Sufficiently stabilized asymmetric SIRNA

Fully chemically stabilized, asymmetric siRNA compounds with 2'-fluoro and 2'-methoxy modifications and phosphorothioate tails, conjugated to targeting agents, address the need for efficient RISC entry, minimal immune response, and specific tissue distribution, enhancing therapeutic efficacy and reducing off-target effects.

JP7881194B2Active Publication Date: 2026-06-29UNIV OF MASSACHUSETTS
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2023222969
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2016-01-26
Filing Date
2023-12-28
Publication Date
2026-06-29
Estimated Expiration
2036-04-01

AI Technical Summary

Technical Problem

There is a need for self-delivering siRNAs that exhibit efficient RISC entry, minimal immune response, efficient cell uptake, and specific tissue distribution without formulation, while maintaining high potency and reducing off-target effects.

Method used

The development of fully chemically stabilized, asymmetric siRNA compounds with an 11-16 base pair duplex and an alternating pattern of 2'-fluoro and 2'-methoxy modifications, along with a fully phosphorothioated tail, which can be conjugated to targeting agents like cholesterol, DHA, or gangliosides, enhancing in vitro potency and tissue distribution.

Benefits of technology

These compounds, referred to as hsiRNA-ASP, demonstrate dramatic improvements in tissue distribution across the brain, spinal cord, liver, placenta, kidney, and spleen, with specific delivery to endothelial and Kupffer cells, and reduced toxicity, making them suitable for therapeutic intervention.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007881194000024
    Figure 0007881194000024
  • Figure 0007881194000025
    Figure 0007881194000025
  • Figure 0007881194000026
    Figure 0007881194000026
Patent Text Reader

Abstract

To provide self-delivering oligonucleotides that realize efficient RISC entry, minimum immune response and off-target effects, efficient cellular uptake, and efficient and specific tissue distribution, without formulation.SOLUTION: Provided herein is an oligonucleotide of at least 16 contiguous nucleotides, the oligonucleotide having a 5' end, a 3' end, and complementarity to a target, where (1) the oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are connected via phosphodiester or phosphorothioate linkages; and (4) the nucleotides at positions 1-6 from the 3' end or positions 1-7 from the 3' end are connected to adjacent nucleotides via phosphorothioate linkages.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related applications This application claims priority under U.S. Provisional Patent Application No. 62 / 142,786 filed 3 April 2015, U.S. Provisional Patent Application No. 62 / 205,218 filed 14 August 2015, and U.S. Provisional Patent Application No. 62 / 287,255 filed 26 January 2016, and incorporates, by reference, the entire contents of those applications.

[0002] Statements relating to federal aid research or development This invention was implemented with government assistance under authorization numbers NS038194 and TR000888 granted by the National Institutes of Health (NIH) and authorization number OPP1086170 granted by the National Science Foundation (NSF). The government has certain rights to this invention.

[0003] Field of Invention This invention relates to novel oligonucleotides useful for RNA interference (RNAi), consisting of fully chemically modified ribonucleotides. The chemically modified nucleotides and linkers are shaped to achieve unexpectedly high potency, uptake, and tissue distribution. [Background technology]

[0004] background Oligonucleotides containing chemically modified ribonucleotides (e.g., 2'-fluoro and 2'-methoxy modifications) and / or chemically modified linkers (e.g., phosphorothioate modifications) are known to exhibit enhanced nuclease resistance compared to their corresponding unmodified oligonucleotides while maintaining the ability to promote RNAi. See, e.g., Fosnaugh, et al. (U.S. Publication 2003 / 0143732). Oligonucleotides containing alternating chemically modified nucleotides are known. See, e.g., Bhat et al. (U.S. Publication 2008 / 0119427). Hydrophobic modifications of therapeutic RNAs (e.g., siRNAs) are known. See, e.g., Khvorova, et al. (PCT / US2009 / 005247). SUMMARY OF THE INVENTION PROBLEMS TO BE SOLVED BY THE INVENTION

[0005] There is still a need for self-delivering siRNAs that are characterized by efficient RISC entry, minimal immune response and off-target effects, efficient cell uptake, and efficient and specific tissue distribution without formulation. MEANS FOR SOLVING THE PROBLEMS

[0006] summary Thus, in one aspect, siRNA compounds are provided herein having the following properties: (1) completely chemically fully stabilized (i.e., no unmodified 2'-OH residues); (2) asymmetric; (3) an 11-16 base pair duplex; (4) an alternating pattern of chemically modified nucleotides (e.g., 2'-fluoro and 2'-methoxy modifications); (5) a single-stranded, fully phosphorothioated tail of 5-8 bases. The number of phosphorothioate modifications varies from a total of 6-17 in various aspects.

[0007] In certain embodiments, the siRNA compounds described herein can be conjugated to a variety of targeting agents including, but not limited to, cholesterol, DHA, phenyltropane, cortisol, vitamin A, vitamin D, GalNac, and gangliosides. Cholesterol modifications improve the in vitro potency 5 - 10 fold in a wide range of cell types (e.g., HeLa, neurons, hepatocytes, trophoblasts) relative to previously used chemical stabilization patterns (e.g., modifying all purines rather than pyrimidines).

[0008] Certain compounds of the invention having the structural properties described above and herein can be referred to as "hsiRNA-ASP" (hydrophobically-modified, small interfering RNA, featuring an advanced stabilization pattern), and also as "FM-hsiRNA" (Fully Modified hydrophobically-modified, small interfering RNA). Further, this hsiRNA-ASP pattern shows dramatic improvements in distribution across the brain, spinal cord, delivery to the liver, placenta, kidney, spleen, and several other tissues, making them available for therapeutic intervention.

[0009] In the liver, hsiRNA-ASP is delivered specifically to endothelial and Kupffer cells, but not hepatocytes, making this chemical modification pattern a complementary technology to GalNac conjugation, rather than a competing one.

[0010] The compounds of the invention can be described in the following aspects and embodiments.

[0011] In a first aspect, provided herein is a compound (I): an oligonucleotide of at least 16 contiguous nucleotides, the oligonucleotide having 5' and 3' termini and complementarity to a target, where, (1) The oligonucleotides consist of alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) The nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxyribonucleotides; (3) Nucleotides are linked by phosphodiester bonds or phosphorothioate bonds; and (4) Nucleotides at positions 1-6 from the 3' end or positions 1-7 from the 3' end are linked to adjacent nucleotides by phosphorothioate bonds.

[0012] In the second aspect, provided herein is a double-stranded, chemically modified nucleic acid comprising a first oligonucleotide compound (I) and a second oligonucleotide compound (II), where, (1) A portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (2) The second oligonucleotide consists of alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (3) The nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxyribonucleotides; and (4) The nucleotides of the second oligonucleotide are linked by phosphodiester or phosphorothioate bonds.

[0013] In the third dimension, the compound (Ia) is provided herein. [ka] [During the ceremony, X is [ka] Selected from the group consisting of; A is independently a 2'-methoxy-ribonucleotide; B is independently a 2'-fluoro-ribonucleotide; K is independently a phosphodiester or phosphorothioate linker; S is a phosphorothioate linker; R is independently selected from hydrogen and a capping group (e.g., an acyl group such as acetyl); j is 4, 5, 6, or 7; r is 2 or 3; t is 0 or 1. This is an oligonucleotide having the following structure.

[0014] In the fourth dimension, provided herein is a double-stranded, chemically modified nucleic acid comprising a first oligonucleotide and a second oligonucleotide, where, (1) The first oligonucleotide is the oligonucleotide described herein (for example, compound (I), (Ia), or (Ib)); (2) A portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; and (3) The second nucleotide is compound (IIa) [ka] [In the formula, C is a hydrophobic molecule; A is independently a 2'-methoxy-ribonucleotide; B is independently a 2'-fluoro-ribonucleotide; L is a linker comprising one or more parts selected from the group consisting of ethylene glycol, phosphodiesters, and phosphorothioates with 0 to 20 repeat units; S is a phosphorothioate linker; P is a phosphodiester linker; R is selected from hydrogen and a capping group (e.g., an acyl group such as acetyl); m' is 0 or 1; n' is 4, 5, or 6; q' is 0 or 1; r' is 0 or 1; t' is 0 or 1.] It has the structure of [the object]. [Brief explanation of the drawing]

[0015] [Figure 1-1]Figures 1A-D. Hydrophobic siRNA structure / chemical composition, uptake in the primary human trophoblast cell layer (CTB), and efficacy are shown. (A) A schematic representation of hydrophobic modification and stabilization of siRNA (hsiRNA) in a certain manner is shown. sFlt1-i13-2283 hsiRNA and matching NTCs were added to the CTB at the concentrations shown. (B) sFLT1 protein levels were measured by ELISA (#MVR100, R&D systems) in conditional culture medium 72 hours after treatment. (C) sFlt1-i13 mRNA levels and (D) Flt1-FL mRNA levels are listed, measured using QUANTIGENE (Affymetrix) at 72 hours (n=3, mean ±SD). UNT - untreated cells, NTC - non-targeting control with matching chemistry. [Figure 1-2] Same as above.

[0016] [Figure 2] This document describes specific nucleotide and linker chemical modifications.

[0017] [Figure 3] This document describes the identification and verification of the compounds of the present invention that target the i13 and i14 isoforms of sFLT1.

[0018] [Figure 4] This shows the efficiency of hsiRNA delivery to the liver, kidneys, and placenta. (A) Wild-type pregnant mice (E15) were injected with Cy3-sFLT1-2283-P2 (red) (10 mg / kg; IV via tail vein). Tissues were fixed 24 hours later, processed, and imaged at 10x and 63x with a Leica tiling fluorescence microscope; nuclei were stained with DAPI (blue). (B) Tissue distribution of sFLT1-2283 (40 mg / kg) 5 days after injection, analyzed by PNA assay (n=7, mean ± SEM).

[0019] [Figure 5] The in vivo quantification of the compound of the present invention by PNA assay is described below.

[0020] [Figure 6] The data shows the silencing of Flt1 by the compound of the present invention in WT pregnant mice.

[0021] [Figure 7] The effects of hsiRNA chemistry and administration route on placental accumulation and distribution are described. (A) Wild-type pregnant mice (E15) were injected with Cy3-sFLT1-2283 (red) (10 mg / kg; intravenous via tail vein). The placentas were fixed after 24 hours, processed, and imaged with a Leica tiling fluorescence microscope; nuclei were stained with DAPI (blue). (B) Accumulation of sFLT1-i13-2283 (10 mg / kg) after 24 hours, as analyzed by PNA assay (n=3, mean ± SEM). (C) Schematic representation of sFLT1-i13-2283 hsiRNA with various modification patterns. P - 5'-phosphate; Chol-teg - cholesterol-teg linker; white circle - RNA; black circle - 2'-O-methyl; gray circle - 2'-fluoro; red circle - phosphorothioate.

[0022] [Figure 8] The structure and stabilization pattern of the siRNA compound of the present invention are shown.

[0023] [Figure 9] This shows the modification pattern of the compound of the present invention and the resulting increase in in vitro potency.

[0024] [Figure 10] Data demonstrating the increased efficacy of the compound of the present invention compared to comparator compounds that do not have ASP (Advanced Stabilization Pattern) chemical modification is described.

[0025] [Figure 11] Data demonstrating the increased efficacy of the compound of the present invention compared to comparator compounds that do not have ASP (Advanced Stabilization Pattern) chemical modification is described.

[0026] [Figure 12]The efficacy of HTT10150-ASP-P1 and HTT10150-ASP-P2 against HTT10150 in nerve cells is described.

[0027] [Figure 13] This document presents data demonstrating that HTT10150-ASP is more powerful when ROS is regulated in Q140.

[0028] [Figure 14] This paper describes data showing that HTT10150-ASP-P2 exhibits good long-term silencing and efficacy in nerve cells.

[0029] [Figure 15] This document describes data demonstrating that HTT10150-ASP-P2 exhibits reduced toxicity to primary neurons.

[0030] [Figure 16] Data showing a significant reduction in toxicity for compounds exhibiting an ASP pattern relative to HTT10150 will be described.

[0031] [Figure 17] The number of phosphorothioates and modified nucleotide monomers are shown compared to the P0, P1, and P2 modification patterns.

[0032] [Figure 18] Alternative modification patterns are shown.

[0033] [Figure 19] This section describes data regarding the uptake of siRNAs with alternative modification patterns.

[0034] [Figure 20] This document describes data demonstrating that siRNAs with alternating 2'-O-methyl(2'-methoxy) / 2'-fluoro patterns exhibit increased potency in vitro.

[0035] [Figure 21] This paper describes data demonstrating that siRNAs with fully fluorinated antisense strands exhibit reduced potency compared to siRNAs with the corresponding alternating 2'-methoxy / 2'-fluoro patterns.

[0036] [Figure 22] This paper describes data showing that siRNAs with fluorinated antisensyl do not exhibit improved efficacy compared to siRNAs with the corresponding fully alternating 2'-methoxy / 2'-fluoro pattern.

[0037] [Figure 23-1] This table lists potent siRNAs representing various chemical skeletons and unique sequences of the sFlt1 I13 short, I13 long, and I15a isoforms. In this table, “guide” refers to the antisense chain; “C” refers to cytidine; “U” refers to uridine; “A” refers to adenosine; “G” refers to guanosine; “m” indicates 2'-methoxy chemical modification; “f” indicates 2'-fluoro chemical modification; “#” refers to a phosphorothioate linker; “P” refers to a 5'-phosphate; “teg” refers to triethylene glycol; and “Chol” refers to cholesterol. [Figure 23-2] Same as above. [Figure 23-3] Same as above. [Figure 23-4] Same as above. [Figure 23-5] Same as above. [Figure 23-6] Same as above.

[0038] [Figure 24-1]This table describes target sequences, modified oligonucleotides, and their efficacy in a particular manner. In this table, "C" refers to cytidine; "U" refers to uridine; "A" refers to adenosine; "G" refers to guanosine; "m" indicates 2'-methoxy chemical modification; "f" indicates 2'-fluoro chemical modification; "#" refers to a phosphorothioate linker; "P" refers to a 5'-phosphate; "." refers to a phosphodiester bond; "teg" refers to triethylene glycol; and "Chol" refers to cholesterol. [Figure 24-2] Same as above. [Figure 24-3] Same as above. [Figure 24-4] Same as above. [Figure 24-5] Same as above. [Figure 24-6] Same as above. [Figure 24-7] Same as above. [Figure 24-8] Same as above. [Figure 24-9] Same as above.

[0039] [Figure 25] Figures 25A-25B. Graphs show concentration-dependent silencing of huntingtin mRNA by HTT10150 in HeLa cells. Huntingtin mRNA levels were measured over 72 hours using QUANTIGENE (Affymetrix), normalized for housekeeping genes, PPIB (cyclophyllin B), and expressed as a percentage relative to untreated control (n=3, mean ± SD). UNT - untreated cells, NTC - untargeted control. A) Dose response of 16 active sequences in passive uptake (no formulation). B) Dose response of 8 selectable sequences using lipid-mediated uptake (Invitrogen LIPOFECTAMINE RNAIMAX Transfection Reagent). Dose response data were fitted using GraphPad Prism 6.03.

[0040] [Figure 26]Figures 26A–26C describe concentration-dependent silencing of huntingtin mRNA by HTT10150, both passively (A) and via lipid-mediated delivery (B). Chemical modifications allow for passive uptake without negatively affecting siRNA RISC (RNA-Induced Silencing Complex) entry. HeLa cells were incubated with modified (including both hydrophobic and nucleotide chemical modifications) or unmodified HTT10150 at the indicated concentrations, in the absence (A) and in the presence (B) of RNAIMAX. Huntingtin mRNA levels were measured at 72 hours using QUANTIGENE (Affymetrix), normalized to the housekeeping gene PPIB (cyclophyllin B), and expressed as a percentage relative to untreated control (n=3, mean ± SD). UNT - untreated cells. IC50 values ​​were calculated as shown here (C).

[0041] [Figure 27-1] Figures 27A-27B. Graphs show concentration-dependent silencing of huntingtin mRNA and protein by HTT10150 in primary neurons (passive uptake). Primary neurons were incubated with HTT10150 at the indicated concentrations. Huntingtin mRNA levels were measured using QUANTIGENE (Affymetrix), normalized to the housekeeping gene PPIB (cyclophyllin B), and expressed as a percentage relative to untreated control (n=3, mean ± SD). UNT - Untreated cells. (A) Primary cortical and striatal neurons, 1 week. (B) Huntingtin protein levels after 1 week incubation with HTT10150 were detected by Western blotting and normalized to β-tubulin. [Figure 27-2] Same as above.

[0042] [Figure 28]Huntingtin mRNA levels are described. Primary cortical neurons were incubated with the indicated concentrations of 3HTT hsiRNA sequences HTT10150, HTT10146, and HTT1215. Huntingtin mRNA levels were measured using QUANTIGENE (Affymetrix), normalized for the housekeeping gene PPIB (cyclophyllin B), and expressed as a percentage relative to untreated control (n=3, mean ± SD). UNT - Untreated cells.

[0043] [Figure 29-1] Figures 29A-29F. hsiRNA and their properties are described. (A) Schematic structures of conventionally modified hsiRNA and fully modified hsiRNA (FM-hsiRNA). (B) Modifications used in hsiRNA. (C) hsiRNAHTT efficacy in HeLa cells. (D) hsiRNAHTT efficacy in primary neurons. (E) hsiRNAPPIB efficacy in primary trophoblast cells. (F) hsiRNASFLI efficacy in primary trophoblast cells. [Figure 29-2] Same as above.

[0044] [Figure 30-1] Figures 30A-30G. Complete metabolic stabilization in conjugate-mediated siRNA delivery in vivo is described. (A) Schematic diagrams of partially (hsiRNA) and completely metabolically stabilized hsiRNA-FMS compounds. (B) hsiRNAFLT accumulation level after IV administration. (C) hsiRNAFLT accumulation level after SC administration. (D) FM-hsiRNAFLT accumulation level after IV administration. (E) FM-hsiRNAFLT accumulation level after SC administration. (F) sFLT1 mRNA expression in the liver and kidney 120 hours after hsiRNAFLTIV administration. (G) sFLT1 mRNA expression in the liver and kidney 120 hours after FM-hsiRNAFLTIV administration. [Figure 30-2] Same as above.

[0045] [Figure 31-1]Figures 31A-31G. Intrastriatal administration of hsiRNAHTT and FM-hsiRNAHTT. (A) hsiRNAHTT expression levels in brain sections. (B) FM-hsiRNAHTT expression levels in brain sections. (C) FM-hsiRNAHTT expression levels in the cortex. (D) FM-hsiRNAHTT expression levels in the striatum. (E) FM-hsiRNAHTT expression levels in the cerebellum. (F) hsiRNAHTT and FM-hsiRNAHTT silencing using 3 μg, 6 μg, and 12 μg doses. (G) hsiRNAHTT and FM-hsiRNAHTT silencing 1, 2, and 4 weeks after injection. [Figure 31-2] Same as above.

[0046] [Figure 32] This paper describes a comparison of Htt hsiRNAHTT (hsiRNA-F1) and LNA-GAPMER silencing over a certain concentration range.

[0047] [Figure 33] This paper describes the preferential elimination of cytoplasmic Htt mRNA over nuclear Htt mRNA by HTT10150.

[0048] [Figure 34-1] This report describes the results of a single intrastriatal hsiRNA injection to induce dose-dependent silencing in vivo. [Figure 34-2] Same as above.

[0049] [Figure 35] This section describes the quantification of the inflammatory response at the HTT10150 injection site.

[0050] [Figure 36] Examples of nucleotide internucleotide bonding are described below.

[0051] [Figure 37] Examples of internucleotide main chain bonding are described below.

[0052] [Figure 38]This document describes fully metabolized and stabilized hsiRNA (FM-hsiRNA). (A) Schematic diagrams of partially and fully modified hsiRNA. (B) hsiRNA and FM-hsiRNA have equivalent ability to enter RISC (HeLa, 72 hours, QuantiGene®). (C) FM-hsiRNA supports passive delivery, unlike naked siRNA. (D) Metabolized and stabilized 5'-E-VP is active as 5'-P. (E) 5'-E-VP allows for sustained delivery to distal tissues (7 days after injection, PNA assay).

[0053] [Figure 39] This report describes in vivo conjugate-mediated siRNA delivery and duration of effect. hsiRNA (A) and fully modified FM-hsiRNA (B) were injected IV (10 mg / kg) or ICV (60 μg), and distribution was evaluated by microscopy (10x, Leica, Dapi, blue, nucleus, Cy3, red, hsiRNA). Full stabilization dramatically enhances tissue retention (C). Intact guide chain quantification was analyzed in the liver and kidney 5 days after IV injection by PNA assay (n=3, mean ± SEM). (D) FM-hsiRNA silences Htt mRNA in the mouse striatum 1 month after injection (IS, 12 μg), QuantiGene®. Partially modified hsiRNA loses its silencing effect after 1 week. [Modes for carrying out the invention]

[0054] Detailed description In the first aspect, provided herein is compound (I): an oligonucleotide of at least 16 consecutive nucleotides, wherein the oligonucleotide has a 5' end, a 3' end and complementarity to the target, (1) The oligonucleotides consist of alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) The nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxyribonucleotides; (3) Nucleotides are linked by phosphodiester bonds or phosphorothioate bonds; and (4) Nucleotides at positions 1-6 from the 3' end or positions 1-7 from the 3' end are linked to adjacent nucleotides by phosphorothioate bonds.

[0055] In one embodiment, the oligonucleotide has sufficient complementarity to hybridize with the target. In one embodiment, the complementarity is >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50%. In one embodiment, the oligonucleotide has complete complementarity with the target.

[0056] In one embodiment of the oligonucleotide, the target is mammalian or viral mRNA. In another embodiment, the target is an intron region of the mRNA. In another embodiment, the target is the 5' UTR region of the mRNA. In another embodiment, the mRNA corresponds to a portion of soluble Flt1 (sFlt1). In a particular embodiment, the mRNA corresponds to a portion (e.g., an intron region) of sFlt i13 (e.g., long sFlt-i13 or short sFlt-i13). In another particular embodiment, the mRNA corresponds to a portion (e.g., an intron region) of sFlt i15a. In another embodiment, the mRNA corresponds to a portion of the huntingtin gene (e.g., a mutant huntingtin gene).

[0057] In the second aspect, provided herein is a double-stranded, chemically modified nucleic acid comprising a first oligonucleotide compound (I) and a second oligonucleotide compound (II), where, (1) A portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (2) The second oligonucleotide consists of alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (3) The nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxyribonucleotides; and (4) The nucleotides of the second oligonucleotide are linked by phosphodiester or phosphorothioate bonds.

[0058] In one embodiment, the first oligonucleotide is an antisense chain, and the second oligonucleotide is a sense chain.

[0059] In one embodiment, the double-stranded nucleic acid contains one or more mismatches within the complementary regions of the first and second oligonucleotides. In a particular embodiment, the double-stranded nucleic acid contains one mismatch within the complementary regions of the first and second oligonucleotides.

[0060] In one embodiment of nucleic acids, a second oligonucleotide is bonded to a hydrophobic molecule at the 3' end of the second oligonucleotide. In one embodiment, the bond between the second oligonucleotide and the hydrophobic molecule contains polyethylene glycol. In a specific embodiment, the bond between the second oligonucleotide and the hydrophobic molecule contains triethylene glycol.

