Nucleic acid molecules for targeting the CYP4V2 gene and for treating crystallin retinopathy

Cellular models using iPS cells with CYP4V2 mutations address the lack of treatments for Bietti's Crystalline Dystrophy by enabling drug screening and dosage optimization, offering hope for effective therapies.

JP7895639B2Inactive Publication Date: 2026-07-28REFLECTION BIOTECH LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2024025982
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2017-07-31
Filing Date
2024-02-22
Publication Date
2026-07-28
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

There are currently no approved treatments for Bietti's Crystalline Dystrophy (BCD), a rare autosomal recessive retinal dystrophy leading to progressive degeneration of the retinal pigment epithelium and eventual blindness, with CYP4V2 gene mutations being a primary cause.

Method used

Development of cellular disease models using induced pluripotent stem cells (iPS cells) with CYP4V2 mutations to mimic BCD, allowing for the study of disease mechanisms and potential therapeutic interventions.

Benefits of technology

Enables the creation of accurate disease models for BCD, facilitating the screening of drugs and dosage optimization, and potentially leading to life-changing treatments for patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007895639000055
    Figure 0007895639000055
  • Figure 0007895639000056
    Figure 0007895639000056
  • Figure 0007895639000057
    Figure 0007895639000057
Patent Text Reader

Abstract

To provide a nucleic acid molecule, and the like for targeting CYP4 V2 gene.SOLUTION: There are provided in the present disclosure: a nucleic acid molecule (e.g., sgRNA or gRNA molecule) for targeting CYP4 V2 gene encoding cytochrome P450, family 4, subfamily V, polypeptide 2 protein; and a donor nucleic acid molecule specific for CYP4 V2 gene. Additionally, there are provided the uses thereof for targeting, disrupting human CYP4 V2 gene, and / or correcting mutations (e.g., c.802-8_810del17insGC mutation) and for treating Bietti's crystalline retinopathy (BCD).SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - References to Related Applications This application claims the benefit of priority of U.S. Patent Application No. 62 / 539,473, filed on July 31, 2017, entitled "CELLULAR MODELS OF AND THERAPIES FOR OCULAR DISEASES", under 35 U.S.C. § 119(e). The entire disclosure of the above - mentioned application is hereby incorporated by reference into this specification.

Background Art

[0002] Bietti's Crystalline Dystrophy (BCD) Bietti's Crystalline Dystrophy (BCD, also known as Bietti Crystalline Corneoretinal Dystrophy, Bietti Crystalline Retinopathy, Bietti's Retinal Dystrophy (OMIM 210370)) is a rare autosomal recessive and blinding retinal dystrophy characterized by atrophy of the retinal pigment epithelium (RPE), pigment clumps, and choroid sclerosis, with numerous small, shiny, yellow - white crystalline - like deposits in the posterior pole of the retina. This disease was first identified in 1937 by Dr. G.B. Bietti. From fundus photographs and SD - OCT images of BCD patients, it has been shown that the crystalline deposits are mainly located on the retinal side of the retinal pigment epithelium (RPE) (H. Kojima, A. Otani, K. Ogino et al., "Outer retinal circular structures in patients with Bietti crystalline retinopathy," British Journal (of Ophthalmology, vol. 96, pp. 390-393, 2012). Crystal deposits on the corneal margin are associated with BCD patients. It is estimated to occur in one-quarter to one-third of those affected (Kaiser-Kupfer et al. Clinical biochemical and pathologic correlations in Bietti's crystalline dystrophy, Am J). Ophthalmol., 1994, 118:569-82). In some cases, crystalline deposition of the lens is also observed (Chung et al., J Ophthalmol. 57:447-450, 2013). In the advanced stage, BCD patients present with severe choroidal sclerosis, decreased or absent crystalline deposits, and weakened retinal blood vessels (Wada et al. Am J Ophthalmol 2005; 139:894-9). Abnormal ERG and thinning of the retina are also observed in BCD. .

[0003] Clinically, BCD is progressive and associated with dystrophy and degeneration of RPE. Marked asymmetry between the eyes in the same patient is common. The age of onset and progression of the disease varies among BCD patients, even within the same family. Most patients develop night blindness, narrowed field of vision, color vision deficiency, macular degeneration, and decreased visual acuity between their teens and thirties, progressing to legal blindness between their twenties and fifties.

[0004] The retinal pigment epithelium (RPE), located between the choroidal capillaries and the photosensitive outer segments of photoreceptor cells, is a monolayer of pigment cells that closely interacts with photoreceptor cells (cone and rod cells) in maintaining visual function. The RPE's important functions include nourishing the cells and removing waste products from the photoreceptor cells, which constitute the sensory retina. Other functions of the RPE include, but are not limited to, light absorption, epithelial transport, buffering of ions in space, the visual cycle, phagocytosis, secretion, and immunomodulation (Strauss, 2005, The retinal pigment epithelium in visual function. Physiol Rev 85:845-81). Therefore, RPE dysfunction and degeneration affect the function of photoreceptor cells. It causes impaired function and degeneration, leading to vision loss. Given that BCD is associated with the progressive dystrophy and degeneration of RPE, RPE is important for both the research and treatment of BCD.

