genes (see Table 1A below).

[0618] [Table 2]

[0619] siRNA design Target-specific siRNAs are designed using publicly available siRNA design tools such as Thermo Fisher Scientific's "BLOCK-iT® RNAi Designer" and Invivogen's "Find siRNA sequences."

[0620] sgRNAs design sgRNAs are designed to target endogenous miRNA genes using publicly available sgRNA design tools, as previously described by Park et al. in Bioinformatics (2015) 31(24):4014-4016. Two sgRNAs are designed for each cassette, but only one sgRNA is expressed per cell to initiate gene exchange. The sgRNA corresponds to the pre-miRNA sequence that is modified after the exchange.

[0621] To maximize the opportunity for efficient sgRNA selection, we use two different publicly available algorithms (CRISPER Design: www.crispr.mit.edu.8079 / and CHOPCHOP: www.chopchop.cbu.uib.no / ) and select the sgRNA that shows the top score from each algorithm.

[0622] Exchange ssDNA oligo design The 400b ssDNA oligo is designed based on the genomic DNA sequence of the miRNA gene. This pre-miRNA sequence is located at the center of the oligo. Next, the double-stranded siRNA sequence is replaced with the mature miRNA sequence so that the guide (silencing) siRNA strand remains 100% complementary to the target. The passenger siRNA strand sequence is modified to preserve the original miRNA structure and maintain the same base pairing profile.

[0623] Design of exchange plasmid DNA A 4000 bp dsDNA fragment is designed based on the genomic DNA sequence of the miRNA gene. The pre-miRNA sequence is located at the center of the dsDNA fragment. This fragment is cloned into a standard vector (e.g., Bluescript) and transfected into cells containing Cas9 system components. Next, the double-stranded siRNA sequence is replaced with the mature miRNA sequence so that the guide (silencing) siRNA strand remains 100% complementary to the target. The passenger siRNA strand sequence is modified to preserve the original miRNA structure and maintain the same base-pairing profile.

[0624] sgRNA sequence Human miR-150 1. CCAGCACTGGTACAAGGGTTGGG (Sequence No. 5) 2. CCAACCCTTGTACCAGTGCTGGG (Sequence No. 6)

[0625] List of endogenous miRNAs that are exchanged 1. Human miR-150 (SEQ ID NO: 13) 2. Human miR-210 (SEQ ID NO: 14) 3. Human miR-34 (SEQ ID NOs: 19-21) 5. Human Let7b (SEQ ID NO: 15) 6. Human miR-184 (SEQ ID NO: 16) 7. Human miR-204 (SEQ ID NO: 17) 8. Human miR-25 (SEQ ID NO: 18)

[0626] ssDNA oligos used in gene exchange Oligo-1:GFP-siRNA1__hsa-mir150(5'→3')(Sequence ID 1) Oligo-2:GFP-siRNA6__hsa-mir150(5'→3')(SEQ ID NO: 2) Oligo-3:TP53-siRNA1__hsa-mir150(5'→3')(Sequence ID 3) Oligo-4:TP53-siRNA2__hsa-mir150(5'→3')(Sequence ID 4) Oligo-5:TP53-siRNA1-mMIR17(5'→3')(SEQ ID NO: 243) Oligo-6:TP53-siRNA2-mMIR17(5'→3')(SEQ ID NO: 244) Oligo-7:HPRT-siRNA1-mMIR17(5'→3')(SEQ ID NO: 245) Oligo-8:HPRT-siRNA2-mMIR17(5'→3')(SEQ ID NO: 246) Oligo-9:TP53-siRNA1-mMIR21a(5'→3')(SEQ ID NO: 247) Oligo-10:TP53-siRNA2-mMIR21a(5'→3')(SEQ ID NO: 248) Oligo11:HPRT-siRNA1-mMIR21a(5'→3')(SEQ ID NO: 249) Oligo12:HPRT-siRNA2-mMIR21a(5'→3')(SEQ ID NO: 250) Oligo13:GFP-siRNA1-mMIR17(5'→3')(SEQ ID NO: 251) Oligo14:GFP-siRNA1-mMIR21a(5'→3')(SEQ ID NO: 252)

[0627] sgRNA cloning The transfection plasmid used consists of four modules, including the following: 1) mCherry driven by a CMV promoter terminated by a BGH poly(A) signal termination sequence; 2) Cas9 (human codon optimization) driven by an EF1a core promoter terminated by a BGH poly(A) signal termination sequence; 3) pol III(U6) promoter sgRNA for guide 1;

[0628] Plasmid design For transient expression, a plasmid containing three transcription units is used. The first transcription unit contains an EF1a core promoter and a BGH poly(A) signaling 35S terminator that drive Cas9 expression. The next transcription unit consists of a CMV promoter and a BGH poly(A) signaling terminator that drive mCherry expression. The third contains a pol III(U6) promoter that expresses an sgRNA to target a miRNA gene (each vector contains a single sgRNA).

[0629] Design and cloning of CRISPR / CAS9 for introducing SWAP targeting miR-173 and miR-390, and targeting GFP, AtPDS3, and AtADH1. For proof of concept, the inventors designed to modify the sequences of mature miR-173 and miR-390 in a genomic context to target GFP, AtPDS3, or AtADH1 (in plant cells) by generating small RNA molecules that are inversely complementary to the target genes. Furthermore, further modifications were made to the pri-miRNA to maintain the secondary structure of the miRNA precursor transcript (Table 2 below). These fragments were cloned into a PUC plasmid and named the donor, and the DNA fragments were referred to as SWAPs. Regarding the sequences for modifying miR-173, SWAP1 and SWAP2 target GFP, SWAP3 and SWAP4 target AtPDS3, and SWAP9 and SWAP10 target AtADH1 (see Table 2 below). Regarding the sequences for modifying miR-390, SWAP5 and SWAP6 target GFP, SWAP7 and SWAP8 target AtPDS3, and SWAP11 and SWAP12 target AtADH1 (see Table 2 below).

[0630] Guide RNAs targeting miR-173 and miR-390 were introduced into a CRISPR / CAS9 vector system to induce DNA breaks at the desired miRNA loci. These were then co-introduced into plants along with a donor vector using a gene shock protocol, and the desired modifications were introduced via homologous DNA repair (HDR). These guide RNAs are identified in Table 2 below.