[0061] In another embodiment of nucleic acids, the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide are linked to adjacent nucleotides by phosphorothioate bonds. In yet another embodiment, the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide and the nucleotides at positions 1 and 2 from the 5' end of the second oligonucleotide are linked to adjacent ribonucleotides by phosphorothioate bonds.

[0062] In the third aspect, what is provided here is compound (Ia) [ka] [During the ceremony, X is [ka] Selected from the group consisting of; A is independently a 2'-methoxy-ribonucleotide; B is independently a 2'-fluororibonucleotide; Each K is independently a phosphodiester or phosphorothioate linker; S is a phosphorothioate linker; R is independently selected from hydrogen and a capping group (e.g., an acyl group such as acetyl); j is 4, 5, 6, or 7; r is either 2 or 3; t is either 0 or 1. This is an oligonucleotide having the following structure.

[0063] In a particular embodiment, R is hydrogen. In another particular embodiment, X is X1. In yet another particular embodiment, X is X3.

[0064] In one embodiment, the oligonucleotide of compound (Ia) is compound (Ib): [ka] [During the ceremony, X is as defined above; A is independently a 2'-methoxy-ribonucleotide; B is independently a 2'-fluororibonucleotide; S is a phosphorothioate linker; P is a phosphodiester linker; R is defined above; m is either 0 or 1; n is 4, 5, or 6; q is either 0 or 1; r is either 2 or 3; t is either 0 or 1. It has the structure of [the object].

[0065] In a first specific embodiment of compound (Ib), m is 0; n is 6; q is 1; r is 2; and t is 1. See, for example, species P1 in Figure 7 and species HTT10150-ASP-P1 in Figure 17.

[0066] In a second specific embodiment of compound (Ib), m is 1; n is 5; q is 1; r is 2; and t is 1. See, for example, species P2 in Figure 7.

[0067] In a third specific embodiment of compound (Ib), m is 1; n is 5; q is 0; r is 3; and t is 1. See, for example, species HTT10150-ASP-P2 in Figure 17.

[0068] In a particular embodiment, R is hydrogen. In another particular embodiment, X is X1. In yet another particular embodiment, X is X3.

[0069] In the fourth aspect, provided herein are double-stranded, chemically modified nucleic acids comprising a first oligonucleotide and a second oligonucleotide, where, (1) The first oligonucleotide is the oligonucleotide described herein (for example, compound (I), (Ia), or (Ib)); (2) A portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; and (3) The second nucleotide is compound (IIa) [ka] [During the ceremony, C is a hydrophobic molecule; A is independently a 2'-methoxy-ribonucleotide; B is independently a 2'-fluororibonucleotide; L is a linker containing ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphodiesters, phosphorothioates, phosphoramidates, amides, carbamates, or combinations thereof; S is a phosphorothioate linker; P is a phosphodiester linker; R is independently selected from hydrogen and a capping group (e.g., an acyl group such as acetyl); m' is either 0 or 1; n' is 4, 5, or 6; q' is either 0 or 1; r' is either 0 or 1; and t' is either 0 or 1. It has the structure of [the object].

[0070] In one embodiment, L is a linker containing ethylene glycol with 0-20, 0-10, or 0-4 repeating units. In a particular embodiment, L is a linker containing ethylene glycol with 3 repeating units (i.e., triethylene glycol). In another particular embodiment, L is L1, L2, and L3 [ka] Selected from.

[0071] In one embodiment of double-stranded nucleic acids, the hydrophobic molecule is cholesterol. In another embodiment, the first oligonucleotide has 3 to 7 more ribonucleotides than the second oligonucleotide. In another specific embodiment, each R is hydrogen.

[0072] In one embodiment, the double-stranded nucleic acid contains one or more mismatches within the complementary regions of the first and second oligonucleotides. In a particular embodiment, the double-stranded nucleic acid contains one mismatch within the complementary regions of the first and second oligonucleotides.

[0073] In one embodiment, the double-stranded nucleic acid comprises 11 to 16 base pairs, where each base pair of nucleotides has a different chemical modification (for example, one nucleotide has a 2'-fluoro modification and the other nucleotide has a 2'-methoxy modification). In a particular embodiment, the double-stranded nucleic acid comprises 15 base pairs.

[0074] In one embodiment of double-stranded nucleic acids, the first oligonucleotide has the structure X(-SBSA)(-PBPA)5(-PBSA)(-SBSA)2(-SB)-OR; the second oligonucleotide has the structure CLB(-SASB)(-PAPB)5(-SA)(-SB)-OR. See, for example, species P2 in Figure 7. In a particular embodiment, the double-stranded nucleic acid is compound (IIIa) [ka] [In the formula, each l represents a hydrogen bonding interaction (i.e., a base pairing interaction).] It has a structure

[0075] In a particular embodiment of compound (IIIa), the first oligonucleotide comprises the sequence 5' UAAAUUUGGAGAUCCGAGAG 3'; the second oligonucleotide comprises the sequence 3' AUUUAAACCUCUAGG 5'; X is X3; and C is cholesterol. In a further embodiment, R is hydrogen. In a further embodiment, L comprises triethylene glycol. In a particular embodiment, L is L3.

[0076] In other specific embodiments of compound (IIIa), the first oligonucleotide comprises the sequence 5' UAUAAAUGGUAGCUAUGAUG 3'; the second oligonucleotide comprises the sequence 3' AUAUUUACCAUCGAU 5'; X is X3; and C is cholesterol. In further embodiments, R is hydrogen. In further embodiments, L comprises triethylene glycol. In specific embodiments, L is L3.

[0077] In other specific embodiments of compound (IIIa), the first oligonucleotide comprises the sequence 5' UUAAUCUCUUUACUGAUAUA 3'; the second oligonucleotide comprises the sequence 3' AAUUAGAGAAAUGAC 5'; X is X3; and C is cholesterol. In further embodiments, R is hydrogen. In further embodiments, L comprises triethylene glycol. In specific embodiments, L is L3.

[0078] In other embodiments of double-stranded nucleic acids, the first oligonucleotide has the structure X(-PBPA)6(-PBSA)(-SBSA)2(-SB)-OR; the second oligonucleotide has the structure CLB(-SASB)(-PAPB)6-OR. See, for example, species P1 in Figure 7. In a particular embodiment, the double-stranded nucleic acid is compound (IIIb) [ka] [In the formula, each l represents a hydrogen bonding interaction (i.e., a base pairing interaction).] It has the structure of [the object].

[0079] In a particular embodiment of compound (IIIb), the first oligonucleotide comprises the sequence 5' UAAAUUUGGAGAUCCGAGAG 3'; the second oligonucleotide comprises the sequence 3' AUUUAAACCUCUAGG 5'; X is X3; and C is cholesterol. In a further embodiment, R is hydrogen. In a further embodiment, L comprises triethylene glycol. In a particular embodiment, L is L3.

[0080] In other specific embodiments of compound (IIIb), the first oligonucleotide comprises the sequence 5' UAUAAAUGGUAGCUAUGAUG 3'; the second oligonucleotide comprises the sequence 3' AUAUUUACCAUCGAU 5'; X is X3; and C is cholesterol. In further embodiments, R is hydrogen. In further embodiments, L comprises triethylene glycol. In specific embodiments, L is L3.

[0081] In other specific embodiments of compound (IIIb), the first oligonucleotide comprises the sequence 5' UUAAUCUCUUUACUGAUAUA 3'; the second oligonucleotide comprises the sequence 3' AAUUAGAGAAAUGAC 5'; X is X3; and C is cholesterol. In further embodiments, R is hydrogen. In further embodiments, L comprises triethylene glycol. In specific embodiments, L is L3.

[0082] In another embodiment of double-stranded nucleic acids, the first oligonucleotide has the structure X(-SBSA)(-PBPA)5(-SBSA)3(-SB)-OR; the second oligonucleotide has the structure CLB(-SASB)(-PAPB)5(-SASB)-OR; and the nucleic acid is of formula (IIIc) [ka] [In the formula, each l represents a hydrogen bonding interaction (i.e., a base pairing interaction).] It has the structure of [the object].

[0083] In other specific embodiments of compound (IIIc), the first oligonucleotide comprises the sequence 5' UUAAUCUCUUUACUGAUAUA 3'; the second oligonucleotide comprises the sequence 3' AAUUAGAGAAAUGAC 5'; X is X3; and C is cholesterol. In further embodiments, R is hydrogen. In further embodiments, L comprises triethylene glycol. In specific embodiments, L is L3.

[0084] In one embodiment, compounds (I), (Ia), and (Ib) contain sequences corresponding to the “guide PO” species in Figure 23 or the “antisense chain” in Figure 24. In another embodiment, compounds (II) and (IIa) contain sequences corresponding to the “sense PO” species in Figure 23 or the “sense chain” species in Figure 24.

[0085] In other words, provided herein is a composition comprising the first nucleic acid of compound (IIIa) (wherein the first oligonucleotide comprises the sequence 5' UAAAUUUGGAGAUCCGAGAG 3'; the second oligonucleotide comprises the sequence 3' AUUUAAACCUCUAGG 5'; X is X3; L is L3; and C is cholesterol); and the second nucleic acid of compound (IIIa) (wherein the first oligonucleotide comprises the sequence 5' UAUAAAUGGUAGCUAUGAUG 3'; the second oligonucleotide comprises the sequence 3' AUAUUUACCAUCGAU 5'; X is X3; L is L3; and C is cholesterol).

[0086] definition Unless otherwise specified, the scientific and technical terms used herein have the meanings generally understood by those skilled in the art. Where any ambiguity is present, the definitions provided herein take precedence over any dictionary or external definitions. Unless the context requires a different interpretation, singular expressions include plurals, and plural expressions include singulars. The use of “or” means “and / or” unless otherwise specified. The term “includes” and other forms such as “includes” and “contains” are not limited.

[0087] As used in oligonucleotide sequences, "A" represents a nucleoside containing the base adenine (e.g., adenosine or its chemically modified derivatives), "G" represents a nucleoside containing the base guanine (e.g., guanosine or its chemically modified derivatives), "U" represents a nucleoside containing the base uracil (e.g., uridine or its chemically modified derivatives), and "C" represents a nucleoside containing the base cytosine (e.g., cytidine or its chemically modified derivatives).

[0088] "Soluble FLt1 (sFLT1)" (also known as sVEGF-R1) refers to a soluble form of the FLT1 receptor possessing sFLT1 biological activity (e.g., sFlt1-i13 short, sFlt1-i13 long, and / or sFlt1-i15a). The biological activity of the sFLT1 polypeptide can be assayed using any standard method, e.g., assays for one or more clinical symptoms of PE, eclampsia, and / or HELLP, assays at the sFLT1 mRNA and / or protein level, assays for sFLT1 binding to VEGF, etc. The sFLT1 protein lacks the transmembrane domain and cytoplasmic tyrosine kinase domain of the FLT1 receptor. The sFLT1 protein can bind to VEGF and to PlGF with high affinity, but cannot induce proliferation or angiogenesis, and is therefore functionally different from the Flt-1 and KDR receptors. sFLT1 was initially purified from human umbilical endothelial cells and later shown to be produced in vivo by trophoblast cells. The sFlt-1 used herein includes all sFlt-1 family members or isoforms, e.g., sFLT1-i13 (e.g., FLT1-i13 short and / or sFLT1-i13 long (sFLT1_v1)), sFlt1-i15a (sFLT1_v2), sFLT1-e15a, sFLT1_v3, sFLT1_v4, etc.

[0089] "Trotrophoblasts" refer to the mesoectoderm cell layer surrounding the blastocyst, which in turn encroaches on the uterine lining, allowing the embryo to receive nutrients from the mother. Trotrophoblasts also contribute to the formation of the placenta.

[0090] The terms “nucleotide analog,” “modified nucleotide,” or “modified nucleotide” refer to non-standard nucleotides, including ribonucleotides or deoxyribonucleotides, that do not exist in nature. Examples of nucleotide analogs are those in which a position is modified to alter a certain chemical property of the nucleotide, but the nucleotide analog still retains its ability to perform its intended function. Derivatizable nucleotide positions include the 5th position, e.g., 5-(2-amino)propyluridine, 5-bromouridine, 5-propyneuridine, 5-propenyluridine; the 6th position, e.g., 6-(2-amino)propyluridine; and for adenosine and / or guanosine, the 8th position, e.g., 8-bromoguanosine, 8-chloroguanosine, 8-fluoroguanosine. Nucleotide analogs include deazanucleotides, e.g., 7-deaza-adenosine; O- and N-modified (e.g., alkylated, e.g., N6-methyladenosine or as otherwise known in the art) nucleotides; and other heterocyclic modified nucleotide analogs, such as those described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.

[0091] Nucleotide analogs may also involve modifications to the sugar portion of the nucleotide. For example, the 2' OH group may be replaced with H, OR, R, F, Cl, Br, I, SH, SR, NH2, NHR, NR2, COOR, or OR (where R is a substituted or unsubstituted C1-C6 alkyl, alkenyl, alkynyl, aryl, etc.). Other possible modifications include those described in U.S. Patents 5,858,988 and 6,291,438.

[0092] The phosphate group of a nucleotide may also be modified, for example, by replacing one or more oxygen atoms of the phosphate group with sulfur (e.g., phosphorothioate), or by making other substitutions that enable the nucleotide to perform its intended function, as described, for example, in Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2):117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5):317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85 and U.S. Patent No. 5,684,143. Some of the above modifications (e.g., phosphate group modifications) preferably reduce the rate of hydrolysis of polynucleotides containing the analog, for example, in vivo or in vitro.

[0093] In one embodiment, the compounds, oligonucleotides, and nucleic acids described herein may be modified to include internucleotide bonds provided in Figure 36. In a specific embodiment, the compounds, oligonucleotides, and nucleic acids described herein include internucleotide bonds selected from phosphodiesters and phosphorothioates.

[0094] For example, it is understood that certain internucleotide bonds provided herein, including phosphodiesters and phosphorothioates, form a formal charge of -1 at physiological pH, and that this formal charge is in equilibrium with a cationic moiety, such as an alkali metal like sodium or potassium, an alkaline earth metal like calcium or magnesium, or an ammonium or guanidinium ion.

[0095] In one embodiment, the compounds, oligonucleotides, and nucleic acids described herein may be modified to include internucleotide main chain bonds as shown in Figure 37.

[0096] In one embodiment, provided herein are compounds comprising phosphate moieties (e.g., X1, X4, X5, and X6) and phosphonate moieties (e.g., X3, X7, and X8). These moieties are partially or completely ionized as a function of the pKa of the moiety and the pH of the environment. It is understood that negatively charged ions equilibrium with cationic moieties, e.g., alkali metals such as sodium or potassium, alkaline earth metals such as calcium or magnesium, or ammonium or guanidinium ions.

[0097] Pharmaceutical composition and method of administration In some respects, provided herein is a pharmaceutical composition comprising a therapeutically effective amount of one or more compounds, oligonucleotides or nucleic acids described herein and a pharmaceutically acceptable carrier. In some embodiment, the pharmaceutical composition comprises one or more double-stranded, chemically modified nucleic acids described herein and a pharmaceutically acceptable carrier. In a particular embodiment, the pharmaceutical composition comprises one double-stranded, chemically modified nucleic acid described herein and a pharmaceutically acceptable carrier. In other particular embodiments, the pharmaceutical composition comprises two double-stranded, chemically modified nucleic acids described herein and a pharmaceutically acceptable carrier.

[0098] In a particular embodiment, the pharmaceutical composition comprises a first nucleic acid of compound (IIIa) (wherein the first oligonucleotide comprises the sequence 5' UAAAUUUGGAGAUCCGAGAG 3'; the second oligonucleotide comprises the sequence 3' AUUUAAACCUCUAGG 5'; X is X3; C is cholesterol); and a second nucleic acid of compound (IIIa) (wherein the first oligonucleotide comprises the sequence 5' UAUAAAUGGUAGCUAUGAUG 3'; the second oligonucleotide comprises the sequence 3' AUAUUUACCAUCGAU 5'; X is X3; C is cholesterol).

[0099] The present invention relates to the use of the above-mentioned agents for preventive and / or therapeutic treatment, as described below. Accordingly, the modulators of the present invention (e.g., RNAi agents) can be incorporated into a pharmaceutical composition suitable for administration. Such compositions generally include nucleic acid molecules, proteins, antibodies or modulating compounds and pharmaceutically acceptable carriers. The term “pharmaceutically acceptable carrier” as used herein includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption retarders, etc., that are suitable for pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Unless any conventional media or agent is incompatible with the active compound, its use in the composition is intended. Auxiliary active compounds can also be incorporated into the composition.

[0100] The pharmaceutical compositions of the present invention are formulated to suit the intended route of administration. Examples of routes of administration include non-enteral, e.g., intravenous (IV), intradermal, subcutaneous (SC or SQ), intraperitoneal, intramuscular, oral (e.g., inhalation), transdermal (topical), and transmucosal administration. Solutions or suspensions used for non-enteral, intradermal, or subcutaneous application may contain the following components: sterile diluents such as water for injection, saline solution, fixative oil, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparaben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetate, citrate, or phosphate; and tonic modifiers such as sodium chloride or dextrose. The pH can be adjusted with an acid or base such as hydrochloric acid or sodium hydroxide. Non-enteral formulations are filled into ampoules, disposable syringes, or glass or plastic multi-dose vials.

[0101] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (when water-soluble) or dispersants and sterile powders for immediate formulation of sterile injectable solutions or dispersants. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, and Cremophor EL. TMThe composition may include (BASF, Parsippany, NJ) or phosphate-buffered saline (PBS). In any case, the composition must be sterile and fluid enough to have syringeability. It must be stable under manufacturing and storage conditions and protected from microbial contamination such as bacteria and fungi. The carrier may be a solvent or dispersion medium, for example, containing water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol) and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of a dispersant, and by the use of a surfactant. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. Often, it is preferable to include isotonic agents in the composition, such as sugars, polyalcohols, such as mannitol, sorbitol, and sodium chloride. Long-term absorption of injectable compositions can be achieved by incorporating absorption-delaying agents into the composition, such as aluminum monostearate and gelatin.

[0102] Sterile injectable solutions can be prepared by incorporating the required amount of active compound into a suitable solvent with one or a combination of the above components, as needed, followed by sterile filtration. Generally, dispersants are prepared by incorporating the active compound into a sterile medium containing a basic dispersion medium and other necessary components from the above. In the case of sterile powders for formulation of sterile injectable solutions, preferred formulation methods are vacuum drying and freeze-drying, which produce a powder of the active component and any desired additional components from a previously sterile-filtered solution.

[0103] The toxicity and therapeutic efficacy of such compounds are, for example, LD 50 (A lethal dose in 50% of the population) and ED 50 The dose (therapeutably effective in 50% of the population) can be determined by standard pharmaceutical processes in cell culture or experimental animals. The dose-to-toxicity ratio is the therapeutic index, or ratio LD50. 50 / ED 50 This can be expressed as follows. Compounds exhibiting a high therapeutic index are preferred. While compounds exhibiting toxic side effects can be used, consideration should be given to designing a delivery system that targets such compounds to the site of the affected tissue to minimize the possibility of damage to non-infected cells, thereby mitigating side effects.

[0104] Data obtained from cell culture assays and animal studies can be used to formulate a range of doses for use in humans. The doses of such compounds are preferably non-toxic or only slightly toxic and ED-positive. 50 It is within the circulating blood concentration range, including [specific component]. The dose varies depending on the dose form used and the route of administration. For all compounds used in the method of the present invention, the therapeutically effective dose can first be calculated from the cell culture assay. The dose is determined by the EC in cell culture. 50 In animal models, a formula can be formulated to achieve a circulating plasma concentration range, including the concentration of the test compound that achieves the maximum half of the response. This information can then be used to determine a more precise useful dose in humans. Plasma levels can be measured, for example, by high-performance liquid chromatography.

[0105] Treatment method In some aspects, the present invention provides methods for both prevention and treatment in subjects who are at risk (or suspected) of a disease or disorder caused by secreted Flt1 protein, in whole or in part. In some embodiments, the disease or disorder is a liver disease or disorder. In other embodiments, the disease or disorder is a kidney disease or disorder. In some embodiments, the disease or disorder is a placental disease or disorder. In some embodiments, the disease or disorder is a pregnancy-related disease or disorder. In some embodiments, the disease or disorder is a disorder related to the expression of soluble Flt1 protein, where amplified expression of soluble Flt1 protein leads to the clinical manifestation of PE (pre-eclampsia), postpartum PE, eclampsia, and / or HELLP (i.e., HELLP syndrome).

[0106] In other aspects, the present invention provides methods for both prevention and treatment in subjects at risk of (or suspected of being at risk of) a disease or disorder caused by a gain-of-function mutant protein, in whole or in part. In one embodiment, the disease or disorder is a trinucleotide repeat disease or disorder. In another embodiment, the disease or disorder is a polyglutamine disorder. In a preferred embodiment, the disease or disorder is a disorder associated with huntingtin expression, in which a variant of huntingtin, particularly an amplification of the CAG repeat copy number, results in a defect in the huntingtin gene (structure or function) or huntingtin protein (structure or function or expression), such that the clinical manifestation includes those seen in patients with Huntington's disease.

[0107] As used herein, “treatment” or “to treat” is defined as the application or administration of a therapeutic agent (e.g., an RNA agent or a vector or transgene encoding it) to a patient for the purpose of treating, curing, alleviating, improving, modifying, correcting, enhancing, improving or acting upon a disease or disorder, symptoms of a disease or disorder, or a predisposition to a disease or disorder, or a predisposition to a disease or disorder, or the application or administration of a therapeutic agent to an isolated tissue or cell line isolated from a patient having a disease or disorder, symptoms of a disease or disorder, or a predisposition to a disease or disorder.

[0108] In some respects, the present invention provides a method for preventing the aforementioned disease or disorder in a subject by administering a therapeutic agent (e.g., an RNAi agent or a vector or transgene encoding it) to the subject. Subjects at risk of disease can be routed, for example, by one or a combination of the diagnostic or prognostic assays described herein. Administration of the prophylactic agent may be performed before the manifestation of characteristic symptoms of the disease or disorder, so that the disease or disorder is prevented or its progression is delayed.

[0109] Another aspect of the present invention relates to methods for therapeutically treating a subject, i.e., altering the onset of symptoms of a disease or disorder. In exemplary embodiments, the modulatory methods of the present invention involve contacting cells expressing a gain-of-function mutant with a therapeutic agent (e.g., an RNAi agent or a vector or transgene encoding it) that is specific to one or more target sequences in the gene, such that sequence-specific interference in the gene is achieved. These methods can be carried out in vitro (e.g., by culturing cells with the drug) or in vivo (e.g., by administering the drug to the subject).

[0110] RNA silencing agents modified for enhanced uptake by nerve cells are administered in doses of approximately 1.4 mg / kg body weight or 10 mg / kg body weight, 5 mg / kg body weight, 2 mg / kg body weight, 1 mg / kg body weight, 0.5 mg / kg body weight, 0.1 mg / kg body weight, 0.05 mg / kg body weight, 0.01 mg / kg body weight, 0.005 mg / kg body weight, 0.001 mg / kg body weight, 0.0005 mg / kg body weight, 0.0001 mg / kg body weight, 0.00005 mg / kg body weight, or less than 0.00001 mg / kg body weight and RNA agents with a molecular weight of 200 nmole (e.g., approximately 4.4 × 10⁻¹⁰). 16 RNA silencing agents of less than 1500 nmole / kg body weight or 1500 nmole, 750 nmole, 300 nmole, 150 nmole, 75 nmole, 15 nmole, 7.5 nmole, 1.5 nmole, 0.75 nmole, 0.15 nmole, 0.075 nmole, 0.015 nmole, 0.0075 nmole, 0.00075 nmole, and 0.00015 nmole can be administered in unit doses of less than 1500 nmole / kg body weight. The unit dose can be administered, for example, by injection (e.g., intravenously or intramuscularly, intrathecally or directly into the brain), by inhalation, or by topical application. Particularly preferred doses are less than 2, 1, or 0.1 mg / kg body weight.