[0005] BCD is a rare disease. According to one source, the BCD incidence rate was estimated at 1:67,000 (ghr.nlm.nih.gov / condition / bietti-crystalline-dystrophy#statistics, World Wide Web). Another source estimated the prevalence of BCD to be 2.5% of all RP patients (3 BCD patients out of 121 RP patients, see Mataftsi et al., Retina. 24:416-426, 2004). Based on this estimate, if the RP incidence rate is 1:4000 (Hartong et al., Lancet. 368:1795-1809, 2006), the BCD incidence rate is estimated to be 1:160,000. Because the symptoms of cerebrospinal cord disease (BCD) are similar to those of other eye diseases that progressively damage the retina, it is sometimes commonly misdiagnosed as retinitis pigmentosa (RP) (Mataftsi Aet al. Bietti's crystalline corneoretinal dystrophy: a cross-sectional study. Retina. 2004; 24: 416-426). Patients with BCD have been reported in various parts of the world, including Asia, Africa, Europe, the Middle East, North America, and South America, but BCD has been reported to be more common in people of East Asian descent, particularly Chinese and Japanese (Hu 1983, Ophthalmic genetics in China. Ophthal Paed Genet 2:39-45; Li et al., Am J Hum Genet. 2004 May; 74(5): 817-826).

[0006] Currently, there are no approved treatments for BCD, and patients ultimately go blind. There is a strong unmet medical need to develop life-changing treatment options for patients suffering from this rare disease.

[0007] CYP4V2 CYP4V2 (cytochrome P450, family 4, subfamily V, polypeptide 2, (OMIM 608614), synonym: CYP4AH1) is one of the proteins in the cytochrome P450 superfamily and a member of hemethiolate cytochrome P450 subfamily 4 (CYP4). Cytochrome P450 (CYP) are important heme-containing proteins known for their role in monooxygenase reactions. They are involved in the metabolism of xenobiotics and endogenous compounds such as steroids and fatty acids. Human CYPs are membrane-associated proteins mainly located in the inner mitochondrial membrane or the endoplasmic reticulum of cells. P450 proteins are identifiable by the characteristic sequence element FxxGxxxCxG (sequence ID 30), where the underlined cysteine ​​functions as an axial ligand for heme iron. Another characteristic sequence element of P450 proteins is ExxR (sequence ID 31). The Human Genome Project identifies 57 human P450 genes. For reference, there are 103 mouse P450 genes and 89 rat P450 genes (Guengerich & Cheng, Pharmacological Reviews, September 2011, 63(3) 684-699).

[0008] The human CYP4 family consists of 12 genes and 10 pseudogenes. The human CYP4V2 gene (HGNC:23198) is located at 4q35 and has 11 exons. Mutations in the CYP4V2 gene cause BCD (Li et al., Am J Hum Genet. 74:817-826, 2004). CYP4V2 is expressed in almost all tissues, but in tissues showing the main clinical findings of BCD, it is expressed at high levels in the retina and RPE, and at slightly lower levels in the cornea (Li et al., Am J Hum Genet. 74:817-826, 2004; Nakano M, Kelly EJ, Rettie AE: Expression and Characterization of CYP4V2 as a Fatty Acid omega-Hydroxylase. Drug Metab Dispos 2009; Nakano M, Kelly EJ, Wiek C, Hanenberg H, Rettie AE: CYP4V2 in Bietti's crystalline dystrophy: ocular localization, metabolism of omega-3-polyunsaturated fatty acids, and functional deficit of the p.H331P variant. Mol Pharmacol 2012; 82: 679-686).

[0009] CYP4V2 is a relatively new member of the P450 family, and because BCD is a rare disease, the function of CYP4V2 has not been widely studied. Previous studies have shown that the CYP4V2 protein is primarily active in fatty acid metabolism. Abnormalities in fatty acids and their metabolism have been shown in serum, lymphocytes, and cutaneous fibroblasts from BCD patients (Lee J, Jiao X, Hejtmancik JF et al: The metabolism of fatty acids in human Bietti crystalline dystrophy. Invest Ophthalmol Vis Sci 2001; 42: 1707-1714; Lai T, Chu KO, Chan KP et al: Alterations in serum fatty acid concentrations and desaturase activities in Bietti crystalline dystrophy unaffected by CYP4V2 genotypes. Invest Ophthalmol Vis Sci 2010; 51: 1092-1097). Another study showed that CYP4V2 is an omega-3 polyunsaturated fatty acid (PUFA) hydroxylase and is P450, which is highly expressed in transformed human RPE cell line ARPE-19 (Nakano M, Kelly EJ, Wiek C, Hanenberg H, Rettie AE: CYP4V2 in Bietti's crystalline dystrophy: ocular localization, metabolism of omega-3-polyunsaturated fatty acids, and functional deficit of the p.H331P variant. Molecular pharmacology 2012; 82: 679-686).