[0631] [Table 3(1)]

[0632] [Table 3(2)]

[0633] [Table 3(3)]

[0634] [Table 3(4)]

[0635] Plasmid transfection For transfection, use Lipofectamine® 2000 transfection reagent (or any other) according to the manufacturer's protocol. In summary, this is as follows: Regarding adherent cells: To ensure that the cells reach 90-95% confluence at the time of transfection, apply 0.5-2 × 10⁶ cells one day before transfection. 5 Plate the cells into 500 μl of antibiotic-free growth medium.

[0636] Regarding suspension cells: Immediately before preparing the complex, 4-8 × 10⁶ cells in 500 μl of growth medium. 5 The cells are plated without the use of antibiotics.

[0637] For each transfection sample, prepare the complex as follows: a) Dilute the DNA in 50 μl of serum-free Opti-MEM® I Reduced Serum Medium (or other serum-free medium) and mix slowly. b) Slowly mix Lipofectamine® 2000 before use, then dilute an appropriate amount in 50 μl of Opti-MEM® I Medium and incubate at room temperature for 5 minutes. Note that step c must be completed within 25 minutes. c) After 5 minutes of incubation, combine the diluted DNA with diluted Lipofectamine® 2000 (total volume = 100 μl), mix slowly, and incubate at room temperature for 20 minutes (the solution may appear cloudy). Note that this complex is stable at room temperature for 6 hours. d) Add 100 μl of this complex to each well containing cells and medium and mix slowly by shaking the plate back and forth. e) Before testing for transgene expression, incubate the cells in a CO2 incubator at 37°C for 18–48 hours. The culture medium may be changed after 4–6 hours.

[0638] FACS sorting of fluorescent protein-expressing cells Forty-eight hours after plasmid / RNA delivery, cells were collected and screened for fluorescent protein expression (e.g., mCherry) using a flow cytometer, and fluorescent protein / editor-expressing cells were enriched as previously described [Chiang et al., Sci Rep (2016) 6:24356]. This enrichment step bypasses antibiotic selection and allows for the collection of only cells transiently expressing the fluorescent protein, Cas9, and sgRNA. These cells can be further tested for target gene editing by HR events and subsequent efficient silencing of the target gene, i.e., GFP.

[0639] Impact and plant regeneration Arabidopsis thaliana root preparation Chlorine gas-sterilized Arabidopsis thaliana (cv. Col-0) seeds were sown on MS-minus sucrose plates, vernalized in the dark at 4°C for 3 days, and then germinated vertically in constant light at 25°C. After 2 weeks, roots were cut into 1 cm sections and placed on Callus Induction Media (CIM: 1 / 2 MS containing vitamin B5, 2% glucose, pH 5.7, 0.8% agar, 2 mg / l IAA, 0.5 mg / l 2,4-D, and 0.05 mg / l kinetin) plates. After incubation in the dark at 25°C for 6 days, the root sections were transferred to filter paper discs and placed on CIMM plates (1 / 2 MS without vitamin B5, 2% glucose, 0.4 M mannitol, pH 5.7, and 0.8% agar) for 4-6 hours to protect from impact.

[0640] impact The plasmid construct was introduced into root tissue via PDS-1000 / He particle delivery (Bio-Rad; PDS-1000 / He system #1652257), and several preparation steps outlined below were necessary to carry out this procedure.

[0641] Preparation of gold stock materials 40 mg of 0.6 μm gold (Bio-Rad; catalog: 1652262) was mixed with 1 ml of 100% ethanol, and the mixture was pulsed centrifugally to form a pellet, after which the ethanol was removed. This washing procedure was repeated two more times.

[0642] After washing, the pellets were resuspended in 1 ml of sterile distilled water and dispensed into 1.5 ml tubes as 50 μl aliquots for working volume.

[0643] Bead preparation In short, I did the following: A single tube was sufficient to strike two plates of Arabidopsis thaliana roots (two shots per plate), and therefore each tube was distributed between four Biolistic rupture plates (Bio-Rad; catalog: 1652329) at 1,100 psi (approximately 7.6 MPa).

[0644] Since the impact required multiple plates of the same sample, the tubes were combined, and the volumes of DNA and CaCl2 / spermidine mixture were adjusted accordingly to maintain sample consistency and minimize the overall preparation.

[0645] The following protocols summarize the process of preparing one tube of gold, and these should be adjusted according to the number of tubes of gold to be used.

[0646] All subsequent processes were carried out at 4°C in an Eppendorf thermomixer.

[0647] Plasmid DNA samples were prepared, with each tube containing 11 μg of DNA added at a concentration of 1000 ng / μl. 1) 493 μl of ddH2O was added to 1 aliquot (7 μl) of spermidine (Sigma-Aldrich; S0266) to obtain a final concentration of 0.1 M spermidine. 1250 μl of 2.5 M CaCl2 was added to the spermidine mixture, vortexed, and placed on ice. 2) The pre-prepared gold tube was placed in a thermomixer and rotated at a speed of 1400 rpm. 3) Add 11 μl of DNA to the tube, vortex, and return to the rotating thermomixer. 4) To bind the DNA / gold particles, 70 μl of spermidine CaCl2 mixture was added to each tube (in a thermomix). 5) Vigorously vortex the tube for 15-30 seconds, then place it on the ice for approximately 70-80 seconds. 6) The mixture was centrifuged at 7000 rpm for 1 minute, the supernatant was removed, and the mixture was placed on ice. 7) 500 μl of 100% ethanol was added to each tube, the pellet was resuspended by pipetting, and vortexed. 8) The tube was centrifuged at 7000 rpm for 1 minute. 9) Remove the supernatant, resuspend the pellet in 50 μl of 100% ethanol, and store on ice.

[0648] Macrocarrier Preparation The following was done inside the laminar flow cabinet: 1) The macro carrier (Bio-Rad; 1652335), stop screen (Bio-Rad; 1652336), and macro carrier disc holder were sterilized and dried. 2) The macro carrier was placed flat in the disk holder of the macro carrier. 3) The DNA-coated gold mixture was vortexed and spread to the center of each biolytic rupture plate (5 μl). The ethanol was evaporated.