[0111] Direct delivery of RNA silencing agents to organs (e.g., directly to the brain, spine, placenta, liver, and / or kidneys) may be in doses of approximately 0.00001 mg to 3 mg per organ, preferably approximately 0.0001 to 0.001 mg per organ, approximately 0.03 to 3.0 mg per organ, approximately 0.1 to 3.0 mg per eye, or approximately 0.3 to 3.0 mg per organ. The dose may be an effective amount for the treatment or prevention of neurological disorders or conditions (e.g., Huntington's disease) or hepatic, renal, or pregnancy-related disorders or conditions (e.g., PE, postpartum PE, eclampsia, and / or HELLP). In one embodiment, the unit dose is administered less frequently than once daily, for example, less frequently than every 2 days, every 4 days, every 8 days, or every 30 days. In another embodiment, the unit dose is not administered at a constant frequency (e.g., not regularly). For example, the unit dose may be administered all at once. In one embodiment, an effective dose is administered together with other traditional therapeutic modalities.

[0112] In one embodiment, the subject is administered an initial dose and one or more maintenance doses of an RNA silencing agent. The one or more maintenance doses are generally lower than the initial dose, for example, half of the initial dose. The maintenance regimen may include treating the subject with one or more doses of 0.01 μg to 1.4 mg / kg body weight per day, for example, 10, 1, 0.1, 0.01, 0.001, or 0.00001 mg / kg body weight per day. The maintenance dose is preferably administered less than once every 5, 10, or 30 days. Furthermore, the treatment regimen may be terminated after a certain period of time, which varies depending on the nature of the specific disease, its severity, and the patient's overall condition. In a preferred embodiment, the dose may be delivered less than once a day, for example, once or less every 24, 36, or 48 hours, for example, once or less every 5 or 8 days. After treatment, the patient may be monitored for changes in condition and reduction of symptoms of the disease state. The dosage of the compound may be increased if the patient does not respond significantly to the current dose level, or decreased if a reduction in the symptoms of the disease state is observed, if the disease state disappears, or if undesirable side effects are observed.

[0113] In some respects, what is provided herein is a method for treating or managing pre-eclampsia, postpartum pre-eclampsia, eclampsia, or HELLP syndrome, the method comprising administering a therapeutically effective amount of the compound, oligonucleotide, or nucleic acid described herein, or a pharmaceutical composition comprising said compound, oligonucleotide, or nucleic acid, to a subject requiring such treatment or management.

[0114] In other words, provided herein are methods for treating or managing Huntington's disease, comprising administering a therapeutically effective amount of the compound, oligonucleotide, or nucleic acid described herein, or a pharmaceutical composition comprising said compound, oligonucleotide, or nucleic acid, to a subject requiring such treatment or management.

[0115] Design of Ava molecules In one embodiment, the siRNA is a double-stranded molecule consisting of a sense strand and a complementary antisense strand, the antisense strand having sufficient complementarity to intervene in RNAi with respect to htt mRNA. Preferably, the siRNA molecule is about 10 to 50 or more nucleotides long, i.e., each strand contains 10 to 50 nucleotides (or nucleotide analogs). More preferably, the siRNA molecule has about 16 to 30 nucleotides long on each strand, for example, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long, where one strand is sufficiently complementary to the target region. Preferably, these strands are aligned such that when these strands are annealed, there are at least 1, 2, or 3 non-aligned bases (i.e., complementary bases are not present on the opposite strand) at the ends of the strands, resulting in an overhang of 1, 2, or 3 residues at one or both ends of the double-stranded molecule. Preferably, the siRNA molecule has a length of about 10 to 50 or more nucleotides, i.e., each chain contains 10 to 50 nucleotides (or nucleotide analogs). More preferably, the siRNA component has a length of about 16 to 30 nucleotides per chain, for example, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, where one chain is substantially complementary to the target sequence and the other chain is identical or substantially identical to the first chain.

[0116] In general, siRNA can be designed using any method known in the art, for example, the following protocol.

[0117] 1. The siRNA must be specific to a target sequence, e.g., the target sequence shown in Figure 23. In one embodiment, the target sequence is found in sFlt1. In one embodiment, the target sequence is found in the mutant huntingtin (htt) allele but not in the wild-type huntingtin allele. In another embodiment, the target sequence is found in both the mutant huntingtin (htt) allele and the wild-type huntingtin allele. In yet another embodiment, the target sequence is found in the wild-type huntingtin allele. The first strand must be complementary to the target sequence, and the other strand is substantially complementary to the first strand (see Figure 23 for examples of sense and antisense strands). In one embodiment, the target sequence is outside the extended CAG repeat of the mutant huntingtin (htt) allele. In another embodiment, the target sequence is outside the coding region of the target gene. Examples of target sequences are selected from the 5' untranslated region (5'-UTR) or intron region of the target gene. Cleavage of mRNA at these sites should eliminate translation of the corresponding mutant protein. Target sequences from other regions of the htt gene are also suitable for targeting. The sense strand is designed based on the target sequence. Furthermore, siRNAs with low G / C content (35-55%) may be more active than those with a G / C content higher than 55%. Thus, in one embodiment, the present invention includes nucleic acid molecules having a G / C content of 35-55%.

[0118] 2. The sense strand of the siRNA is designed based on the sequence of the selective target site. Preferably, the sense strand contains about 19 to 25 nucleotides, for example, 19, 20, 21, 22, 23, 24, or 25 nucleotides. More preferably, the sense strand contains 21, 22, or 23 nucleotides. However, those skilled in the art will recognize that siRNAs having lengths of less than 19 nucleotides or more than 25 nucleotides can also function in the mediation of RNAi. Thus, siRNAs of such lengths are also within the scope of the present invention, as long as they retain the ability to mediate RNAi. Long RNAi agents have been shown to induce interferon or PKR responses in certain mammalian cells, which may be undesirable. Preferably, the RNAi agents of the present invention do not induce a PKR response (i.e., are sufficiently short in length). However, long RNAi agents may be useful, for example, in cell types that cannot produce a PKR response or in situations where the PKR response is downregulated or attenuated by alternative means.

[0119] The siRNA molecule of the present invention has sufficient complementarity with the target sequence so that the siRNA can intervene in RNAi. Generally, siRNA containing a nucleotide sequence that is sufficiently identical to the target sequence portion of the target gene is preferred in order to perform RISC-mediated cleavage of the target gene. Therefore, in a preferred embodiment, the sense strand of the siRNA is designed to have a sequence that is sufficiently identical to a portion of the target. For example, the sense strand may have 100% identity with the target site. However, 100% identity is not required. More than 80% identity between the sense strand and the target RNA sequence is preferred, for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity. The present invention has the advantage of being able to tolerate certain sequence diversity in order to enhance the efficiency and specificity of RNAi. In one embodiment, the sense strand has a target region with 4, 3, 2, 1, or 0 inappropriate nucleotides, such as a target region in which the wild-type and mutant alleles differ by at least one base pair, e.g., a target region containing a gain-of-function mutation, while the other strand is identical or substantially identical to the first strand. Furthermore, siRNA sequences with small insertions or deletions of 1 or 2 nucleotides may also be effective for RNAi intervention. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions may be effective for inhibition.

[0120] Sequence identity can be determined by sequence comparison and alignment algorithms known in this field. To determine the identity percentage of two nucleic acid sequences (or two amino acid sequences), the sequences are aligned for optimal comparison purposes (for example, gaps may be inserted into the first or second sequence for optimal alignment). The nucleotides (or amino acid residues) at corresponding nucleotide (or amino acid) positions are then compared. If a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then these molecules are identical at that position. The identity percentage between the two sequences is a function of the number of identical positions shared by the sequences (i.e., homology % = number of identical positions / total number of positions × 100), and optionally, a score is applied as a penalty for the number of inserted gaps and / or the length of the inserted gaps.

[0121] Sequence comparison and identity percentage determination between two sequences can be achieved using mathematical algorithms. In one embodiment, alignment is constructed over a portion of a well-aligned sequence with sufficient identity, but not over a portion with low identity (i.e., local alignment). A preferred, non-restrictive example of a local alignment algorithm used for sequence comparison is the algorithm from Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as described in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST program (version 2.0) in Altschul, et al. (1990) J. Mol. Biol. 215:403-10.

[0122] In another embodiment, the alignment is optimized by inserting appropriate gaps to determine the identity percentage over the length of the aligned sequence (i.e., gapped alignment). To obtain gapped alignment for comparison purposes, gapped BLAST can be used (Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402). In another embodiment, the alignment is optimized by inserting appropriate gaps to determine the identity percentage over the entire length of the sequence alignment (i.e., exhaustive alignment). A preferred, non-restrictive example of a mathematical algorithm used for exhaustive sequence comparison is the algorithm of Myers and Miller, CABIOS (1989). Such algorithms are incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When using the ALIGN program for amino acid sequence comparison, the PAM120 weight residue table, gap length penalty 12, and gap penalty 4 can be used.

[0123] 3. The antisense or guide strand of an siRNA is routinely the same length as the sense strand and contains complementary nucleotides. In one embodiment, the guide and sense strands are fully complementary, i.e., these strands have blunt ends when aligned or annealed. In another embodiment, the strands of an siRNA can be paired in such a way that they have 1 to 4, e.g., 2, nucleotide 3' overhangs. The overhangs may contain (or consist of) nucleotides corresponding to the target gene sequence (or its complement). Alternatively, the overhangs may contain (or consist of) deoxyribonucleotides, e.g., dTs or nucleotide analogs or other suitable non-nucleotide substances. Thus, in another embodiment, the nucleic acid molecule may have a 2-nucleotide 3' overhang, such as TT. The overhang nucleotides may be RNA or DNA. As described above, it is desirable to select a target region where the mutant:wild-type mismatch is a purine:purine mismatch.

[0124] 4. Using any method known in this field, compare potential targets with appropriate genome databases (human, mouse, rat, etc.) and eliminate any target sequences that have significant homology with other coding sequences. One such method for such sequence homology searches is known as BLAST, which is available on the National Center for Biotechnology Information website.

[0125] 5. Select one or more sequences that meet the evaluation criteria.

[0126] Further general information regarding the design and use of siRNA can be found in “The siRNA User Guide,” available on The Max-Plank-Institut fur Biophysikalishe Chemie website.

[0127] Alternatively, siRNA may be functionally defined as a nucleotide sequence (or oligonucleotide sequence) capable of hybridizing with a target sequence (e.g., hybridizing in 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, at 50°C or 70°C for 12–16 hours, followed by washing). Further preferred hybridization conditions include hybridization in 1×SSC at 70°C or 1×SSC at 50°C with 50% formamide, followed by washing in 0.3×SSC at 70°C, or hybridization in 4×SSC at 70°C or 4×SSC at 50°C with 50% formamide, followed by washing in 1×SSC at 67°C. For hybrids estimated to be less than 50 base pairs long, the hybridization temperature must be 5–10°C lower than the melting point (Tm) of the hybrid, where Tm is determined according to the following formula: For hybrids less than 18 base pairs in length, Tm(°C) = 2(A + T bases) + 4(G + C bases). For hybrids between 18 and 49 base pairs in length, Tm(°C) = 81.5 + 16.6(log10[Na+]) + 0.41(%G+C) - (600 / N), where N is the number of bases in the hybrid and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+] of 1×SSC = 0.165M). Further examples of stringency conditions for polynucleotide hybridization (Sambrook, J., EF Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, chapters 9 and 11 and Current Protocols in Molecular Biology, 1995, FM Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4) are incorporated herein by reference.

[0128] The negative control siRNA should have the same nucleotide composition as the selected siRNA but no significant sequence complementarity with the appropriate genome. Such negative controls can be designed by randomly mixing the nucleotide sequences of the selected siRNA. A homology search can be performed to ensure that the negative control lacks homology with any other gene in the appropriate genome. Additionally, negative control siRNA can be designed by introducing one or more base mismatches into the sequence.

[0129] 6. To evaluate the effect of siRNA on disrupting target mRNA (e.g., wild-type or mutant huntingtin mRNA), the siRNA can be incubated with cDNA (e.g., huntingtin cDNA) in a Drosophila-based in vitro mRNA expression system. 32 Newly synthesized mRNA radiolabeled with P (e.g., huntingtin mRNA) is detected by autoradiography on an agarose gel. The presence of cleaved mRNA indicates mRNA nuclease activity. Appropriate controls include omission of siRNA and use of non-target cDNA. Alternatively, a control siRNA having the same nucleotide composition as the selected siRNA but no significant sequence complementarity with the appropriate target gene is selected. Such negative controls can be designed by randomly mixing the nucleotide sequences of the selected siRNA. A homology search can be performed to ensure that the negative control lacks homology with any other gene in the appropriate genome. Additionally, negative control siRNA can be designed by introducing one or more base mismatches into the sequence.

[0130] The siRNA can be designed to target any of the above target sequences. The siRNA includes an antisense strand that is sufficiently complementary to the target sequence to mediate silencing of the target sequence. In certain embodiments, the RNA silencing agent is siRNA.

[0131] In certain embodiments, the siRNA includes a sense strand comprising the sequence shown in FIG. 23 or 24 and an antisense strand comprising the sequence shown in FIG. 23 or 24.

[0132] Select an siRNA-mRNA complementation site that produces optimal mRNA specificity and maximum mRNA cleavage.

[0133] siRNA-like molecules The siRNA-like molecule of the present invention has a sequence that is "sufficiently complementary" to the target sequence of mRNA in order to direct gene silencing by RNAi or translational repression (i.e., it has a sequence-containing strand). The siRNA-like molecule is designed in accordance with the siRNA molecule, but the degree of sequence identity between the sense strand and the target RNA approximates that observed between miRNA and its target. Generally, as the degree of sequence identity between the miRNA sequence and the corresponding target gene sequence decreases, the tendency to intervene in post-transcriptional gene silencing by translational repression rather than RNAi increases. Therefore, in an alternative embodiment, when post-transcriptional gene silencing by translational repression of the target gene is desired, the miRNA sequence has partial complementarity with the target gene sequence. In some embodiments, a miRNA sequence has partial complementarity with one or more short sequences (complementary sites) dispersed in the target mRNA (e.g., within the 3'-UTR of the target mRNA) (Hutvagner and Zamore, Science, 2002; Zeng et al., Mol. Cell, 2002; Zeng et al., RNA, 2003; Doench et al., Genes & Dev., 2003). When the mechanism of translational repression is coordinated, multiple complementary sites (e.g., 2, 3, 4, 5, or 6) may be targeted in some embodiments.

[0134] The ability of siRNA-like double strands to intervene in RNAi or translational repression can be predicted by the distribution of non-identical nucleotides between the target gene sequence and the silencing agent nucleotide sequence at the complementarity site. In one embodiment, when gene silencing by translational repression is desired, at least one non-identical nucleotide is present in the central part of the complementarity site such that the double strand formed by the miRNA guide strand and target mRNA contains a central "bump" (Doench JG et al., Genes & Dev., 2003). In other embodiments, 2, 3, 4, 5, or 6 consecutive or discontinuous non-identical nucleotides are introduced. The non-identical nucleotides may be selected to form fluctuating base pairs (e.g., G:U) or improper base pairs (G:A, C:A, C:U, G:G, A:A, C:C, U:U). In a more preferred embodiment, the "bump" is concentrated at nucleotide positions 12 and 13 of the 5' end of the miRNA molecule.

[0135] Gene silencing oligonucleotides In one exemplary embodiment, gene expression (i.e., htt gene expression) can be regulated using an oligonucleotide-based compound comprising two or more single-stranded antisense oligonucleotides ligated via their 5' ends, allowing for the presence of two or more available 3' ends to effectively inhibit or reduce htt gene expression. Such ligated oligonucleotides are also known as gene silencing oligonucleotides (GSOs) (see, for example, US8,431,544, assigned to Idera Pharmaceuticals, Inc., which is incorporated herein by reference in its entirety for all purposes).

[0136] The bond at the 5' end of the GSO is independent of other oligonucleotide bonds and may be direct via the 5', 3', or 2' hydroxyl group, or indirectly via a non-nucleotide linker or nucleoside using the 2' or 3' hydroxyl position of the nucleoside. The bond may also use a functionalized sugar or nucleic acid base of the 5' terminal nucleotide.

[0137] GSOs may contain two identical or different sequences conjugated at their 5'-5' ends by a phosphodiester, phosphorothioate, or non-nucleoside linker. Such compounds may contain 15-27 nucleotides complementary to a specific region of the target mRNA for antisense downregulation of a gene product. GSOs containing identical sequences bind to specific mRNA via Watson-Crick hydrogen bond interactions and inhibit protein expression. GSOs containing different sequences can bind to two or more different regions of one or more mRNA targets and inhibit protein expression. Such compounds consist of heteronucleotide sequences complementary to the target mRNA and form a stable double-stranded structure via Watson-Crick hydrogen bonds. Under certain conditions, GSOs containing two free 3' ends (5'-5' bound antisense) may be more potent inhibitors of gene expression than those containing a single free 3' end or those without a free 3' end.

[0138] In one embodiment, the non-nucleotide linker is of the formula HO-(CH2) o -CH(OH)-(CH2) p -OH (wherein the formula o and p are independently integers 1 to about 6, 1 to about 4, or 1 to about 3) is glycerol or a glycerol homolog. In some other embodiments, the non-nucleotide linker is a derivative of 1,3-diamino-2-hydroxypropane. Some such derivatives have the formula HO-(CH2) m -C(O)NH-CH2-CH(OH)-CH2-NHC(O)-(CH2) m -OH (where m is an integer between 0 and approximately 10, 0 and approximately 6, 2 and approximately 6, or 2 and approximately 4).

[0139] Some non-nucleotide linkers allow for the binding of more than two GSO components. For example, the non-nucleotide linker glycerol has three hydroxyl groups to which GSO components can be covalently bonded. A compound of the present invention based on a certain oligonucleotide contains two or more oligonucleotides linked to a nucleotide or non-nucleotide linker. Such oligonucleotides are referred to as “branched” by the present invention.

[0140] In one embodiment, the GSO is at least 14 nucleotides long. In one exemplary embodiment, the GSO is 15–40 nucleotides long or 20–30 nucleotides long. Thus, the component oligonucleotides of the GSO can independently be 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides long.

[0141] These oligonucleotides can be prepared by methods recognized in the art, such as phosphoramidate or H-phosphonate chemistry, which can be carried out manually or by automated synthesizers. These oligonucleotides can also be modified in a variety of ways without impairing their ability to hybridize with mRNA. Such modifications may include at least one internucleotide bond of an oligonucleotide that is an alkylphosphonate, phosphorothioate, phosphorodithioate, methylphosphonate, phosphate ester, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate hydroxyl, acetamidate or carboxymethyl ester or a combination thereof, and other internucleotide bonds between the 5' end of one nucleotide and the 3' end of the other nucleotide, where the 5' nucleotide phosphodiester bond is substituted with any number of chemical groups.

[0142] Modified RNA silencing agent In a certain aspect of the present invention, the RNA silencing agent (or any part thereof) of the present invention described above may be modified to further improve the activity of the agent. For example, the RNA silencing agent of Section II above may be modified by any of the following modifications. The modifications may, in part, help to further enhance target recognition, enhance drug stability (e.g., inhibit degradation), promote cell uptake, enhance target efficiency, improve efficacy in binding (e.g., to targets), improve patient tolerance to the drug, and / or reduce toxicity.

[0143] 1) Modification for target recognition enhancement In one embodiment, the RNA silencing agent of the present invention may be substituted with an unstable nucleotide to enhance single-nucleotide target recognition (see U.S. application 11 / 698,689 filed January 25, 2007 and U.S. Provisional Application 60 / 762,225 filed January 25, 2006, both of which are incorporated herein by reference). Such modifications may be sufficient to eliminate the specificity of the RNA silencing agent to non-target mRNA (e.g., wild-type mRNA) without apparently affecting the specificity of the RNA silencing agent to target mRNA (e.g., gain-of-function mutant mRNA).

[0144] In a preferred embodiment, the RNA silencing agent of the present invention is modified by introducing at least one universal nucleotide into its antisense strand. The universal nucleotide comprises a base moiety that can form base pairs with any of the four conventional nucleotide bases (e.g., A, G, C, U) without distinction. Universal nucleotides are preferred because they have relatively little effect on the stability of the RNA double helix or the double helix formed by the guide strand of the RNA silencing agent and the target mRNA. Examples of universal nucleotides include those having an inosine base moiety or an inosine analog base moiety selected from the group consisting of deoxyinosine (e.g., 2'-deoxyinosine), 7-deaza-2'-deoxyinosine, 2'-aza-2'-deoxyinosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidate-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. In a particularly preferred embodiment, the universal nucleotide is an inosine residue or a naturally occurring analog thereof.

[0145] In one embodiment, the RNA silencing agent of the present invention is modified by introducing at least one destabilizing nucleotide within 5 nucleotides of a specificity-determining nucleotide (i.e., a nucleotide that recognizes disease-related polymorphisms). For example, the destabilizing nucleotide may be introduced at a position within 5, 4, 3, 2, or 1 nucleotide from the specificity-determining nucleotide. In an exemplary embodiment, the destabilizing nucleotide is introduced at a position 3 nucleotides from the specificity-determining nucleotide (i.e., there are two stabilizing nucleotides between the destabilizing nucleotide and the specificity-determining nucleotide). In RNA silencing agents having two strands or strand portions (e.g., siRNA and shRNA), the destabilizing nucleotide may be introduced into a strand or strand portion that does not contain the specificity-determining nucleotide. In a preferred embodiment, the destabilizing nucleotide is introduced into the same strand or strand portion that contains the specificity-determining nucleotide.

[0146] 2) Modifications for enhancing efficacy and specificity In one embodiment, the RNA silencing agents of the present invention may be modified by asymmetric design rules to promote enhanced efficacy and specificity in intervening RNAi (see U.S. Patents Nos. 8,309,704, 7,750,144, 8,304,530, 8,329,892, and 8,309,705). Such modifications facilitate the entry of the antisense strand of the siRNA (e.g., siRNA produced from siRNA or shRNA designed using the methods of the present invention) into the RISC for the sense strand, so that the antisense strand preferentially guides the cleavage or translational repression of the target mRNA, thereby increasing or improving the efficiency of targeted cleavage and silencing. Preferably, the asymmetry of the RNA silencing agent is enhanced by reducing the base pair strength between the 5' end of the antisense strand (AS 5') and the 3' end of the sense strand (S 3') of the RNA silencing agent compared to the binding strength or base pair strength between the 3' end of the antisense strand (AS 3') and the 5' end of the sense strand (S 5').