[0010] The CYP4V2 gene has been identified with numerous mutations that cause BCD, with at least one mutation in each of its 11 exons. The most common CYP4V2 mutation in BCD patients is c.802-8_810del17insGC (referring to a 17-base deletion and a 2-base (GC) insertion at a site beginning 8 bases from the end of intron 6 of the CYP4V2 gene, also known as IVS6-8 del / insGC. See Sequence ID 46, which shows the sequence of the human CYP4V2 genomic DNA region containing the c.802-8_810del17insGC mutation, and Sequence ID 47, which shows the corresponding wild-type sequence. The c.802-8_810del17insGC mutation is shown in the following sequence representing the human CYP4V2 intron 6-exon 7 junction. The intron 6 sequence is shown in lowercase, and the exon 7 sequence in uppercase. The 17bp deletion and GC insertion are shown in parentheses): caa aca gaa gca tgt gat tat cat tca aa(tca tac agG TCA TCG CT)(GC) GAA CGG GCC AAT GAA ATG AAC GCC AAT GA (SEQ ID NO: 46). This causes exon 7 skipping. (Xiao et al., Biochem Biophys Res Commun. 409:181-6, 2011, Meng et al., 2014, Mol. Vis., 20:1806-14, Wada et al., Am J Ophthalmol. 139:894-9, 2005, Jiao et al., European Journal of Human Genetics (2017) 25, 461-471). Recent studies have estimated the age of the c.802-8_810del17insGC mutation to be 1,040-8,200 generations in Chinese and 300-1,100 generations in Japanese. See Jiao et al., European Journal of Human Genetics (2017) 25, 461-471.

[0011] Various types of CYP4V2 mutations have been found in association with BCD, including total deletions and missenses, replications, splice sites, frameshifts, deletions, insertions, indels (insertions and deletions), nonsenses, polymorphisms (e.g., single nucleotide polymorphisms), and premature termination of the CYP4V2 gene. A summary of selected CYP4V2 mutations among human BCD patients is shown in Table 1 of this specification, which can be found in various publications and online databases, such as LOVD (databases.lovd.nl / shared / genes / CYP4V2, see World Wide Web), OMIM (omim.org / allelicVariant / 608614, see World Wide Web), and ClinVar (ncbi.nlm.nih.gov / clinvar?term=608614[MIM], see World Wide Web).

[0012] [Table 1A]

[0013] [Table 1B]

[0014] [Table 1C]

[0015] This is merely a selected list and may not include all pathogenic CYP4V2 mutations / variants identified and reported in BCD patients to date. Mutations are compared to the reference sequences (NM_207352.3) and (NP_997235.3). New CYP4V2 pathogenic mutations in BCD patients are continuously being identified. All previously identified and future identified pathogenic CYP4V2 mutations / variants associated with BCD are incorporated herein by reference.

[0016] Inherited Retinal Degeneration (IRD) Hereditary retinal degeneration (IRD) is a leading cause of blindness. Currently, more than 200 genes are known to be involved in IRD and related diseases. Retinitis pigmentosa (RP) is the major human IRD. There are three common patterns of inheritance for RP (autosomal dominant, autosomal recessive, and X-linked). The global incidence of RP is estimated at 1 in 4000 people, and autosomal recessive RP accounts for 50% to 60% of RP cases (Hartong DT, Berson EL, Dryja TP. Retinitis pigmentosa. Lancet. 2006;368:1795-809). European studies estimate the prevalence of BCD to be 2.5% of all RP patients and about 10% of those with non-syndromic autosomal recessive RP (Mataftsi A, Zografos L, Milla E, Secretan M, Munier FL. Bietti's crystalline corneoretinal dystrophy: a cross-sectional study. Retina. 2004;24:416-26). The same study also points out that BCD is often commonly diagnosed as RP. Therefore, BCD may have been underdiagnosed. BCD is a global disease, but it is most common in East Asia, particularly among Chinese and Japanese people (Li et al., Am J Hum Genet. 2004 May; 74(5): 817-826).

