In vitro transfer technology
By employing optimized CTP and ATP molar ratios and controlled addition schedules in IVT reactions, the production of therapeutic RNA is enhanced, addressing yield and integrity issues, and reducing dsRNA impurities, suitable for both small and large-scale RNA production.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- BIONTECH SE
- Filing Date
- 2021-09-01
- Publication Date
- 2026-06-18
AI Technical Summary
Existing technologies face challenges in producing therapeutic RNA, particularly on a commercial scale, with issues related to low yield, integrity, and high levels of double-stranded RNA (dsRNA) impurities, which are exacerbated by impurities and integrity problems at larger scales.
The use of specific molar ratios of cytidine triphosphate (CTP) and adenosine triphosphate (ATP) in in vitro transcription (IVT) reaction mixtures, along with controlled addition schedules, to enhance RNA yield, integrity, and reduce dsRNA production, regardless of RNA sequence.
This approach significantly improves RNA yield, integrity, and reduces dsRNA levels, enabling high-quality RNA production across various scales, from small batches to large commercial quantities.
Smart Images

Figure 0007875944000022 
Figure 0007875944000023 
Figure 0007875944000024
Abstract
Description
Background Art
[0001] Particularly in light of the increasing importance as a therapeutic modality, the technology for producing RNA is important and valuable.
Summary of the Invention
[0002] The present disclosure provides certain insights regarding techniques for producing RNA, particularly therapeutic RNA (e.g., therapeutic mRNA). In some embodiments, the techniques provided are particularly useful when used for large-scale production of, for example, therapeutic-grade RNA and / or provide surprising benefits and / or advantages.
[0003] For example, the present disclosure provides insights regarding particularly useful concentrations of cytidine triphosphate (CTP) and / or adenosine triphosphate (ATP) in an in vitro transcription (IVT) reaction mixture (e.g., in the initial reaction mixture, it is understood by those skilled in the art that NTPs are utilized during the reaction such that their concentrations decrease over time unless replenished).
[0004] In some embodiments, the present disclosure provides techniques that improve one or more of RNA yield, RNA integrity, RNA capping level, and / or efficiency, and alternatively or additionally, in some embodiments, the present disclosure provides techniques that reduce the levels of one or more contaminants or aberrant products (e.g., dsRNA).
[0005] In some embodiments, the present disclosure provides IVT reaction conditions (e.g., nucleotide concentrations in the reaction mixture) that are useful regardless of the sequence of the RNA transcript produced in the reaction.
[0006] This disclosure encompasses an awareness of the problems relating to RNA production by IVT, particularly on a large scale (e.g., commercial scale). In particular, this disclosure identifies that it can be difficult to produce in vitro transcribed RNA in high yield and / or integrity and / or with low levels of abnormal products (e.g., double-stranded RNA (dsRNA)). This disclosure particularly understands that such challenges can be especially urgent when producing therapeutic RNA (e.g., mRNA) (for administration to animals, and especially humans) particularly on a commercial scale (e.g., 0.1–10 g, 10–500 g, 500 g–1 kg, 750 g–1.5 kg; those skilled in the art will understand that different products may be produced on different scales depending, for example, patient population size) and / or pharmaceutical quality (which can typically be more difficult to achieve on larger scales, for example, because, for example, impurities and / or integrity problems may be more pronounced at such scales).
[0007] In some embodiments, the provided techniques may be useful when applied to the production of transcripts having relatively high C and / or A content (compared to, for example, G and / or U content in the transcript). However, in some embodiments, the disclosure provides the surprising insight that the provided reaction conditions (e.g., levels of CTP and / or ATP [or analogues] in the reaction mixture [e.g., absolute and / or relative levels]) may be useful independently of the transcript sequence.
[0008] In some embodiments, the increased CTP and / or ATP described herein improve yield and / or integrity and / or capping, and / or reduce the production of one or more abnormal products (e.g., dsRNA), independently of the percentage and / or molar ratio of nucleotides (e.g., nucleotide content) in the RNA produced.
[0009] In some embodiments, the techniques provided herein are particularly useful for the production of RNA of commercial quality and / or on a commercial scale. Those skilled in the art will recognize that different therapeutic RNAs are utilized on very different scales. For example, target-specific RNAs are described and used in personalized cancer vaccines (see, e.g., RO7198457), and these need to be produced only on a scale sufficient to treat the individuals concerned. In contrast, RNAs developed for other purposes, e.g., as general cancer vaccines, as infectivity factor vaccines, or as vectors for the expression of antibodies, enzymes, cytokines, etc., can typically be produced on larger scales. Therapeutic RNAs have proven particularly valuable in the recent SARS-CoV-2 pandemic, which required production on unprecedented scales. The techniques provided herein can be utilized on each of these scales in various embodiments. Therefore, for example, in some embodiments, the techniques described herein are useful for producing RNA in the range of about 0.01 gRNA / hour to about 1 gRNA / hour, 1 gRNA / hour to about 100 gRNA / hour, about 1 g RNA / hour to about 20 g RNA / hour, or about 100 g RNA / hour to about 10,000 g RNA / hour (e.g., on a production scale). In some embodiments, the techniques described herein are used in reactions that produce tens or hundreds of milligrams to tens or hundreds of grams (or more) of RNA per batch. Those skilled in the art will understand, by reading this disclosure, that certain advantages achieved (e.g., improved integrity and / or yield) may be particularly advantageous in pharmaceutical grade and / or in large-scale production as particularly described herein.
[0010] In some embodiments, the techniques described herein may be used in parallel, for example, to further improve throughput capacity.
[0011] In some specific embodiments, the technology provided provides at least 0.01g, 0.02g, 0.03g, 0.04g, 0.05g, 0.06g, 0.07g, 0.08g, 0.09g, 0.1g, 0.5g, 1g, 2g, 3g, 4g, 5g, 6g, 7g, 8g, 9g, 10g RNA (for example, at least 15g RNA, at least 20g RNA, at least 25g RNA, at least 30g RNA, at least 35g RNA, at least 40g RNA, at least 45g RNA, at least 50g RNA, at least 55g RNA, at least 60g RNA, at least 70g RNA, at least 80g RNA, at least 90g RNA, at least 100g RNA, at least 150g RNA, at least 200g RNA, at least 300g RNA, at least 400g RNA, at least 500g This may be useful for producing RNA preparations (e.g., RNA drug substances) in batch sizes containing at least 750 g, at least 1 kg, at least 1.1 kg, at least 1.2 kg, at least 1.3 kg, at least 1.4 kg, or at least 1.5 kg of RNA. In some embodiments, the techniques provided herein can be used to produce batch sizes in the range of about 0.01 g to about 500 g RNA, about 0.01 g to about 10 g RNA, about 1 g to about 10 g RNA, about 10 g to about 500 g RNA, about 10 g to about 300 g RNA, about 10 g to about 200 g RNA, or about 30 g to about 60 g RNA.
[0012] In some embodiments, the techniques provided herein are useful for large-scale production that produce large throughputs of at least 1.5 g RNA per hour (e.g., including at least 2 g RNA per hour, at least 2.5 g RNA per hour, at least 3 g RNA per hour, at least 3.5 g RNA per hour, at least 4 g RNA per hour, at least 4.5 g RNA per hour, at least 5 g RNA per hour, at least 5.5 g RNA per hour, at least 6 g RNA per hour, at least 6.5 g RNA per hour, at least 7 g RNA per hour, at least 7.5 g RNA per hour, at least 8 g RNA per hour, at least 8.5 g RNA per hour, at least 9 g RNA per hour, and at least 10 g RNA per hour or more). In some embodiments, the large-scale production methods described herein can reach capacities of 15 g RNA per hour to 20 g RNA per hour (e.g., about 17 g per hour).
[0013] Indeed, in some embodiments, the provided technology offers the remarkable advantage of being useful on a variety of scales and / or specifically on very large production scales (e.g., beyond about tens or even hundreds of grams / batch), and / or being useful substantially independently of RNA sequences (e.g., for the production of RNA with varying C and / or A content) (e.g., even on such very large scales).
[0014] In some embodiments, the present disclosure provides a method for producing a ribonucleic acid (RNA) molecule via in vitro transcription, comprising preparing a reaction mixture under reaction conditions to form an RNA molecule, wherein the reaction mixture comprises a nucleic acid polymerase, a nucleic acid template, and total cytidine triphosphate (CTP) and / or one or more functional CTP analogs in a molar ratio a to total guanosine triphosphate (GTP) and / or one or more functional GTP analogs, and / or total CTP and / or one or more functional CTP analogs in a molar ratio b to total uridine triphosphate (UTP) and / or one or more functional UTP analogs, and / or total CTP and / or one or more functional CTP analogs in a molar ratio c to total adenosine triphosphate (ATP) and / or one or more functional ATP analogs, and the RNA molecule The present invention provides a method comprising: total cytidine and / or one or more functional cytidine analogs in a molar ratio x to total guanosine and / or one or more functional guanosine analogs; and / or total uridine and / or one or more functional uridine analogs in a molar ratio y to total cytidine and / or one or more functional uridine analogs; and / or total cytidine and / or one or more functional cytidine analogs in a molar ratio z to total adenosine and / or one or more functional adenosine analogs, wherein a is at least 1.25, and / or a is at least about 1.10 times x, and / or b is at least 1.25, and / or b is at least about 1.10 times y, and / or c is at least 1.10, and / or c is at least about 1.10 times z.
[0015] In some embodiments, a is at least 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.65, 1.70, 1.75, or 1.8. In some embodiments, a is at least 1.5. In some embodiments, a is at least about 1.15 times, 1.20 times, 1.25 times, 1.30 times, 1.35 times, 1.40 times, 1.45 times, 1.50 times, 1.55 times, 1.60 times, 1.65 times, 1.70 times, or 1.75 times x. In some embodiments, a is at least about 1.15 times x. In some embodiments, a is at least about 1.20 times x.
[0016] In some embodiments, b is at least 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.65, 1.70, 1.75, or 1.8. In some embodiments, b is at least 1.5. In some embodiments, b is at least about 1.15 times, 1.20 times, 1.25 times, 1.30 times, 1.35 times, 1.40 times, 1.45 times, 1.50 times, 1.55 times, 1.60 times, 1.65 times, 1.70 times, or 1.75 times y. In some embodiments, b is at least about 1.15 times y. In some embodiments, b is at least about 1.20 times y.
[0017] In some embodiments, c is at least 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, or 1.50. In some embodiments, c is at least 1.25. In some embodiments, c is at least about 1.15 times, 1.20 times, 1.25 times, 1.30 times, 1.35 times, 1.40 times, 1.45 times, 1.50 times, 1.55 times, 1.60 times, 1.65 times, 1.70 times, or 1.75 times z. In some embodiments, c is at least about 1.15 times z. In some embodiments, c is at least about 1.20 times z.
[0018] In some embodiments, the disclosure further comprises combining total ATP and / or one or more functional ATP analogs in a molar ratio d to total GTP and / or one or more functional GTP analogs, and / or total ATP and / or one or more functional ATP analogs in a molar ratio e to total UTP and / or one or more functional UTP analogs, wherein the RNA molecule reacts with total guanosine and / or one or more functional guanosine analogs. A method is provided comprising a molar ratio w of total adenosine and / or one or more functional adenosine analogs to total adenosine and / or one or more functional uridine analogs, and / or total uridine and / or one or more functional uridine analogs, wherein d is at least 1.10, and / or d is at least about 1.05 times v, and / or e is at least 1.10, and / or e is at least about 1.05 times w. In some such embodiments, d is at least 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, or 1.50. In some such embodiments, d is at least 1.20. In some such embodiments, d is at least about 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, or 1.50 times v. In some such embodiments, d is at least about 1.10 times v. In some such embodiments, d is at least about 1.20 times v. In some such embodiments, e is at least 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, or 1.50. In some such embodiments, e is at least 1.20. In some such embodiments, e is at least about 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, or 1.50 times w. In some such embodiments, e is at least about 1.10 times w. In some such embodiments, e is at least about 1.20 times w.
[0019] In some embodiments, a portion of total CTP and / or one or more functional CTP analogs is added to the reaction mixture before the start of transcription and / or at the start of transcription, and the remaining portion of total CTP and / or one or more functional CTP analogs is added to the reaction mixture after the start of transcription.
[0020] In some embodiments, all of the total CTP and / or one or more functional CTP analogs are added to the reaction mixture before the start of transcription and / or at the start of transcription.
[0021] In some embodiments, a portion of total GTP and / or one or more functional GTP analogs is added to the reaction mixture before and / or at the start of transcription, and the remaining portion of total GTP and / or one or more functional GTP analogs is added to the reaction mixture after the start of transcription.
[0022] In some embodiments, all of the total GTP and / or one or more functional GTP analogs are added to the reaction mixture before and / or at the start of transcription.
[0023] In some embodiments, a portion of the total UTP and / or one or more functional UTP analogs is added to the reaction mixture before the start of transcription and / or at the start of transcription, and the remaining portion of the total UTP and / or one or more functional UTP analogs is added to the reaction mixture after the start of transcription.
[0024] In some embodiments, all of the total UTP and / or one or more functional UTP analogs are added to the reaction mixture before the start of transcription and / or at the start of transcription.
[0025] In some embodiments, a portion of the total ATP and / or one or more functional ATP analog(s) is added to the reaction mixture before transcription begins and / or at the start of transcription, and the remaining portion of the total ATP and / or one or more functional ATP analog(s) is added to the reaction mixture after the start of transcription.
[0026] In some embodiments, all of the total ATP and / or one or more functional ATP analog(s) is added to the reaction mixture before transcription begins and / or at the start of transcription.
[0027] In some embodiments, the RNA molecule is single-stranded. In some embodiments, the RNA molecule is linear RNA, messenger RNA, and / or nucleoside-modified messenger RNA.
[0028] In some embodiments, the nucleic acid template is a DNA template. In some embodiments, the template is a linear template (e.g., a linear DNA template). In some embodiments, the template is a plasmid (e.g., a DNA plasmid). In some embodiments, the template is an amplicon (e.g., generated by polymerase chain reaction).
[0029] In some embodiments, the reaction mixture contains the nucleic acid template at a concentration of 0.01 - 2 μg / μL.
[0030] In some embodiments, the nucleic acid polymerase is an RNA polymerase. In some embodiments, the nucleic acid polymerase is T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, N4 virion RNA polymerase, or a variant or functional domain thereof.
[0031] In some embodiments, the reaction mixture comprises (e.g., further comprises) one or more of a reaction buffer, an RNase inhibitor, pyrophosphatase, one or more salts, a reducing agent, and spermidine. In some embodiments, the reaction buffer comprises HEPES, Tris-HCl, or PBS. In some embodiments, the reaction mixture comprises the reaction buffer at a concentration of 20-60 mM or 100-150 mM. In some embodiments, the reaction buffer has a pH of 7-9. In some embodiments, the reaction mixture comprises the RNase inhibitor at a concentration of 0.01-0.1 U / μL. In some embodiments, one unit (U) of the RNase inhibitor inhibits the activity of 5 ng of RNase A by at least 50%. In some embodiments, the pyrophosphatase is inorganic pyrophosphatase. In some embodiments, the reaction mixture comprises the pyrophosphatase at a concentration of 0.01-0.2 mU / μL. In some embodiments, the one or more salts included in the reaction mixture comprise one or more magnesium salts and / or one or more calcium salts. In some embodiments, the one or more magnesium salts comprise magnesium acetate or magnesium chloride. In some embodiments, the reaction mixture comprises the one or more salts at a concentration of 20-60 mM. In some embodiments, the reaction mixture comprises the one or more salts at a concentration of 100-150 mM. In some embodiments, the reducing agent comprises dithiothreitol or 2-mercaptoethanol. In some embodiments, the reaction mixture comprises the reducing agent at a concentration of 5-15 mM. In some embodiments, the reaction mixture comprises spermidine at a concentration of 0.5-3 mM.
[0032] In some embodiments, the in vitro transcription is carried out for at least 20-180 minutes. In some embodiments, the in vitro transcription is carried out at a temperature of 25-55 °C.
[0033] In some embodiments, the methods disclosed herein further include digesting a nucleic acid template after in vitro transcription of an RNA molecule. In some such embodiments, the nucleic acid template is digested by a DNase. In some such embodiments, the DNase includes DNase I.
[0034] In some embodiments, the methods disclosed herein include digesting a polypeptide of the IVT reaction mixture (e.g., nucleic acid polymerase, pyrophosphatase, DNAse, RNAse inhibitor such as DNAse I) after in vitro transcription to produce an RNA molecule (e.g., further include). In some such embodiments, the nucleic acid polymerase is digested by a proteinase. In some such embodiments, the proteinase is or comprises proteinase K.
[0035] In some embodiments, the techniques provided by this disclosure include (for example, further including) performing one or more evaluations (e.g., evaluation of one or more quality control parameters) of an in vitro transcription reaction and / or the RNA produced thereby. In some such embodiments, one or more quality control parameters are selected from the group consisting of RNA integrity, RNA concentration, residual double-stranded RNA (dsRNA), and / or capping of the RNA molecule during and / or after transcription. In some such embodiments, RNA integrity is evaluated using agarose gel electrophoresis. In some such embodiments, RNA integrity is evaluated using capillary gel electrophoresis. In some such embodiments, the RNA integrity of the RNA molecule produced by this method is at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%.
[0036] In some embodiments, the RNA integrity of RNA molecules(s) produced according to the techniques provided herein is increased by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to a suitable comparative control (e.g., using an otherwise equivalent in vitro transcription reaction, e.g., a reaction reaction in which a is not at least 1.25, b is not at least 1.25, and / or c is not at least 1.10). In some embodiments, RNA integrity is measured against appropriate controllable parameters (e.g., equivalent in vitro transcription reactions by other means, e.g., d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least 1.25, c is not at least 1.10 and / or d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least about 1.25, c is not at least 1.10 and / Or d is at least 1.10, and / or e is at least 1.10, and / or a is at least 1.25, b is at least 1.25, and / or c is at least 1.10, and / or d is not at least 1.10, and / or e is not at least 1.10, compared to the reaction mixture used) an increase of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%. In some embodiments, RNA integrity is increased by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to a suitable control (e.g., using a reaction reaction that is otherwise equivalent, e.g., a reaction reaction in which a is not at least about 1.10 times x, b is not at least about 1.10 times y, and / or c is not at least about 1.10 times z)In some embodiments, RNA integrity is not measured against a suitable comparison control (e.g., an equivalent in vitro transcription reaction by other means, e.g., d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, c is not at least about 1.10 times z, and / or d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, and c is not at least about 1.10 times z) Compared to the reaction mixture (using the reaction mixture), RNA integrity increases by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%. In some such embodiments, RNA integrity increases by at least about 5%. In some such embodiments, RNA integrity increases by at least about 8%.
[0037] In some embodiments, the RNA concentration is evaluated using UV absorption spectrophotometry. In some embodiments of the present disclosure, the concentration of RNA molecules(s) in the relevant sample or preparation (e.g., IVT solution) produced according to the techniques provided herein is at least about 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL, 5 mg / mL, 6 mg / mL, 7 mg / mL, 8 mg / mL, 9 mg / mL, 10 mg / mL, 11 mg / mL, 12 mg / mL, 13 mg / mL, 14 mg / mL, or 15 mg / mL. In some such embodiments, the concentration of RNA molecules(s) (e.g., in the relevant sample or preparation, such as in IVT solution) is increased by at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, or 30% compared to a suitable control (e.g., using a reaction reaction where a is not at least 1.25, b is not at least 1.25, and / or c is not at least 1.10).In some such embodiments, the concentration of RNA molecules(s) is set to a suitable control (e.g., an equivalent in vitro transcription reaction by other means), e.g., d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least 1.25, c is not at least 1.10 and / or d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least 1.25, c is not at least 1.10 If the reaction mixture is not at least 1.10, and / or d is at least 1.10, and / or e is at least 1.10, and / or a is at least 1.25, b is at least 1.25, and / or c is at least 1.10, and / or d is not at least 1.10, and / or e is not at least 1.10, then the reaction mixture will increase by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to the reaction mixture used. In some such embodiments, the concentration of RNA molecules(s) produced according to the techniques provided herein is increased by at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, or 30% compared to a suitable control (e.g., using a reaction reaction where a is not at least about 1.10 times x, b is not at least about 1.10 times y, and / or c is not at least about 1.10 times z).In some such embodiments, the concentration of RNA molecules(s) is set to a suitable control (e.g., an equivalent in vitro transcription reaction by other means, e.g., d is not at least about 1.05 times v and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, c is not at least about 1.10 times z and / or d is not at least about 1.05 times v and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, c is at least about 1.10 times z) The reaction mixture is not 0x, and / or d is not at least about 1.05x of v, and / or e is not at least about 1.05x of w, and / or a is not at least about 1.10x of x, b is at least about 1.10x of y, and / or c is at least about 1.10x of z, and / or d is not at least about 1.05x of v, and / or e is not at least about 1.05x of w. Compared to the reaction mixture used, the concentration of RNA molecules(s) increases by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%. In some such embodiments, the concentration of RNA molecules(s) increases by at least about 20%.
[0038] In some embodiments, residual dsRNA is evaluated using polymerase chain reaction (PCR), absorbance, fluorescent dyes, and / or gel electrophoresis. In some embodiments, residual dsRNA (e.g., in IVT solution) is evaluated using quantitative PCR. In some such embodiments, the residual dsRNA during and / or after transcription of the RNA molecule is at least about 25 pg dsRNA / μg RNA, 50 pg dsRNA / μg RNA, 75 pg dsRNA / μg RNA, 100 pg dsRNA / μg RNA, 125 pg dsRNA / μg RNA, 150 pg dsRNA / μg RNA, 175 pg dsRNA / μg RNA, 200 pg dsRNA / μg RNA, 225 pg dsRNA / μg RNA, 250 pg dsRNA / μg RNA, 275 pg dsRNA / μg RNA, or 300 pg dsRNA / μg RNA. In some such embodiments, residual dsRNA during and / or after transcription is reduced by at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80% compared to a suitable control (e.g., using a reaction reaction where a is not at least 1.25, b is not at least 1.25, and / or c is not at least 1.10).In some embodiments, residual dsRNA during and / or after transcription is compared with a suitable control (e.g., an equivalent in vitro transcription reaction by other means, e.g., d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least 1.25, c is not at least 1.10 and / or d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least about 1.25, and c is at least 1.10) The reaction mixture is not one of the following: and / or d is at least 1.10, and / or e is at least 1.10, and / or a is at least 1.25, b is at least 1.25, and / or c is at least 1.10, and / or d is not at least 1.10, and / or e is not at least 1.10. Compared to the reaction mixture used, the mixture increases by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%. In some embodiments, residual dsRNA during and / or after transcription is reduced by at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80% compared to a suitable control (e.g., using a reaction that is otherwise equivalent in vitro, e.g., a reaction where a is not at least about 1.10 times x, b is not at least about 1.10 times y, and / or c is not at least about 1.10 times z).In some such embodiments, residual dsRNA during and / or after transcription is compared with a suitable control (e.g., an equivalent in vitro transcription reaction by other means, e.g., d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, c is not at least about 1.10 times z, and / or d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, c is not at least about z) d is not about 1.10 times, and / or d is at least about 1.05 times v, and / or e is at least about 1.05 times w, and / or a is at least about 1.10 times x, b is at least about 1.10 times y, and / or c is at least about 1.10 times z, and / or d is not at least about 1.05 times v, and / or e is at least about 1.05 times w. Compared to the reaction mixture used, the concentration increases by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%. In some such embodiments, the residual dsRNA concentration decreases by at least about 70%.
[0039] In some embodiments, the capping of RNA molecules is evaluated by (a) evaluating the translation of functionally capped RNA, (b) performing bioactivity tests to confirm that the RNA molecules are translated into polypeptides (e.g., proteins) of the correct size, (c) performing nuclease-based assays, and / or (d) performing catalytic nucleic acid-based assays. In some such embodiments, the nuclease-based assays include RNase-based assays, for example, an RNase-based assay that includes (a) annealing a number of RNA molecules to one or more probes that bind to RNA molecules to form RNA probe complexes, (b) digesting the RNA probe complexes with RNase to produce fragments containing the 5' ends of RNA molecules, (c) purifying the fragments using affinity-based purification, chromatography-based purification, or a combination thereof, (d) subjecting the purified fragments to mass spectrometry (MS), (e) identifying capped and uncapped fragments based on observed MS values, and / or (f) calculating the proportion of capped RNA by comparing the amounts of capped and uncapped fragments. In some such embodiments, the RNase includes RNase H.In some such embodiments, a nuclease-based assay includes one or more of the following: (a) contacting a number of RNA molecules with one or more DNA oligonucleotides complementary to a sequence in the 5' untranslated region of an RNA molecule adjacent to a 5' RNA cap or the second-to-last uncapped base of the RNA; (b) annealing one or more DNA oligonucleotides to a sequence in the 5' untranslated region of an RNA molecule to form a DNA / RNA hybrid complex; (c) degrading the DNA / RNA hybrid complex and / or the unannealed RNA molecule with one or more nucleases to produce capped and uncapped 5' terminal RNA fragments and a 3' RNA fragment; (d) separating the capped and uncapped 5' terminal RNA fragments from the 3' RNA fragment using affinity-based purification, chromatography-based purification, or a combination thereof; and / or (e) comparing the amounts of capped and uncapped 5' terminal RNA fragments to calculate the proportion of capped RNA. In some such embodiments, a catalytic nucleic acid-based assay includes one or more of the following: (a) cleaving a number of RNA molecules with a catalytic nucleic acid molecule into 5' terminal RNA fragments and at least one 3' RNA fragment, such that the RNA molecules have a cleavage site on the catalytic nucleic acid molecule; (b) separating the 5' terminal RNA fragments and 3' RNA fragments using affinity-based purification, chromatography-based purification, or a combination thereof; (c) measuring the amounts of capped and uncapped 5' terminal RNA fragments using spectroscopy, quantitative mass spectrometry, sequencing, or a combination thereof; and / or (d) calculating the percentage of capped RNA by comparing the amounts of capped and uncapped 5' terminal RNA fragments. In some such embodiments, the catalytic nucleic acid molecule includes a DNAzyme or a ribozyme. In some such embodiments, at least about 40%, 50%, 60%, 70%, 80%, 90%, or 99% of the RNA molecules produced according to the techniques provided herein are capped.In some such embodiments, the capping of RNA molecules(s) produced according to the techniques provided herein is increased by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% compared to a suitable comparative control (e.g., using a reaction mixture in an otherwise equivalent way, e.g., a reaction mixture in which a is not at least 1.25, b is not at least 1.25, and / or c is not at least 1.10).
[0040] In some embodiments, residual dsRNA during and / or after transcription is compared with a suitable control (e.g., an equivalent in vitro transcription reaction by other means, e.g., d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least 1.25, c is not at least 1.10 and / or d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least about 1.25, and c is at least 1.10) The reaction mixture is not one of the following: and / or d is at least 1.10, and / or e is at least 1.10, and / or a is at least 1.25, b is at least 1.25, and / or c is at least 1.10, and / or d is not at least 1.10, and / or e is not at least 1.10. Compared to the reaction mixture used, the mixture increases by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%.