[0147] In one embodiment, the asymmetry of the RNA silencing agent of the present invention may be enhanced such that there are fewer G:C base pairs between the 5' end of the first strand or antisense strand and the 3' end of the sense strand portion than between the 3' end of the first strand or antisense strand and the 5' end of the sense strand portion. In another embodiment, the asymmetry of the RNA silencing agent of the present invention may be enhanced such that there is at least one inappropriate base pair between the 5' end of the first strand or antisense strand and the 3' end of the sense strand portion. Preferably, the inappropriate base pair is selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C, and U:U. In another embodiment, the asymmetry of the RNA silencing agent of the present invention may be enhanced such that there is at least one fluctuating base pair, for example, G:U, between the 5' end of the first strand or antisense strand and the 3' end of the sense strand portion. In another embodiment, the asymmetry of the RNA silencing agent of the present invention may be enhanced such that there is at least one base pair containing a dilute nucleotide, for example, inosine(I). Preferably, the base pair is selected from the group consisting of I:A, I:U, and I:C. In yet another embodiment, the asymmetry of the RNA silencing agent of the present invention can be enhanced so that there is at least one base pair containing a modified nucleotide.

[0148] 3) RNA silencing agent with enhanced stability The RNA silencing agent of the present invention can be modified to improve its stability in serum or cell culture growth medium. To enhance stability, the 3' residues can be stabilized against degradation, for example, by selecting purine nucleotides, particularly adenosine or guanosine nucleotides. Alternatively, substitution with pyrimidine nucleotide modification analogs, such as substitution of uridine with 2'-deoxythymidine, is tolerable and does not affect the efficiency of RNA interference.

[0149] In a preferred aspect, the present invention relates to an RNA silencing agent comprising a first strand and a second strand, wherein the second strand and / or the first strand are modified by substitution of an internal nucleotide with a modified nucleotide so as to enhance in vivo stability compared to the corresponding unmodified RNA silencing agent. A “internal” nucleotide, as defined herein, is any nucleotide located anywhere other than the 5' or 3' end of a nucleic acid molecule, polynucleotide, or oligonucleotide. The internal nucleotide may be within a single-stranded molecule or within one strand of a double-stranded or bihedra. In one embodiment, the sense strand and / or antisense strand are modified by substitution of at least one internal nucleotide. In another embodiment, the sense strand and / or antisense strand are modified by substitution of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more internal nucleotides. In another embodiment, the sense strand and / or antisense strand are modified by substitutions of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% or more of the internal nucleotides. In yet another embodiment, the sense strand and / or antisense strand are modified by substitutions of all of the internal nucleotides.

[0150] In a preferred embodiment of the present invention, the RNA silencing agent may comprise at least one modified nucleotide analog. The nucleotide analog may be located in a region at the 5' and / or 3' end of the siRNA molecule, where target-specific silencing activity, such as RNAi-mediated activity or translational repression activity, is substantially unaffected. In particular, the terminus may be stabilized by the incorporation of the modified nucleotide analog.

[0151] Examples of nucleotide analogs include sugar- and / or main-chain modified ribonucleotides (i.e., modifications of the phosphate-sugar main chain). For example, the phosphodiester bond of native RNA may be modified to include at least one nitrogen or sulfur heteroatom. In examples of main-chain modified ribonucleotides, the phosphoester group connecting adjacent ribonucleotides is replaced with a modifying group, for example, a phosphothioate group. In examples of sugar-modified ribonucleotides, the 2' OH group is replaced with a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2, or ON, where R is a C1-C6 alkyl, alkenyl, or alkynyl, and halo is F, Cl, Br, or I.

[0152] In certain embodiments, the modifications are 2'-fluoro, 2'-amino, and / or 2'-thio modifications. Particularly preferred modifications include 2'-fluorocytidine, 2'-fluorouridine, 2'-fluoroadenosine, 2'-fluoroguanosine, 2'-aminocytidine, 2'-aminouridine, 2'-aminoadenosine, 2'-aminoguanosine, 2,6-diaminopurine, 4-thiouridine, and / or 5-aminoallyluridine. In certain embodiments, all 2'-fluororibonucleotides are uridine and cytidine. Further examples of modifications include 5-bromouridine, 5-iodouridine, 5-methylcytidine, ribothymidine, 2-aminopurine, 2'-aminobutyrylpyreneuridine, 5-fluorocytidine, and 5-fluorouridine. 2'-deoxynucleotides and 2'-Omenucleotides can also be used within the modified RNA silencing agent moiety of the present invention. Further modified residues include deoxy-base, inosine, N3-methyluridine, N6,N6-dimethyladenosine, pseudouridine, purine ribonucleoside, and ribavirin. In a particularly preferred embodiment, the 2' portion is a methyl group such that the linking portion is a 2'-O-methyl oligonucleotide.

[0153] In exemplary embodiments, the RNA silencing agent of the present invention comprises locked nucleic acid (LNA). The LNA comprises sugar-modified nucleotides that are resistant to nuclease activity (highly stable) and have single-nucleotide recognition for mRNA (Elmen et al., Nucleic Acids Res., (2005), 33(1): 439-447; Braasch et al. (2003) Biochemistry 42:7967-7975, Petersen et al. (2003) Trends Biotechnol 21:74-81). These molecules have 2'-O,4'-C-ethylene-bridged nucleic acids, along with possible modifications such as 2'-deoxy-2''-fluorouridine. Furthermore, the LNA increases the specificity of oligonucleotides by constraining the sugar moiety to a 3'-endo conformation, thereby pre-organizing the nucleotides for base pairing and raising the melting point of the oligonucleotides by approximately 10°C per base.

[0154] In another exemplary embodiment, the RNA silencing agent of the present invention comprises peptide nucleic acid (PNA). The PNA comprises a modified nucleotide in which the sugar-phosphate moiety is replaced with a neutral 2-aminoethylglycine moiety that can form a polyamide backbone, which makes the nucleotide highly resistant to nuclease digestion and provides improved binding specificity to molecules (Nielsen, et al., Science, (2001), 254: 1497-1500).

[0155] Also preferred are nucleic acid base-modified ribonucleotides, i.e., ribonucleotides that contain at least one non-naturally occurring nucleic acid base in place of a naturally occurring nucleic acid base. The bases are modified to block adenosine deaminase activity. Examples of modified nucleic acid bases include, but are not limited to, uridine and / or cytidine modified at position 5, e.g., 5-(2-amino)propyluridine, 5-bromouridine; adenosine and / or guanosine modified at position 8, e.g., 8-bromoguanosine; deazanucleotides, e.g., 7-deaza-adenosine; and O- and N-alkylated nucleotides, e.g., N6-methyladenosine. It should be noted that the above modifications may be combined.

[0156] In other embodiments, crosslinking can be used to alter the pharmacokinetics of RNA silencing agents, for example, to extend their half-life in the body. For this purpose, the present invention includes RNA silencing agents having two complementary strands of nucleic acid, where the two strands are crosslinked. The present invention also includes RNA silencing agents that are conjugated or unconjugated (e.g., at the 3' end) with other parts (e.g., non-nucleic acid parts such as peptides), organic compounds (e.g., dyes), etc. Modification of siRNA derivatives in this manner can improve cellular uptake of the resulting siRNA derivatives or enhance their cell targeting activity compared to the corresponding siRNA, which is useful for tracking the siRNA derivatives in cells or improving the stability of the siRNA derivatives compared to the corresponding siRNA.

[0157] Other examples of modifications include (a) 2' modifications, e.g., sense or antisense chains, particularly providing a 2'OMe portion at U in the sense chain or, e.g., at the 3' end, providing a 2'OMe portion in the 3' overhang (as indicated in context, the 3' end means the 3' atom or the most 3' portion of the molecule, e.g., the most 3'P or 2' position); (b) modifications of the main chain, e.g., in the phosphate main chain, by substitution of P with S, e.g., providing phosphorothioate modifications of U or A or both, particularly in the antisense chain; e.g., substitution of O with S; (c) substitution of U with a C5 aminolinker; (d) substitution of A with G (preferably the sequence change is located in the sense chain rather than the antisense chain); and (d) modifications at the 2', 6', 7' or 8' position. Exemplary embodiments are those in which one or more of these modifications are present in the sense chain but not in the antisense chain or the antisense chain has fewer such modifications. Further exemplary modifications include, for example, the use of methylated P in the 3' overhang at the 3' end; 2' modifications, for example, providing a 2' OMe moiety and modifications of the main chain, for example, by substitution of P with S, for example, providing a phosphorothioate modification or a combination of the use of methylated P at the 3' end; 3' alkyl modifications; for example, debasing pyrrolidone modifications at the 3' end and in the 3' overhang; and modifications of naproxen, ibuprofen, or other moieties that inhibit degradation at the 3' end.

[0158] 4) Modifications to enhance cellular uptake In other embodiments, RNA silencing agents may be modified with chemical moieties to enhance cellular uptake by target cells (e.g., nerve cells). Therefore, the present invention includes RNA silencing agents conjugated or unconjugated (e.g., at the 3' end) with other moieties (e.g., non-nucleic acid moieties such as peptides), organic compounds (e.g., dyes), etc. Conjugation can be achieved using methods known in this field, for example, Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describes nucleic acids packed into polyalkylcyanoacrylate (PACA) nanoparticles); Fattal et al., J. Control Release 53(1-3):137-43 (1998) (describes nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (describes nucleic acids linked to inserts, hydrophobic groups, polycations, or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (describes nucleic acids linked to nanoparticles).

[0159] In certain embodiments, the RNA silencing agent of the present invention is conjugated with a lipophilic moiety. In one embodiment, the lipophilic moiety is a ligand containing a cationic group. In another embodiment, the lipophilic moiety is conjugated to one or both strands of siRNA. In an exemplary embodiment, the lipophilic moiety is conjugated to one end of the sense strand of siRNA. In another exemplary embodiment, the lipophilic moiety is conjugated to the 3' end of the sense strand. In one embodiment, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin E, vitamin K, vitamin A, folic acid, or a cationic dye (e.g., Cy3). In an exemplary embodiment, the lipophilic moiety is cholesterol. Other lipophilic components include cholic acid, adamantane acetate, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.

[0160] 5) Tether Ligand Other substances can be tethered to the RNA silencing agent of the present invention. Ligands are tethered to the RNA silencing agent for, for example, stability, hybridization thermodynamics with target nucleic acids, targeting to specific tissues or cell types, or improved cell permeability by, for example, endocytosis-dependent or independent mechanisms. Ligands and associated modifications may increase sequence specificity and consequently reduce off-target targeting. A tethered ligand may contain one or more modified bases or sugars that can function as intervenes. These are preferably located in internal regions, such as in the bulge of the RNA silencing agent / target double helix. The intervenes may be aromatic, e.g., polycyclic aromatic or heterocyclic aromatic compounds. Polycyclic intervenes may have stacking ability and may include systems having 2, 3, or 4 fused rings. The universal bases described herein may be inserted onto the ligand. In some embodiments, the ligand may contain cleavage groups that contribute to target gene inhibition by cleaving the target nucleic acid. The cleavage group may be, for example, bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2), pyrene, phenanthroline (e.g., O-phenanthroline), polyamine, tripeptide (e.g., lys-tyr-lys tripeptide), or a metal ion chelating group. The metal ion chelating group may include, for example, Lu(III) or EU(III) macrocyclic complexes, Zn(II) 2,9-dimethylphenanthroline derivatives, Cu(II) terpyridine, or acridine, which can promote the selective cleavage of target RNA at the site of elevation by free metal ions such as Lu(III). In one embodiment, a peptide ligand can be tethered to an RNA silencing agent to promote the cleavage of target RNA, for example, at the elevation region. For example, 1,8-dimethyl-1,3,6,8,10,13-hexaazacyclotetradecane (Sicram) can be conjugated to a peptide (e.g., by an amino acid derivative) to promote target RNA cleavage. Tether ligands can be aminoglycoside ligands that can improve the hybridization properties or sequence specificity of RNA silencing agents.Examples of aminoglycosides include glycosylated polylysine, galactosized polylysine, neomycin B, tobramycin, kanamycin A, and acridine conjugates of aminoglycosides, such as Neo-N-acridine, Neo-S-acridine, Neo-C-acridine, Tobra-N-acridine, and KanaA-N-acridine. The use of acridine analogs can increase sequence specificity. For example, neomycin B has high affinity for RNA compared to DNA but low sequence specificity. The acridine analog, neo-5-acridine, has increased affinity for HIV Rev response sequences (RREs). In one embodiment, a guanidine analog (guanidinoglycoside) of an aminoglycoside ligand is tethered to an RNA silencing agent. In the guanidinoglycoside, the amine group of the amino acid is exchanged for the guanidine group. Binding of the guanidine analog increases the cell permeability of the RNA silencing agent. The tether ligand may be a polyarginine peptide, peptoid, or peptide mimetic, which can enhance the cellular uptake of the oligonucleotide agent.

[0161] Ligands bind to ligand-conjugate carriers directly or indirectly via tethers, preferably by covalent bond. In exemplary embodiments, ligands bind to carriers via intervening tethers. In exemplary embodiments, ligands alter the distribution, targeting, or lifetime of the incorporated RNA silencing agent. In exemplary embodiments, ligands provide enhanced affinity to selective targets, such as molecules, cells or cell types, compartments, such as cell or organ compartments, tissues, organs, or body regions, compared, for example, species lacking such ligands.

[0162] Ligands can improve transport, hybridization, and specificity properties, and can also improve the nuclease resistance of polymer molecules and / or natural or modified ribonucleotides, including the resulting natural or modified RNA silencing agents or any combination of the monomers described herein. Ligands may generally include, for example, therapeutic modifiers to enhance uptake; for example, diagnostic compounds or reporter groups to monitor distribution; crosslinking binders; nuclease-resistance-constituting moieties; and natural or abnormal nucleic acid bases. Common examples include lipid-soluble substances, lipids, steroids (e.g., ubaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, friederin, epifriederanol-deranolic acid-derived lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein binders, integrin-targeting molecules, polycationic substances, peptides, polyamines, and peptide mimics. Ligands may include naturally occurring substances (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); amino acids, or lipids. Ligands may also be recombinant or synthetic molecules, such as synthetic polymers, such as synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-coglycolide) copolymer, divinyl ether-maleic acid anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphatidine.Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptide mimetic polyamines, dendrimer polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts or alpha-helical peptides of polyamines.

[0163] Ligands may also include targeting groups that bind to specific cell types, such as kidney cells, such as cell or tissue targeting agents, such as lectins, glycoproteins, lipids or proteins, or antibodies. Targeting groups may include tyrotropin, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartate, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, biotin, or RGD peptides or RGD peptide mimetic compounds. Other examples of ligands include dyes, inserts (e.g., acridine and substituted acridines), crosslinkers (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphylline, saffrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrene), lys-tyr-lys tripeptides, aminoglycosides, guanidinium aminoglycolides, artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol and its thioanalogs), cholic acid, cholic acid, cholanic acid, litcholic acid, adamantane acetate, 1-pyrenebutyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono, bis or tris fatty acid esters, e.g., C)). 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19or C 20 fatty acids) and their ethers, for example, C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19 or C 20 Alkyl groups (e.g., 1,3-bis-O(hexadecyl)glycerol, 1,3-bis-O(octadecyl)glycerol), geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, stearic acid (e.g., glyceryl distearate), oleic acid, myristic acid, O3-(oleoyl)litcholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine) and peptide conjugates (e.g., AN Tenapedia peptides (Tat peptides), alkylating agents, phosphates, amino acids, mercaptos, PEGs (e.g., PEG-40K), MPEG, [MPEG]2, polyamino acids, alkyl groups, substituted alkyl groups, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, naproxen, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu tetraaza macrocyclic rings) 3+ Contains a complex, dinitrophenyl, HRP, or AP.

[0164] Ligands can be proteins, such as glycoproteins or peptides, molecules or antibodies that have a specific affinity for a co-ligand, such as antibodies that bind to specific cell types, like cancer cells, endothelial cells, or osteocytes. Ligands can also include hormones and hormone receptors. They can also be lipids, lectins, carbohydrates, vitamins, cofactors, and non-peptide species such as polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, or polyvalent fucose. Ligands can be, for example, liposaturates, activators of p38MAP kinase, or activators of NF-κB.

[0165] A ligand can be a substance, such as a drug, that can increase the uptake of an RNA silencing agent into cells by, for example, disrupting the cytoskeleton of a cell, e.g., disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. Drugs may include, for example, taxone, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latruncrine A, phalloidin, swinholide A, indanosine, or myoservin. Ligands can also increase the uptake of RNA silencing agents into cells by, for example, activating an inflammatory response. Examples of ligands with such effects include tumor necrosis factor alpha (TNFα), interleukin-1 beta, or gamma interferon. In some aspects, a ligand is a lipid or lipid-based molecule. Such lipid or lipid-based molecules preferably bind to serum proteins, e.g., human serum albumin (HSA). HSA-binding ligands allow the distribution of the conjugate to target tissues, e.g., non-renal target tissues of the body. For example, the target tissue may be the liver, including the parenchymal cells of the liver. Other molecules that can bind to HSA can also be used as ligands. For example, neproxin or aspirin can be used. Lipid or lipid-based ligands can be used to (a) increase the resistance of the conjugate to degradation, (b) increase targeting or transport to target cells or cell membranes, and / or (c) modulate binding to serum proteins, e.g., HSA. Lipid-based ligands can be used to modulate, e.g., control the binding of the conjugate to target tissues. For example, a lipid or lipid-based ligand that binds more strongly to HSA is less likely to be targeted to the kidney and therefore less likely to be cleared from the body. The conjugate can be targeted to the kidney using a lipid or lipid-based ligand that binds to HSA less strongly. In a preferred embodiment, the lipid-based ligand binds to HSA. The lipid-based ligand can bind to HSA with sufficient affinity so that the conjugate is distributed to non-renal tissues, preferably. However, the affinity is preferably not so strong that the HSA-ligand binding cannot be maintained.In other preferred embodiments, the lipid-based ligand either weakly or not binds at all to the HSA so that the conjugate is preferably distributed to the kidney. Other portions targeting renal cells can also be used in place of or in addition to the lipid-based ligand.

[0166] In other aspects, ligands are the portions taken up by target cells, such as proliferating cells, e.g., vitamins. These are particularly useful in treating unwanted cell proliferation, whether malignant or non-malignant, such as disorders characterized by cancer cells. Examples of vitamins include vitamins A, E, and K. Other examples of vitamins include B vitamins, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. HSA and low-density lipoprotein (LDL) are also included.

[0167] In other respects, the ligand is a cell permeation agent, preferably a helical cell permeation agent. Preferably, the agent is amphiphilic. Examples of agents are peptides such as tat or Antennapedia. If the agent is a peptide, it can be modified, including the use of peptidyl mimes, inverted isomers, non-peptide or pseudo-peptide bonds and D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has lipophilic and oleophobic phases.

[0168] Ligands can be peptides or peptide mimes. Peptide mimes (also referred to here as oligopeptide mimes) are molecules that can fold into a defined three-dimensional structure similar to natural peptides. The binding of peptides and peptide mimes to oligonucleotide agents affects the pharmacokinetic distribution of RNA silencing agents, such as by increased cellular recognition and absorption. The peptide or peptide mime moiety can be about 5 to 50 amino acids long, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. Peptides or peptide mimes can be, for example, cell-penetrating peptides, cationic peptides, amphiphilic peptides, or hydrophobic peptides (e.g., mainly consisting of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, a restricting peptide, or a cross-linked peptide. The peptide moiety can be an L-peptide or a D-peptide. In other alternatives, the peptide moiety can contain a hydrophobic membrane translocation sequence (MTS). Peptides or peptide mimetic compounds can be encoded by random sequences of DNA, such as peptides identified from phage display libraries or one-bead-one-compound (OBOC) combinatorial libraries (Lam et al., Nature 354:82-84, 1991). In exemplary embodiments, peptides or peptide mimetic compounds tethered to RNA silencing agents by incorporated monomeric units are cell-targeting peptides such as arginine-glycine-aspartate (RGD) peptides or RGD mimetic compounds. The peptide moiety may range in length from approximately 5 to approximately 40 amino acids. The peptide moiety may have structural modifications to increase stability or to indicate conformational properties. Any of the following structural modifications may be available: [Examples]

[0169] Example 1. Background and significance of pre-eclampsia (PE) Overwhelming evidence from epidemiological and experimental studies now indicates that preeclampsia (PE) is caused by increased levels of a “soluble decoy” protein (soluble FLT1 (sFLT1)) from the Flt1 gene (VEGFR1) in maternal bloodstream (Young, BC, Levine, RJ & Karumanchi, SA. Pathogenesis of preeclampsia. Annual review of pathology 5, 173-192 (2010); Maynard, SE et al. Excess placental soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial dysfunction, hypertension, and proteinuria in preeclampsia. The Journal of clinical investigation 111, 649-658 (2003); Levine, RJ et al. Circulating angiogenic factors and the risk of preeclampsia. The New England journal of medicine 350, 672-683 (2004)). Heydarian, M. et al. Novel splice variants of sFlt1 are upregulated in preeclampsia. Placenta 30, 250-255 (2009). FLT1 is a receptor tyrosine kinase (RTK) primarily expressed in the placenta. The general mechanism of RTK regulation involves receptor cleavage and secretion, acting as a dominant-negative regulator of the overall signaling pathway.Ligand sequestration by such soluble decoys inhibits intracellular signaling by the full-length receptor, thereby desensitizing the system to ligand concentrations (Vorlova, S. et al. Induction of antagonistic soluble decoy receptor tyrosine kinases by intronic polyA activation. Molecular cell 43, 927-939 (2011)). In the case of FLT1, the soluble decoy is expressed from cleaved mRNA produced by polyadenylation within two introns (i13 and i15) upstream of the exon encoding the full-length FLT1 (fl-FLT1) transmembrane (TM) and kinase domains.

[0170] In mammals, FLT1 is primarily expressed in the placenta, with Flt1 mRNA levels in the human placenta being 10 to 100 times higher than those observed in other adult tissues (Cerdeira, AS & Karumanchi, SA Angiogenic factors in preeclampsia and related disorders. Cold Spring Harbor perspectives in medicine 2 (2012)). While the full-length isoform is dominant in all tissues in non-pregnant adults (Id.), placental expression is dominated by three cleaved isoforms: sFlt1-i13 short, sFlt1-i13 long, and sFlt1-i15a, all of which encode the sFLT1 protein. A similar pattern of high Flt1 expression in the placenta and low expression in other non-pregnant adult tissues is observed in rodents. However, because rodents lack the intron 14 polyadenylation site, they only express the single soluble decoy form, sFlt1-i13. In PE, both full-length (fl-Flt1) and truncated Flt1 mRNA accumulate in the placenta at higher levels than in normal pregnancies, with the truncated isoform being far more pronounced. This change at the mRNA level may explain the significant increase in sFLT1 protein in maternal bloodstream during PE.

[0171] 1.1 Applicability of siRNA for the treatment of PE siRNA-based therapeutics have been designed for the treatment of preeclampsia (PE). Both preclinical and clinical data support sFLT1 reduction as a valuable therapeutic strategy for prolonging PE pregnancy (Thadhani, R. et al. Pilot study of extracorporeal removal of soluble fms-like tyrosine kinase 1 in preeclampsia. Circulation 124, 940-950 (2011)). Furthermore, the unique regions specific to each sFLT1 protein are extremely small, with only a handful of unique amino acids added to each C-terminus. This small target size has been an obstacle to the development of conventional drugs (e.g., small molecules and antibodies) that target only sFLT1 and not fl-FLT1. On the other hand, the target window at the RNA level is much larger, with the i13 and i15 mRNA isoforms having 435 and 567 unique bases, respectively, neither of which are present in fl-FLT1 mRNA. Since RNAi requires a target size of only 19–22 nucleotides, this was determined to be more than enough nucleotide space for designing multi-isoform selective siRNAs. From a clinical perspective, the possibility that a single subcutaneously delivered dose is sufficient to block escaped sFLT1 expression for several weeks makes the treatment simple and affordable.