[0017] Reference for the mutations in Table 1: Li A, Jiao X, Munier FL, Schorderet DF, Yao W, et al. (2004) Bietti crystalline corneoretinal dystrophy is caused by mutations in the novel gene CYP4V2. Am J Hum Genet 74: 817-826. Xiao X, Mai G, Li S, Guo X, Zhang Q(2011) Identification of CYP4V2 mutation in 21 families and overview of mutation spectrum in Bietti crystalline corneoretinal dystrophy. Biochem Biophys Res Commun 409: 181-186。 Shan M, Dong B, Zhao X, Wang J, Li G, et al.(2005) Novel mutations in the CYP4V2 gene associated with Bietti crystalline corneoretinal dystrophy. Mol Vis 11: 738-743。 Rossi S, Testa F, Li A, Yaylacioglu F, Gesualdo C, et al.(2013) Clinical and genetic features in Italian Bietti crystalline dystrophy patients. Br J Ophthalmol 97: 174-179。 Lin J, Nishiguchi KM, Nakamura M, Dryja TP, Berson EL, et al.(2005) Recessive mutations in the CYP4V2 gene in East Asian and Middle Eastern patients with Bietti crystalline corneoretinal dystrophy. J Med Genet 42: e38。 Manzouri B, Sergouniotis PI, Robson AG, Webster AR, Moore A(2012) Bietti crystalline retinopathy: report of retinal crystal deposition in male adolescent offspring. ARCH OPTHALMOL 130:1470–1473. Lai TY, Ng TK, Tam PO, Yam GH, Ngai JW, et al.(2007) Genotype phenotype analysis of Bietti's crystalline dystrophy in patients with CYP4V2 mutations. Invest Ophthalmol Vis Sci 48:5212–5220. Parravano M, Sciamanna M, Giorno P, Boninfante A, Varano M(2012) Bietti crystalline dystrophy: a morpho-functional evaluation. Doc Ophthalmol 124:73–77. [ PMC free article ] [ PubMed ] [ Cross Ref ] Wada Y, Itabashi T, Sato H, Kawamura M, Tada A, et al. Am J Ophthalmol 139:894–899. Zenteno JC, Ayala-Ramirez R, Graue-Wiechers F(2008) Novel CYP4V2 gene mutation in a Mexican patient with Bietti's crystalline corneoretinal dystrophy. Curr Eye Res 33:313–318. Lee KY, Koh AH, Aung T, Yong VH, Yeung K, et al.(2005) Characterization of Bietti crystalline dystrophy patients with CYP4V2 mutations. Invest Ophthalmol Vis Sci 46: 3812-3816。 Yokoi Y, Sato K, Aoyagi H, Takahashi Y, Yamagami M, et al.(2011) A Novel Compound Heterozygous Mutation in the CYP4V2 Gene in a Japanese Patient with Bietti’s Crystalline Corneoretinal Dystrophy. Case Rep Ophthalmol 2: 296-301。 Haddad NM, Waked N, Bejjani R, Khoueir Z, Chouery E, et al.(2012) Clinical and molecular findings in three Lebanese families with Bietti crystalline dystrophy: report on a novel mutation. Mol Vis 18: 1182-1188。 Fu Q, Wang F, Wang H, Xu F, Zaneveld JE, et al.(2013) Next-generation sequencing-based molecular diagnosis of a Chinese patient cohort with autosomal recessive retinitis pigmentosa. Invest Ophthalmol Vis Sci 54: 4158-4166。 Song Y, Mo G, Yin G(2013) A novel mutation in the CYP4V2 gene in a Chinese patient with Bietti’s crystalline dystrophy. Int Ophthalmol 33: 269-276。 Jin ZB, Ito S, Saito Y, Inoue Y, Yanagi Y, et al.(2006) Clinical and molecular findings in three Japanese patients with crystalline retinopathy. Jpn J Ophthalmol 50: 426-431。 Halford S, Liew G, Mackay DS, Sergouniotis PI, Holt R, Broadgate S, Volpi EV, Ocaka L, Robson AG, Holder GE, Moore AT, Michaelides M, Webster AR. Detailed phenotypic and genotypic characterization of bietti crystalline dystrophy. Ophthalmology. 2014; 121:1174-84。 Houfa Yin, Chongfei Jin, Xiaoyun Fang, Qi Miao, Yingying Zhao,Zhiqing Chen, Zhaoan Su, Panpan Ye, Yao Wang and Jinfu Yin, Molecular Analysis and Phenotypic Study in 14 Chinese Families With Bietti Crystalline Dystrophy. PLoS One 9(4), e94960. 2014 Apr 16。 Identification of novel CYP4V2 gene mutations in 92 Chinese families with Bietti's crystalline corneoretinal dystrophy, Molecular Vision(2014); 20:1806-1814. Galuh DN Astuti, Vincent Sun, Miriam Bauwens, Ditta Zobor, Bart P Leroy, Amer Omar, Bernhard Jurklies, Irma Lopez, Huanan Ren, Volkan Yazar, Christian Hamel, Ulrich Kellner, Bernd Wissinger, Susanne Kohl, Elfride De Baere, Rob WJ Collin, and Robert K Koenekoop Pathogenesis of CYP4V2-associated Bietti's retinal dystrophy, Mol Genet Genomic Med. 2015 January; 3(1): 14-2 Xiaodong Jiao, Anren Li, Zi-Bing Jin, Xinjing Wang, Alessandro Iannaccone, Elias I Traboulsi, Michael B Gorin, Francesca Simonelli and J Fielding Hejtmancik, Identification and Population History of CYP4V2 mutations in Patients with Bietti Crystalline Corneoretinal Dystrophy, European Journal of Human Genetics(2017) 25, 461-471. [Overview of the project]

[0018] Claims related to cell systems Claims relating to cell lines and disease models Cell-based composition In one embodiment, a cellular disease model including a cell line is provided. Such a disease model includes (a) stem cells provided from a subject, or stem cells reprogrammed from cells provided from a subject, or (2) cells derived from stem cells provided from a subject, or cells derived from stem cells reprogrammed from cells provided from a subject, each containing one or more mutations in a target gene.

[0019] In some embodiments, the stem cells are induced pluripotent stem (iPS) cells. In some embodiments, the stem cells are embryonic stem (ES) cells, somatic (or adult) stem cells, or mesenchymal stem cells (MSCs). In some embodiments, the cells provided from the subject are of any cell type and / or any tissue of the subject. In some embodiments, the cells provided from the subject are skin cells, fibroblasts, or blood cells. In some embodiments, the cells provided from the subject are cutaneous fibroblasts or peripheral blood mononuclear cells (PBMCs). In some embodiments, the cells provided from the subject are urinary cells, renal epithelial cells, hair follicle cells, or dermal papilla cells.