[0041] In some embodiments, the capping of RNA molecules(s) produced according to the techniques provided herein is increased by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% compared to a suitable control (e.g., using a reaction reaction in which a is not at least about 1.10 times x, b is not at least about 1.10 times y, and / or c is not at least about 1.10 times z).
[0042] In some embodiments, residual dsRNA during and / or after transcription of RNA molecules(s) produced according to the techniques provided herein is compared with appropriate control groups (e.g., equivalent in vitro transcription reactions by other means, e.g., d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, c is not at least about 1.10 times z, and / or d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y) The reaction mixture used is not increased by at least approximately 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to the original reaction mixture (using the original reaction mixture).
[0043] In some embodiments, the capping of RNA molecules(s) produced according to the techniques provided herein is increased by at least about 5%. [Brief explanation of the drawing]
[0044] [Figure 1] The components and conditions of an exemplary IVT reaction mixture are provided. [Figure 2] The residual nucleotide triphosphates (NTPs) after exemplary large-scale IVT reactions (36.7 L) performed with two different constructs are shown. Construction 1 is BNT162b1, and construction 2 is BNT162b2. [Figure 3] This shows the RNA integrity and capping percentage of RNA produced from exemplary IVT reactions using IVT reaction mixtures containing either -10%, +10%, +20%, or +50% CTP volumes, compared to a control (e.g., standard) IVT reaction mixture containing +0% CTP volume. These reactions showed that increasing CTP volume resulted in increased RNA integrity and capping at +20% and +50% CTP volumes, but were relatively stable at + / -10% CTP starting concentrations compared to RNA produced using the control IVT reaction mixture. [Figure 4] This shows the poly(A) integrity and RNA integrity of RNA produced from exemplary IVT reactions using IVT reaction mixtures containing either -10%, +10%, +20%, or +50% CTP volumes, compared to a control (e.g., standard) IVT reaction mixture containing +0% CTP volume. Increased CTP resulted in increased poly(A) and RNA integrity of the produced RNA compared to the control. [Figure 5] The residual NTP and cap levels, as well as the yield, from exemplary IVT reactions using IVT reaction mixtures containing either -10%, +10%, +20%, or +50% CTP volume, compared to a control (e.g., standard) IVT reaction mixture containing +0% CTP volume, are shown. An increase in yield was observed with increasing CTP concentration. Increases in CTP volume above the control resulted in the maintenance of CTP concentrations above the limit of quantification. Higher CTP concentrations resulted in ATP concentrations below the limit of quantification. [Figure 6]Additional exemplary studies demonstrate RNA integrity and capping percentage, as well as yield and residual CTP levels, from exemplary IVT reactions using IVT reaction mixtures containing either -10%, +10%, +20%, or +50% CTP volume, compared to a control (e.g., standard) IVT reaction mixture containing +0% CTP volume. Light pink markers indicate controls from previous experiments assayed in this study. [Figure 7] Figure 1 shows the yield (top), RNA integrity (center), and residual double-stranded RNA (bottom) from an exemplary IVT reaction using the conditions summarized in Figure 1. The exemplary IVT reactions compared reaction mixtures containing either +10%, +20%, or +50% CTP to a control (+0% CTP). The starting concentration of GTP / m1ΨTP was reduced to 0.5 mM (1 / 18*9 mM) of the starting concentration and supplied in 11 additions throughout the transcription reaction until the final concentration was reached. [Figure 8] The RNA integrity and capping percentage of RNA produced from exemplary IVT reactions using IVT reaction mixtures containing either +40%, +50%, or +60% CTP volume are shown, compared to a control (e.g., standard) IVT reaction mixture containing +0% CTP volume. [Figure 9] This shows the polyA integrity and RNA integrity of RNA produced from exemplary IVT reactions using IVT reaction mixtures containing either +40%, +50%, or +60% CTP volumes, compared to a control (e.g., standard) IVT reaction mixture containing +0% CTP volume. [Figure 10] The residual NTP and capping levels, as well as yields, from exemplary IVT reactions using IVT reaction mixtures containing either +40%, +50%, or +60% CTP volumes, compared to a control (e.g., standard) IVT reaction mixture containing +0% CTP volume, are shown. [Figure 11]Additional exemplary studies demonstrate RNA integrity and capping percentage, as well as yield and residual CTP levels, from exemplary IVT reactions using IVT reaction mixtures containing either +40%, +50%, or +60% CTP volume, compared to a control (e.g., standard) IVT reaction mixture containing +0% CTP volume. Increasing CTP to +40%, +50%, and +60% CTP volumes resulted in ATP depletion below the limit of quantification, increased yield to 10 mg / mL, and increased integrity (FA) from 73.4% to 83.4%. [Figure 12] The RNA integrity and capping percentage of RNA produced from exemplary IVT reactions using IVT reaction mixtures containing either +50% CTP volume and +10% ATP volume or +50% CTP volume and +20% ATP volume are shown, compared to a control IVT reaction mixture containing +50% CTP volume and +0% ATP volume. [Figure 13] The polyA integrity and RNA integrity of RNA produced from exemplary IVT reactions are shown, using IVT reaction mixtures containing either +50% CTP volume and +10% ATP volume or +50% CTP volume and +20% ATP volume, compared to a control IVT reaction mixture containing +50% CTP volume and +0% ATP volume. [Figure 14] We present additional exemplary studies demonstrating RNA integrity and capping percentage, as well as yield and residual NTP levels, from exemplary IVT reactions using IVT reaction mixtures containing either +50% CTP volume and +10% ATP volume or +50% CTP volume and +20% ATP volume, compared to a control IVT reaction mixture containing +50% CTP volume and +0% ATP volume. [Figure 15]Additional exemplary studies demonstrate RNA integrity and capping percentage, as well as yield and residual CTP levels, from exemplary IVT reactions using IVT reaction mixtures containing either +50% CTP volume and +10% ATP volume or +50% CTP volume and +20% ATP volume, compared to a control IVT reaction mixture containing +50% CTP volume and +0% ATP volume. When CTP was +50%, increasing ATP to +10% increased yield and integrity, but ATP was still depleted or nearly depleted. When CTP was +50%, increasing ATP to +20% further increased yield, but no significant improvement in integrity was observed, and GTP was depleted. [Figure 16] Further exemplary evaluations of IVT reaction mixtures are shown, characterized by various levels of CTP (+0% CTP, +10% CTP, +20% CTP, +50% CTP) and yield, RNA integrity, dsRNA content, and residual DNA content. [Figure 17] Further exemplary studies of yield (top), RNA integrity (middle), and dsRNA (bottom) are shown. Exemplary IVT reactions utilized IVT reaction mixtures containing either +50% CTP volume, +50% ATP volume, or +50% CTP volume and +50% ATP volume, compared to a control reaction mixture (+0% CTP volume, +0% ATP volume). [Figure 18] Further exemplary evaluations of IVT reaction mixtures with varying levels of NTP (+50% CTP and +20% ATP, +50% CTP and +20% ATP compared to control) are presented. Yield, integrity, dsRNA content, and residual DNA content were characterized. [Figure 19] This paper describes exemplary assessments of the yield, residual NTP, and integrity of exemplary IVT reactions using reaction mixtures comprising either +50% CTP and +20% ATP (process 2b) or a standard / control (e.g., 1:1:1:1, e.g., 9 mM each) reaction mixture (process 2a). [Figure 20]This section presents exemplary evaluations of the yield, integrity, and residual dsRNA content of exemplary IVT reactions using reaction mixtures containing either +25% ATP and +7% CTP, -21% ATP and -37% CTP, +25% ATP, or +7% CTP, compared to reaction mixtures containing 10.8 mM ATP, 13.5 mM CTP, 9 mM GTP, and 9 mM UTP.
[0045] definition Approximately: When used herein in relation to a value, the term "approximately" refers to a value that is similar to the value being referred to. In general, a person skilled in the art familiar with the context will understand the reasonable degree of difference that "approximately" encompasses in that context. For example, in some embodiments, the term "approximately" may encompass a range of values within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less than 1% of the value being referred to.
[0046] Administration: As used herein, the term “administration” typically refers to the administration of a composition to a subject or system. Those skilled in the art will recognize the various routes available for administration to a subject, e.g., a human, under appropriate circumstances. For example, in some embodiments, administration may be ocular, oral, parenteral, topical, etc. In some specific embodiments, administration may be bronchial (e.g., by bronchial drip), buccal, dermis (e.g., one or more of the topical methods such as dermal, intradermal, interdermal, transdermal, etc., or may include them), enteral, intra-arterial, intradermal, gastric, intramedullary, intramuscular, intranasal, intraperitoneal, intramedullary, intravenous, intraventricular, intraspecific organ (e.g., intrahepatic), mucous membrane, nasal cavity, oral, rectal, subcutaneous, sublingual, topical, trachea (e.g., by intratracheal drip), vagina, vitreous humor, etc. In some embodiments, administration may involve drug delivery that is intermittent (e.g., multiple doses separated by time) and / or periodic (e.g., individual doses separated over a common period). In some embodiments, administration may involve continuous drug delivery (e.g., perfusion) over at least a selected period.
[0047] Acting Factor: In general, as used herein, the term “acting factor” is used to mean an entity (e.g., lipids, metals, nucleic acids, polypeptides, polysaccharides, small molecules, etc., or complexes, combinations, mixtures or systems thereof [e.g., cells, tissues, organisms]) or a phenomenon (e.g., heat, electric current or electric field, magnetic force or magnetic field, etc.). Under appropriate circumstances, as will be apparent to those skilled in the art, the term may be used to mean an entity that is or contains a cell or organism, or a fraction, extract or component thereof. Alternatively or additionally, as will be apparent to the context, the term may be used to mean a natural product found in nature and / or taken from nature. In some cases, again, as will be apparent to the context, the term may be used to mean one or more artificial entities that are artificially designed, manipulated and / or produced and / or not found in nature. In some embodiments, the acting factor may be available in isolated or pure form, and in some embodiments, the acting factor may be available in crude form. In some embodiments, potential action factors may be provided as a collection or library that may be screened, for example, to identify or characterize active action factors among them. In some cases, the term “action factor” may refer to a compound or entity that is or contains a polymer, and in some cases, the term may refer to a compound or entity that contains one or more polymeric moieties. In some embodiments, the term “action factor” may refer to a compound or entity that is not a polymer and / or substantially does not contain any polymer and / or one or more specific polymeric moieties. In some embodiments, the term may refer to a compound or entity that lacks or substantially does not contain any polymeric moieties.
[0048] Allele: As used herein, the term “allele” refers to one of two or more existing gene variants of a particular polymorphic genomic locus.
[0049] Amino Acids: As used herein, the term “amino acid” most broadly means a compound and / or substance that may be a polypeptide chain, is a polypeptide chain, or is incorporated into a polypeptide chain, for example, through the formation of one or more peptide bonds. In some embodiments, an amino acid has the general structure H2N-C(H)(R)-COOH. In some embodiments, an amino acid is a naturally occurring amino acid. In some embodiments, an amino acid is a non-natural amino acid, in some embodiments, an amino acid is a D-amino acid, and in some embodiments, an amino acid is an L-amino acid. A “standard amino acid” refers to any of the 20 standard L-amino acids commonly found in naturally occurring peptides. A “non-standard amino acid” refers to any amino acid other than a standard amino acid, whether it is synthetically prepared or obtained from a natural source. In some embodiments, an amino acid may include carboxyl-terminal and / or amino-terminal amino acids in a polypeptide, and may include structural modifications compared to the general structure described above. For example, in some embodiments, amino acids may be modified compared to their general structure by methylation, amidation, acetylation, pegylation, glycosylation, phosphorylation, and / or substitution (e.g., of an amino group, a carboxylic acid group, one or more protons, and / or a hydroxyl group). In some embodiments, such modifications may alter, for example, the cyclic half-life of a polypeptide containing a modified amino acid compared to one containing the same amino acid except that which is unmodified. In some embodiments, such modifications do not significantly alter the relevant activity of a polypeptide containing a modified amino acid compared to one containing the same amino acid except that which is unmodified. As will be apparent from the context, in some embodiments, the term “amino acid” may be used to refer to a free amino acid, and in some embodiments, the term may be used to refer to an amino acid residue of a polypeptide.
[0050] Analogue: As used herein, the term “analogue” refers to a substance that shares one or more specific structural features, elements, components, or parts with a reference substance. Typically, an “analogue” exhibits significant structural similarity to the reference substance, for example, by sharing a core or consensus structure, but also differs in a particular distinct way. In some embodiments, an analogue is a substance that can be produced from a reference substance, for example, by the chemical manipulation of the reference substance. In some embodiments, an analogue is a substance that can be produced by performing a synthetic process that is substantially similar to (e.g., sharing several steps) the synthetic process that produces the reference substance. In some embodiments, an analogue is produced or can be produced by performing a synthetic process different from the synthetic process used to produce the reference substance.
[0051] Animal: As used herein, refers to any member of the animal kingdom. In some embodiments, “animal” refers to a human being of any sex at any stage of development. In some embodiments, “animal” refers to a non-human animal at any stage of development. In certain embodiments, a non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cattle, primates, and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or parasites. In some embodiments, an animal may be a genetically modified animal, a genetically modified animal, and / or a clone.
[0052] Antigen: As used herein, the term “antigen” refers to an activating factor that elicits an immune response, and / or an activating factor that binds to a T cell receptor (e.g., when presented by an MHC molecule) or an antibody. In some embodiments, the antigen elicits a humoral response (e.g., including the production of antigen-specific antibodies), and in some embodiments, the antigen elicits a cellular response (e.g., the involvement of T cells whose receptors specifically interact with the antigen). In some embodiments, the antigen may or may not bind to an antibody and induce a specific physiological response in an organism. Generally, the antigen is or may contain any chemical entity such as, for example, small molecules, nucleic acids, polypeptides, carbohydrates, lipids, or polymers (in some embodiments, other than biopolymers [e.g., other than nucleic acids or amino acid polymers]). In some embodiments, the antigen is or contains a polypeptide. In some embodiments, the antigen is or contains a glycan. Those skilled in the art will understand that the antigen may generally be provided in isolated or pure form, or alternatively in crude form (e.g., together with other materials, such as cell extracts or other relatively crude preparations of the antigen-containing source). In some embodiments, the antigen used according to the present invention is provided in a crude form. In some embodiments, the antigen is a recombinant antigen.
[0053] Bonding: As used herein, the term “bonding” is typically understood to refer to a non-covalent bond between two or more entities. “Direct” bonding involves physical contact between entities or parts, while indirect bonding involves physical interaction through physical contact by one or more intermediate entities. Bonding between two or more entities can typically be evaluated in any of a variety of situations, including when the interacting entities or parts are studied alone or in relation to a more complex system (e.g., covalently or otherwise bound to a carrier entity and / or a biological system or cell). Under the conditions being evaluated, a bond between two entities may be considered “specific” if the entities in question are more likely to bind to each other than to other valid binding partners.
[0054] Characteristic Sequence Elements: As used herein, the term “characteristic sequence elements” refers to sequence elements found in a polymer (e.g., a polypeptide or nucleic acid) that represent a characteristic portion of that polymer. In some embodiments, the presence of characteristic sequence elements correlates with the presence or level of a particular activity or property of the polymer. In some embodiments, the presence (or absence) of characteristic sequence elements defines a particular polymer as a member (or not a member) of a particular family or group of such polymers. Characteristic sequence elements typically comprise at least two monomers (e.g., amino acids or nucleotides). In some embodiments, characteristic sequence elements comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, or more monomers (e.g., continuously linked monomers). In some embodiments, characteristic sequence elements comprise at least first and second segments of continuous monomers separated by one or more spacer regions, which may or may not vary in length, between polymers sharing the sequence elements.
[0055] Comparable: As used herein, the term “comparable” means two or more actors, entities, situations, sets of conditions, etc., which may not be identical to one another but are similar enough that comparison between them is permissible, so that a person skilled in the art will understand that conclusions can be reasonably drawn based on the differences or similarities observed. In some embodiments, a comparable set of conditions, situations, individuals, or groups is characterized by several substantially identical features and one or a few diverse features. A person skilled in the art will understand, depending on the context, what degree of identity is required for two or more such actors, entities, situations, sets of conditions, etc., to be considered comparable in any given situation. For example, a set of situations, individuals, or groups are comparable to one another if the differences in results or observed phenomena under or using different sets of situations, individuals, or groups are caused by variations in their features or are characterized by a sufficient number and variety of substantially identical features to guarantee reasonable conclusions that demonstrate variations in features.
[0056] Composition: Those skilled in the art will understand that, as used herein, the term “composition” may be used to refer to a separate physical entity comprising one or more specified components. Generally, unless otherwise specified, a composition may be in any form, such as a gas, gel, liquid, or solid.
[0057] Comprising: A composition or method described herein as "comprising" one or more enumerated elements or steps is open-ended, meaning that the enumerated elements or steps are essential, but other elements or steps may be added to the scope of the composition or method. To avoid redundancy, any composition or method described as "comprising" or "comprises" one or more named elements or steps also means a corresponding, more limited composition or method that "consisting essentially of" or "consists essentially of" the same named elements or steps, meaning that the composition or method may include additional elements or steps that include the named essential elements or steps but do not substantially affect the basic and novel characteristics of the composition or method. Furthermore, it should be understood that any composition or method described herein as "comprising" or "consisting essentially of" one or more named elements or steps also represents a corresponding, more limited, closed-end composition or method that "consists of" or "consists of" the named elements or steps, excluding any other elements or steps that are not named. In any composition or method disclosed herein, a known or disclosed equivalent of any of the named essential elements or steps may be used in place of that element or step.
[0058] Designed: As used herein, the term “designed” means (i) an action factor whose structure is selected or chosen by human hands, (ii) an action factor produced by a process requiring human hands, and / or (iii) an action factor distinct from natural substances and other known action factors.
[0059] Domain: As used herein, the term “domain” means a section or portion of an entity. In some embodiments, a “domain” is related to a particular structural and / or functional feature of an entity such that, when physically separated from the rest of its parent entity, it substantially or completely retains that particular structural and / or functional feature. Alternatively, or additionally, a domain may be a portion of an entity that, when separated from its (parent) entity and combined with a different (recipient) entity, substantially retains and / or confers to one or more structural and / or functional features that characterize the parent entity to the recipient entity. In some embodiments, a domain is a section or portion of a molecule (e.g., a small molecule, carbohydrate, lipid, nucleic acid, or polypeptide). In some embodiments, a domain is a section of a polypeptide, and in some such embodiments, a domain is characterized by specific structural elements (e.g., a specific amino acid sequence or sequence motif, α-helix features, β-sheet features, coil-like coil features, random coil features, etc.) and / or specific functional features (e.g., binding activity, enzymatic activity, folding activity, signaling activity, etc.).
[0060] Manipulated: Generally, the term “manipulated” refers to an embodiment that has been manipulated by human hands. For example, a polynucleotide is considered “manipulated” if two or more sequences that are not linked together in their order in nature are manipulated by human hands so that they are directly linked to one another within the manipulated polynucleotide, and / or if certain residues within the polynucleotide are unnaturally present, and / or artificially caused to be linked to entities or parts that are not linked in nature. For example, in some embodiments of the present invention, a manipulated polynucleotide includes a regulatory sequence that is found naturally and operably associates with a first coding sequence but not with a second coding sequence, and is linked by human hands so that it operably associates with the second coding sequence. Relatively speaking, a cell or organism is considered “manipulated” if its genetic, epigenetic, and / or phenotypic identity is altered compared to a suitable reference cell, such as another identical cell that has not been manipulated in the same way. In some embodiments, the operation is or includes a genetic operation such that its genetic information is altered (e.g., new genetic material that was not previously present is introduced by, for example, transformation, mating, somatic hybridization, transfection, transduction, or other mechanisms, or previously present genetic material is altered or removed by, for example, substitution or deletion mutation, or mating protocol). In some embodiments, the operated cells are operated to contain and / or express a particular action factor of interest (e.g., polypeptides (e.g., proteins), nucleic acids, and / or specific forms thereof) in modified amounts and / or timing relative to such a suitable reference cell. As is common practice and as will be understood by those skilled in the art, the offspring of an operated polynucleotide or cell are typically still referred to as “operated,” even though the actual operation was performed on a prior entity.
[0061] Epitope: As used herein, the term “epitope” refers to a portion of an immunoglobulin (e.g., an antibody or receptor) that is specifically recognized by its binding component. In some embodiments, an epitope consists of multiple chemical atoms or groups on an antigen. In some embodiments, such chemical atoms or groups are surface-exposed when the antigen takes the form of a relevant three-dimensional conformation. In some embodiments, such chemical atoms or groups are spatially and physically close to each other when the antigen takes the form of such a conformation. In some embodiments, at least some such chemical atoms or groups are physically separated from each other when the antigen takes an alternative conformation (e.g., linearized).
[0062] Expression: As used herein, the term “expression” of a nucleic acid sequence refers to the production of any gene product from a nucleic acid sequence. In some embodiments, the gene product may be a transcript. In some embodiments, the gene product may be a polypeptide. In some embodiments, the expression of a nucleic acid sequence involves one or more of the following: (1) production of an RNA template from a DNA sequence (e.g., by transcription), (2) processing of the RNA transcript (e.g., by splicing, editing, etc.), (3) translation of the RNA into a polypeptide (e.g., a protein), and / or (4) post-translational modification of the polypeptide (e.g., a protein).
[0063] Fragment: A “fragment” of a substance or entity as described herein has a structure that includes a distinct part of the whole but lacks one or more parts found in the whole. In some embodiments, the fragment consists of such distinct parts. In some embodiments, the fragment consists of or includes characteristic structural elements or parts found in the whole. In some embodiments, the polymer fragments contain or consist of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more monomer units (e.g., residues) found throughout the polymer. In some embodiments, polymer fragments contain or consist of at least about 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of monomer units (e.g., residues) found throughout the polymer. In some embodiments, the whole substance or entity may be referred to as the “parent” of the fragments.
[0064] Gene: As used herein, the term “gene” refers to a DNA sequence in a chromosome that codes for a product (e.g., an RNA product and / or a polypeptide product). In some embodiments, a gene includes a coding sequence (i.e., a sequence that codes for a particular product), and in some embodiments, a gene includes a non-coding sequence. In some specific embodiments, a gene may include both coding (e.g., exon) sequences and non-coding (e.g., intron) sequences. In some embodiments, a gene may include one or more regulatory elements that can control or influence, for example, one or more modes of gene expression (e.g., cell type-specific expression, inducible expression, etc.).
[0065] Host: The term “host” is used herein to refer to a system (e.g., a cell, an organism, etc.) in which the polypeptide of interest resides. In some embodiments, the host is a system susceptible to infection by a particular infectious agent. In some embodiments, the host is a system expressing a polypeptide of interest.
[0066] Host cell: As used herein, refers to a cell into which an exogenous nucleic acid (recombinant or non-recombinant) has been introduced. Those skilled in the art will understand, upon reading this disclosure, that such a term means not only a specific target cell but also the offspring of such a cell. Since certain modifications may occur in later generations either by mutation or environmental influence, such offspring are not actually identical to the parent cell but are still included within the scope of the term “host cell” as used herein. In some embodiments, host cells include prokaryotic and eukaryotic cells selected from any living world suitable for expressing exogenous DNA (e.g., recombinant nucleic acid sequences). Examples of cells include those of prokaryotes and eukaryotes (unicellular or multicellular), bacterial cells (e.g., strains such as E. coli, Bacillus spp., and Streptomyces spp.), mycobacterial cells, fungal cells, yeast cells (e.g., S. cerevisiae, S. pombe, P. pastoris, P. methanolica, etc.), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, Trichoplusia ni, etc.), non-human animal cells, human cells, or cell fusions such as hybridomas or quadromas. In some embodiments, the cells are those of humans, monkeys, apes, hamsters, rats, or mice. In some embodiments, the cells are eukaryotic, such as CHO (e.g., CHO Kl, DXB-1 1 CHO, Veggie-CHO), COS (e.g., COS-7), retinal cells, Vero, CV1, kidney cells (e.g., HEK 293, 293EBNA, MSR293, MDCK, HaK, BHK), Hela, HepG2, WI38, MRC 5, Colo205, HB8065, HL-60, (e.g., BHK21), Jurkat, Daudi, A431 (epidermal), CV-1, U937, 3T3, L cells, C127 cells, SP2 / 0, NS-0, MMT 060562, Sertoli cells, BRL 3 A cells, HT1080 cells, myeloma cells, tumor cells, and cell lines derived from the aforementioned cells. In some embodiments, the cells contain one or more viral genes.
[0067] Identity: As used herein, the term “identity” refers to the overall relationship between polymer molecules, for example, between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules. In some embodiments, polymer molecules are considered “substantially identical” to one another if their sequences are identical by at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. For example, the calculation of identity percentage between two nucleic acid or polypeptide sequences can be performed by aligning the two sequences for the best possible comparison (for example, gaps can be introduced in one or both of the first and second sequences for the best alignment, and non-identical sequences can be ignored for the purpose of comparison). In certain embodiments, the length of the aligned sequence for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. The nucleotides at the corresponding positions are then compared. The molecules are identical at a given position if the position in the first sequence is occupied by the same residue (e.g., a nucleotide or amino acid) as the corresponding position in the second sequence. The percentage of identity between two sequences is a function of the number of gaps and the number of identical positions shared by the sequences, taking into account the length of each gap that needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and the determination of the percentage of identity between two sequences can be achieved using mathematical algorithms. For example, the algorithm by Meyers and Miller (CABIOS, 1989, 4:11-17), incorporated into the ALIGN program (version 2.0), can be used to determine the percentage of identity between two nucleotide sequences. In some exemplary embodiments, nucleic acid sequence comparisons prepared by the ALIGN program use the PAM120 weight residue table, gap length penalty 12, and gap penalty 4.The percentage of identity between two nucleotide sequences can, alternatively, be determined using the NWSgapdna.CMP matrix and the GAP program within the GCG software package.
[0068] “Improved,” “Increased,” or “Reduced”: As used herein, these terms or grammatically equivalent comparative terms indicate values relative to equivalent reference measures. For example, in some embodiments, an evaluation value achieved by the agent of interest may be “improved” compared to one obtained by an equivalent reference agent. Alternatively or additionally, in some embodiments, an evaluation value achieved in the subject or system of interest may be “improved” compared to one obtained in the same subject or system under different conditions (e.g., before and after an event such as administration of the agent of interest) or in a different equivalent subject (e.g., in an equivalent subject or system different from the subject or system of interest, in the presence of one or more indicators of a particular disease, disorder, or condition of interest, or before exposure to the condition or agent). In some embodiments, comparative terms refer to a statistically significant difference (e.g., a rate and / or magnitude sufficient to achieve a statistically significant difference). A person skilled in the art will know, or can easily determine, the degree and / or rate of difference necessary or sufficient to achieve such a statistically significant difference in a given context.
[0069] In vitro: As used herein, the term “in vitro” refers to events that occur in an artificial environment, such as in a test tube or reaction vessel, or in a cell culture, rather than within a multicellular organism.