[0649] PDS-1000 (Helium Particle Delivery System) In short, I did the following: The helium bottle's regulating valve was adjusted to an inflow pressure of at least 1300 psi (approximately 9.0 MPa). A vacuum was created by pressing the vacuum / vent / hold switch and holding down the operate switch for 3 seconds. This ensured that helium flowed into the piping.

[0650] A burst disc with a pressure of 1100 psi (approximately 7.6 MPa) was placed in isopropanol and mixed to remove static electricity. 1) One ruptured disk was placed inside the disk retaining cap. 2) A microcarrier launch assembly was constructed (equipped with a stop screen and gold-containing microcarriers). 3) Arabidopsis thaliana root callus was placed 6 cm below the launch assembly on a petri dish. 4) Set the vacuum pressure to 27 inches Hg (mercury) (approximately 91 kPa) and open the helium valve (to approximately 1100 psi (approximately 7.6 MPa)). 5) The vacuum was released. The microcarrier launch assembly and rupture disc retaining cap were removed. 6) Impact on the same tissue (i.e., each plate was impacted twice). 7) Next, the impacted roots were placed on a CIM plate in a dark place at 25°C for a further 24 hours.

[0651] Simultaneous impact When shocking a combination of GEiGS plasmids, 5 μg (1000 ng / μl) of sgRNA plasmid was mixed with 8.5 μg (1000 ng / μl) of swap plasmid, and 11 μl of this mixture was added to the sample. When shocking multiple GEiGS plasmids simultaneously, the concentration ratio of sgRNA plasmid to swap plasmid used was 1:1.7, and 11 μg (1000 ng / μl) of this mixture was added to the sample. When simultaneously shocking plasmids not related to GEiGS exchange, equal ratios were mixed, and 11 μg (1000 ng / μl) of the mixture was added to each sample.

[0652] plant regeneration For shoot regeneration, a modified protocol from Valvekens et al. [Valvekens, D. et al., Proc Natl Acad Sci USA (1988) 85(15):5536-5540] was implemented. The impacted roots were placed on a 1 / 2 MS plate containing vitamin B5, 2% glucose, pH 5.7, 0.8% agar, 5 mg / l 2 iP, and 0.15 mg / l IAA. The plate was left in a 16-hour light cycle at 25°C followed by an 8-hour dark cycle at 23°C. After 10 days, the plate was transferred to an MS plate containing 3% sucrose and 0.8% agar for one week, and then to a fresh, similar plate. Once the plants had regenerated, they were excised from the roots and placed on an MS plate containing 3% sucrose and 0.8% agar until analysis.

[0653] Phenotype analysis As described above, this is done by observing fluorescence, cell morphology, or other phenotypes such as growth rate / inhibition and / or apoptosis dependent on the target gene, or, in the case of TP53 silencing, Nutlin3 resistance.

[0654] Antiviral assay The assay is based on cytopathic effect (CPE), a commonly used test to determine the potency of purified interferon stock solutions. The CPE assay measures antiviral activity based on the ability to inhibit virus-induced cytopathology, as measured by crystal violet live cell staining [previously described by Rubinstein et al., J Virol. (1981) 10:755-758].

[0655] VSV forms dispersed, microscopic lysis plaques in static culture of WISH amniotic cell lines. Microlysis plaque formation is rapid, reproducible, easily quantifiable, occurs at temperatures in the range of 33–40°C, and does not require a semi-solid overlay.

[0656] Allyl alcohol selection To select plants with allyl alcohol, roots were placed on SIM medium 10 days after shock. The roots were immersed in 30 mM allyl alcohol (Sigma-Aldrich, USA) for 2 hours. Next, the roots were washed three times with MS medium and placed on MS plates containing 3% sucrose and 0.8% agar. The regeneration process was carried out as described above.

[0657] Genotype determination Plant tissue samples were processed, and amplicons were amplified according to the manufacturer's recommendations. The MyTaq Plant-PCR Kit (BioLine BIO 25056) was used for short internal amplification, and the Phire Plant Direct PCR Kit (Thermo Scientific; F-130WH) was used for long external amplification. The oligonucleotides used for these amplifications are identified in Table 2 above. Different modifications at the miRNA locus were identified through different digestion patterns of the amplicons, as described below.

[0658] Regarding the modification of miR-390, the internal amplicon was 978 base pairs long, while the external amplification was 2629 base pairs long. For the identification of swap7, digestion with NlaIII resulted in a fragment size of 636 base pairs, but in the wt version, it was cleaved into fragments of lengths 420 and 216. For the identification of swap8, digestion with Hpy188I resulted in fragment sizes of 293 and 339 base pairs, but in the wt version, this site was absent, resulting in a fragment of length 632. For the identification of swap11 and 12, digestion with BccI resulted in a fragment size of 662 base pairs, but in the wt version, it was cleaved into fragments of lengths 147 and 417.

[0659] Regarding the modification of miR-173, the internal amplicon was 574 base pairs long, while the nested external amplification was 466 base pairs long. For the identification of swap3, digestion with BslI resulted in fragment sizes of 217 and 249 base pairs in the external amplicon, and fragment sizes of 317 and 149 base pairs in the internal amplicon. In the wt version, this site was absent, resulting in a 466-base-pair fragment in the external amplicon and a 574-base-pair fragment in the internal reaction. For the identification of swap4, digestion with BtsαI resulted in fragment sizes of 212 and 254 base pairs in the external amplicon, and fragment sizes of 212 and 362 base pairs in the internal amplicon. In the wt version, this site was absent, resulting in a 466-base-pair fragment in the external amplicon and a 574-base-pair fragment in the internal reaction. Regarding the identification of swap9, digestion by NlaIII produced fragment sizes of 317 and 149 base pairs in the outer amplicon, and fragment sizes of 317 and 244 base pairs in the inner amplicon. In the wt version, this site was absent, resulting in a 466-base-length fragment in the outer amplicon and a 561-base-length fragment in the inner reaction. Regarding the identification of swap10, digestion by NlaIII produced fragment sizes of 375 and 91 base pairs in the outer amplicon, and fragment sizes of 375 and 186 base pairs in the inner amplicon. In the wt version, this site was absent, resulting in a 466-base-length fragment in the outer amplicon and a 561-base-length fragment in the inner reaction.