[0172] Novel chemically modified oligonucleotides known as self-delivering hydrophobic modified siRNA (hsiRNA) (Figure 1A) offer the most significant benefits of cost-effective therapeutics. While the current cost of chemical synthesis ($200 per g, approximately $20 at dose levels of 1 mg / kg) is relatively high, it is predicted that costs will drop dramatically (10 to 50 times) at kilogram-level scale-up. Furthermore, hsiRNA can be fully synthesized using solid-phase supported chemistry in less than 10 hours. Like other oligonucleotides, dried hsiRNA is highly stable and can be stored at ambient temperatures for long periods (i.e., years) and can be dissolved immediately before injection. In addition, the in vivo half-life of hsiRNA is long enough for a single intravenous dose to be well-suited for 2 to 6 weeks of inhibition of sFLt1 production.

[0173] The sFlt1-neutralizing ONT described herein is the first novel pre-eclampsia treatment based on an understanding of the disease mechanism and is cost-effective and readily available worldwide.

[0174] 1.2 Pilot Product Profile for RNAi-Based Treatment of PE Specific concerns regarding the development of RNAi-based treatments for PE are listed below.

[0175] 1.3 Multiple sFLT1 mRNA isoforms By performing polyadenylation site sequencing of total RNA from multiple normal and PE placentas ((PAS-Seq (Heyer, EE, Ozadam, H., Ricci, EP, Cenik, C. & Moore, MJ An optimized kit-free method for making strand-specific deep sequencing libraries from RNA fragments. Nucleic Acids Res 43, e2 (2015))), the PE placentas were found to have i13 and i15 Overexpression of sFLT1 variants was determined, with i15 responsible for 55% of readouts and i13 responsible for approximately 45%. While not intended to be bound by scientific theory, the endogenous variation in isoform ratios across various samples suggests that targeting both isoforms is the best option for covering the majority of PE patients. Therefore, the candidate drug was defined as an equimolar mixture of 2hsiRNAs: one targeting both short and long sFLT1-i13, and the other targeting sFLT1-i15a.The FDA has already recognized siRNA mixtures as monophasic drugs when the component siRNAs are similarly formulated or chemically modified and their PK / PD profiles are very similar (e.g., multi-siRNA formulations targeting VEGF-A / KSP (Tabernero, J. et al. First-in-humans trial of an RNA interference therapeutic targeting VEGF and KSP in cancer patients with liver involvement. Cancer Discovery 3, 406-417 (2013)); HBV (Wooddell, CI et al. Hepatocyte-targeted RNAi Therapeutics for the Treatment of Chronic Hepatitis B Virus Infection. Molecular Therapy: The Journal of the American Society of Gene Therapy 21, 973-985 (2013)), Arrowhead, etc.). While the use of mixtures adds complexity to CMC (chemistry, manufacturing, and control), the advantage that mixtures allow for the treatment of a broad PE population regardless of isoform variant overexpression ratios outweighs this. In one embodiment, two candidate mixtures are administered subcutaneously (SC) in saline as an additive.

[0176] In one embodiment, the desired level of sFLT1 silencing is only 30-40%, since a high degree of silencing should be disadvantageous. Preliminary data show that doses of 10-20 mg / kg produced >50% silencing in mice, and therefore less silencing may simply be achieved at lower doses. The desired product profile is a single injection, however, higher doses should be necessary to extend the duration of action. Therefore, in one embodiment, i13 or i15 could be used as a clinical candidate alone.

[0177] 1.4 Overall Safety and Toxicity Considerations ONT-related toxicity may be due to target-specific effects (e.g., over-silencing of sFlt1 isoforms), target-independent effects (i.e., unintentional silencing of non-target mRNAs), or class-related chemical-specific events. The ability to target i13 and i15 variants separately dramatically reduces any major target-related toxicity. Furthermore, i13 and i15 variants are placenta and pregnancy-specific, with low or undetectable expression in other adult tissues. Therefore, clinically limiting toxicity is most likely to be target-independent. These types of effects include siRNA off-targeting, RNA-based induction and selective delivery of innate immune responses, and general toxicity associated with these (e.g., hydrophobic modifications combined with phosphorothioates). The most advanced bioinformatics were initially used to optimize oligonucleotide design to minimize the possibility of off-target events (Uchida, S. et al. An integrated approach for the systematic identification and characterization of heart-enriched genes with unknown functions. BMC Genomics 10, 100 (2009)). Furthermore, all ribose in the seed sequence (i.e., nucleotides 2-8 of the guide strand) are modified with 2'-F and 2'-O-methyl, and this modification itself is well-established for minimizing off-target events (Jackson, AL et al. Position-specific chemical modification of siRNAs reduces "off-target" transcript silencing. RNA 12, 1197-1205 (2006)).Simultaneously, the evaluation of off-target signatures was established by microarray profiling in in vitro and mouse samples (Jackson, AL et al. Position-specific chemical modification of siRNAs reduces "off-target" transcript silencing. RNA 12, 1197-1205 (2006); Anderson, E., Boese, Q., Khvorova, A. & Karpilow, J. Identifying siRNA-induced off-targets by microarray analysis. Methods in molecular biology 442, 45-63 (2008); Anderson, EM et al. Experimental validation of the importance of seed complement frequency to siRNA specificity. RNA 14, 853-861 (2008); Birmingham, A. et al. 3' UTR seed matches, but not overall identity, are associated with RNAi off-targets. Nat Methods 3, 199-204 (2006); Fedorov, Y. et al. Off-target effects by siRNA can induce toxic phenotype. RNA 12, 1188-1196 (2006). The value of such tests is questionable because the overlap of siRNA off-target signatures in tissue culture / animal models and humans is generally minimal (Burchard, J. et al. MicroRNA-like off-target transcript regulation by siRNAs is species specific. RNA 15, 308-315 (2009)). For each sFLT1 isoform, two different sequences were selected for in vivo evaluation (one read and one backup) (Figure 3).If a lead fails due to off-targeting-induced toxicity, use the second sequence as a backup (Jackson, AL & Linsley, PS Recognizing and avoiding siRNA off-target effects for target identification and therapeutic application. Nature Reviews. Drug Discovery 9, 57-67 (2010)). As there is currently no official guidance specific to siRNA therapy, follow standard recommendations for NCE (Novel Chemical Substance) development, including safety demonstrations in two animal models: Hughes M, IJ, Kurtz A, et al. (ed. CN Sittampalam GS, Nelson H, et al., editors) (Eli Lilly & Company and the National Center for Advancing Translational Sciences, Bethesda (MD); 2012)).

[0178] The lead compound was fully chemically modified (meaning no unmodified ribose remained) using an alternating 2'-O-methyl / 2'-F pattern. The 2'-OMe / 2'-F combination is known to block the activation of the innate immune response (Nair, JK et al. Multivalent N-Acetylgalactosamine-Conjugated siRNA Localizes in Hepatocytes and Elicits Robust RNAi-Mediated Gene Silencing. Journal of the American Chemical Society (2014)). The absence of interferon pathway activation was confirmed by in vitro human whole blood cytokine activation assays observing IL-1β, IL-1RA, IL-6, IL-8, IL-10, IL-12(p70), IP-10, G-CSF, IFN-γ, MCP-1, MIP-1α, MIP-1β, and TNF-α (Bio-Plex Pro Magnetic Cytokine Assay; BioRad Laboratories), and in vivo (after injection into mice) observations of G-CSF, TNF, IL-6, IP-10, KC, and MCP-1 (Cytokine / Chemokine Magnetic Bead Panel; Millipore) (Kumar, V. et al. Shielding of Lipid Nanoparticles for siRNA Delivery: Impact on Physicochemical Properties, Cytokine Induction, and Efficacy. Molecular Therapy. Nucleic acids 3, e210 (2014)).

[0179] While not intending to be bound by scientific theory, based on data from other oligonucleotide chemistry studies (Wooddell, CI et al. Hepatocyte-targeted RNAi Therapeutics for the Treatment of Chronic Hepatitis B Virus Infection. Molecular Therapy: The Journal of the American Society of Gene Therapy 21, 973-985 (2013); Coelho, T. et al. Safety and efficacy of RNAi therapy for transthyretin amyloidosis. The New England Journal of Medicine 369, 819-829 (2013)), dose-limiting toxicity is most likely related to liver function. Preliminary studies determined that up to 50% of the hsiRNA injection dose accumulated in the liver, and that delivery was specific to endothelial, Kupffer, and stellate cells, but not to hepatocytes (Figure 4). Other phosphorothioate-containing oligonucleotides have been reported to cause slight, reversible increases in liver enzymes and mild, reversible injection site reactions as side effects (Frazier, KS Antisense Oligonucleotide Therapies: The Promise and the Challenges from a Toxicologic Pathologist's Perspective. Toxicologic pathology 43, 78-89 (2015)), but this liver enzyme elevation is usually only observed after long-term, continuous administration at high dose levels. Since this treatment requires only short-term administration (only one or two injections over a period of 1-2 months) and does not target hepatocytes, hepatotoxicity is probably not a concern. Nevertheless, these concerns will be examined in detail.

[0180] Any therapeutic agent targeting pregnant women raises further safety concerns. A major concern is the potential for hsiRNA transfer to the fetus and any potential toxicity this may cause. In preliminary studies, no detectable oligonucleotide transfer to the fetus was observed, either using fluorescence microscopy or a highly sensitive PNA (peptide nucleic acid)-based quantitative assay (Figure 4). No effects on fetal growth, miscarriage rate, placental histology, or other teratogenic effects were observed.

[0181] 1.5 Assays and model systems for lead compound evaluation Fluorescence microscopy evaluation of in-situ tissue distribution hsiRNA variants were synthesized with a Cy3 or Cy5.5 (low autofluorescence) dye attached to the 5' end of the sense (passenger) strand via a non-degradable linker. This compound was biologically stable without Cy3 cleavage, detectable within 24 hours. The fluorescent sense strand hybridized with its complementary guide strand (hence double-stranded hsiRNA formation) was administered to animals, and the oligonucleotide distribution pattern was examined in 4 μm tissue sections also stained with DAPI and / or cell-type selective antibodies. Parallel sections could be stained with standard histological markers, enabling detailed tissue mapping. Because the hsiRNA was already heavily hydrophobic, the addition of the dye had little effect on the overall hydrophobicity and therefore minimal impact on the oligonucleotide distribution. This assay allowed for rapid assessment of tissue and cell-type distribution and was supplemented by a PNA-based quantitative assay for direct guide strand detection.

[0182] PNA hybridization for quantitative guide chain detection in tissue lysates To enable the direct quantification of intact guides present in tissues, a novel assay was developed and performed (Figure 5) in which the guide strand was hybridized to a perfectly complementary Cy3-labeled PNA (peptide nucleic acid) oligonucleotide and the corresponding duplex was separated from excess single-stranded PNA by HPLC. Since PNA is uncharged and binds tightly to the guide strand, it outcompetes both the hsiRNA sense strand and any endogenous target sequences. Fluorescent detection of the Cy3-PNA:guide hybrid provides a direct measure of the amount of guide strand present in tissue lysates. In combination with an HPLC autoinjector, this assay enabled the quantification of guide strands in hundreds of samples overnight. The assay is also highly sensitive, with a detection limit of less than 10 fmole / g, and can quantify full-length, partially degraded, 5'-phosphorylated, and 5'-dephosphorylated guide strand-containing hybrids as separate peaks or shoulders in the HPLC trace. Since this assay was able to detect both labeled and unlabeled compounds, it can be directly translated to future CROs for clinical sample analysis.

[0183] QUANTIGENE (Affymetrix) assay for the direct detection of Flt1 mRNA variants in cells and tissues QUANTIGEN is a high-sensitivity 96-well-based assay in which mRNA is directly detected by direct signal amplification from tissue and / or cell lysates. By coupling this direct detection assay with a 192-well automated TissueLyser, a high-throughput version was developed, which enabled the processing of dozens of samples per animal. Therefore, quantitative data on the expression of target and housekeeping genes could be generated in many animals at once. In a pilot study, n = 8 was sufficient to detect a 40% modulation of sFlt1 mRNA isoform expression with 80% confidence.

[0184] ELISA (#MVR100, R&D systems) for the detection of sFLT1 protein in conditioned media and blood This 96-well-based assay required only 10 μL of biological fluid per sample. This assay has been optimized over the years for both in vitro and in vivo use. It is clinically compliant and enables the evaluation of circulating sFLT1 protein levels without killing animals, and is particularly useful for non-human primate studies.

[0185] Normal mouse pregnancy model The sFlt1-i13 variant is expressed during mouse pregnancy, and the i13 levels increase exponentially between days 14 and 19. The perfect homology between the sFLT1-i13-2283 compound and the i13 mouse variant enables the study of both efficacy and safety in this simple rodent model.

[0186] Preeclampsia model Use the reduced uterine perfusion pressure (RUPP) model of placental ischemia and the hypoxia model of preeclampsia as further described below.

[0187] Baboon wild-type pregnancy model The sFlt1-i15a variant is not expressed in pregnant rodents, and therefore the overall combined efficacy and safety are evaluated in wild-type pregnant baboons using ELISA, a non-invasive assay, as a lead-out of efficacy.

[0188] Preliminary data Developed a simple and cost-effective PE therapeutic using RNAi to limit the excessive placental expression of sFLT1 protein. To make this work, the following objectives were achieved: (1) Identified appropriate siRNA targeting sites in sFlt1 mRNA; (2) Confirmed that RNA silencing is possible in the placenta using general (i.e., intravenous or subcutaneous) delivery; and (3) Developed a novel siRNA chemistry that enables preferential delivery to placental trophoblasts, the cell type responsible for excessive sFLT1 production.

[0189] Using tissue-specific RNA-Seq data available from the Human Protein Atlas (see proteinatlas.org) and PAS-Seq data from multiple normal and PE human placentas, we determined that the full-length (fl) isoform is dominant in all tissues of non-pregnant adults, but placental expression is dominated by three cleavage isoforms produced by polyadenylation within introns 13 and 15: sFlt1-i13 short, sFlt1-i13 long, and sFlt1-i15a, respectively. Targeting the intron region with hsiRNA enabled selective silencing of the cleavage isoforms without interfering with fl-Flt1 mRNA abundance.

[0190] We developed a novel type of siRNA chemistry that enables efficient delivery to endothelial cells and demonstrated selective transfer to the placental labyrinthine region (i.e., to trophoblast cells, the cell type responsible for sFLT1 expression). Furthermore, up to 12% of the injectable dose accumulated in the placenta without formulation, and without detectable fetal transfer. This technology is the first to demonstrate selective labyrinthine targeting by some form of ONT, enabling silencing of the sFLT1 protein at its primary expression site.

[0191] Over 50 siRNA variants were designed and screened (see Figure 23). Enhanced, fully chemically modified hsiRNAs that selectively target i13 and i15 isoforms without interfering with fl-FLT1 expression were identified (Figure 3). Using these hsiRNAs, efficient silencing of i13 and i15 was demonstrated in primary human trophoblast cells without formulation (Figure 2B). The combination of sFLT1-i13-2283 and sFLT-i15a-2519 hsiRNA was selected as a lead candidate for PE treatment (Figure 3).

[0192] In pregnant mice, tissue concentrations of the compound reached 100 μg / g with a single subcutaneous (SC) or intravenous (IV) injection, resulting in a reduction of over 50–80% of sFlt1-i13 mRNA (Figures 3 and 4, respectively). While not intended to be bound by scientific theory, at this delivery level, silencing is predicted to last for several weeks in humans, and therefore only a few injections would suffice. Indeed, a single SC injection is sufficient for several weeks of sFLT1 silencing and sufficient PE pregnancy prolongation, likely for the full duration.

[0193] Example 2. Hydrophobic Modified siRNA (hsiRNA): Fully Chemically Modified siRNA / Antisense Hybrid A group of chemistry and formulations were considered as possible approaches for placental delivery. These include LNA antisense, LNPs, chol-conjugate / DPC GalNacs, and hsiRNA. hsiRNA far surpassed the other chemistry in placental delivery (see below) and was selected for further testing. The efficacy of hsiRNA uptake in primary trophoblast cells was evaluated. Efficient uptake by whole cells was observed upon addition of a Cy3-labeled compound to the culture medium. hsiRNA is an asymmetric compound with a short double-stranded region (e.g., 15 base pairs) and a single-stranded fully phosphorothioated tail, where all bases are fully modified using an alternating 2'-F / 2'-O-methyl pattern (providing stabilization and avoidance of PKR response), and the 3' end of the passenger strand (i.e., sense strand) is conjugated to the hydrophobic portion via a linker (e.g., TEG-cholesterol). The hydrophobic portion promotes rapid membrane binding, while the single-stranded phosphorothioate tail is required for intracellular internalization at a similar rate to that achieved with conventional antisense oligonucleotides (DM Navaroli, JC, L. Pandarinathan, K. Fogarty, C., Standley, LL, K. Bellve, M. Prot, A. Khvorova and & Corvera, S. Self-delivering therapeutic siRNA internalization through a distinct class of early endosomes. PNAS, under review, (2015)). Addition of Cy3-labeled hsiRNA to any cultured cell type results in rapid and efficient internalization via the EE1-related portion of the endocytosis pathway.An earlier version of this technology, in which only 50% of the bases are 2'F / 2'-O-methyl modified, is currently in Phase II clinical trials for dermatofibrosis (Byrne, M. et al. Novel Hydrophobically Modified Asymmetric RNAi Compounds (sd-rxRNA) Demonstrate Robust Efficacy in the Eye. Journal of Ocular Pharmacology and Therapeutics: The Official Journal of the Association for Ocular Pharmacology and Therapeutics (2013)).

[0194] We developed a chemical modification pattern that does not interfere with major RISC entry. Through the creation of a wide range of chemical variations, we identified that alternating 2'F / 2'-O-methyl patterns optimally constitute a guide strand that conforms to a geometric configuration that precisely mimics the individual strands in a type A RNA double helix. The type A RNA double helix is ​​recognized by the RISC complex, enabling the proper placement of target mRNA within the cleavage site (Ameres, SL, Martinez, J. & Schroeder, R. Molecular basis for target RNA recognition and cleavage by human RISC. Cell 130, 101-112 (2007); Schirle, NT, Sheu-Gruttadauria, J. & MacRae, IJ Gene Regulation. Structural basis for microRNA targeting. Science 346, 608-613 (2014)). Starting with an alternating pattern of 5'-phosphorylated 2'-O-methylribose (the 5'-phosphate is required for PIWI domain interaction and Ago2 recognition), 2'F modifications were placed at even positions from 2 to 14. Positions 2 and 14 had previously been shown to be resistant to bulky 2'-ribose modifications (Jackson, AL et al. Position-specific chemical modification of siRNAs reduces "off-target" transcript silencing. RNA 12, 1197-1205 (2006); Kenski, DM et al. siRNA-optimized Modifications for Enhanced In Vivo Activity. Molecular therapy. Nucleic Acids 1, e5 (2012)).

[0195] These fully chemically stabilized compounds are at least as effective as, or even more effective than, naked siRNA at RISC entry and represent a first fully chemically modified pattern that does not negatively affect RISC function. This finding led to a PE project, as fully chemical stabilization is essential for tissue accumulation by systemic administration. Figure 7 shows that the full-length compound was undetectable in mouse placentas 24 hours after administration of a version in which 40% of the ribose was still 2'-OH (P0 chemistry). For comparison, both fully 2'-F / 2'-O-methyl modified versions (P1 and P2 chemistry) accumulated above therapeutically effective levels (Figure 7). Another advantage of siRNA-containing non-RNA is ease of manufacture—its DNA-like chemistry, which does not require orthogonal ribose protection, shortens the deprotection step and increases coupling efficiency. Finally, complete elimination of all 2'-OH groups helps to evade the innate immune response, which is primarily based on 2'-OH interactions (Alexopoulou, L., Holt, AC, Medzhitov, R. & Flavell, RA Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 413, 732-738 (2001); Choe, J., Kelker, MS & Wilson, IA Crystal structure of human toll-like receptor 3 (TLR3) ectodomain. Science 309, 581-585 (2005)).

[0196] The discovery of this modification pattern redefined the established paradigm for therapeutic siRNA design. Partial modification of siRNA at 2'-O-methyl and 2'-fluoro dramatically improved in vitro stability, leading to the erroneous hypothesis that partial modification would be sufficient for oligonucleotides in vivo. However, this hypothesis is incorrect (see Figures 39A, B; Hassler et al., 2016 Nature Biotech). Visual (fluorescence; Figure 39B) and quantitative (PNA-based; Figure 39C) assays showed that chemical modification of the entire 2'-OH group (FM-hsiRNA) significantly increased the stability, accumulation, and retention of the compound in most tissues upon systemic (intravenous) or CSF (lateral ventricular, ICV) administration. Partially stabilized hsiRNA (40% ribose retaining the 2'-OH group) performed poorly compared to FM-hsiRNA. Furthermore, CNS injection of FM-hsiRNA supports maximum silencing for at least one month after injection (Figure 39D, longer-term studies underway) – a significant enhancement over the long-term silencing achieved by partially modified compounds (Figure 39D).

[0197] Substitution of all 2'-OH groups with 2'-O-methyl or 2'-fluoro groups offers two further advantages. The absence of 2'-OH groups simplifies synthesis—DNA-like chemistry eliminates the need for orthogonal ribose protection, thereby shortening the deprotection step and increasing coupling efficiency. Furthermore, the absence of 2'-OH groups minimizes innate immune activation,27 28 which is essential for increasing the therapeutic index.

[0198] Metabolic stability testing was performed with FM-hsiRNA, and it was found that the major degradation product of FM-hsiRNA (90% within 2 hours of systemic administration) originated from the removal of the 5' phosphate from the guide chain. Without the 5' phosphate, the compound could not bind to RISC and was therefore inactive (Figure 38C). As a result, the 5' phosphate was replaced with its stable stereocompatible analog, 5'-(E)-vinylphosphonate (5'-E-VP) (also referred to here as X3). The 5'-E-VP modified hsiRNA was as active as 5'-P-hsiRNA (Figure 38C), but guide chain retention was significantly increased in injection site-mutated tissue after one week (Figure 38D). The 5'-E-VP modification is expected to further extend the duration of in vivo effect.

[0199] Example 3. hsiRNA enabled selective delivery to placental labyrinthine trophoblasts without detectable fetal transfer. To evaluate in vivo hsiRNA distribution, Cy3-labeled sFlt-i13-2283 hsiRNA was injected into normal pregnant mice (15 days old), and distribution was examined by two independent assays. Total tissue fluorescence microscopy confirmed that the majority of the oligonucleotides accumulated in three tissues: liver endothelium, kidney endothelium, and placental labyrinth (Figure 4). While not intended to be bound by scientific theory, this distribution profile appears to be largely determined by a combination of blood flow / filtration rate and cell surface cholesterol receptor concentration. Using the novel FDA-compliant PNA-hybridization assay described above, it was shown that the overall drug concentration in the placenta exceeded the effective level (approximately 100 ng / g) by several orders of magnitude with a single 10 mg / kg injection (Figure 4). This level of tissue delivery is nearly equivalent to IV and SC administration, with approximately 50%, 10%, and 12% of the compound distributed to the liver, kidney, and placenta 24 hours after injection (Figure 4). Interestingly, only half of this was eliminated from the liver after 5 days (with a little more in the kidneys), indicating that a single dose is sufficient to induce long-term silencing.