[0020] In some embodiments, the cells derived from stem cells are ophthalmic cells. In some embodiments, the ophthalmic cells are retinal pigment epithelial (RPE) cells, photoreceptor cells (PRCs); including rod cells, cone cells, and photoreceptor progenitor cells, retinal cells, corneal cells, corneal epithelial cells (CECs), optic nerve cells, lens cells, choroidal endothelial (CE) cells, optic nerve cells, or choroidal cells. In some embodiments, the cells derived from stem cells are neuron cells.

[0021] In some embodiments, the mutation is endogenous to the subject. In some embodiments, the mutation is exogenous to the subject. In some embodiments, the mutation is artificially introduced through gene editing or genetic manipulation. In some embodiments, the cell line includes multiple mutations that are endogenous and / or exogenous to the subject.

[0022] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0023] In some embodiments, the target gene includes the genes shown in Table 4. In some embodiments, the target gene is Mutant or defective CYP4V2, CYP1B1, MYO7A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, A The genes for BCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A, or Proteins encoding incomplete or partial function or activity, such as CYP4V2, CYP1B1, MYO7A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, T The genes for XNRD2, WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A. This includes. In some embodiments, the target gene is CYP4V2.

[0024] In some embodiments, the cell line comprises iPS cells. In some embodiments, the cell line comprises iPS-RPE cells. In some embodiments, the cell line comprises iPS-photoreceptor (iPS-PRC) cells, iPS-corneal epithelial cells (iPS-CEC), iPS-choroidal endothelial (CE) cells, iPS-corneal cells, iPS-choroidal cells, iPS-optic nerve cells, iPS-ophthalmic cells, or iPS-neuron cells. In some embodiments, the CYP4V2 mutation in the cell line is endogenous to the subject. In some embodiments, the subject has a pathogenic mutation in the CYP4V2 gene or an ortholog of the CYP4V2 gene.

[0025] In some embodiments, the subject has at least one mutation as shown in Table 1. In some embodiments, the subject has hereditary retinal degeneration (IRD) or retinitis pigmentosa (RP). In some embodiments, the subject has or is at risk of developing crystallin retinopathy (BCD, also known as Bietti crystalline corneal-retinal dystrophy, Bietti crystalline retinopathy, or Bietti retinal dystrophy).

[0026] In some embodiments, the cell line includes a CYP4V2 mutation that is exogenous to the subject and artificially introduced through gene editing or genetic manipulation.

[0027] In some embodiments, the cell line includes iPS cells, ES cells, MSCs, or adult stem cells; or RPE cells, photoreceptor cells, corneal epithelial cells, choroidal endothelial (CE) cells, or choroidal cells derived from iPS cells, ES cells, MSCs, or adult stem cells. In some embodiments, the iPS cells or other types of stem cells are characterized by one or more of the following: a. The specific form of iPSCs among iPS, ES, or MSCs; b. One or more pluripotency markers such as Oct-4, Sox-2, SSEA4, TRA-1-60, TRA-1-81, NANOG, and AP; c. The ability to differentiate into a desired cell type (e.g., RPE); and / or d. Teratoma assay.

[0028] In some embodiments, the iPS-RPE cells or RPE cells derived from other types of stem cells are, a. Form: Pigment and hexagonal shape, and / or b.1 or more of the following biomarkers: retinaldehyde-binding protein 1 (RLBP1, also known as CRALBP), RPE65, BESTROPHIN-1, MITF, LRAT, RDH5, PAX6, MERTK, TYR, ZO-1 and / or VINCULIN It is characterized by:

[0029] In another embodiment, a BCD human cell model or a CYP4V2 functional cell model is provided. Such a model includes iPS cells or iPS cell lines or iPS-RPE cells or iPS-RPE cell lines derived from cells or cell lines of a BCD patient, or from cells or cell lines having an artificially created CYP4V2 mutation.

[0030] In some embodiments, the cell line has an abnormal biochemical profile with respect to one or more compounds from the following group of compounds compared to the corresponding cell line of a healthy control: (i) fatty acids, (ii) ceramides, (iii) sphingomyelin, (iv) sphingosine, (v) sphinganin, or (vi) hydroxy fatty acids. In some embodiments, the cell line has an abnormal biochemical profile with respect to one or more compounds shown in Table 2 compared to the relevant cell line of a healthy control.

[0031] Methods for creating cellular disease models: In another embodiment, a method for creating an iPS-derived BCD disease model is provided. Such a method is Obtaining cells from a target that have an endogenous mutation in the CYP4V2 gene, or obtaining cells that do not have an endogenous mutation in the CYP4V2 gene, wherein an exogenous CYP4V2 mutation is artificially introduced at this stage or at any subsequent stage via gene editing or genetic manipulation; Inducing pluripotency in the aforementioned cells, or reprogramming the aforementioned cells to produce iPSCs; To produce an iPS-derived ophthalmic cell line by culturing the iPSCs under conditions that allow them to differentiate into desired ophthalmic cells. Includes.