[0660] Isolation of DNA and RNA Plant samples were collected in liquid nitrogen and stored at -80°C until processing. Tissue grinding was performed in a tube placed in dry ice using a plastic tissue grinding pestle (Axygen, USA). DNA and total RNA were isolated from the ground tissue using an RNA / DNA purification kit (catalog no. 48700; Norgen Biotek Corp., Canada) according to the manufacturer's instructions. For low RNA fractions with a 260 / 230 ratio (<1.6), isolated RNA was precipitated overnight at -20°C using 1 μl glycogen (catalog 10814010; Invitrogen, USA), 10% V / V sodium acetate, 3M pH 5.5 (catalog AM9740; Invitrogen, USA) and 3 times the volume of ethanol. The solution was centrifuged at maximum speed for 30 minutes at 4°C. Subsequently, the samples were washed twice with 70% ethanol, air-dried for 15 minutes, and resuspended in nuclease-free water (catalog number 10977035; Invitrogen, USA).

[0661] Reverse transcription (RT) and quantitative real-time PCR (qRT-PCR) 1 μg of isolated total RNA was treated with DNase I according to the manufacturer's instructions (AMPD1; Sigma-Aldrich, USA). This sample was reverse transcribed according to the instructions for the High-Capacity cDNA Reverse Transcription Kit (catalog 4368814; Applied Biosystems, USA).

[0662] For gene expression analysis, quantitative real-time PCR (qRT-PCR) analysis was performed using the CFX96 Touch® Real-Time PCR Detection System (BioRad, USA) and SYBR® Green JumpStart® Taq ReadyMix® (S4438, Sigma-Aldrich, USA) according to the manufacturer's protocol and analyzed with the Bio-Rad CFX Manager program (version 3.1). For the analysis of AtADH1 (AT1G77120), the following primer sets were used: forward GTTGAGAGTGTTGGAGAAGGAG SEQ ID NO: 237 and reverse CTCGGTGTTGATCCTGAGAAG SEQ ID NO: 238. For the analysis of AtPDS3 (AT4G14210), the following primer sets were used: forward GTACTGCTGGTCCTTTGCAG SEQ ID NO: 239 and reverse AGGAGCACTACGGAAGGATG SEQ ID NO: 240. For the endogenous calibration gene, the 18S ribosomal RNA gene (NC_037304) was used - forward ACACCCTGGGAATTGGTTT SEQ ID NO: 241 and reverse GTATGCGCCAATAAGACCAC SEQ ID NO: 242.

[0663] Example 1A Genome editing-induced gene silencing (GEiGS) platform MicroRNAs (miRNAs) are small, endogenous non-coding RNAs (ncRNAs) ranging from 20 to 24 nucleotides in length, derived from long, self-complementary precursors. Mature miRNAs regulate gene expression in two ways: (i) by inhibiting translation, or (ii) by degrading coding mRNA through complete or near-complete complementation with target mRNA. In animals, important studies on miRNAs have shown that only the seed region (the sequence spanning positions 2-8 at the 5' end) is crucial for target recognition. This seed sequence pairs well with its response sequence, primarily in the 30-untranslated region (UTR) of the target mRNA. Changes in miRNA biosynthesis mechanisms, miRNA expression levels, and the miRNA regulatory network affect important biological pathways such as cell differentiation and apoptosis, and these changes are detected in various human diseases and syndromes, particularly cancer.

[0664] All tumors exhibit specific traces of altered miRNA expression. For this reason, tumor miRNA expression profiles may represent valid and useful biomarkers for diagnosis, prognosis, patient stratification, risk group definition, and monitoring of therapy response. Equally relevant is the emerging role of miRNA in viral infection. Data from the literature show interaction between viral and host cell miRNA mechanisms. For example, viruses may disrupt host cell miRNA pathways by interacting with certain proteins, synthesizing their own miRNAs to alter the cellular environment, regulating their own mRNA, or utilizing cellular miRNAs to their advantage. However, it can also be said that host cell miRNAs may target viral mRNA. Often, this bidirectional interference resolves in the virus's favor, allowing it to evade the immune response and complete its replication cycle.

[0665] Accordingly, the inventors use endogenous ncRNA sequences (e.g., miRNAs) that are redesigned by homologous recombination (HR) using GEiGS to acquire silencing functionality in order to specifically silence any RNA of interest. To replace the selected sequence, HR utilizes longer-extended sequence homology adjacent to the DSB site to repair DNA damage, and therefore HR is considered a precise mechanism for DSB repair because higher sequence homology between the damaged DNA strand and the intact donor strand (i.e., the inserted siRNA sequence) is required. This process is considered error-free if the DNA template used for repair is identical to the original DNA sequence at the DSB, or this process can introduce highly specific mutations into the damaged DNA, e.g., swapping genes.

[0666] Example 1B Genome editing-induced gene silencing (GEiGS) Designing GEiGS oligos requires a template non-coding RNA molecule (precursor) that is processed to produce a derivative small silencing RNA molecule (mature). As previously discussed in Rybak-Wolf [Rybak-Wolf, A. et al., Cell (2014) 159:1153, Ai1167], the inventors have characterized the dicer substrate RNA (i.e., cellular RNA bound by dicers) that generates small RNAs involved in silencing (i.e., small RNAs bound by Argonaut 2 and Argonaut 3) in humans and Elegans nematodes. By crossing both datasets (dicer-bound RNA and Ago2 and Ago3-bound small RNAs), it was possible to generate a list of non-coding RNAs that are precursors to small silencing RNAs (Figures 10 and 11A-E). Two sources of precursors and their corresponding mature sequences were used to generate GEiGS oligos. For miRNAs, sequences were obtained from the miRBase database [Kozomara, A. and Griffiths-Jones, S., Nucleic Acids Res (2014) 42:D68, AiD73]. Other types of precursors (including tRNAs, snRNAs, and various types of repeats) were obtained from recent publications describing Dicer-binding and AGO-binding RNAs [Rybak-Wolf, A. et al., Cell (2014) 159:1153, Ai1167].