[0070] Linker: As used herein, this term is used to refer to the portion of a multi-element activator that connects different elements to one another. For example, those skilled in the art will understand that a polypeptide having two or more functional or organizational domains in its structure often contains a sequence of amino acids between such domains that link them together. In some embodiments, a polypeptide containing a linker element has an overall structure of the general form S1-L-S2, where S1 and S2 may represent two domains that are the same or different and associate with each other by a linker. In some embodiments, the polypeptide linker is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more amino acids in length. In some embodiments, the linker tends not to adopt a rigid three-dimensional structure, but rather is characterized by providing flexibility to the polypeptide. Various different linker elements can be appropriately used when manipulating polypeptides known in the art (e.g., fusion polypeptides) (see, for example, Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, RJ, et al. (1994) Structure 2:1 121-1123).
[0071] Part: Those skilled in the art will understand that “part” is a defined chemical group or entity having a specific structure and / or activity as described herein.
[0072] Nucleic acid: As used herein, in its broadest sense, means any compound and / or substance that is incorporated into or can be incorporated into an oligonucleotide chain. In some embodiments, nucleic acid is a compound and / or substance that is incorporated into or can be incorporated into an oligonucleotide chain via a phosphodiester bond. As will be apparent from the context, in some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides), and in some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, “nucleic acid” is or contains RNA, and in some embodiments, “nucleic acid” is or contains DNA. In some embodiments, nucleic acid is one or more native nucleic acid residues, or contains or consists of them. In some embodiments, nucleic acid is one or more nucleic acid analogs, or contains or consists of them. In some embodiments, nucleic acid analogs differ from nucleic acids in that they do not utilize a phosphodiester backbone. For example, in some embodiments, the nucleic acid is, contains, or consists of one or more "peptide nucleic acids," which are known in the art, have peptide bonds in their backbone instead of phosphodiester bonds, and are considered to be within the scope of the present invention. Alternatively or additionally, in some embodiments, the nucleic acid has one or more phosphorothioate and / or 5'-N-phosphoramidite bonds instead of phosphodiester bonds. In some embodiments, the nucleic acid is, contains, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine).In some embodiments, the nucleic acid is, includes, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, the nucleic acid contains one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to that of natural nucleic acids. In some embodiments, the nucleic acid has a nucleotide sequence encoding a functional gene product such as RNA or polypeptide (e.g., protein). In some embodiments, the nucleic acid contains one or more introns. In some embodiments, the nucleic acid is prepared by one or more of the following: isolation from natural sources, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), replication in recombinant cells or systems, and chemosynthesis. In some embodiments, the nucleic acid has a residue length of at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, or 5000 residues. In some embodiments, the nucleic acid is partially or entirely single-stranded. In some embodiments, nucleic acids are partially or entirely double-stranded.In some embodiments, the nucleic acid has a nucleotide sequence comprising at least one element that encodes a polypeptide or is a complement to a polypeptide-encoding sequence. In some embodiments, the nucleic acid has enzymatic activity.
[0073] Pharmaceutical Composition: As used herein, the term “pharmaceutical composition” refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose appropriate for administration in a therapeutic regime that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to an appropriate population. In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, including oral administration, e.g., drenches (aqueous or nonaqueous solutions or suspensions), tablets, e.g., those targeting oral, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, e.g., sterile solutions or suspensions, or as sustained-release formulations, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection; topical application, e.g., creams, ointments, or controlled-release patches or sprays applied to the skin, lungs, or oral cavity; e.g., pessaries, creams, or foams suitable for vaginal or rectal, sublingual, ocular, transdermal, or nasal, lung, and other mucosal surfaces.
[0074] Polypeptide: As used herein, refers to a high molecular weight chain of amino acids. In some embodiments, the polypeptide has a naturally occurring amino acid sequence. In some embodiments, the polypeptide has an amino acid sequence that is not naturally occurring. In some embodiments, the polypeptide has an engineered amino acid sequence in that it is artificially designed and / or produced. In some embodiments, the polypeptide may contain or consist of natural amino acids, non-natural amino acids, or both. In some embodiments, the polypeptide may contain or consist of only natural amino acids or only non-natural amino acids. In some embodiments, the polypeptide may contain D-amino acids, L-amino acids, or both. In some embodiments, the polypeptide may contain only D-amino acids. In some embodiments, the polypeptide may contain only L-amino acids. In some embodiments, the polypeptide may include one or more pendant groups or other modifications, e.g., modifications or attachments to one or more amino acid side chains, at the N-terminus of the polypeptide, at the C-terminus of the polypeptide, or in any combination thereof. In some embodiments, such pendant groups or modifications may be selected from the group consisting of acetylation, amidation, lipidation, methylation, pegylation, etc., or combinations thereof. In some embodiments, the polypeptide may be cyclic and / or contain a cyclic portion. In some embodiments, the polypeptide is not cyclic and / or does not contain any cyclic portion. In some embodiments, the polypeptide is linear. In some embodiments, the polypeptide is or may contain a staple polypeptide. In some embodiments, the term “polypeptide” may be affixed to the name of a reference polypeptide, activity, or structure, in which case it is used herein to refer to polypeptides that share a relevant activity or structure and can therefore be considered members of the same class or family of polypeptides. For each such class, exemplary polypeptides within the class whose amino acid sequence and / or function are known are provided herein and / or will be apparent to those skilled in the art.In some embodiments, such exemplary polypeptides are reference polypeptides of a class or family of polypeptides. In some embodiments, members of a polypeptide class or family exhibit significant sequence homology or identity with the reference polypeptide of the class (and, in some embodiments, with all polypeptides within the class), share common sequence motifs (e.g., characteristic sequence elements), and / or share common activity (in some embodiments, at equivalent levels or within a specified range). For example, in some embodiments, member polypeptides exhibit an overall degree of sequence homology or identity with the reference polypeptide, often exceeding about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, and / or include at least one region (e.g., in some embodiments, a characteristic sequence element or a conserved region that may contain one) that exhibits a very high degree of sequence identity, often exceeding 90%, or even more exceeding 95%, 96%, 97%, 98%, or 99%. Such conserved regions typically contain at least 3-4 amino acids, often up to 20 or more, and in some embodiments, the conserved region contains at least one interval of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more consecutive amino acids. In some embodiments, the relevant polypeptide may contain or consist of fragments of a parent polypeptide. In some embodiments, the useful polypeptide may contain or consist of multiple fragments, each found in the same parent polypeptide in a different spatial arrangement with respect to each other than that found in the polypeptide of interest (e.g., a fragment directly linked to the parent may be spatially separated in the polypeptide of interest, or vice versa, and / or the fragments may be present in the polypeptide of interest in a different order than that of the parent), and thus the polypeptide of interest is a derivative of its parent polypeptide.
[0075] Predetermined: Predetermined means, for example, that something is chosen in a planned manner, as opposed to something that occurs or is achieved randomly.
[0076] Preventing or Preventing: As used herein, when used in connection with the development of a disease, disorder, and / or condition, means reducing the risk of developing a disease, disorder, and / or condition, and / or delaying the development of one or more characteristics or symptoms of a disease, disorder, or condition. Prevention may be deemed complete if the development of the disease, disorder, or condition has been delayed for a predefined period of time.
[0077] Pure: As used herein, an active ingredient or entity is “pure” if it is substantially free of other components. For example, a preparation containing more than about 90% of a particular active ingredient or entity is typically considered a pure preparation. In some embodiments, the active ingredient or entity is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% pure.
[0078] Reference: When used herein, a reference or control against which a comparison is made is described. For example, in some embodiments, the target agent, animal, individual, population, sample, sequence, or value is compared to the reference or control agent, animal, individual, population, sample, sequence, or value. In some embodiments, the reference or control is tested and / or determined substantially simultaneously with the test or determination of the target. In some embodiments, the reference or control is a historical reference or control embodied in a tangible medium, at the discretion of the user. Typically, as will be understood by those skilled in the art, the reference or control is determined or characterized under conditions or circumstances comparable to those being evaluated. Those skilled in the art will understand that there may be sufficient similarity to justify reliance on and / or comparison to a particular reference or control.
[0079] Sample: As used herein, the term “sample” typically refers to an aliquot of material obtained from or derived from the source of interest described herein. In some embodiments, the source of interest is a biological or environmental source. In some embodiments, the source of interest may be or include living organisms such as cells, microorganisms, plants, or animals (e.g., humans). In some embodiments, the source of interest may be or include living tissue or fluids. In some embodiments, biological tissue or fluid may be or include amniotic fluid, aqueous humor, ascites, bile, bone marrow, blood, breast milk, cerebrospinal fluid, earwax, chyle, chime, ejaculate, endolymph, exudate, feces, gastric acid, gastric juice, lymph, mucus, pericardial fluid, perilymph, peritoneal fluid, pleural fluid, pus, eye discharge, saliva, sebum, semen, serum, smegma, sputum, synovial fluid, sweat, tears, urine, vaginal secretions, vitreous humor, vomit, and / or combinations or components thereof. In some embodiments, biological fluid may be or include intracellular fluid, extracellular fluid, intravascular fluid (plasma), interstitial fluid, lymph, and / or interstitial fluid. In some embodiments, biological fluid may be or include plant exudates. In some embodiments, biological tissue or specimens may be obtained, for example, by aspiration, biopsy (e.g., fine-needle biopsy or tissue biopsy), swab (e.g., oral, nasal, skin, or vaginal swab), scraping, surgery, washing, or lavage (e.g., bronchoalveolar, mammary duct, nose, eye, oral cavity, uterus, vagina, or other washing or lavage). In some embodiments, the biological specimen is or contains cells obtained from an individual. In some embodiments, the specimen is a “primary specimen” obtained directly from the source of interest by any suitable means. In some embodiments, as will be apparent from the context, the term “specimen” means a preparation obtained by processing a primary specimen (e.g., by removing one or more components and / or adding one or more active ingredients). For example, filtration using a semipermeable membrane.Such “processed samples” may include, for example, nucleic acids or polypeptides (e.g., proteins) extracted from the sample, or obtained by subjecting the primary sample to one or more techniques such as nucleic acid amplification or reverse transcription, isolation and / or purification of a particular component.
[0080] Subject: As used herein, the term “subject” means an organism, typically a mammal (e.g., a human, including in some embodiments a prenatal human form). In some embodiments, the subject is suffering from the relevant disease, disorder, or condition. In some embodiments, the subject is susceptible to the disease, disorder, or condition. In some embodiments, the subject exhibits one or more symptoms or characteristics of the disease, disorder, or condition. In some embodiments, the subject does not exhibit any symptoms or characteristics of the disease, disorder, or condition. In some embodiments, the subject is a person who has one or more characteristics that are characteristic of susceptibility to or risk of the disease, disorder, or condition. In some embodiments, the subject is a patient. In some embodiments, the subject is an individual who is being diagnosed and / or receiving treatment.
[0081] Therapeutic Acting Factors: As used herein, the term “therapeutic acting factor” generally means any acting factor that, when administered to an organism, induces a desired pharmacological effect. In some embodiments, an acting factor is considered a therapeutic acting factor if it exhibits a statistically significant effect in a suitable population. In some embodiments, the suitable population may be a population of model organisms. In some embodiments, the suitable population may be defined by various criteria such as a particular age group, sex, genetic background, or pre-existing clinical condition. In some embodiments, a therapeutic acting factor is a substance that can be used to alleviate, improve, reduce, inhibit, prevent, delay the onset, reduce the severity, and / or decrease the incidence of one or more symptoms or characteristics of a disease, disorder, and / or pathological condition. In some embodiments, a “therapeutic acting factor” is an acting factor that has been approved or requires approval by a government agency before it can be made available for sale for administration to humans. In some embodiments, a “therapeutic acting factor” is an acting factor that requires a medical prescription for administration to humans.
[0082] Treatment: As used herein, the term “treatment” (and also “to treat” or “to treat”) refers to the administration of a therapy that partially or completely alleviates, improves, reduces, inhibits, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms, features, and / or causes of a particular disease, disorder, and / or condition. In some embodiments, such treatment may be treatment of subjects who do not exhibit signs of the disease, disorder, and / or condition in question, and / or subjects who exhibit only initial signs of the disease, disorder, and / or condition. Alternatively or additionally, such treatment may be treatment of subjects who exhibit one or more established signs of the disease, disorder, and / or condition in question. In some embodiments, treatment may be treatment of subjects diagnosed with the disease, disorder, and / or condition in question. In some embodiments, treatment may be treatment of subjects who are known to have one or more susceptibility factors that are statistically correlated with an increased risk of developing the disease, disorder, and / or condition in question. Thus, in some embodiments, treatment may be prophylactic, and in some embodiments, treatment may be therapeutic.
[0083] Vaccination: As used herein, the term “vaccination” refers to the administration of a composition intended to produce an immune response to, for example, a disease-related (e.g., disease-causing) agent. In some embodiments, vaccination may be administered before, during, and / or after exposure to a disease-related agent, and in certain embodiments, before, during, and / or immediately after exposure to that agent. In some embodiments, vaccination may involve multiple administrations of the vaccine composition at appropriate time intervals.
[0084] Variant: As used herein in the context of molecules, e.g., nucleic acids, polypeptides (e.g., proteins), or small molecules, the term “variant” refers to a molecule that exhibits significant structural identity with a reference molecule but is structurally different from the reference molecule, e.g., in the presence or absence, or level, of one or more chemical moieties compared to the reference entity. In some embodiments, a variant may also be functionally different from its reference molecule. Generally, whether a particular molecule is appropriately considered a “variant” of a reference molecule depends on the degree of structural identity with that reference molecule. As will be understood by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural elements. By definition, a variant is a distinct molecule that shares one or more such characteristic structural elements but differs from the reference molecule in at least one aspect. To give some examples, a polypeptide may have a characteristic sequence element composed of multiple amino acids that have designated positions relative to each other in linear or three-dimensional space and / or contribute to a particular structural motif and / or biological function, and a nucleic acid may have a characteristic sequence element composed of multiple nucleotide residues that have designated positions relative to each other in linear or three-dimensional space. In some embodiments, the variant polypeptide or nucleic acid may differ from the reference polypeptide or nucleic acid as a result of one or more differences in the amino acid or nucleotide sequence and / or one or more differences in the chemical portion (e.g., carbohydrates, lipids, phosphate groups) that is a covalent component of the polypeptide or nucleic acid (e.g., to which the polypeptide or nucleic acid backbone is bound). In some embodiments, the variant polypeptide or nucleic acid exhibits overall sequence identity with the reference polypeptide or nucleic acid of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some embodiments, the variant polypeptide or nucleic acid does not share at least one characteristic sequence element with the reference polypeptide or nucleic acid. In some embodiments, the reference polypeptide or nucleic acid has one or more biological activities.In some embodiments, a variant polypeptide or nucleic acid shares one or more of the biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid lacks one or more of the biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid exhibits a reduced level of one or more biological activities compared to a reference polypeptide or nucleic acid. In some embodiments, a polypeptide or nucleic acid in question is considered a “variant” of a reference polypeptide or nucleic acid if its amino acid or nucleotide sequence is identical to that of the reference polypeptide or nucleic acid, but has a small number of sequence changes at specific positions. Typically, less than 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, or 2% of residues in the variant are substituted, inserted, or deleted compared to the reference. In some embodiments, the variant polypeptide or nucleic acid contains about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 substituted residue compared to the reference. Often, the variant polypeptide or nucleic acid contains very few (e.g., less than about 5, about 4, about 3, about 2, or about 1) substituted, inserted, or deleted functional residues (i.e., residues involved in specific biological activity) compared to the reference. In some embodiments, the variant polypeptide or nucleic acid contains about 5, about 4, about 3, about 2, or about 1 or fewer additions or deletions compared to the reference, and in some embodiments, it contains no additions or deletions compared to the reference. In some embodiments, the variant polypeptide or nucleic acid contains, compared to the reference, about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, less than about 6, and generally about 5, about 4, about 3, or less than about 2 additions or deletions. In some embodiments, the reference polypeptide or nucleic acid is one found in nature. In some embodiments, the reference polypeptide or nucleic acid is a human polypeptide or nucleic acid.
[0085] Vector: As used herein, a vector refers to a nucleic acid molecule capable of transporting another nucleic acid linked to it. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop that can ligate further DNA segments. Another type of vector is a viral vector, which can ligate further DNA segments to a viral genome. Certain vectors can autonomously replicate within the host cell into which they are introduced (e.g., bacterial vectors with bacterial origins of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the host cell's genome upon introduction and thus replicate together with the host genome. Furthermore, certain vectors can induce the expression of a gene to which the vector is functionally linked. Such vectors are referred herein to as "expression vectors." Standard techniques for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation may be used (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques may be carried out according to the manufacturer's specifications, or as is commonly done in the art, or as described herein. The techniques and procedures described above can generally be carried out in accordance with conventional methods well known in the art and as described in various general and more specific references cited and discussed throughout this specification. For any purpose, see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)), which is incorporated herein by reference.
[0086] Wild-type: As used herein, the term “wild-type” has the meaning understood in the art to refer to an entity having the structure and / or activity as found in nature in a “normal” state or context (as opposed to mutant, diseased, modified, etc.). Those skilled in the art will understand that wild-type genes and polypeptides often exist in multiple different forms (e.g., alleles).
[0087] Detailed description of a specific embodiment RNA therapies have recently emerged as a relatively new and promising class of treatments for the treatment and / or prevention of a variety of diseases, including cancer, infectious diseases, and / or diseases or disorders associated with deficiencies of certain polypeptides (e.g., proteins). Given the potential of these technologies and their applicability to a wide range of clinical situations, including on a large scale (e.g., global vaccination and / or treatment for infectious diseases such as influenza and coronaviruses [e.g., SARS, MERS, etc.]), improvements in manufacturing technologies, especially those applicable to large-scale production, are of particular value.
[0088] The techniques provided herein are particularly useful for achieving the particularly effective and / or efficient production of RNA-containing compositions and / or preparations, for example, on a commercial scale and / or under commercial conditions. For example, in various embodiments, the techniques provided enable and / or facilitate the achievement of requirements specific to pharmaceutical-grade (and / or scale) production, such as batch size and / or production rate and / or predetermined quality control parameters.
[0089] This disclosure provides, in particular, a technique for producing RNA, such as therapeutic RNA, and / or compositions containing the same, by IVT. In some embodiments, the provided technique is useful for producing pharmaceutical-grade RNA and / or RNA therapeutics. In some embodiments, the provided technique is useful for the large-scale production of RNA therapeutics, such as pharmaceutical-grade RNA therapeutics.
[0090] For example, in some such embodiments, the techniques provided herein are used to process at least 1,000 vials of RNA therapeutic agent (e.g., at least 2,000 vials, at least 5,000 vials, at least 10,000 vials, at least 20,000 vials, at least 30,000 vials, at least 40,000 vials, at least 50,000 vials, at least 60,000 vials, at least 70,000 vials, at least 80,000 vials) It can produce batch throughput (e.g., pharmaceutical-grade batch throughput) of vials, including at least 90,000 vials, at least 100,000 vials, at least 200,000 vials, at least 300,000 vials, at least 400,000 vials, at least 500,000 vials, 600,000 vials, 700,000 vials, 800,000 vials, 900,000 vials, and 1,000,000 vials or more.
[0091] For example, in some such embodiments, the techniques provided herein can be used to produce batch throughput (e.g., pharmaceutical-grade batch throughput) of at least 50 L (e.g., including at least 50 L, at least 60 L, at least 70 L, at least 80 L, at least 100 L, at least 110 L, at least 120 L, at least 130 L, at least 140 L, and at least 150 L or more) of RNA therapeutic agents. In some embodiments, each vial may contain an amount of RNA ranging from 0.01 mg to 5 mg (e.g., 0.01 mg, 0.02 mg, 0.03 mg, 0.04 mg, 0.05 mg, 0.06 mg, 0.07 mg, 0.08 mg, 0.09 mg, 0.1 mg, 0.15 mg, 0.2 mg, 0.25 mg, 0.3 mg, 0.35 mg, 0.4 mg, 0.45 mg, 0.5 mg).
[0092] In particular, this disclosure provides the insight that elevated cytidine triphosphate (CTP) and / or adenosine triphosphate (ATP) concentrations can offer certain advantages in IVT reactions, including for the production of pharmaceutical-grade RNA compositions and / or preparations, regardless of the percentage and / or molar ratio of nucleotides (e.g., nucleotide content) in the produced RNA.
[0093] The techniques described herein may be useful for producing RNA compositions (e.g., RNA such as mRNA, and compositions containing the same). In some embodiments, the techniques described herein may be useful for producing mRNA compositions for the treatment and / or prevention of diseases, disorders, or pathological conditions (e.g., cancer, infectious diseases, diseases associated with polypeptide (e.g., protein) deficiencies). In some embodiments, the techniques described herein may be useful for producing mRNA compositions encoding polypeptides and / or multiple polypeptides.
[0094] composition In some embodiments, the disclosure provides, among other things, a method for producing compositions and / or preparations comprising RNA by in vitro transcription (IVT). In some embodiments, the compositions and / or preparations comprise therapeutic RNA (e.g., mRNA). In some embodiments, a method for producing the compositions and / or preparations of the present disclosure can be used on a commercial scale, for example, with at least 0.01g, 0.02g, 0.03g, 0.04g, 0.05g, 0.06g, 0.07g, 0.08g, 0.09g, 0.1g, 0.5g, 1g, 2g, 3g, 4g, 5g, 6g, 7g, 8g, 9g, 10g RNA (e.g., at least 15g RNA, at least 20g RNA, at least 25g RNA, at least 30g RNA, at least 35g RNA, at least 40g RNA, at least 45g RNA, at least 50g RNA, at least 55g RNA, at least 60g RNA, at least 70g RNA, at least 80g RNA, at least 90g RNA, at least 100g RNA, at least 150g RNA, at least 200g RNA, at least 300g RNA, at least 400g RNA, at least 500g RNA) This is a large-scale batch throughput (including RNA and above). In some embodiments, such methods described herein can be used to produce large-scale batch throughput of about 0.01 g to about 500 g RNA, about 0.01 g to about 10 g RNA, about 1 g to about 10 g RNA, about 10 g to about 500 g RNA, about 10 g to about 300 g RNA, about 10 g to about 200 g RNA, or about 30 g to about 60 g RNA.In some embodiments, such methods described herein are useful for large-scale production that produce large batch throughputs of at least 1.5 g RNA per hour (e.g., including at least 2 g RNA per hour, at least 2.5 g RNA per hour, at least 3 g RNA per hour, at least 3.5 g RNA per hour, at least 4 g RNA per hour, at least 4.5 g RNA per hour, at least 5 g RNA per hour, at least 5.5 g RNA per hour, at least 6 g RNA per hour, at least 6.5 g RNA per hour, at least 7 g RNA per hour, at least 7.5 g RNA per hour, at least 8 g RNA per hour, at least 8.5 g RNA per hour, at least 9 g RNA per hour, and at least 10 g RNA per hour or more). In some embodiments, the large-scale production methods described herein can reach capacities of 15 g RNA to 20 g RNA per hour (e.g., about 17 g per hour).
[0095] RNA In some embodiments, the RNA applicable to the techniques described herein is single-stranded RNA. In some embodiments, the RNA disclosed herein is linear RNA. In some embodiments, the single-stranded RNA is non-coding RNA in that its nucleotide sequence does not contain an open reading frame (or its complementary strand). In some embodiments, the single-stranded RNA has a nucleotide sequence that codes for (or is a complementary strand of a coding sequence for) a polypeptide or a plurality of polypeptides (e.g., an epitope) of the Disclosure.
[0096] In many embodiments, the relevant RNA is mRNA.
[0097] In some embodiments, the RNA contains unmodified uridine residues, and RNA containing only unmodified uridine residues may be referred to as “uRNA”. In some embodiments, the RNA contains one or more modified uridine residues, and in some embodiments, such RNA (e.g., RNA containing fully modified uridine residues) is referred to as “modRNA”. In some embodiments, the RNA may be self-amplified RNA (saRNA). In some embodiments, the RNA may be trans-amplified RNA (see, for example, WO2017 / 162461).
[0098] In some embodiments, the techniques described herein may be particularly useful for producing RNA (e.g., single-stranded RNA) having a length of at least 500 ribonucleotides (e.g., at least 600 ribonucleotides, at least 700 ribonucleotides, at least 800 ribonucleotides, at least 900 ribonucleotides, at least 1000 ribonucleotides, at least 1250 ribonucleotides, at least 1500 ribonucleotides, at least 1750 ribonucleotides, at least 2000 ribonucleotides, at least 2500 ribonucleotides, at least 3000 ribonucleotides, at least 3500 ribonucleotides, at least 4000 ribonucleotides, at least 4500 ribonucleotides, at least 5000 ribonucleotides, or more). In some embodiments, the techniques described herein may be particularly useful for synthesizing single-stranded RNA having a length of about 800 to 5000 ribonucleotides.
[0099] In some embodiments, the relevant RNA includes a portion encoding a polypeptide or a portion encoding multiple polypeptides. In some specific embodiments, one or more such portions may be an antigen (or its epitope), a cytokine, an enzyme, etc., or encode one or more polypeptides containing them. In some embodiments, the encoded polypeptide(s) may be one or more novel antigens or epitopes associated with a tumor, or may contain them. In some embodiments, the encoded polypeptide(s) may be one or more antigens (or epitopes) of an infectious agent (e.g., bacteria, fungi, viruses, etc.), or may contain them. In some specific embodiments, the encoded polypeptide may be a variant of a wild-type polypeptide.
[0100] In some embodiments, single-stranded RNA (e.g., mRNA) may include a region encoding a secretory signal (e.g., a region encoding a secretory signal that enables one or more encoded target entities to be secreted by a cell upon translation). In some embodiments, such a region encoding a secretory signal may be or include a non-human secretory signal. In some embodiments, such a region encoding a secretory signal may be or include a human secretory signal.
[0101] In some embodiments, single-stranded RNA (e.g., mRNA) may include at least one non-coding sequence element (e.g., to improve RNA stability and / or translation efficiency). Examples of non-coding sequence elements include, but are not limited to, the 3' untranslated region (UTR), the 5' UTR, a cap structure for co-transcriptional capping of mRNA, a polyadenine (polyA) tail, and any combination thereof.
[0102] format At least four forms of unmodified uridine, including mRNA (uRNA), nucleoside-modified mRNA (modRNA), self-amplified mRNA (saRNA), and trans-amplified RNA, have been developed that are useful for RNA pharmaceutical compositions (e.g., immunogenic compositions or vaccines).
[0103] The characteristics of an unmodified uridine platform may include, for example, one or more of the following: intrinsic adjuvant effects, good tolerability and safety, and potent antibody and T-cell responses.
[0104] The characteristics of a modified uridine (e.g., pseudouridine) platform may include reduced adjuvant effect, blunted immune innate sensor activation ability, and therefore increased antigen expression, good tolerability and safety, as well as a strong antibody and CD4-T cell response. As described herein, this disclosure provides the insight that such a strong antibody and CD4-T cell response may be particularly useful for vaccination.
[0105] The characteristics of a self-amplification platform may include, for example, long-term polypeptide (e.g., protein) expression, good tolerability and safety, and the potential for high efficacy at very low vaccine doses.
[0106] In some embodiments, the self-amplification platform (e.g., RNA) comprises two nucleic acid molecules, one of which encodes a replicase (e.g., viral replicase) and the other nucleic acid molecule is replicable by the said replicase in a trans (trans replication system) (e.g., a replicon). In some embodiments, the self-amplification platform (e.g., RNA) comprises multiple nucleic acid molecules, the nucleic acids which encode multiple replicases and / or replicons.