[0032] In some embodiments, the cells obtained from the subject are somatic cells. In some embodiments, the cells obtained from the subject are skin cells, fibroblasts, blood cells, peripheral blood mononuclear cells (PBMCs), or ophthalmic cells. In some embodiments, the cells obtained from the subject are urinary cells, renal epithelial cells, hair follicle cells, or dermal papilla cells. In some embodiments, the ophthalmic cells are retinal pigment epithelial (RPE) cells, corneal epithelial cells (CECs), photoreceptor cells (PRCs), choroidal endothelial (CE) cells, optic nerve cells, retinal cells, corneal cells, or choroidal cells. In some embodiments, pluripotency is induced or cells are reprogrammed using one or more of the transcription factors OCT4, SOX2, KLF4, and c-MYC.

[0033] In some embodiments, the mutation is pathological. In some embodiments, the cell line contains one or more mutations from those shown in Table 1. In some embodiments, the cell line is heterozygous with respect to the mutation. In some embodiments, the cell line is homozygous with respect to the mutation.

[0034] In some embodiments, the cellular disease model exhibits abnormal levels of one or more compounds from the following group of compounds compared to the relevant cell line of a healthy control: (i) fatty acids, (ii) ceramides, (iii) sphingomyelin, (iv) sphingosine, (v) sphinganin, or (vi) hydroxy fatty acids. In some embodiments, the cellular disease model exhibits abnormal levels of one or more compounds shown in Table 2 compared to the relevant cell line of a healthy control.

[0035] Biochemical assay methods: In one embodiment, a method is provided for detecting abnormalities or phenotypes in disease cell models. Such a method typically involves evaluating and comparing levels of one or more compounds selected from (i) fatty acids, (ii) ceramides, (iii) sphingomyelin, (iv) sphingosine, (v) sphinganin, and / or (vi) hydroxy fatty acids between a patient cell line (or a gene-edited or genetically engineered cell line containing exogenous mutations in the genes causing the disease) and a healthy control.

[0036] In some embodiments, one or more of the compounds to be evaluated are shown in Table 2. In some embodiments, compound-level identification and / or evaluation are performed using LC-MS, LC-MS / MS, GC-MS, GC-MS / MS, and / or FIA-MS / MS. In some embodiments, the disease cell model includes genes with mutations or defects shown in Table 4. In some embodiments, the disease cell model includes CYP4V2, CYP1B1, MYO7A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, ABCA 4. The genes REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A contain a mutated or defective gene.

[0037] Methods for using the BCD cell model (screening of drugs, dosages, and devices) In another embodiment, a method is provided for screening an investigational drug for its therapeutic effect on BCD. Such a method is typically, Cells from iPS-RPE cell lines derived from BCD patients, or cells from iPS-RPE cell lines containing mutated or defective CYP4V2 genes as a result of artificial gene editing or genetic manipulation, are brought into contact with the test drug; The cells are evaluated for normalization of the levels of one or more compounds shown in Table 2 compared to before contact with the above-mentioned test reagent; an increase in non-defective CYP4V2 nucleic acid sequences within the cells; an increase in the amount of CYP4V2 polypeptides within the cells; and / or improvement in cell structure, cell morphology, or cell function. Includes, Normalization of the levels of one or more compounds shown in Table 2 compared to before treatment with the above-mentioned test drug; increase in non-defective CYP4V2 nucleic acid sequences within the cells; increase in the amount of CYP4V2 polypeptides within the cells; and / or improvement in cell structure, cell morphology, or cell function are indicators of a test drug having a therapeutic effect on BCD.

[0038] In some embodiments, the test reagent is selected from the group consisting of nucleic acids or analogs thereof, vectors containing nucleic acid sequences or encoding polypeptides, polypeptides or analogs thereof, antibodies, chemicals, small molecules, and / or any combination thereof. In some embodiments, the cells are evaluated using PCR techniques, immunoassays, sequencing, biochemical assays, functional assays, microscopy, or a combination thereof.

[0039] In another embodiment, a method is provided for screening the efficacy or efficiency of a formulation, vector, or construct containing a BCD test agent. Such a method is typically, Multiple cell samples from iPS-RPE cell lines derived from BCD patients, or multiple cell samples from iPS-RPE cell lines containing mutated or defective CYP4V2 genes as a result of artificial gene editing or genetic manipulation, are brought into contact with test reagents formulated or packaged in various formulations, vectors, or constructs; The efficiency or efficacy of the above-mentioned formulations, vectors, or constructs is determined and compared by evaluating the cell samples for normalization of levels of one or more compounds listed in Table 2; increase in non-defective CYP4V2 nucleic acid sequences in the cells; increase in the amount of CYP4V2 polypeptides in the cells; improvement in cell structure, cell morphology, or cell function; and / or cell resistance or cell death, compared to cell samples treated with the above-mentioned test reagents and / or cell samples treated with the same test reagents but formulated or packaged in different formulations, vectors, or constructs. Includes, The cells are evaluated using PCR technology, immunoassays, sequencing, biochemical assays, functional assays, cell viability assays, microscopy, or a combination thereof.