[0200] In addition to comparing the effects of complete 2'-F / 2'-O-methyl modification on pharmacokinetics (PK), the phosphorothioate (PS) content differed slightly. The P1 chemistry had PS bonds at the 3' ends of both chains (total 8), while the P2 chemistry had the other 2 PS bonds at the 5' ends of each chain (total 12). Terminal PS bonds provide protection against exonucleases and are therefore essential for long-term stability in highly aggressive nuclease environments. Overall, while the two compounds showed comparable oligonucleotide delivery levels at 24 hours (Figure 7), their degradation profiles after long-term tissue exposure may differ, affecting their silencing effects. They also had slightly different liver:placental distribution ratios, which are also somewhat influenced by the route of administration (Figure 7).

[0201] 3.1. Selection and identification of lead candidates: Efficacy in i13 / i15 mixture and primary trophoblast cells The i13 and i15 Flt1 mRNA isoforms contained unique nucleotides, 435 and 567, respectively, that were not present in the fl-Flt1 mRNA. Unfortunately, much of this sequence space was dominated by homopolymer repeats and high GC content regions, none of which are targetable by RNAi. We designed a group of over 50 hsiRNAs that were not inhibited (Birmingham, A. et al. A protocol for designing siRNAs with high functionality and specificity. Nature protocols 2, 2068-2078 (2007)), evaluated GC content, specificity, and low seed complement frequency (Anderson, EM et al. Experimental validation of the importance of seed complement frequency to siRNA specificity. RNA 14, 853-861 (2008)), excluded miRNA seed-containing sequences, and tested for thermodynamic bias (Khvorova, A., Reynolds, A. & Jayasena, SD Functional siRNAs and miRNAs exhibit strand bias. Cell 115, 209-216 (2003); Schwarz, DS et al. Asymmetry in the assembly of the RNAi enzyme complex. Cell 115, 199-208). Standard siRNA design parameters, including those from (2003), were used to design hsiRNAs for any viable targetable sequence. Figure 3B shows the targeting sites of hsiRNAs identified as highly functional.

[0202] In the design criteria, targeting sites with complete homology to other primates supported the simplification of formal toxicity and efficacy testing in both non-human primate and baboon PE models described below. Mice express only the i13 variant. Fortunately, the most effective hsiRNA, sFLT1-i13-2283, happened to be fully complementary to the mouse i13 isoform, enabling direct in vivo efficacy and toxicity evaluation of this compound in both normal and PE mouse pregnancy models. Figure 3C shows the targeting sites and IC of the best compound identified to efficiently silencing the i13 and i15 isoforms. 50 A table of values ​​is shown. IC of effective compounds. 50 The values ​​ranged from 40 to 100 nM in both HeLa cells and primary human trophoblast cells.

[0203] Figure 1C shows IC 50 An example of the dose-response of sFLT1-i13-2283 in primary human trophoblast cells used for value calculation is shown. It is important to emphasize that silencing with hsiRNA was achieved by adding a non-formulated compound to the trophoblast cell medium. mRNA knockdown levels were determined at 72 hours using the QUANTIGENE assay described above. To control for any possible nonspecific effects, i13 or i15 levels were always normalized to housekeeping genes. Non-targeting controls (NTCs) of the same chemistry were used in all experiments to control for chemistry class effects. Full-length Flt1 mRNA levels had no effect (Figure 1D). To assess silencing at the protein level, sFLT1 concentrations in the conditional medium were measured using ELISA (QUANTIKINE FLT1, MVR100, R&D Systems) (Figure 1B).

[0204] To proceed, two hsiRNA pairs were selected: sFLT1-i13-2283 (5’ CTCTCGGATCTCCAAATTTA 3’) / sFLT-i15a-2519 (5’ CATCATAGCTACCATTTATT 3’) and sFLT1-i13-2318 (5’ ATTGTACCACACAAAGTAAT 3’) / sFLT-i15a-2585 (5’ GAGCCAAGACAATCATAACA 3) (Figure 1C). The first pair was the lead drug candidate and was used in all the trials. The second pair was a backup. Sequence-specific toxicity was unlikely to be a problem, but a readily available backup compound combination in case any sequence-dependent toxicity emerged was desired. In summary, functionally hydrophobic modified siRNAs that selectively target the sFlt1-i13 and sFlt1-i15a isoforms were identified. The efficient internalization and silencing of the corresponding targets in primary human trophoblast cells were determined at both the mRNA and protein levels.

[0205] These data led to the development of a novel siRNA chemistry that enables efficient delivery to placental trophoblast cells, the major site of sFLT1 overexpression in PE, and potent silencing of circulating sFLT1 by systemic administration.

[0206] Example 4. Huntingtin Reduction in Both Primary Neurons and Mouse Brain with Unformulated, Stabilized, Hydrophobic siRNA We sought hydrophobic modified ASO-siRNA hybrids that have the potential to provide both good efficacy and distribution in vivo, as well as knockdown in primary neurons in vitro. The huntingtin gene was used as the target for mRNA knockdown. Huntington's disease is monogenic (Mangiarini, L. et al. Exon 1 of the HTT gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell 87, 493-506 (1996)) and involves numerous cellular mechanisms leading to the disease pathology (Zuccato, C., Valenza, M. & Cattaneo, E. Molecular Mechanisms and Potential Therapeutical Targets in Huntington's Disease. Physiological Reviews 90, 905-981 (2010)), making it an excellent candidate for future oligonucleotide therapy.

[0207] We developed a group of hydrophobically modified siRNA-targeting huntingtin genes. See Figure 24. Efficacy and potency were observed in both primary neurons in vitro and mouse brains in vivo with a single low-dose injection, without the need for a delivery formulation. These compounds combine numerous chemical and structural modifications found in both early model iRNAs and hsiRNAs, as well as ASs. These properties, including stabilizing base modifications, cholesterol conjugation, and fully phosphorothioated single-strand tails, make these hsiRNAs excellent tools for studying gene function in hard-to-target primary cells and organs, adaptable for use in a wide variety of biologically appropriate systems.

[0208] 4.1 hsiRNA - Hydrophobic modified siRNA / antisense hybrids were efficiently internalized in primary neurons. hsiRNA is an asymmetric compound possessing a short double-stranded region (e.g., 15 base pairs) and a single-stranded fully phosphorothioated tail. The entire pyrimidine in these compounds is 2'-fluoro or 2'-O-methyl modified (for stabilization), and the 3' end of the passenger strand is conjugated to TEG-cholesterol (Figure 1A, Figure 8). The cholesterol conjugate enables rapid membrane binding, while the single-stranded phosphorothioated tail was required for intracellular translocation via a mechanism similar to that used by conventional antisense oligonucleotides. Addition of Cy3-labeled hsiRNA to primary cortical neurons resulted in immediate (within minutes) cell binding (Figure 1B). Interestingly, uptake was first observed preferentially in dendrites, followed by relocalization to the cell body (Figure 9). Uptake was uniform across all cells in the dish, confirming efficient intracellular translocation. Notably, approximately 60% of htt-mRNA was found to localize to the nucleus (data not shown).

[0209] 4.2 Identification of hsiRNAs that target huntingtin We designed and synthesized a group of 94hsiRNA compounds (Figure 24) that target huntingtin mRNA. These sequences span genes and were selected to conform to standard siRNA design parameters, including evaluation of GC content, specificity, and low seed complementation frequency (Anderson, EM et al. Experimental validation of the importance of seed complement frequency to siRNA specificity. RNA 14, 853-861 (2008)), removal of miRNA seed-containing sequences, and testing for thermodynamic bias (Khvorova, A., Reynolds, A. & Jayasena, SD Functional siRNAs and miRNAs Exhibit Strand Bias. Cell 115, 209-216 (2003); Schwarz, DS et al. Asymmetry in the Assembly of the RNAi Enzyme Complex. Cell 115, 199-208 (2003)). (Birmingham, A. et al. A protocol for designing siRNAs with high functionality and specificity. Nat Protoc 2, 2068-2078) (2007)). Over 50% of the bases were chemically modified, providing in vivo stability and minimizing the immune response (Judge, A., Bola, G., Lee, A. & MacLachlan, I. Design of Noninflammatory Synthetic siRNA Mediating Potent Gene Silencing in Vivo. Molecular Therapy 13, 494-505 (2006)). The modifications imposed further constraints on the sequence space, reducing the hit rate. The effect on huntingtin mRNA expression was measured by the QUANTIGENE assay 72 hours after exposure to 1.5 μM hsiRNA (passive uptake, unformulated) in HeLa cells, and 7% of the sequences showed more than 70% silencing.At 1.5 μM hsiRNA, 24 hsiRNAs reduced Htt mRNA levels to less than 50% of control levels, and 7 hsiRNAs reduced Htt mRNA levels to less than 30% of control levels. Functional target sites extended throughout the gene, with the exception of the distal portion of the 3'UTR, and were later explained by the preferential expression of short htt isoforms in HeLa cells (Li, SH et al. Huntington's disease gene (IT15)). IC. 50 The values ​​were identified in 16 active sequences selected based on a primary screening of activity and interspecies conservation (Figure 10). 50 The values ​​ranged from 90–766 nM (unformulated) for passive uptake and 4–91 pM for lipid-mediated uptake (Figure 8). Fully chemically optimized active compounds were readily identified, and much smaller libraries are sufficient for future screening of other genes, although hit rates may vary per target. hsiRNA targeting position 10150 (HTT10150 (i.e., 5'CAGUAAAGAGAUUAA 3')) was used for further testing. To ensure that the hsiRNA chemical scaffold did not negatively affect the efficacy and potency of HTT10150, modified and unmodified compounds were tested in both passive and lipid-mediated silencing assays (Figure 26). As expected, only the modified sequence was successful in cell delivery and Htt silencing via passive uptake (IC). 50 (=33.5nM), while both the modified and unmodified compounds exhibited similar IC50 in lipid-mediated delivery. 50 The values ​​(0.9 pM and 3.5 pM, respectively) suggested that hsiRNA backbone modification does not interfere with RNA-induced silencing complex (RISC) packing.

[0210] 4.3 Strong and specific gene silencing with informal hsiRNA in primary neurons HTT10150 was further tested for mRNA silencing in primary neurons isolated from FVBN mice. Efficacy was observed in cortical neurons 72 hours and 1 week after simple, unformulated compound administration (Figure 27A), with maximum silencing (70%) observed at a concentration of 1.25 μM. hsiRNA in cortical neurons.HTT The treatment eliminated Htt mRNA preferentially from the cytoplasm beyond the nucleus (Figure 33). HTT10150 also showed similar silencing in primary striatal neurons (Figure 27B). Protein levels were measured by Western blotting one week later, confirming mRNA data showing an 85% reduction in post-treatment protein at 1.25 μM of the compound. HTT10150 hsiRNA did not affect the expression levels of housekeeping controls (Ppib and Tubb1) or the overall viability of major neurons, as measured by the ALAMARBLUE assay, at concentrations up to 2 μM. Similar results have been observed with other hsiRNAs targeting Htt mRNA, supporting the notion that this observed phenomenon is not unique to HTT10150. In other experiments, a slight effect on cell viability was observed at 3 μM.

[0211] To evaluate the duration of effect of single HTT10150 treatment, silencing was measured at 1-week, 2-week, and 3-week intervals. Since the half-life of the packed RISC complex is several weeks (Song, E. et al. Sustained Small Interfering RNA-Mediated Human Immunodeficiency Virus Type 1 Inhibition in Primary Macrophages. Journal of Virology 77, 7174-7181 (2003)), silencing was expected to be long-lasting in non-dividing cells. Indeed, single treatment with hsiRNA was sufficient to induce htt silencing at all time points tested. 3 weeks was the longest duration, during which primary neurons could be maintained in culture. Other systems can be used for long-term experiments.

[0212] To demonstrate the general applicability of hsiRNA as a tool for neuronal gene silencing and to confirm the validity of this chemical skeleton for neuronal delivery, similar experiments were conducted targeting several other HTT-targeting hsiRNAs and the housekeeping gene PPIB (cyclophyllin B) (Figure 28). High silencing rates of 70% and 90% were observed with HTT and PPIB, respectively.

[0213] In summary, these data demonstrate that hydrophobically modified siRNA is a simple and straightforward approach to gene silencing in primary neurons and can be adapted to multiple gene targets.

[0214] 4.4 In vivo hsiRNA distribution in mouse brains after single injection RNA is efficiently internalized by various types of neurons in vitro. We further evaluated the potential of selected hsiRNA, HTT10150, to silence gene expression in the brain in vivo. To confirm the distribution profile of HTT10150 after in vivo administration, 12.5 μg of Cy3-labeled hsiRNA (see Figure 7 for sequence) was injected intrastriatically. After 24 hours, the brain was perfused, sectioned, and oligonucleotide distribution visualized using a fluorescence microscope (Leica DM5500 - DFC365FX). Simultaneously processed artificial CSF-injected samples were used for microscopic contrast enhancement in a setting configured to control background tissue epifluorescence.

[0215] The majority of the compound showed a steep diffusion gradient away from the injection site, covering a large portion of the ipsilateral striatum (Figures 5A, 5B). Interestingly, hsiRNA was detected on the non-injection site (contralateral) side of the brain (both cortex and striatum), but at a much lower relative concentration. High-magnification images showed a significant relationship between hsiRNA and fiber tracks, likely due to the presence of hydrophobic modifications. This aspect of hsiRNA may make it useful as a labeling reagent for visualizing brain signaling structures. In addition to fiber track and neurite labeling, hsiRNA could be detected as staining pinpoint in the perinuclear space of various cell types, including neurons, as indicated by co-localization in NeuN (neuronal marker) stained cells just 24 hours after injection.

[0216] 4.5 In vivo hsiRNA efficacy in mouse brains by single injection To determine the efficacy of HTT10150 in vivo, wild-type FVBN mice were administered intrastriatically by a single injection of 3–25 μg (0.1–0.9 mg / kg) of the compound, and mRNA silencing was tested both ipsilaterally and contralaterally at the injection site. Eight animals were administered per treatment group, and three individual punches were taken from each side of the striatum for mRNA and protein quantification. Huntintin expression levels were measured by the QUANTIGENE assay and normalized to housekeeping genes.

[0217] Statistical analysis was performed using GraphPad Prism with one-way ANOVA comparisons against CSF or PBS controls, and repeated measures were corrected with Bonferroni correction (details in online methods). All groups that induced silencing were significant compared to CSF, PBS, and untargeted control treated animals. Statistically significant dose-dependent silencing was observed at the administration site (ipsilateral side) at all concentrations. 25 μg treatment induced 77% silencing (p<0.0001), and 12.5 μg treatment, repeated on different days in two animal groups, showed statistically significant silencing of 66% and 42%.

[0218] Initial distribution studies showed a steep diffusion gradient away from the injection site and the minimum amount of compound to move to the contralateral site, but treatment with higher doses of 25 μg and 12.5 μg resulted in statistically significant silencing at the non-injection site (p<0.0001). However, the level of silencing was significantly lower on the treated side of the brain (only 36% in the 25 μg group).

[0219] To further measure the efficacy of HTT10150 in vivo, dose-response studies were conducted in wild-type FVB / NJ mice injected intrastriatically with 3.1 μg, 6.3 μg, 12.5 μg, or 25 μg of HTT10150. As controls, mice were injected with non-targeting control hsiRNA (NTC), artificial CSF, or PBS. In punch biopsies taken from the ipsilateral and contralateral striatum, HTT10150 reduced Htt mRNA levels in a dose-dependent manner (Figure 34).

[0220] Htt mRNA was significantly reduced on the contralateral striatum. A robust dose-dependent silencing was observed, with a maximum reduction of 77% (unidirectional Anova p<0.0001) in Htt mRNA expression levels at high dose levels. Interestingly, statistically significant but less pronounced silencing was observed in the contralateral striatum and cortex. Silencing reached statistical significance with both unidirectional and bidirectional Anova (values ​​for bidirectional Anova are shown in Figure 34). While some levels of fluorescence were detectable in these brain regions at high laser intensity, detection was technically difficult due to their proximity to autofluorescent tissue and therefore is not described here. The level of silencing effect clearly correlates, at least, with a sharp gradient of distribution from the injection site.

[0221] Htt mRNA silencing was observed with HTT10150 but not with non-targeting controls or CSF (Figure 34). Furthermore, HTT10150 did not affect the expression of several housekeeping genes (PPIB, HPRT). In combination, this indicates that the silencing was caused by HTT10150 mRNA silencing and not by off-target effects.

[0222] In summary, these data demonstrate that monolithic intrastriatal injection of hsiRNA is sufficient to induce potent gene silencing around the injection site. This effect was reproducible across various treatment groups and in independent experiments.

[0223] 4.6 Neuronal cell viability after single hsiRNA injection in mouse brain Cholesterol modification of unmodified, naked siRNAs has been previously used to improve siRNA brain distribution, and toxicity at high doses was identified as a potential limit. To assess the extent of nonspecific chemo-related effects on the brain, DARPP32 expression, an established marker of dopamine receptor expression in medium spiny neurons in the striatum and representing neuronal viability, was tested. Furthermore, the potential to induce an immune response was investigated by evaluating microglial activation induced by hsiRNA injection.

[0224] To evaluate the activation of the innate immune response by hsiRNA in vivo, IBA1-positive microglia cells were quantified in brain sections from mice injected with 12.5 μg HT10150 or artificial CSF. IBA-1 is specific to microglia cells, is upregulated after brain injury, and allows for the differentiation of resting and activated microglia. Total microglia counts showed only a 25% increase ipsilaterally 5 days after injection, indicating no inflammatory response (Figure 35).

[0225] No significant effect on DARPP32 expression was observed at doses up to 12.5 μg, demonstrating persistent neuronal viability. Similarly, minimal microglial activation, an indicator of a limited immune response in the presence of modified hsiRNA, was visualized at a 12.5 μg dose. A 25 μg dose induced a slight decrease in DARPP32 only around the injection site, an indicator of toxicity, establishing the maximum dose level for this chemical framework via the indicated administration route. Single doses of 10–12.5 μg of hsiRNA efficiently silenced HTT mRNA in three well-potential, independent studies, showing reliable silencing of 62%, 42%, and 52% without toxicity. These data suggest that this technology has broad applicability to functional testing of other neurologically significant targets.

[0226] 4.7 hsiRNA, not LNA-GAPMER oligonucleotides HTT This shows a silencing plateau. Silencing plateaus were observed only with RNAi (cytoplasmic; hsiRNA-F1) and not with RNAeH (primarily nuclear; LNA-GAPMER) compounds. The observed silencing plateaus (Figure 32) were specific to the HTT gene.

[0227] 4.8 Discussion This study demonstrates that the use of hydrophobically modified siRNA for delivery to primary cells is a valuable tool for enabling functional and genomic testing of neuronal pathways and neuronal disorders.

[0228] The ability to induce gene silencing in primary neurons without the use of toxic agents will have a significant impact on neuroscience research, facilitating deeper studies of neurological disorders in primary cell lines and ultimately providing a more meaningful understanding of in vivo function and pathology. Most neuronal cell studies are performed using stable cell lines for ease of delivery and cell maintenance, but the use of artificial cell lines can introduce data artifacts that may arise from the manipulation of these cell lines, a problem avoided by using primary cells (Cheung, Y.-T. et al. Effects of all-trans-retinoic acid on human SH-SY5Y neuroblastoma as in vitro model in neurotoxicity research. NeuroToxicology 30, 127-135 (2009); Gilany, K. et al. The proteome of the human neuroblastoma cell line SH-SY5Y: An enlarged proteome. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics 1784, 983-985 (2008); Lopes, FM et al. Comparison between proliferative and neuron-like SH-SY5Y cells as an in vitro model for Parkinson disease studies. Brain Research 1337, 85-94). (2010); Zhang, W. et al. Cyclohexane 1,3-diones and their inhibition of mutant SOD1-dependent protein aggregation and toxicity in PC12 cells. BIOORGANIC & MEDICINAL CHEMISTRY 1-17 (2011). doi:10.1016 / j.bmc.2011.11.039).Current methods for delivering siRNA to primary neurons include lentiviral vectors, adeno-associated viruses (AAVs), or lipofectamine. TM This includes the use of intermediated transfection (Karra, D. & Dahm, R. Transfection Techniques for Neuronal Cells. Journal of Neuroscience 30, 6171-6177 (2010)). By directly conjugating a hydrophobic moiety such as cholesterol to the siRNA itself and using an additional single-stranded phosphorothioate tail to enhance uptake, it was shown that siRNA can be efficiently delivered in vitro to primary neurons with minimal toxicity while still remaining a potent silencer for mRNA.

[0229] While not intending to be bound by scientific theory, one of the major advantages of RNAi over antisense technology is that packed RISCs are expected to remain active for extended periods in non-dividing cells (Bartlett, DW Insights into the kinetics of siRNA-mediated gene silencing from live-cell and live-animal bioluminescent imaging. Nucleic Acids Research 34, 322-333 (2006)). Furthermore, a limited number of packed RISCs are sufficient to induce RNAi-mediated silencing (Stalder, L. et al. The rough endoplasmatic reticulum is a central nucleation site of siRNA-mediated RNA silencing. The EMBO Journal 32, 1115-1127 (2013)). The data presented here demonstrate up to 3 weeks of silencing of primary cortical neurons in vitro with a single dose of hsiRNA, supporting the view that RNAi-mediated silencing is efficient and sustained. The data presented here also demonstrate that these compounds can target multiple regions of different genes, indicating the applicability of hsiRNA for the study of alternative neurological pathways and diseases.

[0230] Intrastriatal injection of hsiRNA resulted in potent gene silencing near the injection site in vivo, but the effect did not diffuse uniformly throughout the brain. Limited diffusion to other brain regions (illuminated by in vivo efficacy studies) could occur via several mechanisms. These include migration in the CSF, diffusion through nerve cords, or possibly retrograde transport, which has shown a high visible density of Cy3-labeled hsiRNA in distribution studies (tewart, GR & Sah, D. Retrograde Transport of siRNA and Therapeutic Uses to Treat Neurological Disorders. United States Patent Application Publication US 2008 / 0039415 A1, 1-18 (2008)), but further studies are needed to determine the exact mechanisms.

[0231] The technologies described here are useful for understanding the functional genome of specific brain regions, as well as for elucidating the relationships between multiple brain regions. Furthermore, studies of certain neurological disorders (e.g., memory impairment (Samuelson, KW Post-traumatic stress disorder and declarative memory functioning: a review. Dialogues in Clinical Neuroscience 13, 346-351 (2011)))) may benefit from limited and regional target distribution and silencing. However, due to their distribution profiles, currently available hsiRNAs are not viable treatments for common neurological disorders such as Huntington's disease. While multiple injections work to increase overall silencing in small rodents, other chemical modifications and delivery methods would be utilized to adapt this technology for use in large animal brains and humans, and to achieve uniform and broad distribution. There are numerous ways to approach this. First, chemical modifications to the hsiRNA composition itself can be made. These modifications include conjugation to various lipids, auxiliary use of further phosphorothioate groups in the main chain, or addition of hydrophobic portions to the nucleotide itself (Vaught, JD, Dewey, T. & Eaton, BE T7 RNA Polymerase Transcription with 5-Position Modified UTP Derivatives. J. Am. Chem. Soc. 126, 11231-11237 (2004)). All of these modifications are supported by a certain range of hydrophobicity, enabling improved distribution over longer distances. Increased bioavailability is also achieved by injection in various forms, such as into the CSF, which increases the possibility of exposure to the entire brain rather than just the striatum. However, delivery via the CSF supports the localization of hsiRNA to brain regions other than the striatum and is not a more ideal delivery method for Huntington's disease treatment. Another possibility is formulation delivery by encapsulating these hydrophobic modified siRNAs in exosomes and liposomes (currently lipofectamine). TMThese methods are intended for the delivery of cargo in a more uniformly dispersed form of these natural and synthetic nanocarriers (lower toxicity than formulations) (Alvarez-Erviti, L. et al. Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nat Biotechnol 1-7 (2011). doi:10.1038 / nbt.1807; Marcus, M. & Leonard, J. FedExosomes: Engineering Therapeutic Biological Nanoparticles that Truly Deliver. Pharmaceuticals 6, 659-680 (2013)). However, the potency and efficacy of delivered hsiRNA need to be validated using these methods.