[0107] In some embodiments, the trans-replication system involves the presence of both nucleic acid molecules within a single host cell.
[0108] In some such embodiments, the nucleic acid encoding the replicase (e.g., viral replicase) is unable to self-replicate in target cells and / or target organisms. In some such embodiments, the nucleic acid encoding the replicase (e.g., viral replicase) lacks at least one conserved sequence element that is important for (+) strand template-based (-) strand synthesis and / or (-) strand template-based (+) strand synthesis.
[0109] In some embodiments, the self-amplified RNA includes a 5'-cap. While we do not wish to be bound by any single theory, the 5'-cap has been found to be important for the high-level expression of the gene of interest in trans. In some embodiments, the 5'-cap drives the expression of the replicase.
[0110] In some embodiments, the self-amplified RNA does not contain an internal ribosome entry site (IRES) element. In some such embodiments, the translation of the gene and / or replicase of interest is not driven by the IRES element. In some embodiments, the IRES element is replaced by a 5'-cap. In some such embodiments, the substitution by the 5'-cap does not affect the sequence of the polypeptide encoded by the RNA.
[0111] In some embodiments, the self-amplification platform does not require the proliferation of viral particles (e.g., is not associated with undesirable viral particle formation). In some embodiments, the self-amplification platform is unable to form viral particles.
[0112] 5'-Cap In some embodiments, the polynucleotides (e.g., RNA) used in accordance with this disclosure include a 5'-cap. RNA capping has been well studied, for example, in Decroly E et al. (2012) Nature Reviews 10:51-65 and Ramanathan A et al., (2016) Nucleic Acids Res;44(16):7511-7526, the entire contents of which are incorporated herein by reference. In some embodiments, suitable 5'-cap structures in the context of the present invention include cap 0 (methylation of the first nucleic acid base, e.g., m7GpppN), cap 1 (additional methylation of the ribose of an adjacent nucleotide to m7GpppN), cap 2 (additional methylation of the ribose of a second nucleotide downstream of m7GpppN), cap 3 (additional methylation of the ribose of a third nucleotide downstream of m7GpppN), cap 4 (additional methylation of the ribose of a fourth nucleotide downstream of m7GpppN), ARCA (anti-reverse cap analogue), modified ARCA (phosphorothioate-modified ARCA, e.g., beta-S-ARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
[0113] In some embodiments, the 5'-caps used are Cap 0 (also referred to herein as "Cap0"), Cap 1 (also referred to herein as "Cap1"), or Cap 2 (also referred to herein as "Cap2"). See, for example, Figure 1 of Ramanathan A et al. and Figure 1 of Decroly E et al.
[0114] As used herein, the term “5'-cap” refers to a structure found on the 5'-end of RNA, e.g., mRNA, and generally includes a guanosine nucleotide attached to RNA, e.g., mRNA, via a 5'-5'-triphosphate bond (also referred to as Gppp or G(5')ppp(5')). In some embodiments, the guanosine nucleoside contained in the 5'-cap may be modified, for example, by methylation at one or more positions on a base (guanine) (e.g., at position 7) and / or methylation at one or more positions on ribose. In some embodiments, the guanosine nucleoside contained in the 5'-cap includes a 3'O methylation at ribose (3'OMeG). In some embodiments, the guanosine nucleoside contained in the 5'-cap includes methylation at position 7 of guanine (m7G). In some embodiments, the guanosine nucleoside contained in the 5' cap includes methylation at the 7th position of guanine and 3'O methylation at ribose (m7(3'OMeG)).
[0115] In some embodiments, providing RNA of the foregoing having a 5'-cap or a 5'-cap analogue can be achieved by in vitro transcription, in which case the 5'-cap can be co-transcribed within the RNA chain or conjugated to the RNA post-transcriptionally using a capping enzyme. In some embodiments, co-transcriptional capping using the caps disclosed herein, for example, cap1 or a cap1 analogue, improves the capping efficiency of RNA compared to co-transcriptional capping using a suitable reference control. In some embodiments, improving capping efficiency can increase the translation efficiency and / or translation rate of RNA and / or increase the expression of the encoded polypeptide.
[0116] In some embodiments, the RNA described herein comprises a 5'-cap or a 5'-cap analogue, e.g., Cap0, Cap1, or Cap2. In some embodiments, the provided RNA does not have an uncapped 5'-triphosphate. In some embodiments, the RNA may be capped with a 5'-cap analogue. In some embodiments, the RNA described herein comprises Cap0. In some embodiments, the RNA described herein comprises, for example, Cap1. In some embodiments, the RNA described herein comprises Cap2. In some embodiments, polynucleotide alterations generate a non-hydrolyzable cap structure that can, for example, prevent decapping and increase the RNA half-life.
[0117] In some embodiments, the Cap0 structure comprises a guanosine nucleoside (m7G) methylated at the 7th position of guanine. In some embodiments, the Cap0 structure is attached to RNA via a 5'-5'-triphosphate bond, which is also referred to herein as m7Gppp or m7G(5')ppp(5').
[0118] In some embodiments, the Cap1 structure comprises a guanosine nucleoside (m7G or 7mG) methylated at position 7 of guanine in RNA and a first nucleotide (2'OMeN1 or N12'OMe or N12'OMe) methylated at position 2'O. In some embodiments, the Cap1 structure is attached to RNA via a 5'-5'-triphosphate bond, and in some embodiments, the Cap1 structure may be represented as m7Gppp(N12'OMe) or m7G(5')ppp(5')(N12'OMe) or 7mG(5')ppp(5')N12'-OMe). In some embodiments, N1 is selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U.
[0119] Those skilled in the art will understand that methylation at one or more positions within the cap structure may affect or reflect the embedded mode (e.g., simultaneous transcription vs. post-transcription), since the presence of a methyl group (e.g., a 2'OMe group) at a specific position (e.g., N1) may interfere with the elongation by a specific polymerase (e.g., T7), which underlies the ARCA technique.
[0120] In some embodiments, the m7G(5')ppp(5')(N12'OMe)Cap1 structure includes a second nucleotide, N2, which is A, G, C, or U near the cap at position +2. In some embodiments, such a Cap1 structure is represented as (m7G(5')ppp(5')(N12'OMe)pN2). In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
[0121] In some embodiments, the Cap1 structure is m7G(5')ppp(5')(A12'OMe)pG2, or includes the same, where A1 is the A near the cap at position +1, and G2 is the G near the cap at position +2, and has the following structure. [ka]
[0122] In some embodiments, the Cap1 structure is m7G(5')ppp(5')(A12'OMe)pU2, or includes the formula, where A1 is the A near the cap at position +1, U2 is the U near the cap at position +2, and has the following structure. [ka]
[0123] In some embodiments, the Cap1 structure is or comprises m7G(5')ppp(5')(G12'OMe)pG2, where G1 is the G proximal cap at position +1 and G2 is the G proximal cap at position +2, and has the following structure. [ka]
[0124] In some embodiments, the Cap1 structure comprises a guanosine nucleoside methylated at position 7 of guanine (m7G), as well as one or more additional modifications, such as methylation on ribose, and a first nucleotide with 2'O methylation in RNA. In some embodiments, the Cap1 structure comprises a guanosine nucleoside methylated at position 7 of guanine, and 3'O methylation on ribose (m7G3'OMe) or 7mG3'OMe, as well as a first nucleotide with 2'O methylation in RNA (N12'OMe). In some embodiments, the Cap1 structure is attached to RNA via a 5'-5' triphosphate bond and is also referred to herein as (m7G3'OMe)ppp(2'OMeN1) or (m7G3'OMe)(5')ppp(5')(2'OMeN1). In some embodiments, N1 is selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U.
[0125] In some embodiments, the (m7G3'OMe)(5')ppp(5')(N12'OMe)Cap1 structure includes a second nucleotide N2, which is a cap-proximal nucleotide at position 2, selected from A, G, C, or U(m7G3'OMe)(5')ppp(5')(N12'OMe)pN2). In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
[0126] In some embodiments, the Cap1 structure is (m7G3'OMe)(5')ppp(5')(A12'OMe)pG2 or includes the same, where A1 is the A proximal to the cap at position +1 and G2 is the G proximal to the cap at position +2, and has the following structure. [ka]
[0127] In some embodiments, the Cap1 structure is (m7G3'OMe)(5')ppp(5')(G12'OMe)pG2 or includes the same, where G1 is the G proximal cap at position +1 and G2 is the G proximal cap at position +2, and has the following structure. [ka]
[0128] In some embodiments, the second nucleotide of the Cap1 structure may include one or more modifications, such as methylation. In some embodiments, a Cap1 structure containing a second nucleotide with 2'O methylation is a Cap2 structure.
[0129] In some embodiments, RNA polynucleotides containing a Cap1 structure exhibit increased translation efficiency, increased translation rate, and / or increased expression of the encoded payload compared to a suitable reference control. In some embodiments, RNA polynucleotides containing a Cap1 structure having (m7G3'OMe)(5')ppp(5')(A12'OMe)pG2, where A1 is the cap-proximal nucleotide at position +1 and G2 is the cap-proximal nucleotide at position +2, exhibit improved translation efficiency compared to RNA polynucleotides containing a Cap1 structure having (m7G3'OMe)(5')ppp(5')(G12'OMe)pG2, where G1 is the cap-proximal nucleotide at position 1 and G2 is the cap-proximal nucleotide at position 2. In some embodiments, the increased translation efficiency is evaluated when the RNA polynucleotide is administered to cells or organisms.
[0130] In some embodiments, the cap analog used for RNA polynucleotides is m7G3'OMeGppp(m12'-OMe)ApG, which is sometimes referred to as (m27,3'-OMeG(5')ppp(5')m2'-OMeApG or (m7G3'OMe)(5')ppp(5')(A2'OMe)pG) and has the following structure. [ka]
[0131] The following is an example of Cap1 RNA, including RNA and m27,3'OMeG(5')ppp(5')m2'-OMeApG. [ka]
[0132] The following is another exemplary Cap1 RNA. [ka]
[0133] The following is an example of ARCA. [ka]
[0134] 5'-UTR and proximal sequence In some embodiments, the nucleic acids (e.g., DNA, RNA) used in accordance with this disclosure include a 5'-UTR. In some embodiments, the 5'-UTR may include a plurality of distinct sequence elements, and in some embodiments, such plurality of sequence elements may be or include a plurality of copies of one or more particular sequence elements (e.g., they may originate from a particular source or otherwise be known as a functional or characteristic sequence element). In some embodiments, the 5'UTR includes a plurality of different sequence elements.
[0135] The term “untranslated region” or “UTR” is commonly used in the art to refer to a region in a DNA molecule that is transcribed but not translated into an amino acid sequence, or a corresponding region in an RNA molecule such as an mRNA molecule. Untranslated regions (UTRs) may be present in the 5' (upstream) (5'-UTR) and / or the 3' (downstream) (3'-UTR) of the open reading frame. If present, the 5'-UTR is located at the 5' end upstream of the start codon of the polypeptide (e.g., protein) coding region. The 5'-UTR is located downstream of the 5'-cap (if present), for example, directly adjacent to the 5'-cap.
[0136] In some embodiments of this disclosure, the 5'UTR is a heterologous 5'UTR, i.e., a naturally occurring 5'UTR associated with a different ORF. In other embodiments, the 5'UTR is a synthetic 5'UTR, i.e., one that does not exist in nature. In some embodiments, a synthetic 5'UTR may be utilized, such as a 5'UTR whose sequence has been modified relative to a parent reference 5'UTR. Those skilled in the art will recognize, for example, a variety of 5'UTR sequence modifications that may be reported to increase the expression of the associated ORF.
[0137] To give just a few examples, in some embodiments, the 5'UTR used may be, or include, a gene such as an α-globin or β-globin gene (e.g., as described in U.S. Patent No. 8,278,063 and / or U.S. Patent No. 9,012,219), such as Xenopus or human α-globin, β-globin, or oc-globin, human cytochrome b-245a polypeptide, hydroxysteroid (17b) dehydrogenase, or tobacco etch virus (e.g., as described in U.S. Patent No. 8,278,063 and / or U.S. Patent No. 9,012,219). CMV immediate early 1 (IE1) genes (e.g., as described in US2014 / 0206753, W02013 / 185069); HSD17B4, RPL32, ASAH1, ATP5A1, MP68, NDUFA4, NOSIP, RPL31, SLC7A3, TUBB4B, UBQLN2, PSMB3, RPS9, CASP1, COX6B1, NDUFA1, Rpl31, GNAS, ALB7. In some embodiments, the 5'UTR is the 5'UTR from an α-globin gene, or a variant thereof, or includes it.
[0138] In some embodiments, the 5'UTR used is the 5'UTR of the top gene, for example, the 5'UTR of the top gene lacking the 5'TOP motif (oligopyrimidine tract) (as described in, for example, WO / 2015 / 101414, WO2015 / 101415, WO / 2015 / 062738, WO2015 / 024667, WO2015 / 024667), or the 5'UTR of the ribosomal protein Large32 (L32) gene. These are the R element (e.g., as described in WO / 2015 / 101414, WO2015 / 101415, WO / 2015 / 062738), the 5'UTR element of the hydroxysteroid (17-β) dehydrogenase 4 gene (HSD17B4) (e.g., as described in WO2015 / 024667), or the 5'UTR element of ATP5Al (e.g., as described in WO2015 / 024667).
[0139] In some embodiments, an internal ribosome entry site (IRES) is used instead of or in addition to the 5'UTR.
[0140] In some embodiments, the 5'UTR used in accordance with this disclosure is the sequence: [ka] It is either or includes it. In some embodiments, the 5'UTR used in accordance with this disclosure is the sequence: [ka] It is either or includes it. In some embodiments, the 5'UTR may be or include the sequence GGGAUCCUACC (see, for example, WO2014 / 144196). In some embodiments, the 5'UTR may be or include the sequence described in one of sequence numbers 231-252 or 22848-22875 of WO2021 / 156267, or any fragment or variant thereof. In some embodiments, the 5'UTR may be or include one or more sequences described in claim 9 of WO2019 / 077001A1 and / or sequence numbers 1-20, or any fragment or variant thereof. In some embodiments, 5'UTR may be one or more of those described in WO2013 / 143700, for example, sequence numbers 1-1363, 1395, 1421, and 1422 of WO2013 / 143700, or any fragment or variant thereof. In some embodiments, 5'-UTR may be 5'UTR described in WO2016 / 107877, for example, sequence numbers 25-30 or 319-382 of WO2016 / 107877, or any fragment or variant thereof. In some embodiments, 5'-UTR may be 5'UTR described in WO2017 / 036580, for example, sequence numbers 1-151 of WO2017 / 036580, or any fragment or variant thereof. In some embodiments, the 5'UTR may be, or include, the 5'UTRs described in WO2016 / 022914, for example, SEQ ID NOs. 3 to 19 of WO2016 / 022914, or any of the above fragments or variants. In some embodiments, the 5'UTR may include a first polynucleotide fragment and a second polynucleotide fragment from a source and / or different sources (see, for example, the 5'UTR described in U.S. Patent Application Publication 2010 / 0293625 and PCT / US2014 / 069155). In some embodiments, the 5'UTR utilized in accordance with this disclosure may include, for example, a cap-proximal sequence as disclosed herein.In some embodiments, the cap proximal sequence includes a sequence adjacent to the 5'-cap. In some embodiments, the cap proximal sequence includes nucleotides at the +1, +2, +3, +4, and / or +5 positions of the RNA polynucleotide.
[0141] In some embodiments, the Cap structure includes one or more polynucleotides in the cap proximal sequence. In some embodiments, the Cap structure includes an m7 guanosine cap and nucleotide +1 (N1) of the RNA polynucleotide. In some embodiments, the Cap structure includes an m7 guanosine cap and nucleotide +2 (N2) of the RNA polynucleotide. In some embodiments, the Cap structure includes an m7 guanosine cap and nucleotides +1 and +2 (N1 and N2) of the RNA polynucleotide.
[0142] Those skilled in the art will understand, by reading this disclosure, that in some embodiments, one or more residues of the cap proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) may be included in the RNA by being contained in a cap entity (e.g., a Cap1 structure). Alternatively, in some embodiments, at least some of the residues of the cap proximal sequence may be enzymatically added (e.g., by a polymerase such as T7 polymerase). For example, in a particular exemplary embodiment, an m27,3'-OGppp(m12'-O)ApG cap is utilized, where +1 and +2 are the (m12'-O)A and G residues of the cap, and +3, +4, and +5 are added by a polymerase (e.g., T7 polymerase).
[0143] In some embodiments, the cap proximal sequence includes N1 and N2 of the Cap structure, where N1 and N2 are any nucleotides, e.g., A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
[0144] In some embodiments, N1 is A and N2 is A. In some embodiments, N1 is A and N2 is C. In some embodiments, N1 is A and N2 is G. In some embodiments, N1 is A and N2 is U.
[0145] In some embodiments, N1 is C and N2 is A. In some embodiments, N1 is C and N2 is C. In some embodiments, N1 is C and N2 is G. In some embodiments, N1 is C and N2 is U.
[0146] In some embodiments, N1 is G and N2 is A. In some embodiments, N1 is G and N2 is C. In some embodiments, N1 is G and N2 is G. In some embodiments, N1 is G and N2 is U.
[0147] In some embodiments, N1 is U and N2 is A. In some embodiments, N1 is U and N2 is C. In some embodiments, N1 is U and N2 is G. In some embodiments, N1 is U and N2 is U.
[0148] In some embodiments, the cap proximal sequence includes N1 and N2 as well as N3, N4 and N5 of the Cap structure, where N1-N5 correspond to the +1, +2, +3, +4, and / or +5 positions of the RNA polynucleotide.
[0149] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A, and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is A.
[0150] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is A.
[0151] In some embodiments, N1, N2, N3, N4, or N5 is any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is A.
[0152] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is A.
[0153] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A, and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is G.
[0154] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is G.
[0155] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is G.
[0156] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is G.
[0157] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A, and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is C.
[0158] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is C.
[0159] In some embodiments, N1, N2, N3, N4, or N5 is any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is C.
[0160] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is C.
[0161] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is U.
[0162] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is U.
[0163] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is U.
[0164] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A, and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is U.
[0165] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is A.
[0166] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is A.
[0167] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is A.
[0168] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is A.
[0169] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is G.
[0170] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is G.
[0171] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is G.
[0172] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is G.
[0173] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is C.
[0174] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is C.
[0175] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is C.
[0176] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is C.
[0177] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is U.
[0178] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is U.
[0179] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is U.
[0180] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is U.
[0181] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is A.
[0182] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is A.
[0183] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is A.
[0184] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is A.
[0185] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is G.
[0186] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is G.
[0187] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is G.
[0188] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is G.
[0189] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is C.
[0190] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is C.
[0191] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is C.
[0192] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is C.
[0193] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is U.
[0194] In some embodiments, N1, N2, N3, N4, or N5 is any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is U.
[0195] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is U.
[0196] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is U.
[0197] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is A.
[0198] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is A.
[0199] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is A.
[0200] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is A.
[0201] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is G.
[0202] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is G.
[0203] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is G.
[0204] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is G.
[0205] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is C.
[0206] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is C.
[0207] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is C.
[0208] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is C.
[0209] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is U.
[0210] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is U.
[0211] In some embodiments, N1, N2, N3, N4, or N5 are any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is U.
[0212] In some embodiments, N1, N2, N3, N4, or N5 is any nucleotide, for example, A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is U.
[0213] In some embodiments, the 5'UTR disclosed herein includes, for example, a cap proximal sequence as disclosed herein. In some embodiments, the cap proximal sequence includes a sequence adjacent to the 5'-cap. In some embodiments, the cap proximal sequence includes nucleotides at the +1, +2, +3, +4, and / or +5 positions of the RNA polynucleotide.
[0214] In some embodiments, the Cap structure includes one or more polynucleotides in the cap proximal sequence. In some embodiments, the Cap structure includes an m7 guanosine cap and nucleotide +1 (N1) of the RNA polynucleotide. In some embodiments, the Cap structure includes an m7 guanosine cap and nucleotide +2 (N2) of the RNA polynucleotide. In some embodiments, the Cap structure includes an m7 guanosine cap and nucleotides +1 and +2 (N1 and N2) of the RNA polynucleotide.
[0215] In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
[0216] In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
[0217] In some embodiments, N1 is A and N2 is A. In some embodiments, N1 is A and N2 is C. In some embodiments, N1 is A and N2 is G. In some embodiments, N1 is A and N2 is U.
[0218] In some embodiments, N1 is C and N2 is A. In some embodiments, N1 is C and N2 is C. In some embodiments, N1 is C and N2 is G. In some embodiments, N1 is C and N2 is U.
[0219] In some embodiments, N1 is G and N2 is A. In some embodiments, N1 is G and N2 is C. In some embodiments, N1 is G and N2 is G. In some embodiments, N1 is G and N2 is U.
[0220] In some embodiments, N1 is U and N2 is A. In some embodiments, N1 is U and N2 is C. In some embodiments, N1 is U and N2 is G. In some embodiments, N1 is U and N2 is U.
[0221] In some embodiments, the cap proximal sequence includes sequences comprising N1 and N2 of the Cap structure and A3A4X5. In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is selected from A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.
[0222] In some embodiments, the cap proximal sequence includes sequences comprising capping structures N1 and N2, and C3A4X5. In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is selected from A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.
[0223] In some embodiments, the cap proximal sequence includes the capping structure N1 and N2, and the sequence X3Y4X5. In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 are each independently selected from A, C, G, or U. In some embodiments, X3 and / or X5 is A. In some embodiments, X3 and / or X5 is C. In some embodiments, X3 and / or X5 is G. In some embodiments, X3 and / or X5 is U. In some embodiments, Y4 is not C. In some embodiments, Y4 is A. In some embodiments, Y4 is G. In some embodiments, Y4 is U.
[0224] In some embodiments, the cap proximal sequence includes the capping structure N1 and N2, and the sequence X3Y4X5. In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 are each independently selected from A, C, G, or U. In some embodiments, X3 and / or X5 is A. In some embodiments, X3 and / or X5 is C. In some embodiments, X3 and / or X5 is G. In some embodiments, X3 and / or X5 is U. In some embodiments, Y4 is not G. In some embodiments, Y4 is A. In some embodiments, Y4 is C. In some embodiments, Y4 is U.
[0225] In some embodiments, the capping proximal sequence includes the capping structures N1 and N2, as well as the sequence containing A3C4A5. In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G.
[0226] In some embodiments, the capping proximal sequence includes the capping structure N1 and N2, as well as the sequence containing A3U4G5. In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G.
[0227] In some embodiments, the Cap structure includes one or more polynucleotides in the cap proximal sequence. In some embodiments, the Cap structure includes an m7 guanosine cap and nucleotide +1 (N1) of the RNA polynucleotide. In some embodiments, the Cap structure includes an m7 guanosine cap and nucleotide +2 (N2) of the RNA polynucleotide. In some embodiments, the Cap structure includes an m7 guanosine cap and nucleotides +1 and +2 (N1 and N2) of the RNA polynucleotide.
[0228] In some embodiments, N1 and N2 are any nucleotides, for example, A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
[0229] In some embodiments, N1 and N2 are any nucleotides, for example, A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
[0230] In some embodiments, N1 is A and N2 is A. In some embodiments, N1 is A and N2 is C. In some embodiments, N1 is A and N2 is G. In some embodiments, N1 is A and N2 is U.
[0231] In some embodiments, N1 is C and N2 is A. In some embodiments, N1 is C and N2 is C. In some embodiments, N1 is C and N2 is G. In some embodiments, N1 is C and N2 is U.
[0232] In some embodiments, N1 is G and N2 is A. In some embodiments, N1 is G and N2 is C. In some embodiments, N1 is G and N2 is G. In some embodiments, N1 is G and N2 is U.
[0233] In some embodiments, N1 is U and N2 is A. In some embodiments, N1 is U and N2 is C. In some embodiments, N1 is U and N2 is G. In some embodiments, N1 is U and N2 is U.
[0234] In some embodiments, the cap proximal sequence includes sequences N1 and N2 of the Cap structure and A3A4X5. In some embodiments, N1 and N2 are any nucleotides, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is selected from A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.
[0235] In some embodiments, the cap proximal sequence includes sequences N1 and N2 of the Cap structure and C3A4X5. In some embodiments, N1 and N2 are any nucleotides, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is any nucleotide, e.g., A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.
[0236] In some embodiments, the cap proximal sequence includes the sequence containing N1 and N2 of the capping structure, as well as X3Y4X5. In some embodiments, N1 and N2 are any nucleotides, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 are any nucleotides, e.g., A, C, G, or U. In some embodiments, X3 and / or X5 is A. In some embodiments, X3 and / or X5 is C. In some embodiments, X3 and / or X5 is G. In some embodiments, X3 and / or X5 is U. In some embodiments, Y4 is not C. In some embodiments, Y4 is A. In some embodiments, Y4 is G. In some embodiments, Y4 is U.
[0237] In some embodiments, the cap proximal sequence includes the sequence containing N1 and N2 of the capping structure, as well as X3Y4X5. In some embodiments, N1 and N2 are any nucleotides, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 are any nucleotides, e.g., A, C, G, or U. In some embodiments, X3 and / or X5 is A. In some embodiments, X3 and / or X5 is C. In some embodiments, X3 and / or X5 is G. In some embodiments, X3 and / or X5 is U. In some embodiments, Y4 is not G. In some embodiments, Y4 is A. In some embodiments, Y4 is C. In some embodiments, Y4 is U.
[0238] In some embodiments, the cap proximal sequence includes N1 and N2 of the Cap structure, as well as a sequence containing A3C4A5. In some embodiments, N1 and N2 are any nucleotides, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G.
[0239] In some embodiments, the cap proximal sequence includes N1 and N2 of the Cap structure, as well as a sequence containing A3U4G5. In some embodiments, N1 and N2 are any nucleotides, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G.
[0240] Examples of 5'UTRs include human alpha-globin (hAg) 5'UTR or fragments thereof, TEV 5'UTR or fragments thereof, HSP70 5'UTR or fragments thereof, or c-Jun 5'UTR or fragments thereof.
[0241] In some embodiments, the RNA disclosed herein comprises the hAg 5'UTR or a fragment thereof.
[0242] 3'UTR In some embodiments, the RNA described herein includes a 3'-UTR. The terms “3' untranslated region,” “3'-UTR,” or “3'-UTR element” will be recognized and understood by those skilled in the art. As known in the art, the 3'-UTR is typically a portion of a nucleic acid molecule located 3' (i.e., downstream) of a coding sequence and not translated into a protein. In some embodiments, the 3'-UTR may be located between the coding sequence and a (optionally chosen) terminal poly(A) sequence. In some embodiments, the 3'-UTR may include elements for controlling gene expression, such as regulatory elements. Such regulatory elements may be, or include, ribosome-binding sites, miRNA-binding sites, etc.
[0243] If present, the 3'-UTR is located at the 3' end downstream of the terminal codon of the polypeptide (e.g., protein) coding region, but the term "3'-UTR" preferably does not include the poly(A) sequence. Therefore, the 3'-UTR is upstream of the poly(A) sequence (if present) and, for example, directly adjacent to the poly(A) sequence.