[0040] In one embodiment, a method is provided for screening an effective and safe dosage range of a test drug for BCD. Such a method typically involves, Multiple cell samples from iPS-RPE cell lines derived from BCD patients, or multiple cell samples from iPS-RPE cell lines containing mutated or defective CYP4V2 genes as a result of artificial gene editing or genetic manipulation, are exposed to the test drug at different doses for each cell sample. The efficacy and safety of different doses will be determined and compared by evaluating the cell samples for normalization of levels of one or more compounds listed in Table 2 compared to before treatment with the above-mentioned test reagent, and / or compared to cell samples treated with the same test reagent but at different doses; an increase in non-defective CYP4V2 nucleic acid sequences in the cells; an increase in the amount of CYP4V2 polypeptides in the cells; improvement of cell structure, cell morphology, or cell function; and / or cell resistance or cell death, thereby determining and comparing the efficacy and safety of different doses and thereby determining an appropriate dose range. Includes, The cells are evaluated using PCR technology, immunoassays, sequencing, biochemical assays, cell viability assays, functional assays, microscopy, or a combination thereof.

[0041] In another embodiment, a method is provided for screening or evaluating the effectiveness or efficiency of a delivery device or delivery method for delivering a therapeutic agent to the retina or retinal cells. Such a method is typically, (i) Cell samples from iPS-RPE cell lines derived from BCD patients, or cell samples from iPS-RPE cell lines containing a mutated or defective CYP4V2 gene as a result of artificial gene editing or genetic manipulation, are brought into contact with the test drug without using the delivery device or delivery method; (ii) Contacting a separate cell sample from an iPS-RPE cell line derived from a BCD patient, or a separate cell sample from an iPS-RPE cell line containing a mutated or defective CYP4V2 gene as a result of artificial gene editing or genetic manipulation, with the same dose of the test drug as in (i), using the delivery device or delivery method. (iii) Determine and compare the effectiveness or efficiency of the delivery device or delivery method by evaluating and comparing the cell samples from (i) and (ii) with respect to: normalization of the levels of one or more compounds shown in Table 2 compared to before treatment with the above-mentioned test reagent, and / or compared to treatment with the same dose of the same test reagent but without using the delivery device or delivery method; increase in non-defective CYP4V2 nucleic acid sequences in the cells; increase in the amount of CYP4V2 polypeptide in the cells; improvement in cell structure, cell morphology or cell function; cell resistance or cell death; and / or the level of the above-mentioned test reagent in the cells. Includes, The cells are evaluated using PCR technology, immunoassays, sequencing, biochemical assays, functional assays, microscopy, or a combination thereof.

[0042] In some embodiments, retinal cells are RPE cells.

[0043] CRISPR gene editing therapy In one embodiment, a composition is provided comprising (a) a CRISPR guide RNA that targets the nucleic acid sequence of the CYP4V2 gene or a nucleic acid sequence within 100 bp adjacent to the CYP4V2 gene ("target sequence"), and (b) a functional CRISPR-related protein (Cas). In some embodiments, such a composition may further comprise (c) a donor nucleic acid sequence comprising all or part of the wild-type or functional sequence of the CYP4V2 gene for modification, disruption, or substitution of the CYP4V2 gene or a portion thereof.

[0044] In some embodiments, one or more components of the composition are provided in the form of a DNA molecule encoding the component, an mRNA molecule encoding the component, an RNA molecule, a polypeptide, and / or a ribonucleoprotein (RNP), or a protein-RNA complex. In some embodiments, two or more components of the composition are in separate molecules or combined in one molecule or one complex, in separate vectors or combined in one vector, in one or more nucleic acid complexes, or in one or more RNP complexes. In some embodiments, the donor nucleic acid sequence is provided in a single-stranded donor oligonucleotide (ssODN) or in a vector. In some embodiments, the vector is a plasmid, a recombinant AAV vector, a recombinant lentiviral vector, and / or a combination thereof.

[0045] In some embodiments, a composition is provided comprising cells having a pathogenic CYP4V2 mutation, comprising any of the compositions described herein. In some embodiments, (a) the CRISPR guide RNA is (i) CRISPR RNA (crRNA) comprising a protospacer element sequence complementary to a target sequence in or within 100 bp adjacent to the target gene ("target gene"), and a sequence corresponding to a complementary region of the trans-activating crRNA (tracrRNA), (ii) A tracrRNA comprising a region complementary to the corresponding region of the crRNA, and a sequence that interacts with CRISPR-related protein 9 (Cas9), (b) The functional CRISPR-related protein includes Cas9.

[0046] In some embodiments, the protospacer element is approximately 20 nucleotides, approximately 19 nucleotides, approximately 21 nucleotides, approximately 19–21 nucleotides, approximately 18–22 nucleotides, or approximately 16–24 nucleotides. In some embodiments, the crRNA and the tracrRNA are located in separate molecules. In some embodiments, the crRNA and the tracrRNA are combined in a single guide RNA (sgRNA). In some embodiments, the sgRNA is approximately 88–150 bp.