[0667] Silencing targets were selected in various host organisms. siRNAs were designed for these targets using siRNArules software [Holen, T., RNA(2006) 12:1620, Ai1625]. Each of these siRNA molecules was used to replace the mature sequence present in each precursor, generating "naive" GEiGS oligos. The structures of these naive sequences were adjusted to closely resemble the wild-type precursor structure using ViennaRNA Package v2.6 [Lorenz, R. et al., ViennaRNA Package 2.0. Algorithms for Molecular Biology(2011) 6:26]. Examples of successful versus unsuccessful structural maintenance can be seen in Figures 12A-D. After structural adjustment, the sequence number and secondary structural changes between the wild-type and modified oligos were calculated. These calculations are essential for identifying potentially functional GEiGS oligos that require minimal sequence changes relative to the wild-type (Figures 12A-E).

[0668] CRISPR / Cas9 small molecule guide RNA (sgRNA) for wild-type precursors was generated using CasOT software [Xiao, A. et al., Bioinformatics (2014) 30:1180, Ai1182]. The modification applied to generate the GEiGS oligo affected the PAM region of the sgRNA, and sgRNAs that rendered this region ineffective for the modified oligo were selected.

[0669] Example 2 GEIGS of "endogenous" transgenes A rapid and robust approach to confirming the efficiency of GEiGS is to silence the transgene, which will function as an endogenous gene and also be a marker gene such as GFP (green fluorescent protein). There are several options for evaluating the effectiveness of GFP silencing in cells, and we use FACS analysis, RT-qPCR, and microscopy to evaluate the effectiveness of GFP silencing in cells.

[0670] GFP silencing is well-characterized, and many small interfering RNA sequences (siRNAs) are available that are efficient at inducing GFP silencing. Therefore, for gene swapping, we use 21-mer siRNA molecules designed to silence GFP. In addition, or alternatively, we use publicly available algorithms that predict which siRNAs are effective in initiating gene silencing for a given gene (e.g., GFP). Since the predictions of these algorithms are not 100%, we use only sequences that are the result of at least two different algorithms.

[0671] To use siRNA sequences to silence GFP genes, the inventors use a CRISPR / Cas9 system to replace them with known endogenous miRNA gene sequences. Many databases of characterized miRNAs exist. The inventors have selected several known human miRNAs with different expression profiles (e.g., low constitutive expression, high expression, stress-induced, etc.). To replace the endogenous miRNA sequences with siRNA, the inventors use an HR approach.

[0672] As shown in Figure 2, using HR, the inventors envision two options: 1) using a donor ssDNA oligo sequence of approximately 200-500 nt containing a replacement siRNA sequence in the center, or 2) changing to a 2 × 21 bp miRNA and GFP siRNA. * Use a plasmid that expresses a 1Kb-4Kb insertion that is nearly 100% identical to the surrounding miRNA in the genome, except for the miRNA (500-2000 bp upstream and downstream of the siRNA). Transfection involves several constructs: CRISPR:Cas9 / GFP sensor (which tracks and enriches positive transformed cells), gRNA (which induces Cas9 to produce DSBs that are repaired by HR, depending on the insertion vector / oligo).

[0673] The insertion vector contains two homologous contiguous regions surrounding a target gene locus that has been substituted (e.g., miRNA) and modified to carry the desired mutation (i.e., siRNA). When plasmids are used, the targeting construct is used as a template for homologous recombination, which ends with the exchange of miRNA with the selected siRNA. After transfection into tissue culture cells, positive Cas9 / sgRNA transfect events are enriched using FACS, and cells are scored for GFP silencing under a microscope (as shown in Figure 2). Positively edited cells are expected to produce siRNA sequences targeting the GFP gene, and therefore, GFP expression of the transgene is expected to be silenced compared to control cells.

[0674] To demonstrate proof of concept (POC) of GFP silencing using GEiGS, we utilize transgenic human cell lines expressing GFP (including U2OS, RPE1, A549, or HeLa cells). The cells are transfected using the GEiGS methodology with a cassette that replaces endogenous non-coding RNA (e.g., miRNA) with a non-coding RNA that is processed into GFP-targeting siRNA to initiate the RNA silencing mechanism against GFP. As shown in Figures 3A-B, knockdown of GFP gene expression levels in human cells results in reduced GFP expression in cells expressing siGFP (i.e., GFP is silenced) compared to control cells (Figure 3A).

[0675] Example 3 GEiGS of exogenous transgenes (GFP) in tissue culture cells In addition to the aforementioned example of GFP silencing (Example 2 above), another method to demonstrate the efficiency of GEiGS is to silence marker genes such as GFP in a transient GFP transfection assay. As shown in Figure 4, human cells are treated with GEiGS to redirect the silencing specificity of endogenous miRNAs via the expression of a small molecule siRNA targeting the GFP gene (as discussed in Example 2 above). Next, untreated control cells and GEiGS-GFP cells (i.e., expressing siGFP) are transfected separately with plasmids expressing two markers (sensors) GFP+RFP (red fluorescent protein). Cells that express only RFP but not GFP in GEiGS treatment are a result of GFP gene silencing due to siGFP expression. DNA from these cells (red but lacking GFP expression) is extracted and examined for the exact genome editing event. Furthermore, these cells can be analyzed for loss of GFP expression by, for example, fluorescence detection of GFP, or by q-PCR, HPLC.

[0676] Example 4 GEiGS expressing TP53 or HPRT inhibits Nutlin3 induction or 6TG (thioguanine, 6-TG, 6-thioguanine) cell death / proliferation in U2OS and RPE1 or mouse embryonic stem (mES) cells. To demonstrate the proof of clinical course (POC) of GEiGS in human cells, the inventors have investigated using U2OS, RPE1, or mouse embryonic stem cells. U2OS are rapidly growing cells that are highly efficient and easily transfected. These cells are derived from bone cancer - osteosarcoma. RPE1 are epithelial cells derived from normal retina (i.e., not from diseased or diseased cultures) and, like mES, possess normal and active TP53.

[0677] TP53 is a tumor suppressor protein that directly or indirectly induces apoptotic cell death in response to carcinogenic stress. The consequences of DNA damage depend on the cell type and the severity of the damage. Mild DNA damage may or may not be repaired with cell cycle arrest. More severe and irreparable DNA damage leads to the appearance of mutated cells or triggers a shift toward the induction of senescence or cell death programs. For many years, it was claimed that DNA damage killed cells via apoptosis or necrosis, but technological and methodological advances in recent years have helped to reveal that this damage can also activate death through autophagy or mitotic death, which can lead to apoptosis or necrosis. The molecular basis underlying this decision-making process is now the subject of intensive study.