[0244] In some embodiments, the RNA disclosed herein includes a 3'UTR containing an F element and / or an I element. In some embodiments, the 3'UTR or a proximal sequence thereto includes a restriction site. In some embodiments, the restriction site is a BamHI site. In some embodiments, the restriction site is an XhoI site.
[0245] In some embodiments, the RNA construct includes an F element. In some embodiments, the F element sequence is the 3'-UTR of the split amino-terminal enhancer (AES).
[0246] In some embodiments, the RNA disclosed herein includes a 3'UTR having 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to a 3'UTR having a sequence including CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCUCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC (SEQ ID NO: 60). In some embodiments, the RNA disclosed herein includes a 3'UTR provided in SEQ ID NO: 60.
[0247] In some embodiments, 3'UTR is an FI element as described in WO2017 / 060314.
[0248] To give just a few examples, in some embodiments, the 3'UTR used may be or may include 3'UTRs from genes such as globin UTRs, including Xenopus β-globin UTRs and human β-globin UTRs (see, for example, 8278063, 9012219, US2011 / 0086907). In some embodiments, modified β-globin constructs with improved stability in some cell types may be used, such constructs have been reported to be produced by cloning two consecutive human β-globin 3'UTRs from head to tail (US2012 / 0195936, W02014 / 071963). In addition, α2-globin, α1-globin, UTRs, and their variants are also known in the art (W02015 / 101415, W02015 / 024667). Examples of 3'UTRs described in mRNA constructs in non-patent literature include those from CYBA (Ferizi et al., 2015) and albumin (Thess et al., 2015). In some embodiments, exemplary 3'UTRs include those from bovine or human growth hormone (wild-type or modified) (W02013 / 185069, US2014 / 0206753, W02014152774), rabbit β-globin and hepatitis B virus (HBV), α-globin 3'UTR, and viral VEEV 3'UTR sequences, as well as those known in the art. In some embodiments, the sequence UUUGAAUU (W02014 / 144196) is used. In some embodiments, 3'UTRs from human and / or mouse ribosomal proteins are used. In some embodiments, examples include rps9 3'UTR (W02015 / 101414), FIG4 (W02015 / 101415), and human albumin 7 (W02015 / 101415).In some embodiments, the nucleic acid comprises at least one heterologous 3'-UTR, the at least one heterologous 3'-UTR comprising a 3'-UTR of a gene selected from PSMB3, ALB7, alpha-globin (referred to as "muag"), CASP1, COX6B1, GNAS, NDUFA1, and RPS9, or a nucleic acid sequence derived from a homolog, fragment, or variant of any one of these genes.
[0249] In some embodiments, the 3'UTR used may be exemplified, for example, in the published PCT application WO2019 / 077001A1, particularly in claim 9 of WO2019 / 077001A1. In some embodiments, the 3'UTR may be one of sequence numbers 23-34 of WO2019 / 077001A1, or a fragment or variant thereof, or may include them. In some embodiments, the 3'UTR used in accordance with this disclosure is sequence: [ka] Includes. In some embodiments, the 3'UTR of the present disclosure is the array: [ka] Includes. In some embodiments, the nucleic acid may include 3'-UTRs described in WO2016 / 107877. In some embodiments, preferred 3'-UTRs are sequence numbers 1-24 and 49-318 of WO2016 / 107877, or fragments or variants of these sequences. In some embodiments, 3'-UTRs described in WO2017 / 036580 may be used. In some embodiments, preferred 3'-UTRs are sequence numbers 152-204 of WO2017 / 036580, or fragments or variants of these sequences. In some embodiments, 3'-UTRs described in WO2016 / 022914 are used. In some embodiments, the 3'-UTR is or includes sequences described in sequence numbers 20-36 of WO2016 / 022914, or fragments or variants of these sequences.
[0250] Poly A In some embodiments, the polynucleotides (e.g., DNA, RNA) disclosed herein include, for example, a polyadenylate (poly-A) sequence as described herein. In some embodiments, the poly-A sequence is located downstream of the 3'-UTR, for example, adjacent to the 3'-UTR.
[0251] As used herein, the terms “poly(A) sequence” or “polyA tail” typically refer to an uninterrupted or interrupted sequence of adenylate residues located at the 3' end of an RNA polynucleotide. Poly(A) sequences are known to those skilled in the art and may follow the 3'-UTR in the RNA described herein. An uninterrupted poly(A) sequence is characterized by a continuous sequence of adenylate residues. In nature, uninterrupted poly(A) sequences are typical. In some embodiments, the polynucleotides disclosed herein include an uninterrupted poly(A) sequence. In some embodiments, the polynucleotides disclosed herein include an interrupted poly(A) sequence. In some embodiments, the RNA disclosed herein may have a poly(A) sequence attached to the free 3' end of the RNA by a template-independent RNA polymerase after transcription, or a poly(A) sequence encoded by DNA and transcribed by a template-dependent RNA polymerase.
[0252] A poly(A) sequence of approximately 120 A nucleotides has been shown to have beneficial effects on RNA levels in transfected eukaryotic cells, as well as on the levels of polynucleotides (e.g., proteins) translated from the open reading frame located upstream (5') of the poly(A) sequence (Holtkamp et al., 2006, Blood, vol.108, pp.4009-4017).
[0253] In some embodiments, the poly(A) sequences according to this disclosure are not limited to a specific length, and in some embodiments, the poly(A) sequences are of any length. In some embodiments, the poly(A) sequence contains, essentially consists of, or comprises at least 10, at least 20, at least 30, at least 40, at least 80, or at least 100, and up to 1000, up to 500, up to 400, up to 300, up to 200, or up to 150 A nucleotides, particularly about 120 A nucleotides. In this context, “essentially consists of” means that the majority of nucleotides in the poly(A) sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, depending on the number of nucleotides in the poly(A) sequence, are A nucleotides, but the remaining nucleotides may be other nucleotides, such as U nucleotides (uridylate), G nucleotides (guanylate), or C nucleotides (cytidylate). In this context, "consists of" means that all nucleotides in a poly(A) sequence, i.e., 100% are A nucleotides, based on the number of nucleotides in the poly(A) sequence. The term "A nucleotide" or "A" refers to adenylate.
[0254] In some embodiments, the poly(A) sequence is attached to a DNA template containing repeating dT nucleotides (deoxythymidylates) on a strand complementary to the coding strand during RNA transcription, for example, during the preparation of RNA transcribed in vitro. The DNA sequence encoding the poly(A) sequence (coding strand) is referred to as the poly(A) cassette.
[0255] In some embodiments, poly(A) cassettes present in the coding strand of DNA are essentially composed of dA nucleotides but interrupted by a random sequence of four nucleotides (dA, dC, dG, and dT). Such random sequences may be 5–50, 10–30, or 10–20 nucleotides long. Such cassettes are disclosed in WO2016 / 005324A1, which is incorporated herein by reference. Any poly(A) cassette disclosed in WO2016 / 005324A1 may be used in accordance with this disclosure. A poly(A) cassette, essentially composed of dA nucleotides but having an equal distribution of four nucleotides (dA, dC, dG, and dT) and interrupted by a random sequence having, for example, a length of 5–50 nucleotides, exhibits, at the DNA level, a constant proliferation of plasmid DNA in E. coli, and at the RNA level, also contains properties that are beneficial in terms of supporting RNA stability and translation efficiency. In some embodiments, the poly(A) sequence contained in the RNA polynucleotide described herein is essentially composed of A nucleotides but is interrupted by a random sequence of four nucleotides (A, C, G, U). Such a random sequence may be 5–50, 10–30, or 10–20 nucleotides long.
[0256] In some embodiments, nucleotides other than A nucleotides are not adjacent to the poly(A) sequence at their 3' end; that is, the poly(A) sequence is either not masked or not followed by a nucleotide other than A at its 3' end.
[0257] In some embodiments, the poly(A) sequence may comprise at least 20, at least 30, at least 40, at least 80, or at least 100, and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence may consist essentially of at least 20, at least 30, at least 40, at least 80, or at least 100, and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence may consist of at least 20, at least 30, at least 40, at least 80, or at least 100, and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence comprises at least 100 nucleotides. In some embodiments, the poly(A) sequence comprises about 150 nucleotides. In some embodiments, the poly(A) sequence comprises about 120 nucleotides.
[0258] In some embodiments, the polyA tail comprises a specific number of adenosines such as about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 120, or about 150 or about 200. In some embodiments, the polyA tail of the string construct may comprise 200 or fewer A residues. In some embodiments, the polyA tail of the string construct may comprise about 200 A residues. In some embodiments, the polyA tail of the string construct may comprise 180 or fewer A residues. In some embodiments, the polyA tail of the string construct may comprise about 180 A residues. In some embodiments, the polyA tail may comprise 150 or fewer residues.
[0259] In some embodiments, the poly(A) sequence may comprise from about 10 to about 500 adenosine nucleotides, from about 10 to about 200 adenosine nucleotides, from about 40 to about 200 adenosine nucleotides, or from about 40 to about 150 adenosine nucleotides. In some embodiments, the length of the poly(A) sequence may be at least about 10, 50, 64, 75, 100, 200, 300, 400, or 500 or more adenosine nucleotides.
[0260] In some embodiments, the nucleic acid comprises at least one poly(A) sequence comprising from about 30 to about 200 adenosine nucleotides. In some embodiments, the poly(A) sequence comprises about 64 adenosine nucleotides (A64). In some embodiments, the poly(A) sequence comprises about 100 adenosine nucleotides (A100). In some embodiments, the poly(A) sequence comprises about 150 adenosine nucleotides.
[0261] In some embodiments, the nucleic acid comprises at least one poly(A) sequence comprising about 100 adenosine nucleotides, and the poly(A) sequence is interrupted by non-adenosine nucleotides, preferably by 10 non-adenosine nucleotides (A30-N10-A70).
[0262] Open reading frame In some embodiments, the RNA produced according to the techniques provided herein comprises an open reading frame (ORF), which, for example, encodes a polypeptide of interest or encodes a plurality of polypeptides of interest. In some embodiments, the RNA produced according to the techniques provided herein comprises a plurality of ORFs (e.g., encoding a plurality of polypeptides). In some embodiments, the RNA produced according to the techniques herein comprises a single ORF encoding a plurality of polypeptides. In some such embodiments, the polypeptide is or comprises an antigen or an epitope thereof (e.g., a related antigen).
[0263] To give some examples, in some embodiments, the encoded polypeptide may be an antigen or its epitope, or may contain an antigen or its epitope, such that when the provided RNA is expressed in the subject to which it is administered, it results in an immune response (e.g., characterized by antibodies and / or T cells specifically directed to the antigen or one or more epitopes thereof). In some such embodiments, for example, the encoded polypeptide comprising multiple polypeptide elements may be a polyepitope, each comprising at least one epitope, linked to one another, and optionally separated by a linker. As is understood in the art, in some embodiments, a polyepitope construct may contain individual epitopes found in different parts of the same protein in nature. Alternatively or additionally, in some embodiments, a polyepitope construct may contain individual epitopes found in different proteins in nature.Those skilled in the art will recognize various considerations relating to the selection of a useful and desired polyepitope construct and / or antigen and / or epitope to be contained therein in accordance with this disclosure (e.g., WO2014082729, WO2012159754, WO2017173321, WO2014180659, WO20161283762, WO2017194610, WO2011143656, WO2015103037, Nielsen JS, et al. J Immunol Methods. 2010 Aug 31;360(1-2):149-56., “Polyepitope Vaccine Technology.” Polyepitope Vaccine Technology-Creative See Biolabs, www.creative-biolabs.com / vaccine / polyepitope-vaccine-technology.htm., Li, L. et al. Genome Med 13, 56 (2021)., Cafri G. et al. Journal of Clinical Investigation 130, 5976-5988 (2020)., Khairkhah N. et al. (2020) PLOS ONE 15(10):e0240577.
[0264] In some embodiments, the relevant antigen may be an infectious antigen (i.e., an antigen associated with an infectious agent such as an infectious virus, bacteria, or fungus) and / or a cancer antigen (e.g., an antigen associated with a class of tumor or a specific tumor; in some embodiments, the cancer-related antigen may be or include a novel antigen or novel epitope) or an epitope thereof.
[0265] Alternatively or additionally, in some embodiments, the ORF may encode, for example, an antibody or a portion thereof (e.g., an antigen-binding portion), an enzyme, a cytokine, a therapeutic protein, etc. (see, e.g., WO2017186928, WO2017191274, US10669322, Dammes et al Trens Pharmacol Sci 4:755, 2020-10-01, Wang et al Nature Reviews Drug Discovery 19, 441-442 (2020), Damase et al Front.Bioeng.Biotechnol., 18 March 2021).
[0266] In some embodiments, the ORF for use according to this disclosure encodes a polypeptide comprising a signal sequence that is functional in mammalian cells, for example.
[0267] In some embodiments, the signal sequence used is "intrinsic" in nature in that it associates with (e.g., ligates with) the encoded polypeptide.
[0268] In some embodiments, the signal sequence used is heterogeneous to the encoded polypeptide, for example, not a native part of the polypeptide (e.g., a protein) that contains the encoded polypeptide.
[0269] In some embodiments, the signal peptide is typically a sequence characterized by a length of approximately 15–30 amino acids.
[0270] In many embodiments, the signal peptide is located at the N-terminus of the encoded polypeptide described herein, but is not limited thereto. In some embodiments, the signal peptide preferably enables the transport of the polypeptide encoded by the RNA of the present disclosure to a specified cellular compartment, preferably the cell surface, endoplasmic reticulum (ER), or endosomal-lysosome compartment.
[0271] In some embodiments, the signal sequence is selected from S1S2 signal peptides (aa1-19), immunoglobulin secretion signal peptides (aa1-22), HSV-1 gD signal peptide (MGGAAARLGAVILFVVIVGLHGVRSKY), HSV-2 gD signal peptide (MGRLTSGVGTAALLVVAVGLRVVCA), human SPARC signal peptide, human insulin isoform 1 signal peptide, human albumin signal peptide, etc. Those skilled in the art will recognize, for example, other secretion signal peptides such as those disclosed in WO2017 / 081082 (e.g., SEQ ID NOs: 1-1115 and 1728, or fragment variants thereof) and WO2019008001.
[0272] In some embodiments, the RNA sequence includes a signal sequence (e.g., a secretory sequence) such as those listed in Table 1, or sequences having at least one, two, three, four, or five amino acid differences therefrom, or otherwise encodes an epitope that can be ligated thereto. In some embodiments, a signal sequence such as MFVFLVLLPLVSSQCVNLT, or a sequence having at least one, two, three, four, or up to five amino acid differences therefrom, is used. In some embodiments, a sequence such as MFVFLVLLPLVSSQCVNLT, or a sequence having at least one, two, three, four, or up to five amino acid differences therefrom, is used.
[0273] In some embodiments, the signal sequence is selected from those included in Table 1 below and / or those encoded by the sequences in Table 2 below. [Table 1] [Table 2]
[0274] In some embodiments, the RNA utilized as described herein encodes a multimerization element (e.g., a heteromultimerization element). In some embodiments, the heteromultimerization element includes a dimerization, trimerization, or tetramerization element.
[0275] In some embodiments, the multimerization element is as described in WO2017 / 081082 (e.g., SEQ ID NOs: 1116 - 1167, or fragments or variants thereof).
[0276] Exemplary trimerization and tetramerization elements include, but are not limited to, engineered leucine zippers, the fibritin foldon domain from enterobacteria phage T4, GCN4pll, GCN4 - pll, and p53.
[0277] In some embodiments, the provided encoded polypeptide(s) can form a trimer complex. For example, the encoded polypeptide(s) utilized can include a domain that enables the formation of a multimer complex, such as a specific trimer complex of an amino acid sequence including the encoded polypeptide(s) described herein. In some embodiments, the domain that enables the formation of a multimer complex includes a trimerization domain, such as the trimerization domain described herein.
[0278] In some embodiments, the encoded polypeptide(s) can be modified, for example, by adding a "foldon" trimerization domain derived from T4 - fibritin to increase its immunogenicity.
[0279] In some embodiments, the RNA described herein encodes a membrane - associated element (e.g., a heteromembrane - associated element) such as a transmembrane domain.
[0280] A transmembrane domain can be N-terminus, C-terminus, or inside the encoded polypeptide. The coding sequence of a transmembrane element is typically located within the frame (i.e., the same reading frame) (5', 3', or inside) of the coding sequence of the sequence to which it is linked (e.g., the sequence encoding the polypeptide(s)).
[0281] In some embodiments, the transmembrane domain includes or is the transmembrane domain of influenza virus hemagglutinin (HA), HIV-1 Env, equine infectious anemia virus (EIAV), mouse leukemia virus (MLV), mouse mammary cancer tumor virus, vesicular stomatitis virus (VSV) G protein, rabies virus, or one of the seven transmembrane domain receptors.
[0282] Codon optimization In some embodiments, the ORF-coding polypeptides of this disclosure are codon-optimized. Codon optimization methods are known in the art. For example, one or more ORFs among the sequences provided herein may be codon-optimized. In some embodiments, codon optimization may be used to match codon frequencies in the target organism and the host organism to ensure proper folding; to bias the GC content to increase mRNA stability or reduce secondary structures; to minimize tandem repeat codons or base runs that may impair gene construction or expression; to customize transcriptional and translational regulatory regions; to insert or remove polypeptide transport sequences; to remove / add post-translational modification sites (e.g., glycosylation sites) in the encoded polypeptide; to add, remove, or shuffle protein domains; to insert or delete restriction sites; to modify ribosome binding sites and mRNA degradation sites; to adjust the translation rate so that various domains of the polypeptide fold properly; or to reduce or eliminate problematic secondary structures within polynucleotides. Codon optimization tools, algorithms, and services are publicly known in the art, and non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park, CA), and / or proprietary methods. In some embodiments, open reading frame (ORF) sequences are optimized using optimization algorithms.
[0283] In some embodiments, the codon-optimized sequence shares less than 95% sequence identity with a naturally occurring or wild-type sequence ORF (e.g., a naturally occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, the codon-optimized sequence shares less than 90% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, the codon-optimized sequence shares less than 85% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, the codon-optimized sequence shares less than 80% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, the codon-optimized sequence shares less than 75% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a polypeptide).
[0284] In some embodiments, the codon-optimized sequence shares 65% to 85% (e.g., about 67% to about 85% or about 67% to about 80%) sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, the codon-optimized sequence shares 65% to 75% or about 80% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally occurring or wild-type mRNA sequence encoding a polypeptide).
[0285] In some embodiments, the codon-optimized sequence encodes a polypeptide (e.g., an antigen) that is immunogenic to the polypeptide encoded by the non-codon-optimized sequence, or is immunogenic to the polypeptide that
[0286] In some embodiments, when transfected into mammalian host cells, the modified mRNA has stability for 12–18 hours, or more than 18 hours, for example, 24, 36, 48, 60, 72, or more than 72 hours, and can be expressed by mammalian host cells.
[0287] In some embodiments, codon-optimized RNA may have an improved G / C level and / or improved A / U ratio. In some embodiments, the G / C content of a nucleic acid molecule (e.g., mRNA) can affect RNA stability. RNA with increased amounts of guanine (G) and / or cytosine (C) residues may be more functionally stable than RNA containing large amounts of adenine (A) and thymine (T) or uracil (U) nucleotides. As an example, WO02 / 098443 discloses a pharmaceutical composition containing mRNA stabilized by sequence modification within the coding region. In some embodiments, due to the degeneracy of the genetic code, the modification works by substituting existing codons with those that promote greater RNA stability, for example, without altering the resulting amino acids. In some embodiments, the approach is limited to the coding region of the RNA.
[0288] Nucleotide content In some embodiments, the RNA and / or ORF described herein comprises a specific composition of nucleotide triphosphates, and in some embodiments, the RNA and / or ORF described herein is not limited to comprising any specific composition of nucleotide triphosphates.
[0289] In some embodiments, the ORF and / or RNA molecule comprises a molar ratio of x total cytidines and / or one or more functional cytidine analogs to total guanosine and / or one or more functional guanosine analogs. In some embodiments, the ORF and / or RNA molecule comprises a molar ratio y of total cytidines and / or one or more functional cytidine analogs to total uridines and / or one or more functional uridine analogs. In some embodiments, the ORF and / or RNA molecule comprises a molar ratio z of total cytidines and / or one or more functional cytidine analogs to total adenosine and / or one or more functional adenosine analogs. In some such embodiments, the molar ratio of x is 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0. In some such embodiments, the molar ratio of y is 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0. In some such embodiments, the molar ratio of y is 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0.In some such embodiments, the molar ratio of z is 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0.
[0290] In some embodiments, the relevant molar ratios in RNA and / or ORF differ from the corresponding ratios in the reaction mixture.
[0291] In some embodiments, the ORF and / or RNA molecules contain nucleotides of 15%, 20%, 25%, 30%, 35%, 40% or more of ATP and / or one or more functional ATP analogs. In some embodiments, the ORF and / or RNA molecules contain nucleotides of 15%, 20%, 25%, 30%, 35%, 40% or more of CTP and / or one or more functional CTP analogs. In some embodiments, the ORF and / or RNA molecules contain nucleotides of 15%, 20%, 25%, 30%, 35%, 40% or more of GTP and / or one or more functional GTP analogs. In some embodiments, the ORF and / or RNA molecules contain nucleotides of 15%, 20%, 25%, 30%, 35%, 40% or more of UTP and / or one or more functional UTP analogs.
[0292] In some embodiments, the ORF and / or RNA molecule comprises a molar ratio v of total adenosine and / or one or more functional adenosine analogs to total guanosine and / or one or more functional guanosine analogs. In some embodiments, the ORF and / or RNA molecule comprises a molar ratio w of total adenosine and / or one or more functional adenosine analogs to total uridine and / or one or more functional uridine analogs. In some embodiments, the ORF and / or RNA molecule comprises a molar ratio q of total adenosine and / or one or more functional adenosine analogs to total cytidine and / or one or more functional cytidine analogs. In some such embodiments, the molar ratio of v is 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0. In some such embodiments, the molar ratio of w is 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0. In some such embodiments, the molar ratio of q is 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0.
[0293] production In some embodiments, the technology provided by this disclosure achieves the production of RNA compositions and / or preparations (e.g., pharmaceutical-grade RNA preparations, including large-batch preparations) by synthesizing RNA using IVT, for example, in a bioreactor. In some embodiments, the compositions and / or preparations containing the produced RNA contain RNA at a specific concentration of at least 1 mg / mL (e.g., including at least 1.5 mg / mL, at least 2 mg / mL, at least 2.5 mg / mL, at least 3 mg / mL, at least 3.5 mg / mL, at least 4 mg / mL, at least 4.5 mg / mL, at least 5 mg / mL, and at least 6 mg / mL or more). In some embodiments, the produced RNA may be present at concentrations of 1.5 mg / mL to 5 mg / mL or 2 mg / mL to 4 mg / mL.
[0294] In some embodiments, RNA (e.g., therapeutic mRNA) is synthesized by IVT, for example, in a bioreactor, in the presence of a suitable reagent, for example, containing at least one RNA polymerase and its appropriate nucleotide triphosphate or variant (e.g., modified ribonucleotide triphosphate). In some embodiments, a bioreactor useful for IVT is large enough to accommodate at least 1 liter of IVT reaction volume, for example, containing at least 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, or 50 liters or more. In some embodiments, bioreactors particularly useful for commercial-scale IVT are large enough to accommodate an IVT reaction volume of at least 20 liters, for example, containing at least 25, 30, 40, 45, 50 liters, or more.
[0295] Exemplary starting materials DNA template Those skilled in the art will understand that nucleic acid templates (e.g., DNA templates) are used to direct the synthesis of RNA (e.g., single-stranded RNA, e.g., therapeutic RNA). In some embodiments, the DNA template is a linear DNA molecule. In some embodiments, the DNA template is a circular DNA molecule. DNA can be obtained or produced using methods known in the art, including, for example, gene synthesis, recombinant DNA technology, or a combination thereof. In some embodiments, the DNA template includes a nucleotide sequence encoding a desired transcribed region (e.g., encoding the RNA described herein) and a promoter sequence recognized by an RNA polymerase selected for use in IVT. In some embodiments, the DNA template includes a nucleotide sequence encoding a plurality of desired transcribed regions and one or more promoter sequences recognized by an RNA polymerase selected for use in IVT. Various RNA polymerases are known in the art, including, for example, DNA-dependent RNA polymerases (e.g., T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, N4 virion RNA polymerase, or variants or functional domains thereof). Those skilled in the art will readily understand that the RNA polymerases used herein may be recombinant RNA polymerases and / or purified RNA polymerases, i.e., not as part of a cell extract containing other components in addition to the RNA polymerase(s), and / or may be variants of wild-type polymerases (e.g., sharing one or more characteristic sequence elements sufficient to confer polymerization activity with such wild-type polymerases, and / or sharing at least about 50%, 60%, 70%, 80%, 85%, 90%, 95%<96%, 97%, 98%, 99% or more of sequence identity with such wild-type polymerases). In some embodiments, the polymerases used are commercially available polymerases (e.g., from sources such as ThermoFisher, New England Biolabs, etc.).Those skilled in the art will recognize a suitable promoter sequence for a selected RNA polymerase. In some embodiments, the DNA template includes the promoter sequence for T7 RNA polymerase.
[0296] In some embodiments, the DNA template includes a nucleotide sequence encoding the RNA described herein (e.g., including a nucleotide sequence encoding the polypeptide of interest, and optionally including one or more nucleotide sequences encoding characteristic elements of the RNA described herein, such as the polyA tail, 3'UTR, and / or 5'UTR). In some embodiments, such a coding sequence may be generated by gene synthesis. In some embodiments, such a coding sequence may be inserted into a vector by any suitable cloning method known in the art (e.g., cold fusion cloning, Gibson assembly, etc.).
[0297] In some embodiments, the DNA template may further include one or more of the following: a recognition sequence for a suitable restriction endonuclease (e.g., used for linearization), a suitable resistance gene, and / or a suitable origin of replication.
[0298] In some embodiments, the DNA template can be amplified from plasmid DNA via polymerase chain reaction (PCR). In some embodiments, the plasmid DNA can be obtained, for example, from bacterial cells (e.g., Escherichia coli (E. coli)) and subsequently through a plasmid isolation procedure that is free from endotoxins and animal products.
[0299] In some embodiments, the DNA template may be a linearized plasmid DNA (pDNA) template in the absence of PCR-based amplification. In some such embodiments, a cell bank or cell stock for the pDNA of interest (e.g., as described herein) may be stable. For example, in some embodiments, such a cell bank or cell stock may include a frozen stock of bacterial cells (e.g., E. coli cells such as DH10B E. coli cells) that have been genetically engineered to contain a pDNA template of interest having predetermined specifications (e.g., as described herein). In some embodiments, the pDNA contains a promoter sequence (e.g., T7 RNA polymerase). In some embodiments, the pDNA contains an endonuclease recognition sequence (e.g., for linearization). In some embodiments, the pDNA contains a resistance gene. In some embodiments, the pDNA contains an origin of replication. In some embodiments, the pDNA contains one or more of the promoter sequence, endonuclease recognition sequence, resistance gene, and / or origin of replication.