[0232] In conclusion, HTT10150 was efficient for localized targeting of huntingtin mRNA in primary neurons in vitro and in the mouse brain in vivo. This compound requires no formulation for delivery to primary cells, enabling functional gene testing for huntingtin and other targets, making it an extremely useful tool for neurological disorder research. The potential benefits of this technology should enable hsiRNA to function as a therapeutic treatment for Huntington's disease and other neurological disorders in the future.

[0233] 4.9 Method cell culture HeLa cells were seeded in DMEM (Corning Cellgro) supplemented with 10% fetal bovine serum (Gibco) and 100 U / mL penicillin / streptomycin (Invitrogen), and grown at 37°C and 5% CO2. Cells were divided into 15 passages every 2-5 days, after which they were discarded.

[0234] Cell culture for passive uptake Cells were seeded at a rate of 10,000 cells / well in 96-well tissue culture treatment plates with 6% FBS-supplemented DMEM. hsiRNA was diluted to 2× final concentration with OptiMEM (Gibco), and 50 μL of the diluted hsiRNA was added to 50 μL of cells up to 3% FBS. Cells were incubated for 72 hours at 37°C and 5% CO2.

[0235] Cell culture for lipid-mediated uptake Cells were seeded at a rate of 10,000 cells / well in 6% FBS-supplemented DMEM in a 96-well tissue culture treatment plate. hsiRNA was diluted to 4× final concentration with OptiMEM. LIPOFECTAMINE RNAIMAX Transfection Reagent (Invitrogen #13778150) was diluted to 4× final concentration (final = 0.3 μL / 25 μL / well). RNAIMAX and hsiRNA were mixed in a 1:1 ratio, and 50 μL of this mixture was added to 50 μL of cells with 3% FBS. Cells were incubated for 72 hours at 37°C and 5% CO2.

[0236] Production of primary neurons Primary cortical neurons were obtained from E15.5 mouse embryos of WT (FVBN) mice. Pregnant females were anesthetized with abatin (250 mg / kg body weight) IP injection, followed by cervical vertebral dislocation. The embryos were removed and transferred to petri dishes containing ice-cold DMEM / F12 medium (Invitrogen). The brain was removed, and the meninges were carefully separated. The cortex was isolated and the tissue was lysed by transferring it to a 1.5 ml tube containing pre-warmed papain solution at 37°C and 5% CO2 for 25 minutes. The papain solution was prepared as follows: Papain (Worthington #54N15251) was dissolved in 2 mL Hibernate E (Brainbits) and 1 mL EBSS (Worthington). Separately, DNase (Worthington #54M15168) was resuspended in 0.5 mL Hibernate E. Then, 0.25 mL of resuspended DNase was transferred to resuspended papain for the final solution. After 25 minutes of incubation, the papain solution was removed, and 1 mL of 2.5% FBS-added NbActiv4 (Brainbits) was added to the tissue. The cortex was then dissociated by heat treatment and by moving a glass Pasteur pipette up and down. Cortical neurons were counted, and 1 × 10⁻⁶ neurons were identified. 6 The cells were plated at a concentration of cells / ml. For viable cell contrast studies, the culture plates were pre-coated with poly-L-lysine (Sigma #P4707) and 2 × 10⁶ cells were used. 5 Cells were added to the glass center of each dish. For the silencing assay, neurons were placed in 1 × 10⁶ well poly-L-lysine pre-coated 96-well plates (BD BIOCOAT #356515). 5 Cells were seeded in wells. After incubation overnight at 37°C and 5% CO2, an equal volume of NbActiv4 (Brainbits) was added to the neuronal cell cultures, along with 0.484 μL / mL of 5'UtP (Sigma #U6625) and 0.2402 μL / mL of 5'FdU (Sigma #F3503), mitotic inhibitors to inhibit the proliferation of non-neuronal cells. Half the volume of the medium was replaced every 48 hours until the neurons were treated with siRNA (new NbActiv4 containing mitotic inhibitors). After the cells were treated, the medium was only added, not removed. All subsequent medium additions contained mitotic inhibitors.

[0237] mRNA quantification mRNA was quantified using the QUANTIGENE 2.0 assay (Affymetrix #QS0011). Cells were lysed in 250 μL of diluted lysate (Affymetrix #13228), 1 part lysate, 2 parts H2O, and 0.167 μg / μL proteinase K (Affymetrix #QS0103) for 30 minutes at 55°C. The cell lysates were thoroughly mixed, and 40 μL (approximately 8000 cells) of lysate was added to a capture plate with 40 μL of further diluted lysate without proteinase K. Probe sets were diluted as specified in the Affymetrix protocol. For HeLa cells, 20 μL of human HTT or PPIB probe set (Affymetrix #SA-50339, #SA-10003) was added to the appropriate wells up to a final volume of 100 μL. For primary neurons, 20 μL of mouse HTT or PPIB probe sets (Affymetrix #SB-14150, #SB-10002) were used.

[0238] The tissue was treated similarly with 300 μL of homogenization buffer (Affymetrix #10642) supplemented with 2 μg / μL proteinase K per 5 mg tissue punch. The tissue was then homogenized in a QIAGEN TissueLyser II in a 96-well plate format, and 40 μL was added to a capture plate. The probe sets were diluted to match the Affymetrix protocol, and 60 μL of either an HTT or PPIB probe set (Affymetrix #SB-14150, #SB-10002) was added to each well of the capture plate up to a final volume of 100 μL. For DARPP32 quantification, only 10 μL of tissue sample and 30 μL of homogenization buffer were added to each well along with 60 μL of a mouse Ppp1r1b probe set (Affymetrix #SB-21622). The signals were amplified according to the Affymetrix protocol. The light emission was detected using Veritas Luminomete or Tecan M 1000.

[0239] Viable cell staining To monitor the uptake of viable cells by hsiRNA, prepare primary neurons as described above, using 2 × 10 cells per 35 mm glass-bottom dish. 5 Cells were seeded. Before contrast enhancement, cell nuclei were stained with phenol-free red NbActiv4 using NUCBLUE (Molecular Probes by Life Technologies #R37605) as indicated by the manufacturer. Contrast enhancement was performed with phenol-free red NbActiv4. Cells were treated with 0.5 μM Cy3-labeled hsiRNA, and viable cell enhancement was performed over time. Confocal images of all viable cells were acquired using a Zeiss confocal microscope, and the images were processed using ImageJ (1.47v) software.

[0240] Immunohistochemistry / Immunofluorescence For the distribution test, 1 nmol (12.5 μg) of Cy3-labeled hsiRNA was injected into the brain. After 24 hours, the mice were sacrificed, the brains were removed and sent to the DERC Morphology Core at UMASS Medical School, where they were embedded in paraffin, sliced ​​into 4 μm sections, and mounted on glass slides. The sections were deparaffinized twice in xylene for 8 minutes each. The sections were then rehydrated with sequential ethanol dilutions (100%, 95%, 80%) for 4 minutes each, and then washed twice with PBS for 2 minutes each. For NueN staining, the slides were boiled in antigen recovery buffer for 5 minutes, then allowed to stand at room temperature for 20 minutes, and then washed with PBS for 5 minutes. The slides were then blocked with 5% normal goat serum in PBS + 0.05% Tween 20 for 1 hour, and washed once with PBS + 0.05% Tween 20 for 5 minutes. The primary antibody (1:1000 dilution in PBS + 0.05% Tween20) was added to the slide for 1 hour incubation, followed by three washes with PBS + 0.05% Tween20 for 5 minutes each. The secondary antibody (1:1000 dilution in PBS + 0.05% Tween20) was added to the slide for 30 minutes incubation in the dark, followed by three washes with PBS + 0.05% Tween20 for 5 minutes each. The slide was then stained with DAPI (Molecular Probes, Life Technologies #D3571), diluted to 250 ng / mL in PBS for 1 minute, followed by three washes with PBS for 1 minute each. Mounting medium and coverslips were applied to the slide, dried overnight, and contrast-enhanced under a Leica DM5500-DFC365FX microscope at the magnifications described.

[0241] For toxicity and microglial activation studies, extracted and perfused brain tissue was sliced ​​into 40 μm sections in ice-cold PBS using a Leica 2000T Vibratome. Immunohistochemistry was performed on every six sections against DARPP32 (Millipore, 1:10,000 dilution) and IBA-1 (Millipore, 1:500 dilution). Sections were mounted and visualized with a light microscope. Four images were taken at 20x magnification for both the injection and non-injection sites of each striatal section. The number of DARPP32-positive neurons was quantified using ImageJ. Activated microglia were quantified by morphology of cells stained for IBA-1.

[0242] animals, stereotactic injection Wild-type (FVBN) mice received microinjection in a stereotactic position into the right striatum (coordinated (relative to bregma) 1.0 mm anterior, 2.0 mm lateral, and 3.0 mm ventral). The animals were deeply anesthetized with 1.2% abatin prior to injection. For both toxicity (DARPP32) and efficacy studies, mice were injected with PBS or artificial cerebrospinal fluid (2 μL / striatum, N=8 mice), 12.5 μg of NTC hsiRNA (2 μL of 500 μM stock solution / striatum, N=8 mice), 25 μg of HTT10150 hsiRNA (2 μL of 1 mM stock solution / striatum, N=8 mice), 12.5 μg of HTT10150 hsiRNA (2 μL of 500 μM stock solution / striatum, total N=16 mice, 2 sets of 8 mice on 2 different days), 6.3 μg of HTT10150 hsiRNA (2 μL of 250 μM stock solution / striatum, N=8 mice), or 3.1 μg of HTT10150 hsiRNA (2 μL of 125 μM stock solution / striatum, N=8 mice), and sacrificed after 5 days. The brain was removed, and three 300 μm coronal sections were prepared. One 2 mm punch was obtained from each section (injected and non-injected) and placed in RNAlater (Ambion #AM7020) for 24 hours at 4°C. Each punch was processed as an independent sample for QUANTIGENE assay analysis. The whole animal procedure was approved by the University of Massachusetts Medical School Institutional Animal Care and Use Committee (IACUC, protocol number A-2411).

[0243] statistical analysis Data analysis was performed using GraphPad Prism 6 version 6.04 software (GraphPad Software, Inc., San Diego, CA). Concentration-dependent curve IC 50The curves were fitted using log(inhibitor) vs. response-variable slope (4 parameters). The base of the curve was set to greater than 0, and the top of the curve was set to less than 100. For each independent mouse experiment, the knockdown level at each dose was normalized to the mean of the control group (non-injection site) in the PBS or artificial CSF group, so that all data were expressed as a proportion of the control. In vivo data were analyzed for multiple comparisons using the Kruskal-Wallis test (one-way ANOVA) with Bonferroni correction. Differences in all comparisons were considered significant if the P-value was less than 0.05.

[0244] Cell culture for passive uptake (primary screening and dose response) Cells were seeded at a rate of 10,000 cells / well in 96-well tissue culture treatment plates with 6% FBS (Gibco) supplemented DMEM (Gibco). HsiRNA was diluted to 2× final concentration with OptiMEM (Gibco), and 50 μL of the diluted hsiRNA was added to 50 μL of cells with 3% FBS final concentration. Cells were incubated for 72 hours at 37C and 5% CO2.

[0245] Cell culture for lipid-mediated uptake Cells were seeded at a rate of 10,000 cells / well in 6% FBS (Gibco)-containing DMEM (Gibco) in 96-well tissue culture treatment plates. HsiRNA was diluted to 4× final concentration with OptiMEM (Gibco). LIPOFECTAMINE RNAIMAX Transfection Reagent (Invitrogen CAT#13778150) was diluted to 4× final concentration (final = 0.3 μL / 25 μL / well). RNAIMAX and hsiRNA were mixed 1:1, and 50 μL was added to 50 μL of cells for 3% FBS final concentration. Cells were incubated for 72 hours at 37C and 5% CO2.

[0246] mRNA quantification mRNA was quantified using the QUANTIGENE 2.0 assay (Affymetrix QS0011). Cells were lysed in 250 μL of diluted lysate, 1 part lysate, 2 parts H2O, and 0.167 μg / μL proteinase K (Affymetrix QS0103) for 30 minutes at 55°C. The cell lysates were thoroughly mixed, and 40 μL (~8000 cells) of lysate was added to a capture plate with 40 μL of further diluted lysate without proteinase K. Tissues were treated similarly with 5 mg tissue punch using 300 μL of homogenization buffer (Affymetrix) containing 2 μg / μL proteinase K. The tissues were then homogenized in a Qaigen TissueLyzer in a 96-well plate format, and 40 μL was added to the capture plate. The probe set was diluted as specified in the Affymetrix protocol, and 20 μL of HTT or PPIB probe (Affymetrix: SA-50339, SA-10003) was added to each well of the capture plate up to a final volume of 100 μL. The signal was amplified according to the manufacturing protocol. Emission was detected using a Veritas Luminomete or Tecan M 1000.

[0247] Staining of viable cells and immunohistochemical staining of brain sections For monitoring the uptake of viable cells, 2 × 10 cells were placed in a 35 mm glass-bottom dish. 5 Cells were seeded at cell density and allowed to grow overnight. Before contrast imaging, organelles were stained with HBSS (Gibco) using staining reagents purchased from Life Technologies unless otherwise specified: the nucleus, endoplasmic reticulum, and lysosomes were stained using NUCBLUE LIVE READYPROBE, ER-TRACKER Green (Bodipy FL Glibenclamide), and LYSOTRACKER Deep Red reagents, respectively, as directed by the manufacturer. Contrast imaging was performed with unenhanced DMEM without phenol red (Invitrogen). Cells were treated with 0.5 μM Cy3-labeled hsiRNA, and viable cell imaging was performed over time.

[0248] confocal imaging Total confocal images were acquired using a CSU10B Spinning Disk Confocal System scan head (Solamere Technology Group) mounted on a TE~200E2 inverted microscope (Nikon) equipped with a 60x Plan / APO oil lens and a Coolsnap HQ2 camera (Roper). Images were processed using ImageJ (1.47v) software. The number of neurons with and without hsiRNA was counted using ImageJ software. Brain section images were acquired with a 1 μm z-axis spacing.

[0249] Probe verification HTT detection probe sets were validated in neurons. Two types of probe sets (exon-exon-identical hybridization sequences (exons 27-35); and exon-exon-different hybridization sequences (exons 27-35 and exons 60-67)) were used for specificity validation. The majority of detection signals from the probes were shown to be specific to htt-mRNA (data not shown). Two further types of probe sets (exon-intron-different hybridization sequences (exons 27-35 and introns 60-61); and exon-exon-different hybridization sequences (exons 27-35 and exons 60-67)) were used to validate that nuclear signals were not intron-specific. It was observed that intron-specific probes showed almost no overlap in the nucleus specific to the transcription site, while exon-specific probes showed a high degree of overlap.

[0250] Example 5. Complete metabolic stabilization is essential for conjugate-mediated siRNA delivery in vivo. Small interfering RNA (siRNA)-based drugs require chemical modification / formulation to enhance stability, minimize innate immunity, and enable delivery to target tissues. Partially modified siRNA (up to 70% nucleotide modification) has been commonly used in exploring the bioconjugate efficacy of RNAi delivery. The data disclosed herein demonstrate that full modification (100% nucleotide modification) is absolutely essential for systemic conjugate-mediated siRNA delivery. Full modification dramatically improves distribution, potency, and duration of action upon local administration. Tissues, including the liver and kidneys, retain levels of fully modified hydrophobic siRNA (FM-hsiRNA) that are two orders of magnitude higher, supporting robust silencing of the target.

[0251] Screening of a group of small, asymmetric, fully modified variants based on alternating 2'-methoxy, 2'-fluoro pattern skeletons showed that 100% of the test compounds were successfully applied without impairing their silencing efficacy. Therefore, fully modified, asymmetric siRNAs provide a framework for discovering novel chemistry that facilitates siRNA delivery and extends the clinical utility of RNAi.

[0252] This example provides a side-by-side comparison of the effects of fully modified versus conventionally modified siRNA backbone on conjugate-mediated in vivo distribution and potency. Hydrophobic (e.g., cholesterol) modified asymmetric siRNA was used as an example (Figure 29). Cholesterol conjugation to partially modified siRNA resulted in robust cellular uptake in vitro (Khvorova A., SW, Kamens J., Samarsky D., Woolf T., Cardia J. Reduced size self-delivering RNAi compounds. USA patent (2014); Lorenz, C., Hadwiger, P., John, M., Vornlocher, HP & Unverzagt, C. Steroid and lipid conjugates of siRNAs to enhance cellular uptake and gene silencing in liver cells. Bioorg Med Chem Lett 14, 4975-4977, doi:10.1016 / j.bmcl.2004.07.018S0960-894X(04)00908-4 [pii] (2004)), but resulted in strong local silencing in vivo (Byrne, M. et al. Novel hydrophobically modified asymmetric RNAi compounds (sd-rxRNA) demonstrate robust efficacy in the eye. Journal of ocular pharmacology and therapeutics: the official journal of the Association for Ocular Pharmacology and Therapeutics 29, 855-864, doi:10.1089 / jop.2013.0148 (2013)) and exhibit minimal systemic efficacy (Soutschek, J. et al.).Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature 432, 173-178, doi:10.1038 / nature03121 (2004)), therefore represents a good model for evaluating the potential impact of complete siRNA modification on delivery.

[0253] Unmodified RNA is rapidly degraded by a combination of endonucleases and eisonucleases; therefore, both internal and terminal modifications are necessary for stability. While complete chemical modification of siRNA can interfere with RNA-Induced Silencing Complex (RISC) interactions, some configurations have been reported to be compatible with naked compounds, albeit only in a very limited number of sequence configurations (Deleavey, GF et al. The 5' binding MID domain of human Argonaute2 tolerates chemically modified nucleotide analogues. Nucleic acid therapeutics 23, 81-87, doi:10.1089 / nat.2012.0393 (2013); Stokman, G., Qin, Y., Racz, Z., Hamar, P. & Price, LS Application of siRNA in targeting protein expression in kidney disease. Advanced drug delivery reviews 62, 1378-1389, doi:10.1016 / j.addr.2010.07.005 (2010)).

[0254] The inability to cleave the sense strand is one of the limiting factors for fully chemically modified siRNA RISC entry. The use of an asymmetric backbone (15 bases in the sense strand, 20 bases in the guide strand) reduced the double-stranded Tm, thereby facilitating sense dissociation necessary for efficient RISC packing. Furthermore, the presence of a single-stranded, fully phosphorothioate-treated tail enhanced the conjugation-mediated intracellular entry of these types of compounds via a mechanism similar to that of conventional antisense compounds.

[0255] The potency of a group of fully modified hsiRNA variants was evaluated based on patterns reported by the Dagma and Bhat laboratories. Initial screening was performed in the context of recently identified huntingtin-targeting hsiRNAs (lterman et al., 2015, Molecular Therapy, under review). An alternating 2'-fluoro, 2'-methoxy pattern, starting with a chemically phosphorylated 2'-methoxy modification U at the 5' position of the guide strand, was shown to perform best, although several other configurations were nearly functional (Figure 29). It was shown to be crucial to initiate the modification pattern with a chemically phosphorylated 2'-methoxy at one position of the antisense strand. Starting with a pattern similar to 2'-fluoro was shown to have a negative impact on potency, at least in some sequences. While not intended to be bound by scientific theory, this may be related to the 2'-methoxy substitutions at positions 2 and 14 in the guide strand, which are not sufficiently tolerant of heavily modified double strands. Chemical phosphorylation of the guide chain was also determined to be essential because terminal 2'-methoxy U is not a good substrate for intracellular kinases. Furthermore, terminal phosphorothioates were added to both the 3' and 5' ends of the oligonucleotide to provide further exonuclease resistance. Figure 29 shows the optimal configuration structure and PyMOL model compared to conventionally modified hsiRNA.

[0256] This chemical modification pattern was applied to several previously identified functional hsiRN sequences, demonstrating similar or improved efficacy (Figures 29C-29D). Interestingly, the most significant improvement was observed in primary trophoblast cells in suspension, where cholesterol-mediated uptake was prolonged, and therefore the relative effect of further stabilization was more pronounced. Furthermore, this chemical modification pattern was applied to several published sequence-targeting Tie-2 and Sod1 sequences with similar success.

[0257] To generalize whether these phenomena are related to other conjugates, the potency of partially and fully modified GalNac-conjugated siRNAs was tested in primary hepatocytes. Similar, fully metabolized compounds were shown to be significantly more active in hepatocytes than partially modified compounds.

[0258] In general, the introduction of chemical modifications often negatively impacts siRNA potency, and naked, enhanced siRNAs lose potency in a wide range of chemical modification patterns. The type A RNA helix, necessary for efficient recognition by the RISC complex, is supported by C3'-endoribose confirmation and preferentially adapts to 2'-fluoro and 2'-methoxy modifications. Alternating modifications regulate thermodynamic stability essential for efficient RISC entry, which has been previously studied in detail with 2'-FANA and 2'-fluoro hybrids.

[0259] Partial siRNA modification (total pyrimidine) results in a dramatic increase in in vitro stability (from minute-by-minute to day-by-day increases in 50% FBS or human serum), which is similar to the stability increases reported with fully modified siRNA. In vivo, oligonucleotides are distributed within tissues and exposed to an aggressive nuclease environment, conditions that are difficult to mimic in vitro. Therefore, the stability of these modification patterns may be entirely different.

[0260] To evaluate the effect of fully modified hydrophobic siRNA on efficacy and distribution in vivo, partially modified and fully modified Cy3-labeled hsiRNAs were administered intravenously (IV) and subcutaneously (SC) to mice at a dose of 10 mg / kg (Figure 30). After 24 hours, tissue distribution was assessed by fluorescence microscopy, and guide chain tissue accumulation levels were quantitatively measured using HPLC-based separation of a PNA-based assay. The PNA assay is a simple, high-throughput assay that allows for the quantitative assessment of oligonucleotide retention in tissues and was adapted to the described and used assay in the Axon laboratory for clinical sample evaluation.

[0261] Firstly, a dramatic increase in fluorescence retention and distribution to major organs was observed with the fully metabolized stabilized compound (Figure 30A). Fluorescence levels after a single injection of partially modified hsiRNA were minimal and limited mainly to the liver and kidneys, while fully metabolized stabilization resulted in dramatic oligonucleotide accumulation in the liver, kidneys, and spleen, as well as efficient distribution to other tissues, including fat and skin. Accumulation levels with IV and SC administration were comparable and similar (Figures 30B and 30C). Interestingly, FM-hsiRNA preferentially accumulated in endothelial cells and macrophages, and only secondarily in hepatocytes. Therefore, the hydrophobic modified compound differed in distribution from GalNac, which was preferentially delivered to hepatocytes.