[0678] Today, anyone interested in cancer research is already well aware of the existence of TP53 and its relevance to virtually every aspect of tumor biology. TP53 is undoubtedly one of the most extensively studied genes and proteins. Early studies have shown that transactivation-deficient mutants of p53 can induce apoptosis, implying a non-transcriptional, transcription-dependent role of p53 in apoptosis. DNA damage leads to mitochondrial translocation of TP53. TP53 binds to the Bcl-2 family protein Bcl-xL and influences cytochrome c release. In the absence of other proteins, TP53 directly activates the pro-apoptotic Bcl-2 protein Bax, allowing mitochondria to permeate and participate in the apoptotic program. TP53 can release both pro-apoptotic multidomain proteins and BH3-only proteins sequestered by Bcl-Xl. In addition, TP53 can mediate the mitochondrial mechanism of apoptosis by facilitating Bax oligomerization and binding to Bcl-xL rather than Bax. The TP53-Bcl-xL interaction releases Bax, which then forms oligomers in the mitochondrial membrane, leading to cytochrome c release and apoptosis (this effect requires the proline-rich domain of TP53, aa62-91 in mice) [Jerry et al. Science (2004) 303(5660):1010-4]. TP53 also acts as a transcription factor that promotes the expression of apoptosis-promoting genes such as BAX, PUMA, and NOXA.

[0679] As shown in Figure 5, the inventors have modified RPE1 cells to express siRNA directed to TP53, and these cells exhibit inhibition of cell death when exposed to Nutlin3 or chemotherapy (e.g., camptothecin (CPT), etoposide, olaparib, etc.). One of the assays used by the inventors is the crystal violet assay, which allows for comparison of the different cell numbers (densities) and morphologies of healthy and dying cells by cell staining. Cell clones resistant to cell death are verified for the correct genome editing event and the expression of the associated TP53 siRNA. Furthermore, these cells can be analyzed for loss of TP53 expression by, for example, GFP fluorescence detection, q-PCR, or HPLC.

[0680] Thioguanine, also known as thioguanine or 6-thioguanine (6-TG), is a commonly used drug (pharmacotherapy) to treat acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), and chronic myeloid leukemia (CML). A metabolite, thioguanine is a purine analog of guanine and works by disrupting DNA and RNA. 6-thioguanine is a naturally occurring thio analog of the purine base guanine. 6-thioguanine is converted to 6-thioguanosine monophosphate (TGMP) using the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRTase / HPRT). High concentrations of TGMP can accumulate inside cells and potentially interfere with guanine nucleotide synthesis via the enzyme inosine monophosphate dehydrogenase (IMP dehydrogenase). TGMP is converted to thioguanosine diphosphate (TGDP) and thioguanosine triphosphate (TGTP) by phosphorylation. Simultaneously, deoxyribosyl analogs are formed via the enzyme ribonucleotide reductase. TGMP, TGDP, and TGTP are collectively named 6-thioguanine nucleotide (6-TGN). 6-TGN is cytotoxic to cells by (1) integration into DNA during the synthetic phase (S phase) of the cell, and by (2) inhibition of the GTP-binding protein (G protein) Rac1, which regulates the Rac / Vav pathway. Additional effects can be induced from the integration of 6-thioguanine into RNA, resulting in modified RNA strands that cannot be read by ribosomes.

[0681] In short, loss or reduction of HPRT gene expression makes cells resistant to 6TG. Therefore, we are analyzing the downregulation of HPRT by modifying HPRT gene expression through the expression of siRNA directed towards HPRT and thereby increasing resistance to 6TG.

[0682] Example 5 GEiGS, a gene for pro-apoptosis (BAX, PUMA, NOXA), inhibits chemotherapy-induced cell death in human cancer cells. In this experiment, the inventors used U2OS cells. To create cells resistant to chemotherapeutic agents such as CPT, etoposide, and olaparib, the inventors first used siRNAs that can target apoptotic genes such as BAX, PUMA, and NOXA, which are known as pro-apoptotic genes.

[0683] As shown in Figure 6, the inventors treated U2OS cells using GEiGS to express siRNA targeting apoptotic genes. Modified cells expressing siRNA are expected to be resistant to chemotherapy (e.g., CPT, etoposide, olaparib, etc.)-induced cell death. After transfection using a GEiGS cassette + RFP sensor, the transfected cells were enriched using FACS and exposed to chemotherapeutic agents. In the control group, all cells were susceptible and either died or entered senescence (easily detectable under a microscope using Dapi staining, with very few cells having large nuclei). Clones resistant to cell death and / or senescence are expected to actively express the edited siRNA and are verified to have accurate genome editing modifications and associated siRNA expression. Furthermore, these cells can be analyzed for loss of expression of apoptotic genes such as BAX, PUMA, and NOXA by, for example, GFP fluorescence detection or q-PCR, HPLC.

[0684] Example 6 Using GEiGS to immunize human cells against viral infections To demonstrate that GEiGS is a robust method for human immunization with the ability to knock down foreign pathogenic genes, the inventors provide an example of viral gene silencing. Lentiviral systems are highly effective in delivering genetic material to entire model organisms and almost all mammalian cells (including non-dividing, non-proliferating cells), as well as to difficult-to-transfect cells (including nerve cells, primary cultured cells, and stem cells). The efficiency of lentiviral transfection is close to 100% depending on the degree of infection (MOI), which makes lentiviruses ideal as expression vector systems.

[0685] Control cells infected with a lentivirus expressing GFP show GFP expression under a microscope (as shown in Figure 7). GEiGS-GFP cells manipulated to express siRNA targeting the GFP gene (as shown in Example 2 above) are expected to show a decrease in GFP levels (as shown in Figure 7). Generating GEiGS cells with no or low GFP gene expression after infection with viral GFP (e.g., Lenti-GFP) demonstrates that exogenous gene silencing has been achieved and that GEiGS is an effective method for immunizing human cells against invasive infectious RNAs such as viruses.