[0300] In some embodiments, the DNA template (e.g., linear DNA template) concentration (g / L IVT start volume) is at least about 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 g / L. In some embodiments, the DNA template (e.g., linear DNA template) start concentration is about 0.01–0.15, 0.02–0.14, 0.03–0.13, 0.04–0.12, 0.05–0.11, 0.06–0.11, 0.07–0.11, 0.08–0.11–0.09–0.11 g / L.
[0301] Ribonucleotides Ribonucleotides for use in in vitro transcription may comprise at least two (e.g., at least three, at least four, at least five, or at least six) different types of ribonucleotides, each type having a different nucleoside. Ribonucleotides for use in in vitro transcription may include unmodified and / or modified ribonucleotides. Unmodified ribonucleotides include the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). In some embodiments, all four types of unmodified ribonucleotides may be used in in vitro transcription.
[0302] In some embodiments, at least one type of ribonucleotide included in the in vitro transcription is a modified ribonucleotide. Modified ribonucleotides may include one or more modifications, including, for example, (a) terminal modifications, e.g., 5' terminal modifications (e.g., phosphorylation, dephosphorylation, conjugation, inversion bond, etc.), 3' terminal modifications (e.g., conjugation, inversion bond, etc.), (b) base modifications, e.g., substitution of a modified base, a stabilizing base, a destabilizing base, or a base having a base pair with an expanded repertoire of partners, or a conjugate base, (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions, and (d) nucleoside bond modifications, including modifications or substitutions of phosphodiester bonds. Such modified ribonucleotides are undesirable for use in the systems and methods described herein if such modifications interfere with translation to an extent that, for example, results in a translation reduction of 50% or more compared to the absence of the modification, as characterized, for example, using a rabbit reticulocyte in vitro translation assay.
[0303] In some embodiments, a modified ribonucleotide may have at least one nucleoside ("base") modification or substitution. Various nucleoside modifications or substitutions are known in the art, and those skilled in the art will know that modified nucleosides include, for example, inosine, xanthine, hypoxanthine, nubularin, isoguanisine, tubercidine, 2-(halo)adenine, 2-(alkyl)adenine, 2-(propyl)adenine, 2-(amino)adenine, 2-(aminoalkyl)adenine, 2-(aminopropyl)adenine, 2-(methylthio)-N6-(isopentenyl)adenine, 6-(alkyl)adenine, 6-(methyl)adenine, 7-(deaza)adenine Nine, 8-(alkenyl)adenine, 8-(alkyl)adenine, 8-(alkynyl)adenine, 8-(amino)adenine, 8-(halo)adenine, 8-(hydroxyl)adenine, 8-(thioalkyl)adenine, 8-(thiol)adenine, N6-(isopentyl)adenine, N6-(methyl)adenine, N6, N6-(dimethyl)adenine, 2-(alkyl)guanine, 2-(propyl)guanine, 6-(alkyl)guanine, 6-(methyl)guanine, 7-(alkyl)guanine, 7-(methyl)guanine, 7-(de Aza) guanine, 8-(alkyl) guanine, 8-(alkenyl) guanine, 8-(alkynyl) guanine, 8-(amino) guanine, 8-(halo) guanine, 8-(hydroxyl) guanine, 8-(thioalkyl) guanine, 8-(thiol) guanine, N-(methyl) guanine, 2-(thio) cytosine, 3-(deaza)-5-(aza) cytosine, 3-(alkyl) cytosine, 3-(methyl) cytosine, 5-(alkyl) cytosine, 5-(alkynyl) cytosine, 5-(halo) cytosine, 5-(methyl) cytosine, 5-(p Ropinyl)cytosine, 5-(propynyl)cytosine, 5-(trifluoromethyl)cytosine, 6-(azo)cytosine, N4-(acetyl)cytosine, 3-(3-amino-3 carboxypropyl)uracil, 2-(thio)uracil, 5-(methyl)-2-(thio)uracil, 5-(methylaminomethyl)-2(thio)uracil, 4-(thio)uracil, 5-(methyl)-4(thio)uracil, 5-(methylaminomethyl)-4(thio)uracil, 5-(methyl)-2,4-(dithio)uracil, 5-(methylaminomethyl)-2,4(dithio)uracil, 5-(2-aminopropyl)uracil, 5-(alkyl)uracil, 5-(alkynyl)uracil, 5-(allylamino)uracil, 5-(aminoallyl)uracil, 5-(aminoalkyl)uracil, 5-(guanidiniumalkyl)uracil, 5-(1,3-diazole-1alkyl)uracil, 5-(cyanoalkyl)uracil, 5-(dialkylaminoalkyl)uracil, 5-(dimethylaminoalkyl)uracil, 5-(halo)uracil, 5-(methoxy)uracil Uracil, Uracil-5-oxyacetic acid, 5-(methoxycarbonylmethyl)-2-(thio)uracil, 5-(methoxycarbonyl-methyl)uracil, 5-(propynyl)uracil, 5-(propynyl)uracil, 5-(trifluoromethyl)uracil, 6-(azo)uracil, dihydrouracil, N3-(methyl)uracil, 5-uracil (i.e., pseudouracil), 2-(thio)pseudracil, 4-(thio)pseudracil, 2,4-(dithio)pseudracil, 5-(alkyl Pseudouracil, 5-(methyl)pseudracil, 5-(alkyl)-2-(thio)pseudracil, 5-(methyl)-2-(thio)pseudracil, 5-(alkyl)-4(thio)pseudracil, 5-(methyl)-4(thio)pseudracil, 5-(alkyl)-2,4(dithio)pseudracil, 5-(methyl)-2,4(dithio)pseudracil, 1-substituted pseudouracil (e.g., 1-methylpseudraidine), C-5 propynyluridine, 2-aminoade Nosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, 1-substituted-2(thio)-pseudracil, 1-substituted-4(thio)pseudracil, 1-substituted-2,4-(dithio)pseudracil, 1-(aminocarbonylethylenyl)-pseudracil, 1-(aminocarbonylethylenyl)-2(thio)-pseudracil, 1(aminocarbonylethylenyl)-4(thio)pseudracil, 1-(aminocarbonylethylenyl)-2,4-(dithio)pseudracil, 1-(aminoalkylaminocarbonylethylenyl)-pseudracil, 1(aminoalkylamino-carbonylethylenyl)-2(thio)-pseudracil, 1-(aminoalkylaminocarbonylethylenyl)-4(thio)pseudracil, 1-(aminoalkylaminocarbonylethylenyl)-2,4-(dithio)pseudracil, 1,3-(diaza)-2-(oxo)-phenoxazine-1-yl, 1-(aza)-2-(thio)-3 -(aza)-phenoxazine-1-yl, 1,3-(diaza)-2-(oxo)-phenthiadin-yl, 1-(aza)-2-(thio)-3-(aza)-phenthiadin-1-yl, 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazine-1-yl, 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazine-1-yl, 7-substituted 1,3-(diaza)-2-(oxo)-phenthiadin-1-yl, 7-substituted 1-(aza)-2-(thio)-3-(aza)-phen Thiazine-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxadin-1-yl, 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxadin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenthiadin-1-yl, 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiadin-1-yl, 7-(guanidinium Alkylhydroxy)-1,3-(diaza)-2-(oxo)phenoxazine-1-yl, 7-(guanidinium alkylhydroxy)-1-(aza)-2-(thio)-3-(aza)phenoxazine-1-yl, 7-(guanidinium alkylhydroxy)-1,3-(diaza)-2-(oxo)phenthiadin-1-yl, 7-(guanidinium alkylhydroxy)-1-(aza)-2-(thio)-3-(aza)phenthiadin-1-yl, 1,3,5-(triaza)-2,6-(dioxa)-naphthalene, inosine, xanthine, hypoxanthine, nubralin, tubercidine, isoguanisine, inosinyl, 2-aza-inosinyl, 7-deazynosinyl, nitroimidazolyl, nitropyrazolyl, nitrobenzimidazolyl, nitroindazolyl, aminoindolyl, pyrrolopyrimidinyl, 3-(methyl)isocarbostyrillyl, 5-(methyl)isocarbostyrillyl, 3-(methyl)-7-(propynyl)isocarbostyrillyl, 7-(aza)indolyl, 6-(methyl)-7-(aza)indolyl, imidizopyriminyl, 9-(methyl)-imidizopyriminyl, pyrrolopyriminyl, isocarbostyrillyl, 7-(propynyl) Socarbostyrillyl, propynyl-7-(aza)indolyl, 2,4,5-(trimethyl)phenyl, 4-(methyl)indolyl, 4,6-(dimethyl)indolyl, phenyl, naphthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenylon, tetracerenyl, pentaceryl, difluorotolyl, 4-(fluoro)-6-(methyl)benzimidazole, 4-(methyl)benzimidazole, 6-(azo)thymine, 2-pyridinone, 5-nitroindole, 3-nitropyrrole, 6-(aza)pyrimidine, 2(amino)purine, 2,6-(diamino)purine, 5-substituted pyrimidine, N2-substituted purine, N6-substituted purine, O6-substituted purine, substituted 1,2,4-Triazole, Pyrrolo-Pyrimidine-2-on-3-yl, 6-Phenyl-Pyrrolo-Pyrimidine-2-on-3-yl, Para-substituted-6-Phenyl-Pyrrolo-Pyrimidine-2-on-3-yl, Ortho-substituted-6-Phenyl-Pyrrolo-Pyrimidine-2-on-3-yl, Bis-ortho-substituted-6-Phenylpyrrolo-Pyrimidine-2-on-3-yl, Para-(aminoalkylhydroxy)-6-Phenyl-Pyrrolo-Pyrimidine-2-on-3-yl, Ortho-(aminoalkylhydroxy) Examples of synthetic and naturally occurring nucleic acid bases include, but are not limited to, droxy)-6-phenyl-pyrrolo-pyrimidine-2-on-3-yl, bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidine-2-on-3-yl, pyridopyrimidine-3-yl, 2-oxo-7-amino-pyridopyrimidine-3-yl, 2-oxo-pyridopyrimidine-3-yl, or any O-alkylated or N-alkylated derivatives thereof.
[0304] In some embodiments, the modified nucleotides used in the IVT system and / or methods described herein can disrupt RNA binding to one or more mammalian (e.g., human) endogenous RNA sensors (e.g., innate immune RNA sensors), including, but not limited to, Toll-like receptor (TLR) 3, TLR7, TLR8, retinoic acid-induced gene I (RIG-I), melanoma differentiation-associated gene 5 (MDA5), protein kinase R (PKR), 2'-5' oligoadenylate synthase (OAS), and genetics and physiology laboratory 2 (LGP2), and combinations thereof. In some embodiments, such modified ribonucleotides may include modifications described in US9,334,328, the contents of which are incorporated herein by reference in their entirety for the purposes described herein. The modified nucleosides are typically preferably translatable in host cells (e.g., the presence of the modified nucleosides does not interfere with the translation of the RNA sequence into its respective polypeptide sequence). The effect of modified nucleotides on translation can be assayed by those skilled in the art, for example, using a rabbit reticulocyte lysate translation assay.
[0305] In some embodiments, the modified ribonucleotide may include a modified nucleoside bond. Various such modified nucleoside bonds are known to those skilled in the art, and those skilled in the art will understand that non-limiting examples of modified nucleoside bonds that may be used in the techniques provided herein include phosphorothioates, chiral phosphorothioates, phosphorothioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkylphosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-aminophosphoamides and aminoalkylholomidates, thionoholomidates, thionoalkylphosphonates, thionoalkylphotriesters, and boranophosphates having their usual 3'-5' and 2'-5' bond analogues, as well as those having inverted polarity in which pairs of adjacent nucleoside units are bonded from 3'-5' to 5'-3' or 2'-5' to 5'-2'. This also includes various salts, mixed salts, and free acid forms. Modified nucleoside bonds may not contain a phosphorus atom and may have short-chain alkyl or cycloalkyl nucleoside bonds, mixed heteroatoms and alkyl or cycloalkyl nucleoside bonds, or nucleoside bonds formed by one or more short-chain heteroatoms or heterocyclic nucleoside bonds. These include those with morpholino bonds (partially formed from the sugar portion of the nucleoside); siloxane skeletons; sulfide, sulfoxide and sulfone skeletons; formacetyl and thioformacetyl skeletons; methyleneformacetyl and thioformacetyl skeletons; alkene-containing skeletons; sulfamate skeletons; methyleneimino and methylenehydrazino skeletons; sulfonates and sulfonamide skeletons; amide skeletons; and others with mixed N, O, S, and CH2 component portions.
[0306] In some embodiments, a modified ribonucleotide may contain one or more substituted sugar moieties. Various such modified sugar moieties are known in the art, and those skilled in the art will understand that in some embodiments, the sugar moiety of a ribonucleotide may contain one of the following at the 2' position: alkyl, alkenyl, and alkynyl (H(deoxyribose); OH(ribose); F; O-, S-, or N-alkyl, O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl), which may be substituted or unsubstituted. In some embodiments, the sugar moiety of the ribonucleotide may include 2'-methoxyethoxy (2'-O-(2-methoxyethyl) or 2'-MOE, also known as 2'-O-CH2CH2OCH3), 2'-dimethylaminooxyethoxy, i.e., the O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-OCH2-N(CH2)2, 2'-methoxy(2'-OCH3), 2'-aminopropoxy(2'-OCH2CH2CH2NH2), and 2'-fluoro(2'-F). Similar modifications can be made at other positions, for example, at the 3' position of the sugar in the 3'-terminal nucleotide or 2'-5' linked nucleotide, and at the 5' position of the 5'-terminal nucleotide.
[0307] In some embodiments, a mixture of ribonucleotides useful for in vitro transcription reactions may include ATP, CTP, GTP, and N1-methylpseudridine-5' triphosphate (m1ΨTP).
[0308] Those skilled in the art will recognize that many standard in vitro transcription reactions utilize a reaction mixture in which ribonucleotides (i.e., ATP, CTP, GTP, and UTP) are used in a 1:1:1:1 ratio (i.e., the molar amount of ATP or ATP analogs (considered together) is equal to the molar amount of CTP or CTP analogs (considered together) in the reaction mixture). In some embodiments, standard or control IVT reactions utilize a reaction mixture in which each ribonucleotide (e.g., ATP, CTP, GTP, and UTP) is present at a concentration of 9 mM.
[0309] In some embodiments, the ratio of ATP, CTP, GTP, and UTP (including one or more NTP analogs) in the reaction mixture for use in the IVT reaction is optimized to improve yield and / or integrity and / or reduce the production of abnormal products (e.g., dsRNA). In some embodiments, the molar ratio a of total CTP and / or one or more functional CTP analogs to total GTP and / or one or more functional analogs is 0.5, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0 or higher. In some embodiments, a is at least 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.65, 1.70, 1.75, 1.80, 1.85, or 1.90. In some embodiments, a is at least 1.5. In some embodiments, a is at least about 1.10, about 1.15, about 1.20, about 1.25, about 1.30, about 1.35, about 1.40, about 1.45, about 1.50, about 1.55, about 1.60, about 1.65, about 1.70, or about 1.75 of x, where x is the molar ratio of total cytidine and / or one or more functional cytidine analogs to total guanosine and / or one or more functional guanosine analogs. In some embodiments, a is at least about 1.15 of x. In some embodiments, a is at least about 1.20 of x.
[0310] In some embodiments, the molar ratio b of total CTP and / or one or more functional analogs to total UTP and / or one or more functional UTP analogs is 0.5, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0 or higher. In some embodiments, b is at least 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.65, 1.70, 1.75, 1.80, 1.85, 1.90 or higher. In some embodiments, b is at least 1.5. In some embodiments, b is at least about 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.65, 1.70, or 1.75 times y, where y is the molar ratio of total cytidine and / or one or more functional cytidine analogs to total uridine and / or one or more functional uridine analogs. In some embodiments, b is at least about 1.15 times y. In some embodiments, b is at least about 1.20 times y.
[0311] In some embodiments, the molar ratio c of total CTP and / or one or more functional analogs to total adenosine triphosphate (ATP) and / or one or more functional ATP analogs is 0.5, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0 or higher. In some embodiments, c is at least 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, or 1.50. In some embodiments, c is at least 1.25. In some embodiments, c is at least about 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.65, 1.70, or 1.75 times z, where z is the molar ratio of total cytidine and / or one or more functional cytidine analogs to total adenosine and / or one or more functional adenosine analogs. In some embodiments, c is at least about 1.15 times z. In some embodiments, c is at least about 1.20 times z.
[0312] In some embodiments, a is at least 1.25 and / or a is at least about 1.10 times x. In some embodiments, b is at least 1.25 and / or b is at least about 1.10 times y. In some embodiments, c is at least 1.10 and / or c is at least about 1.10 times z.
[0313] In some embodiments, the initial CTP and / or one or more functional CTP analog(s) volumes (ml / L initial IVT volumes) are at least about 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 ml / L. In some embodiments, the initial CTP and / or one or more functional CTP analog(s) volumes are about 80–150, 85–145, or 90–140 ml / L.
[0314] In some embodiments, the volume of initial ATP and / or one or more functional ATP analogs (ml / L initial IVT volume) is at least about 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 ml / L. In some embodiments, the volume of initial ATP and / or one or more functional ATP analogs is about 80–150, 85–145, 85–140, or 85–135 ml / L.
[0315] In some embodiments, the initial GTP and / or one or more functional GTP analog(s) volumes (ml / L initial IVT volume) are at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ml / L. In some embodiments, the initial GTP and / or one or more functional GTP analog(s) volumes are about 1–10, 2–9, 3–8, 4–7, 4–6, or 4–5 ml / L.
[0316] In some embodiments, the initial UTP and / or one or more functional UTP analog(s) volumes (ml / L initial IVT volume) are at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ml / L. In some embodiments, the initial UTP and / or one or more functional UTP analog(s) volumes are about 1–10, 2–9, 3–8, 4–7, 4–6, or 4–5 ml / L.
[0317] In some embodiments, the ratios of ATP, CTP, GTP, and m1ΨTP in the reaction mixture for use in in vitro transcription according to this disclosure are independent of those present in the resulting transcript.
[0318] 5'-Cap In some embodiments, the RNA produced by the techniques described herein may include a cap at its 5' end. Those skilled in the art will understand that adding a 5' cap to RNA (e.g., mRNA) can facilitate RNA recognition and attachment to ribosomes, thereby initiating translation and increasing translation efficiency. Those skilled in the art will also understand that the 5' cap can protect the RNA product from 5' exonuclease-mediated degradation and thus increase its half-life. Methods for capping are known in the art, and those skilled in the art will understand that in some embodiments, capping can be performed after in vitro transcription in the presence of a capping system (e.g., an enzyme-based capping system such as a vaccinia virus capping enzyme). In some embodiments, capped RNA can be obtained by in vitro capping of RNA having a 5' triphosphate group or RNA having a 5' diphosphate group, with a capping enzyme system (e.g., including but not limited to a vaccinia capping enzyme system or a Saccharomyces cerevisiae capping enzyme system). In some embodiments, a capping agent may be introduced into an in vitro transcription reaction mixture (e.g., one described herein) along with several ribonucleotides so that the cap is incorporated into the RNA during transcription (also known as co-transcriptional capping). In some embodiments, it may be desirable for the RNA to contain a 5' cap, but in some embodiments, the RNA may not have a 5' cap.
[0319] In some embodiments, the 5'-capping agent can be added to the in vitro transcription reaction mixture. In some embodiments, the 5'-capping agent may include modified nucleotides, such as modified guanine nucleotides. In some embodiments, the 5'-capping agent may include, for example, a methyl group or multiple groups, glyceryl, reverse deoxydebase moiety, 4'5' methylene nucleotide, l-(beta-D-erythrofuranosyl) nucleotide, 4' thionucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotide, alpha nucleotide, modified base nucleotide, threopentofuranosyl nucleotide, acyclic 3',4'-seconucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3'- It may contain a 3'-reverse nucleotide moiety, a 3'-3'-reverse debase moiety, a 3'-2'-reverse nucleotide moiety, a 3'-2'-reverse debase moiety, 1,4-butanediol phosphate, 3'-phosphoramide, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, or a crosslinked or uncrosslinked methylphosphonate moiety, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7'-deaza-guanosine, 8-oxo-guanosine, 2-aminoguanosine, LNA-guanosine, or 2-azido-guanosine. In some embodiments, the 5'-capping agent may be or may include dinucleotide cap analogs (e.g., m7GpppG cap analogs or N7-methyl, 2'-O-methyl-GpppG anti-reverse cap analogs (ARCA) cap analogs or N7-methyl, 3'-O-methyl-GpppG ARCA cap analogs). In some embodiments, the 5'-capping agent may include a 5'N7-methyl-3'-O-methylguanosine structure, e.g., CleanCap® reagent (Trilink BioTechnologies).In some embodiments, a 5'-capping agent is added in excess to a specific ribonucleotide or ribonucleotide (e.g., GTP, ATP, UTP, CTP, or modified versions thereof) to enable the incorporation of a 5'-cap as a first addition to the RNA transcript.
[0320] polymerase Various RNA polymerases suitable for transcription reactions, including but not limited to RNA polymerases, are known in the art. In some embodiments, the RNA polymerase is T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, N4 virion RNA polymerase, or variants or functional domains thereof. Naturally catalyzed RNA-dependent RNA polymerases are typically encoded by all RNA viruses except retroviruses. Alphaviruses are typical representatives of viruses encoding RNA-dependent RNA polymerases. Those skilled in the art will understand that the RNA polymerases used herein may be recombinant RNA polymerases and / or purified RNA polymerases, i.e., not as part of a cell extract containing other components in addition to the RNA polymerase. In some embodiments, the RNA polymerase useful for commercially-scale transcription is T7 RNA polymerase. In some embodiments, inorganic pyrophosphatases may be added to improve the yield of the transcription reaction (e.g., catalyzed by T7 RNA polymerase in some embodiments).
[0321] Exemplary in vitro transcription reaction Those skilled in the art will recognize the components typically contained in an IVT reaction mixture. For example, an IVT reaction mixture typically includes a nucleic acid template (e.g., a DNA template, as described herein), a ribonucleotide (e.g., as described herein), and an RNA polymerase (e.g., a DNA-dependent RNA polymerase).
[0322] In some embodiments, the reaction mixture contains a nucleic acid template at a concentration of 0.05–2 μg / μL (e.g., including 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2.0 μg / μL). In some embodiments, the reaction mixture contains an RNA polymerase volume (ml / L start IVT volume) of approximately 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 ml / L. In some embodiments, the reaction mixture contains an RNA polymerase volume of approximately 70–90, 72–88, 72–90, or 70–88 ml / L.
[0323] In some embodiments, the IVT reaction mixture further comprises one or more of the following: a reaction buffer, an RNase inhibitor, a pyrophosphatase, one or more salts, a reducing agent, and / or spermidine.
[0324] In some embodiments, the IVT reaction mixture further comprises a reaction buffer. In some embodiments, the reaction buffer comprises HEPES, Tris-HCl, or PBS. In some embodiments, the reaction mixture comprises the reaction buffer at a concentration of 20–60 mM. In some embodiments, the reaction buffer has a pH of 7–9 (e.g., including 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, and 9.0).
[0325] In some embodiments, the IVT reaction mixture may further contain an RNAse inhibitor. In some such embodiments, the RNAse inhibitor is at a concentration of 0.01–0.1 U / μL (e.g., including 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, or 0.10 U / μL). In some embodiments, one unit (U) of the RNAse inhibitor inhibits the activity of 5 ng of RNAse (e.g., RNAse A) by at least 50% (e.g., including at least 60%, at least 70%, at least 80%, at least 90%, and at least 99% or more).
[0326] In some embodiments, the IVT reaction mixture may further contain pyrophosphatase (e.g., inorganic pyrophosphatase). In some embodiments, the IVT reaction mixture contains pyrophosphatase (e.g., inorganic pyrophosphatase) at a concentration of 0.01–0.2 mU / μL. In some embodiments, the IVT reaction mixture contains pyrophosphatase (e.g., inorganic pyrophosphatase) at a concentration of 0.01, 0.05, 0.1, 0.15, or 0.20 mU / μL. In some embodiments, the IVT reaction mixture contains pyrophosphatase volumes (ml / L starting IVT volume) of about 0.80, 0.85, 0.90, 0.95, 1.0, 1.05, or 1.10 ml / L. In some embodiments, the IVT reaction mixture contains pyrophosphatase volumes of 0.80-1.10, 0.80-1.05, 0.85-1.10, 0.85-1.05, 0.90-1.10, 0.90-1.05, 0.95-1.10, or 0.95-1.05 ml / L.
[0327] In some embodiments, the IVT reaction mixture may further contain one or more salts (e.g., monovalent and / or divalent salts). In some embodiments, the reaction mixture contains one or more salts at a concentration of 20 to 60 mM. In some embodiments, the one or more salts include one or more magnesium salts and / or one or more calcium salts. In some embodiments, the one or more magnesium salts include magnesium acetate or magnesium chloride.
[0328] In some embodiments, the IVT reaction mixture may further contain a reducing agent (e.g., dithiothreitol, 2-mercaptoethanol, etc.). In some such embodiments, the reaction mixture contains the reducing agent at a concentration of 5–15 mM.
[0329] In some embodiments, the IVT reaction mixture may further contain superimidine. In some such embodiments, the reaction mixture contains superimidine at a concentration of 0.5–3 mM.
[0330] In some embodiments, certain reaction mixture components are added in a specific order. In some embodiments, a portion of total CTP and / or one or more functional CTP analogs is added to the reaction mixture before the start of transcription and / or at the start of transcription, while the remaining portion of total CTP and / or one or more functional CTP analogs is added to the reaction mixture after the start of transcription. In some embodiments, all of total CTP and / or one or more functional CTP analogs is added to the reaction mixture before the start of transcription and / or at the start of transcription. In some embodiments, a portion of total GTP and / or one or more functional GTP analogs is added to the reaction mixture before the start of transcription and / or at the start of transcription, while the remaining portion of total GTP and / or one or more functional GTP analogs is added to the reaction mixture after the start of transcription. In some embodiments, all of total GTP and / or one or more functional GTP analogs is added to the reaction mixture before the start of transcription and / or at the start of transcription. In some embodiments, a portion of the total UTP and / or one or more functional UTP analogs is added to the reaction mixture before and / or at the start of transcription, and the remaining portion of the total UTP and / or one or more functional UTP analogs is added to the reaction mixture after the start of transcription. In some embodiments, all of the total UTP and / or one or more functional UTP analogs is added to the reaction mixture before and / or at the start of transcription. In some embodiments, a portion of the total ATP and / or one or more functional ATP analogs is added to the reaction mixture before and / or at the start of transcription, and the remaining portion of the total ATP and / or one or more functional ATP analogs is added to the reaction mixture after the start of transcription. In some embodiments, all of the total ATP and / or one or more functional ATP analogs is added to the reaction mixture before and / or at the start of transcription.In some embodiments, a portion of the total of multiple nucleotides (e.g., ATP, CTP, GTP, and / or UTP, and / or one or more functional analogs thereof) is added to the reaction mixture before and / or at the start of transcription, and the remainder is added to the reaction mixture after the start of transcription. In some embodiments, all of the total of multiple nucleotides (e.g., ATP, CTP, GTP, and / or UTP, and / or one or more functional analogs thereof) is added to the reaction mixture before and / or at the start of transcription.