[0262] When measured quantitatively, the results were even more striking. Partially modified compounds showed minimal levels of intact guide chains detectable in tissues within 24 hours, while fully modified compounds accumulated at levels up to approximately 200 ng / mg in the liver, kidneys, and spleen (Figures 30B, 30C) and at ng / mg levels in several other tissues. Notably, with FM-hsiRNA, similar levels of intact guide chains were detected 5 days after administration, accounting for nearly 80% of the injected dose (Figure 30). This indicated that fully modified compounds not only reach tissues but are also retained in tissues for extended periods.

[0263] These data are consistent with previously published attempts using hydrophobic modifications (cholesterol, fatty acids, etc.) for systemic delivery of partially modified siRNAs, where repeated administration of high concentrations of the compound, i.e., 50–80 mg / kg, was required to detect any silencing activity.

[0264] Since hepatic and renal accumulation levels exceeded the levels generally required to induce silencing (usually exceeding 10-20 ng / mg), we confirmed whether the observed robust delivery resulted in functional silencing. The hydrophobic modified compound was preferentially delivered to the endothelium, and therefore targeted the soluble isoform of FLT1 (VEGFR1), which is preferentially expressed in the endothelium, using the recently identified hsiRNA compound targeting sFLT1 (Turanov et al, 2015, in preparation for publication).

[0265] The compound was administered to two different mouse strains. In both cases, systemic administration of FM-hsiRNA induced robust silencing of sFTL1 in the liver and kidneys, measured 5 days after administration. In the first study, silencing was compared to PBS-injected animals. In the second study, to control for the possibility of chemistry-related effects, both PBS and a non-targeting control (NTC) with the same chemical composition were used. SFLT1-targeting FM-hsRNA reduced sFTL1 expression, but not the NTC.

[0266] All oligonucleotides were preferentially distributed to the liver, thus demonstrating hepatic efficacy as expected. Furthermore, similar levels of the compound accumulated in the kidney, resulting in efficient silencing. There is limited data in this field regarding renal siRNA delivery (Stokman, G., Qin, Y., Racz, Z., Hamar, P. & Price, LS Application of siRNA in targeting protein expression in kidney disease. Advanced drug delivery reviews 62, 1378-1389, doi:10.1016 / j.addr.2010.07.005 (2010)). Partial modification (alternating 2'-methoxy) was tested for delivery in the renal proximal tubules. Most of the siRNA was removed after 4 hours and was undetectable after 24 hours (Molitoris, BA et al. siRNA Targeted to p53 Attenuates Ischemic and Cisplatin-Induced Acute Kidney Injury. Journal of the American Society of Nephrology: JASN 20, 1754-1764, doi:10.1681 / ASN.2008111204 (2009)).

[0267] Therefore, it was determined that complete modification of siRNA is absolutely essential for systemic delivery and in vivo efficacy. Despite a decade of effort in medicinal chemistry, the liver is currently the only target for unformulated miRNAs with in vivo efficacy. While not intended to be bound by scientific theory, the data presented here should explain this fact in part. The lack of in vivo stabilization must be one of the major factors contributing to the lack of robust efficacy, as the majority of attempts to explore various conjugates (e.g., peptides, antibodies, small molecules, hydrophobic modifications, etc.) have been carried out with partially modified siRNA; the conjugate limits the time available for enhancing uptake. Furthermore, siRNAs described in the literature that show little to no efficacy may exhibit dramatically enhanced efficacy with the use of the scaffold described here.

[0268] While partially modified hydrophobic siRNAs are clearly not systemically active, they can induce robust gene silencing in tissues such as the eye (Byrne (Supra)), skin (Khvorova (Supra)), and brain (Alterman et al, Molecular Therapy, under review) via topical administration in vivo. To evaluate the effect of fully modified siRNA on topical efficacy, conventional and fully modified siRNAs were injected intraventricularly into cerebrospinal fluid (CSF). Similar to systemic administration, the use of fully modified hsiRNAs via CSF infusion dramatically enhanced both the level of oligonucleotide retention in tissues and the extent of distribution across the brain (Figure 31A). With CY3-labeled FM-hsiRNA, the compound distributed to the cortex, striatum, cerebellum, and other brain tissues (Figures 31B-D), with dramatic amounts retained near the injection ventricle. With conventional and partially modified hsiRNAs, small amounts were detected in the periventricular and immediately adjacent tissues, but the overall distribution was limited.

[0269] To investigate the effect of local administration on complete stabilization of in vivo efficacy, the dose-response and duration of effect of two types of compounds administered directly to the brain (intrastriatum) were tested.

[0270] When injected into the striatum, partially modified hsiRNA induced potent silencing at dose levels of 10 μg and above (Figure 31). Silencing abolished at 6 μg and 3 μg. Similar levels of silencing were observed with fully modified hsiRNA at all doses tested (Figure 31F), indicating that the fully modified compound is more potent in vivo when administered topically.

[0271] The differences were even more pronounced when comparing the duration of effect. Partial modification resulted in the disappearance of silencing after two weeks, while fully modified compounds continued to silence the HTT gene for one, two, and four weeks (Figure 31G), indicating a regulatory level that could be considered non-existent. Therefore, locally, complete chemical modification resulted in a dramatic induction of potency and, more importantly, the duration of effect.

[0272] In summary, what is described here is an siRNA skeleton with an alternating 2'-fluoro,2'-methoxy modification pattern applied to an asymmetric structural frame. As described here, this skeleton has been successfully applied to a wide range of previously identified functional siRNA compounds. The chemical modification pattern did not interfere with RISC entry and resulted in fully chemically modified compounds that were recognized by the RISC complex as efficiently as native RNA. The precise effect of this chemistry on RISC cleavage kinetics will be tested using a single-molecule approach. While not intended to be bound by scientific theory, the use of short (e.g., 15 bases) sense strands may facilitate the dissociation of the non-cleavable sense strand required for RISC packing, thus mitigating one of the limiting steps in RISC packing of well-stabilized compounds.

[0273] When administered systemically, fully modified hsiRNA accumulated in most tissues, including the liver, kidneys, spleen, fat, and skin, and silencing was confirmed in the liver and kidneys. The robust efficacy in the kidneys demonstrated here is the first example of conjugate-mediated delivery to this highly clinically relevant organ, opening up options for the development of novel therapies for kidney-related diseases and disorders. Furthermore, full modification dramatically enhanced the potency of hydrophobic modified siRNA in vivo when administered topically to the brain, and, most importantly, enhanced the duration of effect. A single injection induced silencing that lasted at least one month, perhaps the longest, indicating that this chemistry offers the prospect of long-term silencing with a single dose. Surprisingly, with partially modified compounds, silencing lasted only one week. In general, the filled RISC complexes survived for a long time, particularly in non-dividing cells such as neurons. Indeed, in major neuronal cultures, a single treatment induced silencing for at least three weeks. The data presented here indicate that the half-life of the in vivo-filled RISC complex in the brain (at least for the test sequence) is shorter than originally predicted.

[0274] These data suggest that complete chemical modification (i.e., further stabilization) is a major contributor to the in vivo efficacy of conjugate-delivered siRNAs. The data presented here offer the potential for screening simple, fully modified asymmetric siRNA scaffolds for numerous conjugation modalities, potentially leading to significant advances in expanding the clinical use of RNAi beyond the liver.

[0275] Inclusion by citation All references (including literature, patents, patent applications, and websites) that may be cited throughout this specification are expressly incorporated herein for all purposes, insofar as they are cited herein. Unless otherwise noted, this disclosure uses conventional techniques of immunology, molecular biology, and cell biology that are well known in the art.

[0276] This disclosure also incorporates, by reference, well-known techniques in the fields of molecular biology and drug delivery. These techniques include, but are not limited to, those described in the following publications. Atwell et al. J. Mol. Biol. 1997, 270: 26-35; Ausubel et al. (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley &Sons, NY (1993); Ausubel, FM et al. eds., SHORT PROTOCOLS IN MOLECULAR BIOLOGY (4th Ed. 1999) John Wiley & Sons, NY. (ISBN 0-471-32938-X); CONTROLLED DRUG BIOAVAILABILITY, DRUG PRODUCT DESIGN AND PERFORMANCE, Smolen and Ball (eds.), Wiley, New York (1984); Giege, R. and Ducruix, A. Barrett, CRYSTALLIZATION OF NUCLEIC ACIDS AND PROTEINS, a Practical Approach, 2nd ea., pp. 20 1-16, Oxford University Press, New York, New York, (1999); Goodson, in MEDICAL APPLICATIONS OF CONTROLLED RELEASE, vol. 2, pp. 115-138 (1984); Hammerling, et al., in: MONOCLONAL ANTIBODIES AND T-CELL HYBRIDOMAS 563-681 (Elsevier, NY, 1981; Harlow et al. , ANTIBODIES: A LABORATORY MANUAL, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Kabat et al., SEQUENCES OF PROTEINS OF IMMUNOLOGICAL INTEREST (National Institutes of Health, Bethesda, Md. (1987) and (1991); Kabat, E.A., et al. (1991) SEQUENCES OF PROTEINS OF IMMUNOLOGICAL INTEREST, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242; Kontermann and Dubel eds., ANTIBODY ENGINEERING (2001) Springer-Verlag. New York. 790 pp. (ISBN 3-540-41354-5). Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); Lu and Weiner eds., CLONING AND EXPRESSION VECTORS FOR GENE FUNCTION ANALYSIS (2001) BioTechniques Press. Westborough, MA. 298 pp. (ISBN 1-881299-21-X). MEDICAL APPLICATIONS OF CONTROLLED RELEASE, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Old, RW & SB Primrose, PRINCIPLES OF GENE MANIPULATION: AN INTRODUCTION TO GENETIC ENGINEERING (3d Ed. 1985) Blackwell Scientific Publications, Boston. Studies in Microbiology; V.2:409 pp. (ISBN 0-632-01318-4). Sambrook, J. et al. eds., MOLECULAR CLONING: A LABORATORY MANUAL (2d Ed. 1989) Cold Spring Harbor Laboratory Press, NY. Vols. 1-3. (ISBN 0-87969-309-6). SUSTAINED AND CONTROLLED RELEASE DRUG DELIVERY SYSTEMS, JR Robinson, ed., Marcel Dekker, Inc., New York, 1978 Winnacker, EL FROM GENES TO CLONES: INTRODUCTION TO GENE TECHNOLOGY (1987) VCH Publishers, NY (translated by Horst Ibelgaufts). 634 pp. (ISBN 0-89573-614-4) This disclosure provides, for example, the following: [Section 1] An oligonucleotide comprising at least 16 consecutive nucleotides, having complementarity to the 5' end, 3' end and target, where, (1) The oligonucleotides consist of alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) The nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxyribonucleotides; (3) Nucleotides are linked by phosphodiester bonds or phosphorothioate bonds; and (4) Nucleotides at positions 1-6 from the 3' end or positions 1-7 from the 3' end are bound to adjacent nucleotides by phosphorothioate bonds. Oligonucleotides. [Section 2] The oligonucleotide described in item 1, which is fully complementary to the target. [Section 3] Oligonucleotides as described in item 1 or 2, wherein the target is mammalian or viral mRNA. [Section 4] The oligonucleotide according to item 3, wherein the target is the intron region of the mRNA. [Section 5] A double-stranded, chemically modified nucleic acid comprising a first oligonucleotide and a second oligonucleotide, wherein the first oligonucleotide is the oligonucleotide described in item 1, (1) A portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (2) The second oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (3) The nucleotides at the 2nd and 14th positions from the 3' end of the second oligonucleotide are 2'-methoxyribonucleotides; and (4) The nucleotide of the second oligonucleotide is linked by a phosphodiester or phosphorothioate bond. Nucleic acid. [Section 6] The nucleic acid described in item 5, wherein a second oligonucleotide is bound to the hydrophobic molecule at the 3' end of the second oligonucleotide. [Section 7] The nucleic acid according to item 6, wherein the bond between the second oligonucleotide and the hydrophobic molecule contains polyethylene glycol. [Section 8] The nucleic acid according to item 7, wherein the bond between the second oligonucleotide and the hydrophobic molecule contains triethylene glycol. [Section 9] The nucleic acid described in item 5, wherein the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide are linked to adjacent nucleotides by phosphorothioate bonds. [Section 10] The nucleic acid according to item 5, wherein the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide and the nucleotides at positions 1 and 2 from the 5' end of the second oligonucleotide are linked to adjacent ribonucleotides by phosphorothioate bonds. [Section 11] Compound (Ia): [C1] JPEG0007881194000012.jpg11113 [In the formula, X is [C2] Selected from the group consisting of JPEG0007881194000013.jpg239118; A is independently a 2'-methoxy-ribonucleotide; B is independently a 2'-fluororibonucleotide; Each K is independently a phosphodiester or phosphorothioate linker; S is a phosphorothioate linker; R is independently selected from hydrogen and capping groups; j is 4, 5, 6, or 7; r is either 2 or 3; t is either 0 or 1. An oligonucleotide having the structure. [Section 12] Compound (Ib) [C3] JPEG0007881194000014.jpg16168 [In the formula, P is a phosphodiester linker; m is either 0 or 1; n is 4, 5, or 6; q is either 0 or 1; r is either 2 or 3; t is either 0 or 1. An oligonucleotide according to item 11, having the structure described above. [Section 13] m is 1; n is 5; q is 1; r is 2; t is 1, Oligonucleotides as described in item 12. [Section 14] m is 0; n is 6 q is 1; r is 2; t is 1, Oligonucleotides as described in item 12. [Section 15] m is 1; n is 5 q is 0; r is 3; t is 1, Oligonucleotides as described in item 12. [Section 16] A double-stranded, chemically modified nucleic acid comprising a first oligonucleotide and a second oligonucleotide, wherein, (1) The first oligonucleotide is selected from the oligonucleotides listed in any of items 12 to 15; (2) A portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; and (3) The second nucleotide is compound (IIa) [C4] JPEG0007881194000015.jpg13167 [In the formula, C is a hydrophobic molecule; A is independently a 2'-methoxy-ribonucleotide; B is independently a 2'-fluororibonucleotide; L is a linker containing ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphodiesters, phosphorothioates, phosphoramidates, amides, carbamates, or combinations thereof; S is a phosphorothioate linker; P is a phosphodiester linker; R, each independently, is either a hydrogen atom or a capping group; m' is either 0 or 1; n' is 4, 5, or 6; q' is either 0 or 1; r' is either 0 or 1; t' is either 0 or 1. Having a structure Nucleic acid. [Section 17] The nucleic acid described in item 16, wherein the hydrophobic molecule is cholesterol. [Section 18] The nucleic acid according to item 16, wherein the first oligonucleotide has 3 to 7 more ribonucleotides than the second oligonucleotide. [Section 19] Structure of the first oligonucleotide: X(-SBSA)(-PBPA)5(-PBSA)(-SBSA)2(-SB)-OR Having; The structure of the second oligonucleotide: CLB(-SASB)(-PAPB)5(-SA)(-SB)-OR Having; Nucleic acids are compounds (IIIa) [5] JPEG0007881194000016.jpg37165 [In the formula, each | represents a hydrogen bond interaction.] The nucleic acid described in item 16, having the structure. [Section 20] The first oligonucleotide contains the sequence 5' UAAAUUUGGAGAUCCGAGAG 3'; The second oligonucleotide contains the sequence 3' AUUUAAACCUCUAGG 5'; X is X3; C is cholesterol. Nucleic acids as described in item 19. [Section 21] The first oligonucleotide contains the sequence 5' UAUAAAUGGUAGCUAUGAUG 3'; The second oligonucleotide contains the sequence 3' AUAUUUACCAUCGAU 5'; X is X3; C is cholesterol. Nucleic acids as described in item 19. [Section 22] The first oligonucleotide contains the sequence 5' UUAAUCUCUUUACUGAUAUA 3'; The second oligonucleotide contains the sequence 3' AAUUAGAGAAAUGAC 5'; X is X3; C is cholesterol. Nucleic acids as described in item 19. [Section 23] First oligonucleotide structure: X(-PBPA)6(-PBSA)(-SBSA)2(-SB)-OR Having; The structure of the second oligonucleotide: CLB(-SASB)(-PAPB)6-OR Having; Nucleic acids are compounds (IIIb): [6] JPEG0007881194000017.jpg35165 [In the formula, each l represents a hydrogen bond interaction.] The nucleic acid described in item 16, having the structure. [Section 24] The first oligonucleotide contains the sequence 5' UAAAUUUGGAGAUCCGAGAG 3'; The second oligonucleotide contains the sequence 3' AUUUAAACCUCUAGG 5'; X is X3; C is cholesterol. Nucleic acids as described in item 23. [Section 25] The first oligonucleotide contains the sequence 5' UAUAAAUGGUAGCUAUGAUG 3'; The second oligonucleotide contains the sequence 3' AUAUUUACCAUCGAU 5'; X is X3; C is cholesterol. Nucleic acids as described in item 23. [Section 26] The first oligonucleotide contains the sequence 5' UUAAUCUCUUUACUGAUAUA 3'; The second oligonucleotide contains the sequence 3' AAUUAGAGAAAUGAC 5'; X is X3; C is cholesterol. Nucleic acids as described in item 23. [Section 27] Structure of the first oligonucleotide: X(-SBSA)(-PBPA)5(-SBSA)3(-SB)-OR Having; The structure of the second oligonucleotide: CLB(-SASB)(-PAPB)5(-SASB)-OR Having; Nucleic acid is given by formula (IIIc): [7] JPEG0007881194000018.jpg37165 [In the formula, each l represents a hydrogen bond interaction.] The nucleic acid described in item 16, having the structure. [Section 28] The first oligonucleotide contains the sequence 5' UUAAUCUCUUUACUGAUAUA 3'; The second oligonucleotide contains the sequence 3' AAUUAGAGAAAUGAC 5'; X is X3; C is cholesterol. Nucleic acids as described in item 27. [Section 29] A pharmaceutical composition comprising one or more double-stranded, chemically modified nucleic acids and a pharmaceutically acceptable carrier as described in any of items 5 to 10 and 16 to 28. [Section 30] The pharmaceutical composition according to claim 29, comprising the first nucleic acid of compound (IIIa) (wherein the first oligonucleotide comprises the sequence 5' UAAAUUUGGAGAUCCGAGAG 3'; the second oligonucleotide comprises the sequence 3' AUUUAAACCUCUAGG 5'; X is X3; and C is cholesterol); and the second nucleic acid of compound (IIIa) (wherein the first oligonucleotide comprises the sequence 5' UAUAAAUGGUAGCUAUGAUG 3'; the second oligonucleotide comprises the sequence 3' AUAUUUACCAUCGAU 5'; X is X3; and C is cholesterol). [Section 31] A method for treating or managing a disease or disorder, comprising administering a therapeutically effective amount of the pharmaceutical composition described in item 29 to a subject in need of such treatment or management. [Section 32] A method for treating or managing a disease or disorder, comprising administering a therapeutically effective amount of the pharmaceutical composition described in item 30 to a subject in need of such treatment or management.

Claims

1. A double-stranded nucleic acid comprising an 11-16 base pair double-stranded region, an antisense strand, and a sense strand, wherein the antisense strand comprises an oligonucleotide having a 5' end, a 3' end, and complementarity to a target mRNA molecule, wherein the antisense strand has 3-7 more ribonucleotides than the sense strand, the length of the antisense strand is 19, 20, 21, 22, 23, or 24 nucleotides, and the length of the sense strand is 15, 16, 17, 18, 19, 20, or 21 nucleotides, and complementarity to the antisense strand: (1) The oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) The nucleotides at the 2 and 14 positions from the 5' end of the oligonucleotide are 2'-fluororibonucleotides; (3) The nucleotides are linked to each other by phosphodiester bonds or phosphorothioate bonds; (4) The nucleotides at positions 1-6 from the 3' end of the oligonucleotide or at positions 1-7 from the 3' end of the oligonucleotide are linked to each other by phosphorothioate bonds; and (5) The oligonucleotide contains a 6-17 phosphorothioate bond, Double-stranded nucleic acid.

2. The oligonucleotide has a chemical structure represented by formula (Ia) in the 5' to 3' direction: X(-K-B-K-A) j (-S-B-S-A) r -OR (Ia) In the formula, X is 【Chemistry 1】 , and; A is independently a 2'-methoxyribonucleotide; Each of B is independently a 2'-fluororibonucleotide; Each K is independently either a phosphodiester bond or a phosphorothioate bond; Each S is a phosphorothioate bond; R is a capping group; j is an integer selected from 4, 5, 6, or 7; and r is an integer selected from 2 and 3. The double-stranded nucleic acid according to claim 1.

3. X, 【Chemistry 2】 The double-stranded nucleic acid according to claim 2.

4. The double-stranded nucleic acid according to claim 2, wherein j is 7.

5. The double-stranded nucleic acid according to claim 2, wherein r is 3.

6. The aforementioned oligonucleotide is oriented from 5' to 3' in the direction of formula X(-K-B-K-A). 7 (-S-B-S-A) 3 It has a chemical structure represented by -OR, and X is 【Transformation 3】 The double-stranded nucleic acid according to claim 2.

7. The double-stranded nucleic acid according to claim 1, wherein the target mRNA corresponds to a portion of the mutant huntingtin allele.

8. The double-stranded nucleic acid according to claim 1, wherein the double-stranded nucleic acid is a double-stranded small interfering RNA (siRNA) molecule.

9. A double-stranded siRNA molecule comprising an 11-16 base pair double-stranded region, a 5-8 base fully phosphorothioated single-stranded tail, an antisense strand, and a sense strand, wherein the antisense strand comprises an oligonucleotide having a 5' end, a 3' end, and complementarity to a target mRNA molecule, the length of the antisense strand being 16-30 nucleotides, and the length of the sense strand being 15, 16, 17, 18, 19, 20, or 21 nucleotides: (1) The sense chain is complementary to the antisense chain; (2) The nucleotides at the 2 and 14 positions from the 5' end of the oligonucleotide are 2'-fluororibonucleotides; (3) The nucleotides are linked to each other by phosphodiester bonds or phosphorothioate bonds; (4) The nucleotides at positions 1-6 from the 3' end of the oligonucleotide or at positions 1-7 from the 3' end of the oligonucleotide are linked to each other by phosphorothioate bonds; (5) The oligonucleotide comprises a 6-17 phosphorothioate bond; and (6) The oligonucleotide has a chemical structure represented by formula (Ia) in the 5' to 3' direction: X(-K-B-K-A) j (-S-B-S-A) r -OR (Ia) Here, X is 【Chemistry 4】 And; A is independently a 2'-methoxyribonucleotide; Each of B is independently a 2'-fluororibonucleotide; Each K is independently either a phosphodiester bond or a phosphorothioate bond; Each S is a phosphorothioate bond; R is a capping group; j is an integer selected from 4, 5, 6, or 7; and r is an integer selected from 2 and 3. Double-stranded siRNA molecule.

10. X 【Transformation 5】 The double-stranded siRNA molecule according to claim 9, wherein j is 7 and r is 3.

11. The double-stranded siRNA molecule according to claim 9, wherein the antisense strand has a length of 19, 20, 21, 22, or 23 nucleotides.

12. The double-stranded siRNA molecule according to claim 9, wherein the sense strand has a length of 16, 17, 18, 19, 20, or 21 nucleotides.

Citation Information

Patent Citations

  • Reduced size self-delivery RNAi compounds

    JP2012502657A

  • Compositions comprising alternating 2'-modified nucleosides for use in gene modulation

    WO2004044136A2

  • PCSK9 iRNA COMPOSITIONS AND METHODS OF USE THEREOF

    WO2014089313A1