[0686] There are several simple options for evaluating the effectiveness of GFP gene silencing in cells, and the inventors have used FACS analysis, RT-qPCR, microscopy, and / or immunoblotting. Therefore, for gene exchange, the inventors designed a 21-mer siRNA molecule (as described in Example 2 above). The inventors used a publicly available algorithm to predict which siRNA would be effective in initiating gene silencing for a given gene (as described in Example 2 above).

[0687] Example 7 Immunizing human cells against viral infection by silencing foreign viral genes (cell viability assay) In addition to the example using a GFP-expressing lentivirus (Example 6 above) to demonstrate that GEiGS has the ability to knock down foreign genes and is a robust method for human immunization, the inventors have also used wild-type RNA virus infection and scored cell viability. The inventors provide an example of silencing the vesicular stomatitis virus (VSV) gene.

[0688] VSV, a rhabdoviridae RNA virus, can infect many cell types and is therefore a common experimental virus used to study the characteristics of rhabdoviridae viruses and to study viral evolution. VSV is an arbovirus, and its replication occurs in the cytoplasm. The VSV genome is a single molecule of 11,161-nucleotide negative-strand RNA encoding five major proteins: G protein (G), L protein (L), phosphorylated protein, matrix protein (M), and nucleoprotein. In healthy human cells, this virus cannot reproduce (presumably due to the interferon response), but in many cancer cells (where the interferon response is reduced), VSV can grow and therefore lyse cancerous cells. As detailed in the "General Materials and Experimental Procedures" section above, a functional antiviral assay based on cytopathic effects (CPE) is used to determine cell viability. This method makes it possible to evaluate and compare cell viability and survival rates. By staining the cells, it is possible to compare the different cell numbers, densities, and morphologies of healthy and dying cells.

[0689] To identify efficient siRNAs targeting the VSV gene, preliminary experiments will be conducted using different transfections of viral gene-targeting siRNAs. Human WISH cells will be edited to express siRNAs that inhibit VSV-induced cell death, in conjunction with GEiGS cells. VSV-infected control cells will exhibit cytopathological effects, as measured by crystal violet, compared to GEiGS cells, which are expected to be resistant to viral infection.

[0690] Example 8 GEiGS, which expresses the pro-apoptotic FAS gene, reduces 5-fluorouracil-induced apoptosis in HCT116 cells. Pedro et al. [Pedro et al. Biochimica et Biophysica Acta (2007) 1772:40-47] previously showed that silencing FAS expression by RNA interference mitigates 5-FU-induced apoptosis in HCT116 human colorectal cancer cells expressing wild-type p53.

[0691] HCT116 cells are treated with GEiGS to express siRNA targeting the FAS gene. HCT116 control and GEiGS-positive cells (expressing FAS siRNA) are treated with 5-FU (e.g., 1-8 μM) for e.g., 8-48 hours. Cell viability is assessed by XTT and trypan blue dye exclusion. Apoptosis is assessed by changes in nuclear morphology and caspase-3 activity. Although 5-FU is cytotoxic in HCT116 cells, it is expected that 5-FU-mediated nuclear fragmentation and caspase-3 activity will be significantly reduced when Fas is inhibited using siRNA.

[0692] Example 9 Generation of plants with modified endogenous miRNAs targeting different genes Even slight alterations to the recognition sequence (which will mature into a miRNA) at the genomic locus of a miRNA can lead to a new system regulating the new gene in a non-transgenic manner. Therefore, to introduce these alterations by shocking Arabidopsis thaliana roots, and for their regeneration for further analysis, we used an Agrobacterium-free transient expression method. We selected two genes, PDS3 and ADH1, to target in the Arabidopsis thaliana plant.

[0693] Carotenoids play a crucial role in many physiological processes in plants, and the phytoendesaturase gene (PDS3) encodes one of the key enzymes in the carotenoid biosynthesis pathway; its silencing results in albino / decolorized phenotypes. Therefore, plants with reduced PDS3 expression exhibit decreased chlorophyll levels, to the point of complete albino and dwarfism.

[0694] Alcohol dehydrogenase (ADH1) is a group of dehydrogenase enzymes that catalyze the interconversion between alcohols and aldehydes or ketones, while simultaneously reducing NAD+ or NADP+. The primary metabolic purpose of these enzymes is the degradation of alcoholic toxic substances in tissues. Plants with reduced ADH1 expression exhibit increased tolerance to allyl alcohols. Therefore, plants with reduced ADH1 are resistant to the toxic effects of allyl alcohols, and their regeneration was carried out using allyl alcohol selection.

[0695] Two well-established miRNAs, miR-173 and miR-390, were selected for modification, and these have previously been shown to be expressed throughout plant development [Zielezinski A et al., BMC Plant Biology (2015) 15:144]. A two-component system was used to introduce the modifications. First, using the CRISPR / CAS9 system, cleavage was generated at the miR-173 and miR-390 loci via a specific guide RNA designed (Table 2 above) to promote homologous DNA repair (HDR) at that site. Second, an A donor (DONOR) sequence with the desired modification of the miRNA sequence to target the newly assigned gene was introduced as a template for HDR (Table 2 above). Furthermore, since the secondary structure of the primary transcript of miRNA (pri-miRNA) is important for the accurate biosynthesis and activity of mature miRNA, further modifications were introduced into the complementary strand of pri-miRNA and analyzed in mFOLD (www(dot)unafold(dot)rna(dot)Albany(dot)edu) for structural preservation (data not shown). Overall, two guides were designed for each miRNA locus, and two different donor sequences (modified miRNA sequences) were designed for each gene (Table 2 above).

[0696] Example 10 Impact and plant regeneration GEiGS constructs were impaled onto pre-prepared roots (as discussed in detail in the Materials and Experimental Procedures section above) and then regenerated. Plants were selected via phenotypic fading for PDS3 transformants and via survival in allyl alcohol treatment for ADH1 transformants. To validate Swap compared to no Swap, i.e., retained wild type, these plants were subsequently screened for insertions via specific primers across the modified region and then restricted digested (Figure 13).

[0697] Example 11 Genotype validation for phenotypic selection As mentioned above, proof-of-concept (POC) of a gene editing system has been established by targeting the well-known phenotypic traits phytoendesaturase (PDS3) and alcohol desaturase (ADH1).