[0331] In some embodiments, GTP and / or UTP and / or one or more functional analogs thereof are restricted during the IVT reaction (e.g., maintained at sufficiently low concentrations). In some such embodiments, GTP and / or UTP and / or one or more functional analogs thereof are maintained at sufficiently low concentrations, for example, by using a fed-batch approach. While we do not wish to be constrained by any single theory, cap analogs can directly compete with GTP for incorporation as the initial nucleotide (starting nucleotide) and are readily incorporated as any other nucleotide (WO2006 / 004648). To favor the incorporation of cap analogs, typically a molar excess of cap analogs is used over GTP (e.g., in a 4:1 ratio), and the GTP concentration is reduced compared to other ribonucleoside triphosphates (e.g., ATP, CTP, and / or UTP, or their analogs). Under these conditions, GTP is typically the limiting factor for RNA molecule synthesis. Therefore, a high percentage of other NTPs (typically 40-70%) are not used for RNA synthesis and are wasted. With this approach, the RNA yield is typically limited to about 1 mg / ml (WO2006 / 004648).
[0332] To compensate for the limited yield due to low GTP concentrations, the yield of capped RNA is increased by supplementing the reaction with competing nucleotides (GTP or ATP when using A-caps) so that a GTP-to-cap analogue ratio of 1:1 to 1:50 is maintained. This approach has been reported to double the amount of capped RNA produced per reaction (WO2006 / 004648).
[0333] While we do not wish to be bound by any single theory, the RNA molecule synthesized by T7 RNA polymerase during run-off transcription of a linearized DNA template can be longer than the encoded RNA (Triana-Alonso et al., 1995, JBC; 270(11): 6298-6307). After leaving the DNA template, RNA polymerase can bind the transcript to the template site, bind the 3' end of the transcript to the product site, and extend it if the 3' end is not part of a stable secondary structure (self-complementary 3' elongation). This effect appears to be particularly sensitive to UTP concentration, with an exclusive reduction in UTP concentration leading to faithful transcription. However, reducing UTP concentration can also affect RNA yield. In particular, if the RNA contains a poly(A) tail, as is common with mRNA and other RNAs, excessive unintegrated UTPs in the transcription reaction can lead to RNA template-dependent integration of uridine nucleotides opposite to the polyA sequence, resulting in double-stranded RNA molecules that can activate innate immune responses and reduce polypeptide synthesis (Kariko et al., 2011, Nucleic Acids Res.; 39(21):e142).
[0334] In some embodiments, in vitro transcription reactions are carried out as batch reactions in which all components are combined and then incubated to allow for the synthesis of RNA molecules until the reaction is complete. To increase the efficiency of in vitro transcription reactions, fed-batch reactions have been developed (Kern et al., 1997. Biotechnol. Prog. 13, 747-756; Kern et al., 1999. Biotechnol. Prog. 15, 174-184). In some embodiments, in the fed-batch system, all components are combined, but then additional amounts of some reagents (e.g., NTP and magnesium) are added over time to maintain constant reaction conditions.
[0335] In some embodiments, total GTP and / or one or more functional analogues(s) are added to the IVT reaction mixture throughout the duration of the IVT reaction (e.g., by fed batch). In some such embodiments, the bolus volume (ml / L starting IVT volume) of total GTP and / or one or more functional analogues(s) is added at approximately 150, 155, 160, 165, 170, 175, 180, 185, or 190 ml / L. In some such embodiments, the total GTP and / or one or more functional analogues bolus volumes are added in the range of approximately 140–200, 145–195, or 150–190 ml / L.
[0336] In some embodiments, total UTP and / or one or more functional analogues(s) are added to the IVT reaction mixture throughout the duration of the IVT reaction (e.g., by fed batch). In some such embodiments, the bolus volume (ml / L starting IVT volume) of total UTP and / or one or more functional analogues(s) is added at approximately 150, 155, 160, 165, 170, 175, 180, 185, or 190 ml / L. In some such embodiments, the total UTP and / or one or more functional analogues bolus volumes are added in the range of about 140–200, 145–195, or 150–190 ml / L. In some embodiments, GTP and / or UTP are limited, and either or both CTP and / or ATP are increased in the initial IVT reaction mixture and / or at one or more time points during the IVT reaction (e.g., as discussed elsewhere herein).
[0337] Exemplary in vitro transcription reaction conditions In some embodiments, the IVT reaction is carried out for a certain period of time in a bioreactor, for example, as described herein (selected for a particular IVT reaction volume as described herein). In some embodiments, the period is at least 20 minutes, including, for example, at least 25 minutes, at least 30 minutes, at least 40 minutes, at least 55 minutes, at least 60 minutes, at least 75 minutes, at least 90 minutes, at least 105 minutes, at least 120 minutes, at least 135 minutes, at least 150 minutes, at least 165 minutes, or at least 180 minutes. In some embodiments, the duration is 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, or 180 minutes. In some embodiments, the duration is approximately 1.5 to 3 hours. In some embodiments, the duration is approximately 25 to 30 minutes.
[0338] In some embodiments, the IVT reaction is carried out, for example, in a bioreactor described herein, at a temperature at which the selected RNA polymerase is functionally active for a period of time (for example, as described herein). Typical phage RNA polymerases (e.g., T7 polymerases that carry out the IVT reaction) are not usually activated at high temperatures (e.g., above 45°C), but thermostable RNA polymerases (e.g., T7 polymerases such as those described in US10519431) are not activated at high temperatures. A thermally stable variant of RNA polymerase (whose contents are incorporated by reference for the purposes described herein) can exhibit increased stability at high temperatures. In some embodiments, the IVT reaction is carried out at temperatures of about 25°C or higher, including, for example, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C, or 45°C. In some embodiments, the in vitro transcription is carried out at temperatures of about 45°C or higher, including, for example, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, or 55°C or higher.
[0339] In some embodiments, the IVT reaction is carried out in a bioreactor described herein at a pH of, for example, about 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, or 9. In some embodiments, a pH suitable for in vitro transfer may be about 7.0 to 9.0.
[0340] In some embodiments, the in vitro transcription reactions carried out in accordance with this disclosure (e.g., in a bioreactor as described herein) may be carried out as a continuous feed reaction, and in some embodiments, they may be carried out as a batch-fed reaction. In some embodiments, one or more nucleotides may be added to the in vitro transcription reaction stepwise (e.g., at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more bolus feeds). In some embodiments, the stirring rate is selected so as to achieve a specific blend time to allow rapid mixing of the bolus additives in order to ensure optimal availability of the modified nucleotide solution and one or more other nucleotide solutions during RNA synthesis.
[0341] Bioreactor In some embodiments, the IVT reaction is carried out in a bioreactor described herein (i.e., using a bioreactor).
[0342] As used herein, the terms “bioreactor” or “transcription reactor” refer to a container such as a chamber, test tube, or column, and the transcription reaction is carried out under specific conditions as described herein. Bioreactors for transcription are known in the art (see WO1995 / 08626 and EP3155129). A bioreactor is typically configured such that the reaction components are delivered to the reactor core by a supply line, and the RNA product moves to the outlet stream by passing through an ultrafiltration membrane (EP3155129 and van de Merbel, (1999), J. Chromatogr. A856(1-2):55~82). A bioreactor useful for the method of the present invention may include a reaction module for carrying out the transcription reaction, a capture module for transiently capturing the transcribed RNA molecule, and a control module for controlling the infeed of components of the reaction mixture to the reaction module, the reaction module may include a filtration membrane for separating nucleotides from the reaction mixture, and the control of the infeed of components of the reaction mixture by the control module may be based on the measured concentration of the separated nucleotides. The bioreactor may be thermally controlled to precisely maintain the temperature of the transfer reaction described herein, for example, a specific temperature such as typically 4°C to 40°C. The bioreactor may include inlet feet and outlet ports. The bioreactor may allow the reaction mixture to be stirred during the transfer reaction, for example, at a variable stirring speed. The stirring may be continuous or discontinuous, such as at intervals.
[0343] Bioreactors for use according to the present invention may be, for example, 0.2 liters or larger, such as 0.2 liters, 0.3 liters, 0.4 liters, 0.5 liters, 0.6 liters, 0.7 liters, 0.8 liters, 0.9 liters, 1.0 liter, 1.1 liters, 1.2 liters, 1.3 liters, 1.4 liters, 1.5 liters, 1.6 liters, 1.7 liters, 1.8 liters, 1.9 liters, 2 liters, 3 liters, 4 liters, 5 liters, 6 liters, 7 liters, 8 liters, 9 liters, 10 liters, 15 liters, 20 liters, 25 liters, 30 liters, 35 liters, 40 liters, 45 liters, 50 liters or more, or any volume in between. Internal conditions of the bioreactor, including but not limited to pH and temperature, are typically controlled during the transfer reaction described herein. The bioreactor may be constructed of any material suitable for in vitro transfer under the conditions described herein, including glass, plastic, or metal.
[0344] In some embodiments, the bioreactor may be equipped with a pump for replenishing the reaction mixture. In some embodiments, a programmable pump may be used for replenishment. In some embodiments, a programmable syringe pump may be used, for example, to automatically carry out the stepwise addition of one or more reaction mixture components. Alternatively or additionally, in some embodiments, a monitor (e.g., a sensor) may be used to detect the level(s) of one or more components, and in some such embodiments, the monitor may automatically communicate with the pump, for example, to release additional feed when a decreased amount of such component(s) is detected.
[0345] Methods for controlling nucleotide levels In some embodiments, the in vitro transcription reactions carried out in accordance with this disclosure (e.g., in a bioreactor as described herein) may be carried out as a continuous feed reaction, and in some embodiments, they may be carried out as a batch-fed reaction. In some embodiments, one or more nucleotides may be added to the in vitro transcription reaction stepwise (e.g., at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more bolus feeds). In some embodiments, the stirring rate is selected so as to achieve a specific blend time to allow rapid mixing of the bolus additives in order to ensure optimal availability of the modified nucleotide solution and one or more other nucleotide solutions during RNA synthesis.
[0346] Exemplary processing In some embodiments, the RNA produced by the IVT described herein undergoes one or more processing steps (e.g., purification).
[0347] The purification of nucleic acids described herein may include, but is not limited to, nucleic acid cleanup, quality assurance, and quality control. Cleanup may be carried out by methods known in the art, such as residual protein digestion and / or DNA digestion by proteinase K and DNase I, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probe (EXIQON® Inc, Vedbaek, Denmark), or by HPLC-based purification methods such as strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), but is not limited to these. The term “purified” as used in reference to nucleic acids, such as “purified nucleic acid,” means that it has been separated from at least one impurity. “Impurity” is any substance that makes another unsuitable, impure, or substandard substance. Therefore, purified nucleic acids (e.g., DNA and RNA) exist in a different form or configuration than those found in nature, or in a different form or configuration than those that existed before treatment or purification.
[0348] Characteristic evaluation In some embodiments, RNA can be evaluated by one or more quality control parameters. In some embodiments, the quality control parameters may be evaluated and / or monitored at any point during the production process of RNA and / or compositions containing it. For example, in some embodiments, RNA quality control parameters, including one or more of RNA integrity, RNA concentration, residual dsRNA, and / or capping, may be evaluated and / or monitored at each step of the RNA production process or during and / or after a particular step, for example, IVT and / or after each purification step.
[0349] In some embodiments, one or more quality control parameters may be used during RNA production or other preparation or use (e.g., as a release test).
[0350] In some embodiments, one or more quality control parameters may be evaluated to determine whether the RNA described herein meets or exceeds acceptable criteria (e.g., for subsequent formulations and / or release into distribution). In some embodiments, such quality control parameters may include, but are not limited to, RNA integrity, RNA concentration, residual dsRNA, and / or capping.
[0351] Certain methods for evaluating RNA quality are known in the art, and for example, those skilled in the art will recognize that in some embodiments, one or more analytical tests can be used for RNA quality evaluation. Examples of such specific analytical tests include, but are not limited to, gel electrophoresis (e.g., agarose gel electrophoresis, capillary gel electrophoresis), UV absorption, and / or PCR assays.
[0352] RNA integrity In some embodiments, RNA integrity is evaluated and / or monitored (e.g., determined at one or more points over time). In some embodiments, RNA integrity can be evaluated and / or monitored by agarose gel electrophoresis. In some embodiments, RNA integrity can be evaluated and / or monitored by capillary gel electrophoresis. In some embodiments, RNA integrity can be quantitatively determined using capillary electrophoresis. In some embodiments, the RNA solution must produce a single peak at a predicted retention time that matches the expected length compared to the retention time of a standard ladder. In some embodiments, the quantification of the major RNA peak is calculated in relation to the signal intensity in an electrophoretic graph in which degradation products are detectable.
[0353] In some embodiments, the RNA integrity of the RNA molecule(s) produced according to the techniques provided herein is at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or higher compared to a suitable comparative control (e.g., an equivalent in vitro transcription reaction by other means). In some embodiments, the RNA integrity of RNA molecules(s) produced according to the techniques provided herein is increased by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to a suitable comparative control (e.g., using an otherwise equivalent in vitro transcription reaction, e.g., a reaction reaction in which a is not at least 1.25, b is not at least 1.25, and / or c is not at least 1.10). In some embodiments, the RNA integrity of the RNA molecule(s) produced by this disclosure is determined by appropriate comparison controls (e.g., equivalent in vitro transcription reactions by other means, e.g., d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least 1.25, c is not at least 1.10 and / or d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least 1.25, c is at least 1 The reaction mixture used is not 0.10, and / or d is at least 1.10, and / or e is at least 1.10, and / or a is at least 1.25, b is at least 1.25, and / or c is at least 1.10, and / or d is not at least 1.10, and / or e is not at least 1.10, compared to a reaction mixture that uses 0.10, which increases the reaction mixture by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to a reaction mixture that uses 0.10.In some embodiments, the RNA integrity of RNA molecules(s) produced according to the techniques provided herein is increased by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to a suitable control (e.g., RNA produced by an IVT reaction not disclosed herein). In some embodiments, the RNA integrity of RNA molecules(s) produced according to the techniques provided herein is increased by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to a suitable comparison control (e.g., using a reaction reaction in which a is not at least about 1.10 times x, b is not at least about 1.10 times y, and / or c is not at least about 1.10 times z).In some embodiments, the RNA integrity of the RNA molecule(s) produced by this disclosure is determined by appropriate comparison controls (e.g., equivalent in vitro transcription reactions by other means, e.g., d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, c is not at least about 1.10 times z, and / or d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, c is less than z) The reaction mixture is increased by at least approximately 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to the reaction mixture (using the reaction mixture).
[0354] In some embodiments, RNA integrity is increased by at least about 5% compared to a suitable reference control. In some embodiments, RNA integrity is increased by at least about 8% compared to a suitable reference control.
[0355] RNA concentration In some embodiments, the RNA concentration (e.g., RNA molecules produced according to the techniques provided herein) is evaluated and / or monitored (e.g., determined at one or more points over time, e.g., during or after the IVT reaction). In some embodiments, the RNA concentration is determined using UV absorption spectrophotometry. In some embodiments, the RNA concentration is determined according to the method described in Ph.Eur.2.2.25. In some embodiments, a desired specific RNA concentration is achieved on a specific batch scale. In some specific embodiments, high RNA concentrations are achieved in a large-scale manufacturing process.
[0356] In some embodiments, the achieved RNA concentration (e.g., of RNA produced by the IVT reaction described herein) may be at least 1 mg / mL (e.g., including at least 1.5 mg / mL, at least 2 mg / mL, at least 2.5 mg / mL, at least 3 mg / mL, at least 3.5 mg / mL, at least 4 mg / mL, at least 4.5 mg / mL, at least 5 mg / mL, at least 6 mg / mL, or more). In some embodiments, the RNA concentration may be between 1.5 mg / mL and 5 mg / mL, or between 2 mg / mL and 4 mg / mL, or between 2.0 and 2.5 mg / mL.
[0357] In some embodiments, the concentration of RNA molecules produced according to the techniques provided herein (e.g., in the IVT reaction described herein) is at least about 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL, 5 mg / mL, 6 mg / mL, 7 mg / mL, 8 mg / mL, 9 mg / mL, 10 mg / mL, 11 mg / mL, 12 mg / mL, 13 mg / mL, 14 mg / mL, or 15 mg / mL. In some embodiments, the concentration of RNA molecules(s) produced by the techniques provided herein is at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, or 30% compared to a suitable control (e.g., using a reaction mixture in which a is not at least 1.25, b is not at least 1.25, and / or c is not at least 1.10). In some embodiments, the concentration of RNA molecules produced by the techniques of this disclosure is compared with an appropriate control (e.g., an equivalent in vitro transcription reaction by other means, e.g., d is not at least 1.10 and / or e is not at least 1.10; a is not at least 1.25, b is not at least 1.25, c is not at least 1.10 and / or d is not at least 1.10 and / or e is not at least 1.10; a is not at least 1.25, b is not at least 1.25, c is not at least 1.10) Rather than and / or d being at least 1.10, and / or e being at least 1.10; and / or a being at least 1.25, b being at least 1.25, and / or c being at least 1.10, and / or d not being at least 1.10, and / or e not being at least 1.10, the reaction mixture increases by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to the reaction mixture used.In some embodiments, the concentration of RNA molecules produced according to the techniques provided herein is increased by at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, or 30% compared to a suitable control (e.g., using a reaction reaction where a is not at least about 1.10 times x, b is not at least about 1.10 times y, and / or c is not at least about 1.10 times z). In some embodiments, the concentration of RNA molecules produced according to the techniques provided herein is compared to a suitable control (e.g., an equivalent in vitro transcription reaction by other means, e.g., d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, c is not at least about 1.10 times z, and / or d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, and c is less than z) The reaction mixture is increased by at least approximately 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to the reaction mixture (using the reaction mixture). In some embodiments, the concentration of RNA molecules produced according to the techniques provided herein is increased by at least about 20% (e.g., at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99% or more) compared to a suitable control.
[0358] residual double-stranded RNA In particular, this disclosure provides insight that the provided technology may offer certain advantages, such as a reduction in dsRNA levels. In some embodiments, low dsRNA levels are particularly useful in the preparation of therapeutic RNA. Alternatively or additionally, the ability to reduce dsRNA may be particularly beneficial in large-scale (e.g., commercial-scale, as described herein) RNA production.
[0359] In some embodiments, residual dsRNA (dsRNA) can be evaluated and / or monitored using, for example, polymerase chain reaction (PCR), absorbance, fluorescent dyes, and / or gel electrophoresis. In some embodiments, dsRNA is evaluated and / or monitored using quantitative PCR.
[0360] In some specific embodiments, for example, dsRNA is evaluated and / or monitored by assessing the RNA sample, and a dsRNA reference (2000 pg dsRNA / μg RNA, 1500 pg dsRNA / μg RNA, 1000 pg dsRNA / μg RNA, 500 pg dsRNA / μg RNA, or less) representing the upper limit of acceptable residual dsRNA content is immobilized on a positively charged nylon membrane and incubated with a dsRNA-specific monoclonal antibody. After incubation with a horseradish peroxidase (HRP)-labeled secondary antibody, an enhanced chemiluminescent (ECL) substrate is added to the membrane, and the chemiluminescence is detected by a bioimager system. The signal intensity is quantified by density measurement, and the value of the RNA sample is compared to the signal intensity of the dsRNA reference. The results are reported as conforming to the specified upper limit. In some embodiments, the dsRNA-specific monoclonal antibody is mouse IgG clone J2. In some embodiments, the HRP-labeled secondary antibody is an anti-mouse IgG secondary antibody.
[0361] In some embodiments, the residual dsRNA during and / or after transcription of RNA molecules produced according to the techniques provided herein is at least about 25 pg dsRNA / μg RNA, 50 pg dsRNA / μg RNA, 75 pg dsRNA / μg RNA, 100 pg dsRNA / μg RNA, 125 pg dsRNA / μg RNA, 150 pg dsRNA / μg RNA, 175 pg dsRNA / μg RNA, 200 pg dsRNA / μg RNA, 225 pg dsRNA / μg RNA, 250 pg dsRNA / μg RNA, 275 pg dsRNA / μg RNA, or 300 pg dsRNA / μg RNA. In some embodiments, residual dsRNA during and / or after transcription of RNA molecules(s) produced according to the techniques provided herein is reduced by at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80% compared to a suitable comparative control (e.g., using an equivalent in vitro transcription reaction by other means, e.g., a reaction reaction in which a is not at least 1.25, b is not at least 1.25, and / or c is not at least 1.10).In some embodiments, residual dsRNA during and / or after transcription of RNA molecules(s) produced according to the techniques provided herein is compared with appropriate control (e.g., an equivalent in vitro transcription reaction by other means, e.g., d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least 1.25, c is not at least 1.10 and / or d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is at least about 1.25) If c is not at least 1.10 and / or d is at least 1.10 and / or e is at least 1.10 and / or a is at least 1.25, b is at least 1.25 and / or c is at least 1.10 and / or d is not at least 1.10 and / or e is not at least 1.10, then the reaction mixture increases by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to the reaction mixture used. In some embodiments, the residual dsRNA during and / or after transcription of RNA molecules(s) produced according to the techniques provided herein is reduced by at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80% compared to a suitable comparative control (e.g., using a reaction reaction that is otherwise equivalent, e.g., a reaction reaction where a is not at least about 1.10 times x, b is not at least about 1.10 times y, and / or c is not at least about 1.10 times z).In some embodiments, residual dsRNA during and / or after transcription of RNA molecules produced according to the techniques provided herein is compared with appropriate control (e.g., an equivalent in vitro transcription reaction by other means, e.g., d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, c is not at least about 1.10 times z, and / or d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y) The reaction mixture increases by at least approximately 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to the reaction mixture (using the reaction mixture). In some embodiments, the residual dsRNA concentration is reduced by at least about 70%, including, for example, at least about 60%, 50%, 40%, 30%, 20%, and 10% or less.In some embodiments, residual dsRNA during and / or after transcription of RNA molecules(s) produced according to the techniques provided herein is compared with appropriate control (e.g., an equivalent in vitro transcription reaction by other means, e.g., d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is not at least 1.25, c is not at least 1.10 and / or d is not at least 1.10 and / or e is not at least 1.10, a is not at least 1.25, b is at least about 1.25) If c is not at least 1.10 and / or d is at least 1.10 and / or e is at least 1.10 and / or a is at least 1.25, b is at least 1.25 and / or c is at least 1.10 and / or d is not at least 1.10 and / or e is not at least 1.10, then the reaction mixture increases by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to the reaction mixture used.In some embodiments, residual dsRNA during and / or after transcription of RNA molecules(s) produced according to the techniques provided herein is compared with appropriate control groups (e.g., equivalent in vitro transcription reactions by other means, e.g., d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y, c is not at least about 1.10 times z, and / or d is not at least about 1.05 times v, and / or e is not at least about 1.05 times w, a is not at least about 1.10 times x, b is not at least about 1.10 times y) The reaction mixture used is not increased by at least approximately 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to the original reaction mixture (using the original reaction mixture).
[0362] This disclosure, in particular, documents that the techniques provided herein can achieve a reduction in dsRNA levels in IVT reactions. In some embodiments, an IVT reaction utilizing a reaction mixture including an elevated ATP level results in a reduction in dsRNA levels (compared to, for example, an IVT reaction utilizing a suitable control, e.g., a standard reaction mixture as described herein). In some embodiments, an IVT reaction utilizing a reaction mixture including an elevated CTP level results in a reduction in dsRNA levels (compared to, for example, an IVT reaction utilizing a suitable control, e.g., a standard reaction mixture as described herein). In some embodiments, an IVT reaction utilizing a reaction mixture including elevated CTP and / or ATP levels results in a reduction in dsRNA levels (compared to, for example, an IVT reaction utilizing a suitable control, e.g., a standard reaction mixture as described herein).
[0363] In certain embodiments, this disclosure documents that the techniques provided (e.g., an increase in CTP and / or ATP levels in the reaction mixture, particularly an increase in ATP levels) can achieve a decrease in dsRNA levels. Furthermore, this disclosure documents that such benefits can be achieved in the production of various RNA transcripts having different C and / or A content. Thus, in some such embodiments, the techniques provided herein achieve a decrease in dsRNA levels in the IVT reaction, regardless of the nucleotide content of the produced RNA, and in some such embodiments, the nucleotide content of the produced RNA is evaluated excluding any poly(A) tails.
[0364] Capping In some embodiments, the capping of RNA molecules (e.g., produced by the techniques of this disclosure) is evaluated and / or monitored (e.g., determined at one or more points over time). In some embodiments, the capping of RNA transcribed in vitro can be verified, for example, by evaluating translation (typically requiring the presence of a functional cap). In some embodiments, for example, a bioactivity test that may be performed during process characterization of animal test material confirms that the RNA is translated into polypeptides of the correct size (e.g., proteins). In some embodiments, the capping of RNA transcribed in vitro is evaluated by performing a nuclease-based assay. In some embodiments, the capping of RNA transcribed in vitro is evaluated by performing a catalytic nucleic acid-based assay. Alternatively or additionally, in some embodiments, non-clinical trials are performed to demonstrate the capping of various different mRNA batches.
[0365] In some embodiments, the capping of RNA molecules (e.g., produced by the techniques disclosed herein) is evaluated by (a) assessing the translation of the functionally capped RNA, (b) performing bioactivity tests to confirm that the RNA molecules are translated into polypeptides of the correct size (e.g., proteins), (c) performing nuclease-based assays, and / or (d) performing catalytic nucleic acid-based assays.
[0366] In some such embodiments, the nuclease-based assay includes an RNase-based assay. In some such embodiments, the RNase-based assay includes one or more of the following: (a) annealing a number of RNA molecules to one or more probes that bind to RNA molecules to form RNA probe complexes; (b) digesting the RNA probe complexes with RNase to produce fragments containing the 5' ends of RNA molecules; (c) purifying the fragments using affinity-based purification, chromatography-based purification, or a combination thereof; (d) subjecting the purified fragments to mass spectrometry (MS); (e) identifying capped and uncapped fragments based on observed MS values; and / or (f) calculating the percentage of capped RNA by comparing the amounts of capped and uncapped fragments. In some embodiments, the RNase includes RNase H.
[0367] In some embodiments, a nuclease-based assay includes one or more of the following: (a) contacting a number of RNA molecules with one or more DNA oligonucleotides complementary to a sequence in the 5' untranslated region of an RNA molecule adjacent to a 5' RNA cap or the second-to-last uncapped base of the RNA; (b) annealing one or more DNA oligonucleotides to a sequence in the 5' untranslated region of an RNA molecule to form a DNA / RNA hybrid complex; (c) degrading the DNA / RNA hybrid complex and / or the unannealed RNA molecule with one or more nucleases to produce capped and uncapped 5' terminal RNA fragments and a 3' RNA fragment; (d) separating the capped and uncapped 5' terminal RNA fragments from the 3' RNA fragment using affinity-based purification, chromatography-based purification, or a combination thereof; and / or (e) comparing the amounts of capped and uncapped 5' terminal RNA fragments to calculate the proportion of capped RNA.