[0698] As described above, plants with reduced ADH1 expression show increased tolerance to allyl alcohol. Therefore, plants stimulated for modified miRNAs targeting ADH1 were regenerated in a medium containing 30 mM allyl alcohol and compared to the regeneration rate of control plants. 118 GEiGS#3+SWAP11 allyl alcohol-selected plants survived on allyl alcohol medium compared to 51 control plants (data not shown). Of the selected GEiGS#3+SWAP11, five were shown to possess a donor (data not shown). The large number of plants regenerating in donor-treated plants may also be due to transient expression during the stimulation process.

[0699] Therefore, the selection of PDS3 and ADH1 by phenotypic fading (Figure 16) and allyl alcohol selection (Figure 17) provides ideal means for selecting transformed microplants for genotyping, respectively.

[0700] The 4kb swap region was evaluated primarily through differentiation of the original wild-type specific amplicon into insertion via variations in internal primers and restriction enzyme digestion.

[0701] ADH1 (Figure 14) shows comparative genotypes of allyl alcohol-selective plants with expected donor-present restriction patterns compared to donor plasmid-restricted and donor plasmid-unrestricted samples. PDS3 (Figure 13) shows comparisons of donor-acquired and unrestricted shock sample phenotypes and their respective different restriction enzyme digestion patterns compared to donor plasmid-restricted and unrestricted samples. These results provided a clear association between the PDS3 albino / decolorized phenotype and the expected restriction pattern. Subsequently, external PCR was performed by combining primers within specific internal, i.e., swap regions with external primers located outside the genomic region to be introduced by swapping and specific to that region (data not shown). Further validation of the swap was obtained by Sanger sequencing of PCR amplicons to assess heterozygosity, homozygosity, or the presence of donor swaps (data not shown).

[0702] Example 12 Modified miRNAs reduce the expression of their new target genes. To investigate the possibility that modified miRNAs in the GEiGS system could downregulate the expression of newly designated targets, gene expression analysis was performed using qRT-PCR (quantitative real-time PCR). RNA was extracted from positively identified regenerated plants, reverse transcribed, and compared with the regenerated plants, and processed in parallel, but the relevant modified constructs were not introduced. When miR-173 was modified to target PDS3 (GEiGS#4+SWAP4), an average decrease of 83% in gene expression was observed (Figure 15). In plants with miR-390 modified to target ADH1 (GEiGS#3+SWAP11), similar changes in gene expression were observed, at 82% of the control plant level (Figure 16). In summary, these results demonstrate a gene editing method that modifies endogenous miRNAs by substituting the target recognition sequence in the miRNA transcript at the endogenous locus, thereby successfully targeting new genes and reducing their expression.

[0703] While the present invention has been described in relation to its specific embodiments, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art. Accordingly, the present invention is intended to encompass all such alternatives, modifications, and variations that fall within the spirit and broad scope of the appended claims.

[0704] All publications, patents, and patent applications referenced herein are incorporated herein by whole as if each individual publication, patent, or patent application were specifically and individually indicated as being incorporated herein by reference. Furthermore, any citation or specification of references in this application should not be construed as acceptance of the availability of such references as prior art of the present invention. Section headings, to the extent used, should not necessarily be construed as limiting.

Claims

1. Isolated and modified eukaryotic cells, wherein the eukaryotic cells are not plant cells, Here, eukaryotic cells are homozygous or heterozygous with respect to DNA editing events. The DNA editing event is a modification of a gene encoding or processing microRNA (miRNA) in a target RNA in the eukaryotic cell, using a method comprising the following steps: The aforementioned method, A step of introducing a DNA editing agent into isolated eukaryotic cells, wherein the DNA editing agent is a DNA editing agent that redirects the silencing specificity of miRNA toward a second target RNA, and the first target RNA and the second target RNA are different, A step of introducing a donor oligonucleotide into an isolated eukaryotic cell, wherein the donor oligonucleotide is a donor oligonucleotide containing the desired modification for use as a repair template for generating the desired modification in the gene, This process includes a step in which the gene encoding the miRNA has its original specificity of the miRNA disrupted and acquires new specificity for a second target RNA. The DNA editing agent is a modified eukaryotic cell comprising a Cas endonuclease and at least one gRNA.

2. The modified eukaryotic cell according to claim 1, wherein the DNA editing event is insertion, deletion, insertion-deletion, inversion, substitution, or a combination thereof.

3. A modified eukaryotic cell according to claim 1 or 2, which is a cell that does not contain a DNA sequence encoding a DNA editing agent.

4. The modified eukaryotic cell according to claim 3, wherein the absence of a DNA sequence encoding a DNA editing agent is detected by the loss of expression of the DNA editing agent.

5. The modified eukaryotic cell according to claim 4, wherein the loss of expression of the DNA editing agent is determined by fluorescence detection of green fluorescent protein (GFP), quantitative polymerase chain reaction (q-PCR), or high-performance liquid chromatography (HPLC).

6. The modified eukaryotic cell according to any one of claims 1 to 5, wherein the DNA editing event is detected by DNA and RNA sequencing, electrophoresis, enzyme-based mismatch detection assays, hybridization assays, such as PCR, RT-PCR, RNase protection, in-situ hybridization, primer extension, Southern blotting, Northern blotting, dot blotting analysis, or a mismatch cleavage assay utilizing a structure-selective enzyme that recognizes and cleaves mismatch DNA.

7. A modified eukaryotic cell according to any one of claims 1 to 5, wherein the eukaryotic cell is obtained from a eukaryote selected from the group consisting of mammals, insects, nematodes, birds, reptiles, fish, crustaceans, fungi, and algae.

8. A modified eukaryotic cell according to any one of claims 1 to 5, wherein the eukaryotic cell is a human cell.

9. A modified eukaryotic cell according to any one of claims 1 to 5, wherein the eukaryotic cell is a totipotent stem cell.

10. A modified eukaryotic cell according to any one of claims 1 to 5, wherein the eukaryotic cell is an immune cell.

11. The modified eukaryotic cell according to claim 10, wherein the immune cell is a T cell, a B cell, a macrophage, or an NK cell.

12. A modified eukaryotic cell according to any one of claims 1 to 11, wherein the endonuclease comprises Cas9.

Citation Information

Patent Citations

  • JP1121-1133

  • Guide RNA with chemical modifications

    US20160289675A1

  • Genome editing for treating glioblastoma

    WO2017123910A1