[0368] In some embodiments, a catalytic nucleic acid-based assay includes one or more of the following: (a) cleaving a number of RNA molecules with a catalytic nucleic acid molecule into 5' terminal RNA fragments and at least one 3' RNA fragment, such that the RNA molecules have a cleavage site on the catalytic nucleic acid molecule; (b) separating the 5' terminal RNA fragments and 3' RNA fragments using affinity-based purification, chromatography-based purification, or a combination thereof; (c) measuring the amounts of capped and uncapped 5' terminal RNA fragments using spectroscopy, quantitative mass spectrometry, sequencing, or a combination thereof; and / or (d) calculating the percentage of capped RNA by comparing the amounts of capped and uncapped 5' terminal RNA fragments. In some such embodiments, the catalytic nucleic acid molecule includes a DNAzyme or a ribozyme.
[0369] In some embodiments, at least about 40%, 50%, 60%, 70%, 80%, 90%, or 99% of the RNA molecules produced according to the techniques provided herein are capped. In some embodiments, the capping of RNA molecules produced according to the techniques provided herein is increased by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% compared to a suitable control (e.g., using a reaction reaction in an otherwise equivalent way, e.g., a reaction reaction in which a is not at least 1.25, b is not at least 1.25, and / or c is not at least 1.10). In some embodiments, the capping of RNA molecules produced according to the techniques provided herein is increased by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% compared to a suitable control (e.g., using a reaction reaction that is otherwise equivalent, e.g., a is not at least about 1.10 times x, b is not at least about 1.10 times y, and / or c is not at least about 1.10 times z). In some embodiments, the capping of RNA molecules produced according to the techniques provided herein is increased by at least about 5% compared to a suitable control.
[0370] yield In some embodiments, the yield of RNA molecules produced by the techniques of the present disclosure is evaluated. In some embodiments, the yield is determined as g / L start IVT volume. In some embodiments, the yield is determined by measuring the total amount of RNA produced in the IVT reaction compared to a theoretical value of RNA calculated to be produced by the IVT reaction. In some embodiments, the yield is given by the formula: The estimated RNA yield (e.g., mg / mL) is determined according to the formula: (D) × (W) × (Z) / (X) = (Y). In the formula, (D), (W) (e.g., mg / mL), Z (e.g., mL), X (e.g., mL), and Y (e.g., mg / mL) represent the dilution factor used to resuspend the pellet (e.g., in water, e.g., RNase-free water), RNA concentration (e.g., measured by ARD), theoretical total reaction volume after the proteinase K digestion step, initial volume of the IVT process, and yield, respectively.
[0371] In some embodiments, the yield is at least about 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115%, 120%, 125% or more of the theoretical value. In some embodiments, the yield is about 70–125%, 75–125%, 80–125%, 85–125%, 70–120%, 75–120%, 80–120%, or 85–120%. In some embodiments, the yield (g / L starting IVT volume) is 3.30, 3.31, 3.32, 3.33, 3.34, 3.35, 3.36, 3.37, 3.38, 3.39, 3.40, 3.50, 3.60, 3.70, 3.80, 3.90, or 4.0 or more.
[0372] use In some embodiments, the RNA produced by the techniques of the present disclosure (e.g., therapeutic RNA, e.g., mRNA) has increased yield, integrity, and / or capping, and / or reduced formation of abnormal products and / or impurities (e.g., dsRNA). In some embodiments, the RNA produced is pharmaceutical-grade RNA. In some embodiments, the RNA produced by the techniques of the present disclosure can be used as a therapeutic agent to treat or prevent infections (e.g., bacteria, viruses) and / or diseases and / or disorders. In some embodiments, the RNA described herein can be used as a therapeutic agent to treat and / or prevent pathological conditions associated with infections and / or diseases and / or disorders.
[0373] In some embodiments, RNA produced by the techniques of the present disclosure may be useful for detecting and / or characterizing one or more features of an immune response (for example, by detecting binding to a provided antigen by serum from an infected and / or diseased and / or impaired subject).
[0374] In some embodiments, RNA produced by the techniques of the present disclosure may be useful in eliciting antibodies against one or more epitopes included herein, such antibodies themselves may be useful, for example, for the detection and / or treatment of infectious diseases and / or disorders.
[0375] In some embodiments, the present disclosure provides the use of RNA to produce an encoded antigen and / or the use of a DNA construct to produce RNA. [Examples]
[0376] Example 1: Exemplary reference in vitro transcription (IVT) reaction This embodiment provides an exemplary reference IVT reaction.
[0377] In some embodiments, a reference (e.g., control or standard) IVT reaction was carried out in the presence of a DNA template (linear plasmid), m27,3'-OGppp(m2'-O)ApG(CC413) cap analog (1.5 mM) for co-transcription capping, and nucleoside triphosphates (GTP, ATP, and m1ΨTP (each at a final concentration of 9 mM)). The starting concentration of GTP / m1ΨTP was reduced to 0.5 mM (1 / 18*9 mM) of the starting concentration and supplied in 11 additions throughout the transcription reaction until the final concentration was reached. The reaction was carried out at 37°C for 105 minutes using HEPES buffer (40 mM, pH 8.3) containing magnesium acetate (MgAc, 40 mM), dithiothreitol, and spermidine, in the presence of T7 RNA polymerase, an RNAse inhibitor (Ribolock), and inorganic pyrophosphatase (0.0001 U / μl). After IVT, the DNA template was removed via DNase digestion, and the RNA was purified using magnetic beads for immobilization (see, for example, Berensmeier, S. Magnetic particles for the separation and purification of nucleic acids. Appl. Microbiol. Biotechnol. 73, 495-504; 10.1007 / s00253-006-0675-0 (2006)). The RNA was eluted in water.
[0378] The constructs used were BNT162b1 or BNT162b2 (see, for example, Shoura et al. Assemblies of putative SARS-CoV-2-spike-encoding mRNA sequences for vaccines BNT-162b2 and mRNA-1273, PCT / EP21 / 59947, US17 / 233, 396).
[0379] Example 2: Exemplary method for producing RNA by in vitro transcription (IVT) This embodiment demonstrates an exemplary method for producing RNA by IVT utilizing the strategies described herein.
[0380] IVT reactions were carried out using N1-methyl-pseuduridine (m1ΨTP) fed batches. The components and conditions of the IVT reaction mixture are summarized in Figure 1. Those skilled in the art will understand, by reading this disclosure (referring, for example, to Figure 7 and / or Figure 17), that in some embodiments, dsRNA may be lower when elevated C is used, when elevated A is used, and / or when both elevated C and elevated A are used. In some embodiments, if C is used at concentrations, for example, in the range of +10% to +50% compared to suitable reference controls described herein, dsRNA may be reduced (e.g., in the range of about 25 to about 50 pg dsRNA / μg RNA). In some embodiments, if A is used at concentrations, for example, in the range of +20% to +50% compared to suitable reference controls described herein, dsRNA may be reduced (e.g., in the range of about 0 to 10 pg dsRNA / μg RNA). In some embodiments, if C is used at a concentration in the range of, for example, +10% to +50%, and A is used at a concentration in the range of, for example, +20% to +50% compared to a suitable comparative control described herein, the dsRNA may be reduced (for example, to an amount in the range of about 0 to about 10 pg dsRNA / μg RNA).
[0381] Residual nucleotide triphosphates (NTPs) after exemplary large-scale IVT production (37.6 L) were analyzed for two constructs (Figure 2).
[0382] Example 3: Exemplary IVT reaction mixture with increased CTP and / or ATP This example provides an exemplary IVT reaction, where the starting volume of ATP and / or CTP in the reaction mixture was adjusted from a control reaction as described in Example 1 (the term "+0%" CTP and / or ATP is used to indicate the control condition). Exemplary RNA was synthesized from a DNA template using IVT and further processed by steps including DNAse I digestion (e.g., to remove the DNA template) and proteinase K digestion (e.g., to facilitate the removal of proteins, e.g., polymerase, by ultrafiltration / diafiltration). After the proteinase K digestion step, the reaction sample was collected and purified for analysis. IVT was performed in a microbioreactor (e.g., AMBR15®) according to the conditions summarized in Table 2.1. [Table 3]
[0383] The produced RNA samples were analyzed for RNA concentration, RNA integrity, 5'-capping, residual NTPs, and poly(A) tail integrity. While we do not wish to be bound by any single theory, these features were selected for analysis due to the potential influence of changes in CTP concentration. The following formula was used to calculate the RNA yield for each scale: Using the estimated RNA yield (mg / mL) = (D) × (W) × (Z) / (X) = (Y), In the formula, (D), W (mg / mL), Z (mL), X (mL), and Y (mg / mL) represent the dilution factors used to resuspend RNA in water. These are the theoretical total reaction volume after the proteinase K digestion step, the initial volume of the IVT process, and the yield, respectively. To minimize the effect of sampling on yield at small scales, the theoretical total reaction volume was used to estimate the total amount of RNA produced in the IVT process.
[0384] Samples for residual NTP analysis were collected after proteinase K digestion. During residual NTP analysis, CTP was identified as being below the limit of quantification (Table 2.2). [Table 4]
[0385] Based on the observed CTP depletion, the CTP concentration in the IVT reaction mixture was evaluated from 10% less CTP volume to 50% more CTP volume compared to the control / standard (+0% CTP) to improve the produced RNA (Table 2.3). [Table 5]
[0386] Next, RNA produced under various exemplary conditions shown in Table 2.3 was evaluated for RNA integrity and capping. Increasing CTP volume resulted in increased integrity and capping at +20% and +50% CTP volumes, but remained relatively stable at + / -10% CTP starting concentrations (Figure 3). Additionally, the produced RNA was evaluated for poly(A) integrity and RNA integrity by digital droplet polymerase chain reaction (ddPCR). Increasing CTP resulted in increased poly(A) and RNA integrity of the produced RNA (Figure 4). Increased yield was also observed with increasing CTP concentration (Figure 5). Increasing CTP volume beyond the control (+0%) also resulted in maintaining CTP concentrations above the limit of quantification (Figure 5). However, higher CTP concentrations (e.g., +50% from control) brought ATP concentrations below the limit of quantification (Figure 5).
[0387] Further studies demonstrated that increasing the CTP initiation concentration in exemplary IVT reaction mixtures (+10% CTP, +20% CTP, +50% CTP compared to control) resulted in increased integrity and capping. Yields were also evaluated and further confirmed that increasing the CTP initiation concentration resulted in increased yield (Figure 6).
[0388] Further exemplary IVT reactions were performed in the presence of a DNA template (linear plasmid), m27,3'-OGppp(m2'-O)ApG(CC413) cap analog (1.5 mM) for simultaneous transcription capping, and nucleoside triphosphates (GTP, ATP, and m1ΨTP (each at a final concentration of 9 mM)). Starting CTP concentrations were 9 mM (standard / control), 9.9 mM (+10%), 10.8 mM (+20%), and 13.5 mM (+50%). The starting concentration of GTP / m1ΨTP was reduced to 0.5 mM (1 / 18*9 mM) of the starting concentration and supplied over the course of the transcription reaction in 11 additions until the final concentration was reached. While we do not wish to be bound by any particular theory, we suggest that such an approach may improve capping efficiency and / or reduce dsRNA. The reaction was carried out at 37°C for 105 minutes using HEPES buffer (40 mM, pH 8.3) containing magnesium acetate (MgAc, 40 mM), dithiothreitol, and spermidine, in the presence of T7 RNA polymerase, an RNAse inhibitor (Ribolock), and inorganic pyrophosphatase (0.0001 U / μl). After IVT, the DNA template was removed via DNase digestion, and the RNA was purified using magnetic beads for immobilization (see, e.g., Berensmeier, S. Magnetic particles for the separation and purification of nucleic acids. Appl. Microbiol. Biotechnol. 73, 495-504; 10.1007 / s00253-006-0675-0 (2006)). The RNA was eluted in water. The RNA concentration was measured by UV (Nanodrop), and the IVT yield was calculated (μg of generated RNA / μl of IVT reaction volume). RNA integrity was analyzed using an Agilent Bioanalyzer. For this purpose, 250 ng of RNA in 50% formamide was denatured at 70°C for 10 minutes and further treated with the Agilent RNA 6000 Nano Kit (5067-1511, Agilent). Integrity was subsequently calculated by the relationship between the major peak integral and the integral of the complete electrophoresis.To determine the amount of dsRNA, 1 μg of RNA was spotted in 5 μl aliquots onto a nylon blotting membrane (Nytran SuPerCharge (SPC) Nylon Blotting Membrane (GE Healthcare Life Sciences, Cat#10416216)). The membrane was then blocked for 1 hour in TBS-T buffer containing 5% (w / v) skim milk powder (20 mM TRIS pH 7.4, 137 mM NaCl, 0.1% (v / v) TWEEN-20). For dsRNA detection, the membrane was tested for J2 dsRNA-specific mouse mAbs diluted 1:10,000 in TBS-T buffer containing 1% (w / v) skim milk powder (English & Scientific). The membranes were incubated with TBS-T for 1 hour. After washing with TBS-T, the membranes were incubated for 1 hour with HRP-labeled donkey anti-mouse IgG (Jackson ImmunoResearch, Cat#715-035-150) diluted 1:10,000 in TBS-T buffer containing 1% (w / v) skim milk powder, washed with TBS-T, and colored using Amersham ECL Prime Western Blotting Detection Reagent (Fisher Scientific, Cat#RPN2232) and the ChemiDoc MP imaging system (BIO-RAD).
[0389] Enrichment of CTP levels in an exemplary IVT reaction mixture increased the yield of RNA produced (Figure 7A). While we do not wish to be bound by any single theory, this suggests that a decrease in CTP during the IVT reaction reaches a point where less RNA can be produced. Increasing the CTP initiation concentration can circumvent this effect. A similar effect is observed with respect to integrity. Here, limiting CTP levels almost always reduces integrity, via incomplete RNA transcripts. Again, this effect can be mitigated by increasing CTP levels (Figure 7B). As an additional positive effect, increasing the CTP initiation concentration reduces dsRNA formation (Figure 7C). One insight provided by this disclosure is that the use of elevated CTP and / or ATP, as described herein, may offer certain advantages, even if unrelated to depletion. Accordingly, in some embodiments, this disclosure provides the insight that the provided reaction conditions can be utilized independently of the construct sequence (for example, in some embodiments, C and / or A are present in the transcript (as described herein) at lower levels and / or associated proportions than in the reaction mixture). In particular, this insight provides standardized IVT production techniques, such as those described herein, with specific advantages and efficiencies for commercial-grade and / or scale production. For example, the ability to utilize equivalent conditions and / or components for a variety of multiple products (e.g., different RNA transcripts) can significantly promote and / or improve the reproducibility, feasibility, and / or reliability of such commercial-grade and / or scale production.
[0390] Increasing CTP concentration not only improves integrity but also increases yield and decreases dsRNA content.
[0391] The additional IVT reaction mixture, including the increased CTP concentration, was evaluated. All characteristics were measured after proteinase K digestion. [Table 6]
[0392] RNA produced under various exemplary conditions in Table 2.4 was evaluated for integrity and capping by CTP volume measured after proteinase K digestion (Figure 8). Additionally, the produced RNA was evaluated for poly(A) integrity and RNA integrity by digital droplet polymerase chain reaction (ddPCR). Increased CTP resulted in increased poly(A) and RNA integrity of the produced RNA (Figure 9). +40% to +60% CTP including the IVT reaction mixture showed little difference between these conditions for integrity (by fragment analyzer), 5'-cap, poly(A) tail, and integrity by ddPCR, but these conditions showed improvement over the control IVT reaction mixture (+0% IVT). Figure 10 shows increased yield for the +40% to +60% IVT reaction mixture over the control, but is consistent within the +40% to +60% range. Residual nucleotide analysis showed that all conditions continued to deplete ATP (Figure 10).
[0393] Further studies demonstrated that increasing the starting CTP concentration in exemplary IVT reaction mixtures (+40% CTP, +50% CTP, +60% CTP compared to control) resulted in increased yield and residual CTP, while ATP became the limiting NTP in this reaction. Interestingly, no further improvement in yield or integrity was observed in these reaction mixtures with CTP above +40%. RNA integrity and capping of RNA produced by IVT reaction mixtures with increased starting CTP concentrations were increased compared to control (Figure 11).
[0394] To evaluate the exemplary RNA produced by IVT with increased CTP and ATP, the IVT reaction was performed with a +50% CTP volume and an increased ATP volume in the reaction mixture. While we do not wish to be bound by any single theory, ATP may be particularly important, among other things, for the synthesis of the poly(A) tail. The conditions tested to evaluate the effect of the additionally increased ATP volume are summarized in Table 2.5. [Table 7]
[0395] Next, RNA produced under various exemplary conditions shown in Table 2.5 was evaluated for integrity and capping by CTP volume measured after proteinase K digestion (Figure 12). Additionally, the produced RNA was evaluated for poly(A) integrity and RNA integrity by digital droplet polymerase chain reaction (ddPCR). Increased CTP resulted in increased poly(A) and RNA integrity of the produced RNA (Figure 13). Figure 14 shows the increased yields of +10% and +20% ATP containing the IVT reaction mixture compared to the control, as well as the increases from +10% and +20% ATP containing the IVT reaction mixture. ATP levels were above the limit of quantification for +20% ATP containing the IVT reaction mixture, but below the limit of quantification for the control and +10% ATP containing the IVT reaction mixture (Figure 14).
[0396] Further studies demonstrated that, in addition to increasing the starting CTP concentration in exemplary IVT reaction mixtures (+50% CTP compared to control), increasing the starting ATP concentration (+10% ATP, +20% ATP compared to control) resulted in increased yield, integrity, and capping at +10% ATP, but ATP was still depleted or nearly depleted. The +20% ATP IVT reaction mixture demonstrated a further increase in yield, but no significant improvement in integrity or capping was demonstrated, and GTP was still depleted (Figure 15).
[0397] Example 4: Additional exemplary evaluation of IVT reaction mixture This embodiment demonstrates an additional exemplary evaluation of IVT reaction mixtures. Figure 16 summarizes the exemplary IVT reaction mixtures evaluated and the exemplary characterization of the produced RNA as CTP in the IVT reaction mixtures increases. Both RNA yield and integrity increased at higher CTP initiation concentrations, while dsRNA content decreased at higher CTP concentrations. Residual DNA increased at higher CTP initiation concentrations (Figure 16). While we do not wish to be bound by any one theory, residual DNA may have increased at higher CTP initiation concentrations due to a decrease in DNAse I activity, for example, from lower free magnesium cation levels.
[0398] The positive effects of additional CTP are not solely due to circumventing its limitations. Increases in other NTP levels (e.g., ATP) can further enhance IVT performance. While we do not wish to be bound by any one theory, additional ATP can reduce "free" Mg2+ ions, contribute to poly(A) tail transcription, lead to improved transcription termination, and potentially further reduce dsRNA formation. Enrichment of CTP and / or ATP in an IVT reaction mixture with 40 mM MgAc is possible only within this range, as the enrichment of ATP and CTP does not impair IVT performance, provided that GTP and UTP are supplied and the overall NTP concentration is kept sufficiently low.
[0399] Exemplary IVT was performed in the presence of a DNA template (linear plasmid), m27,3'-OGppp(m2'-O)ApG(CC413) cap analog (1.5 mM) for simultaneous transcription capping, and nucleoside triphosphates GTP and m1ΨTP (each at a final concentration of 9 mM). Initial CTP and ATP concentrations were 9 mM (standard / control) and 13.5 mM (+50%). Increases in CTP and ATP concentrations were tested individually and in combination.
[0400] As described in Example 2, RNA was transcribed in vitro, purified, and analyzed.
[0401] Enrichment of CTP levels in the IVT reaction mixture increased the yield of RNA produced (Figure 17A). While we do not wish to be bound by any one theory, we suggest that in these reactions, as the reaction progressed, a decrease in CTP reached a point where less RNA could be produced. Increasing the CTP initiation concentration avoided this effect. A similar effect was observed with respect to completeness. Here, it is most likely that limiting the CTP level reduced completeness via incomplete RNA transcripts. Again, this effect was relieved by increasing the CTP level (Figure 17B). As an additional positive effect, increasing the CTP initiation concentration reduced dsRNA formation (Figure 17C).
[0402] In particular, this disclosure provides the insight that increasing the CTP initiation concentration may be beneficial regardless of CTP expression in the produced transcript. For example, without wishing to be bound by any particular theory, we suggest that a reduction in dsRNA formation may be observed regardless of the level of CTP in the transcript. Alternatively or additionally, in some embodiments, elevated CTP may improve integrity regardless of CTP expression in the produced transcript. Nevertheless, since this disclosure teaches that increasing CTP to a level above the level expressed in the produced transcript does not harm the in vitro transcription reaction in many embodiments, in particular, in some embodiments, this disclosure provides IVT reaction conditions (e.g., a useful reaction mixture NTP concentration therein) that can be applied generally or universally to the production of various transcripts, e.g., different lengths and / or different nucleotide compositions.
[0403] Figure 18 summarizes the exemplary IVT reaction mixtures evaluated, as well as the exemplary characterization of the produced RNA as CTP and / or ATP in the IVT reaction mixtures were increased. Furthermore, it was confirmed that the IVT reaction mixtures yielded higher RNA yield and higher RNA integrity at +50% CTP and +20% ATP (Figures 18 and 19). Yield, integrity, and residual NTPs remained stable as the ATP volume increased. Levels of ATP, CTP, GTP, and modUTP were above the limit of quantification and remained stable as the amount of ATP increased (Figure 19).
[0404] Figure 20 shows exemplary evaluations of the yield, integrity, and residual dsRNA content of exemplary IVT reactions using reaction mixtures containing either +25% ATP and +7% CTP, -21% ATP and -37% CTP, +25% ATP, or +7% CTP, compared to a control.
[0405] Additional transcripts (e.g., non-BNT162b1 and BNT162b2) were evaluated with varying nucleotide content. Further ATP and / or CTP were added to the reaction mixture during the exemplary IVT reaction to produce transcripts. Either +50% ATP or +50% ATP and +20% CTP was used compared to a control reaction mixture containing 13.5 mM, 10.8 mM ATP, 9 mM GTP, and 9 mM UTP. The nucleotide content of the additional transcripts and exemplary reaction mixtures is shown in Table 4.1. [Table 8]
[0406] Equal parts Those skilled in the art will recognize many equivalents to the specific embodiments of the invention described herein, or they may verify them by standard experiments alone. The scope of the invention is not intended to be limited to the foregoing description, but is as described in the following claims.
Claims
1. A method for producing ribonucleic acid (RNA) molecules via in vitro transcription, comprising preparing a reaction mixture under reaction conditions to form the RNA molecule, wherein the reaction mixture comprises a nucleic acid polymerase, a nucleic acid template, and Total cytidine triphosphate (CTP) and / or one or more functional CTP analogs and / or total guanosine triphosphate (GTP) and / or one or more functional GTP analogs in a molar ratio of a to total guanosine triphosphate (GTP) and / or Total uridine triphosphate (UTP) and / or one or more functional UTP analogs in molar ratio b of total CTP and / or one or more functional CTP analogs and / or It comprises total adenosine triphosphate (ATP) and / or one or more functional ATP analogs in a molar ratio c, The RNA molecule Total cytidine and / or one or more functional cytidine analogs in a molar ratio of x to total guanosine and / or one or more functional guanosine analogs, and / or Total cytidine and / or one or more functional cytidine analogs in molar ratio y to total uridine and / or one or more functional uridine analogs, and / or It comprises total cytidine and / or one or more functional cytidine analogs in a molar ratio z to total adenosine and / or one or more functional adenosine analogs, a is at least 1.2, and / or a is at least 1.10 times x, and / or b is at least 1.2, and / or b is at least 1.10 times y, and c is at least 1, and / or c is at least 1.10 times z. The aforementioned method, which is independent of the RNA molecule sequence.
2. The method according to claim 1, wherein a is at least 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.65, 1.70, 1.75, or 1.
8.
3. The method according to claim 1 or 2, wherein a is at least 1.15 times x.
4. The method according to any one of claims 1 to 3, wherein b is at least 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.65, 1.70, 1.75, or 1.
8.
5. The method according to any one of claims 1 to 4, wherein b is at least 1.15 times y.
6. The method according to any one of claims 1 to 5, wherein c is at least 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, or 1.
50.
7. The method according to any one of claims 1 to 6, wherein c is at least 1.15 times z.
8. In the reaction mixture, Total ATP and / or one or more functional ATP analogs (or more) in molar ratio d to total GTP and / or one or more functional GTP analogs (or more), and / or Further comprising combining total ATP and / or one or more functional ATP analogs(s) with total UTP and / or one or more functional UTP analogs(s), The RNA molecule Total adenosine and / or one or more functional adenosine analogs in a molar ratio of v to total guanosine and / or one or more functional guanosine analogs, and / or The present invention further comprises total adenosine and / or one or more functional adenosine analogs in a molar ratio w to total uridine and / or one or more functional uridine analogs, d is at least 1.10, and / or d is at least 1.05 times v, and / or The method according to any one of claims 1 to 7, wherein e is at least 1.10 and / or e is at least 1.05 times w.
9. The method according to claim 8, wherein d is at least 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, or 1.
50.
10. The method according to claim 8 or 9, wherein d is at least 1.10 times v.
11. The method according to any one of claims 8 to 10, wherein e is at least 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, or 1.
50.
12. The method according to any one of claims 8 to 11, wherein e is at least 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, or 1.50 times w.
13. The method according to any one of claims 1 to 12, wherein a portion or all of the total CTP, GTP, UTP, or ATP and / or one or more functional CTP, GTP, UTP, or ATP analogs is added to the reaction mixture before the start of transcription and / or at the start of transcription, and the remaining portion of the total CTP, GTP, UTP, or ATP and / or one or more functional CTP, GTP, UTP, or ATP analogs is added to the reaction mixture after the start of transcription.
14. The method according to any one of claims 1 to 13, wherein the RNA molecule is single-stranded.
15. The method according to any one of claims 1 to 14, wherein the nucleic acid template is a DNA template.
16. The method according to any one of claims 1 to 15, wherein the reaction mixture further comprises one or more of a reaction buffer, an RNase inhibitor, a pyrophosphatase, one or more salts, a reducing agent, and spermidine.
17. The method according to any one of claims 1 to 16, wherein the RNA integrity of the RNA molecule produced by the method is at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%.
18. The method according to any one of claims 1 to 17, wherein the RNA integrity of the RNA molecule produced by the method is increased by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% compared to in vitro transcription in a reaction mixture in which a is less than 1.2, b is less than 1.2, and / or c is less than 1.
19. The method according to any one of claims 1 to 18, wherein the concentration of the RNA molecule produced by the method is at least 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL, 5 mg / mL, 6 mg / mL, 7 mg / mL, 8 mg / mL, 9 mg / mL, 10 mg / mL, 11 mg / mL, 12 mg / mL, 13 mg / mL, 14 mg / mL, or 15 mg / mL.
20. The method according to any one of claims 1 to 19, wherein at least 40%, 50%, 60%, 70%, 80%, 90%, or 99% of the RNA molecules produced by the method are capped.
21. The method according to any one of claims 1 to 20, wherein the RNA is therapeutic RNA.
22. The method according to any one of claims 1 to 21, for the large-scale production of RNA.