[0047] In some embodiments, Cas9 is Streptococcus pyogenes (SpCas9), SpCas9 nickase (Cas9n D10A), SpCas9 (D1135E), eSpCas9, SpCas9-HF1, SpCas9 VRER, SpCas9 VQR, SpCas9EQR, Staphylococcus aureus (SaCas9), Neisseria Meningitidis, Streptococcus thermophilus, Streptococcus pneumnoniae, Campylobacter coli The Cas9 ortholog or mutant Cas9 selected from *Campylobacter coli*, *Campylobacter jejuni*, *Streptococcus mutans*, *Pasteurella multocida*, *Bifidobacterium longum*, *Bacillus smithii*, *Treponema denticola*, *Mycoplasma canis*, and *Enterococcus faecalis*. In some embodiments, the CRISPR-associated protein Cas9 or Cpf1 further comprises 1, 2, 3 or more nuclear localization sequences (NLS) at the N-terminus and / or C-terminus, and / or further comprises a selection marker, the most recent example being GFP or EGFP.

[0048] In some embodiments, (a) the CRISPR guide RNA comprises a crRNA containing a protospacer element sequence complementary to a target sequence in or within 100 bp adjacent to the target gene, and (b) the functional CRISPR-associated protein comprises Cpf1. In some embodiments, the protospacer element is approximately 20 nucleotides, approximately 21 nucleotides, approximately 22 nucleotides, approximately 23 nucleotides, approximately 24 nucleotides, approximately 19–25 nucleotides, approximately 18–26 nucleotides, or approximately 16–28 nucleotides.

[0049] In some embodiments, the protospacer element sequence is selected from the group consisting of SEQ ID NOs. 48-52, or has at least 85% sequence identity with one of SEQ ID NOs. 48-52, and is used with a Cas protein that has NGG as a protospacer adjacent motif (PAM) to target the c.802-8_810del17insGC mutation in the CYP4V2 gene. In some embodiments, the donor nucleic acid sequence is selected from SEQ ID NOs. 56 and 57 (which are two donor template sequences), or has at least 90% sequence identity with either SEQ ID NOs. 56 and 57 or their complementary sequence, and is used to modify, disrupt, or replace the c.802-8_810del17insGC mutation in the CYP4V2 gene.

[0050] Claims regarding CRISPR gene therapy In another embodiment, a method is provided for treating or preventing BCD in a subject or cell having a mutated CYP4V2 gene. Such a method is (i) Identifying pathogenic mutations in the subject or cells by sequencing, (ii) Find a Cas-related PAM site in a region extending from approximately 100 bp upstream of the first nucleotide involved in the mutation to approximately 100 bp downstream of the last nucleotide involved in the mutation. (iii)(ii) Identify various protospacer element sequences that target the CYP4V2 sequence associated with each PAM site identified in (iii)(ii), (iv)(iii) The activity level of each CRISPR guide RNA containing the protospacer element sequence identified in (iv)(iii) and the off-target editing profile are evaluated for the protospacer element sequence and PAM. Select one or more CRISPR guide RNA designs based on (v)(iv), (vi) Designing one or more donor nucleic acid sequences based on homologous recombination repair (HDR) to correct, disrupt, or replace a target CYP4V2 mutation. (vii) Constructing a CRISPR guide RNA, Cas, and donor nucleic acid sequence as provided in claims 1 to 18 relating to a composition, (viii) optionally, to examine and further select components of (vii) in cells isolated from the subject; iPS cells derived from the subject, or cells differentiated from stem cells derived from the subject; or genomic DNA isolated from the subject, or cells isolated from the subject or cells derived therefrom, in order to evaluate the activity level and / or off-target editing profile, and (ix) Administering the component of (viii) to the subject or the cells by a delivery system selected from the group consisting of ribonucleoprotein or protein-RNA complexes, vectors, proteins, nucleic acid molecules, nanoparticles, liposomes, micelles, virosomes, nucleic acid complexes, and / or combinations thereof, wherein the delivery is performed by electroporation, or by lipid-mediated transfection, nucleofection, viral transduction or injection, or a combination thereof. Includes, (x) For in vitro cell therapy, a selection marker, such as GFP, EGFP, or puromycin resistance, may be added to or incorporated into the component of (viii) above, as is not limited to this.

[0051] In one embodiment, a gene editing composition is provided for correcting or replacing the c.802-8_810del17insGC mutation in the CYP4V2 gene in vivo in a subject or in vitro in a cell. Such a composition is typically, (i) A CRISPR guide RNA containing a protospacer element sequence selected from one of sequence numbers 48-52, or having at least 80% sequence identity with one of sequence numbers 48-52, (ii) A donor nucleic acid sequence selected from one of sequence numbers 56 and 57, or having at least 90% sequence identity with one of sequence numbers 56 and 57 or its complementary sequence, and (iii) Cas9 protein (an exemplary sequence is shown in SEQ ID NO: 58) (optionally including one, two, three or more NLS and / or select markers, such as GFP or EGFP, as non-limiting examples), Includes.

[0052] In some embodiments, an optional nucleotide G is added before the protospacer element sequence. In some embodiments, the CRISPR guide RNA comprises crRNA (an exemplary sequence (but not including the 5' protospacer element sequence) is shown in SEQ ID NO: 53) and tracrRNA (an exemplary sequence is shown in SEQ ID NO: 54); the protospacer element sequence is included in the crRNA. In some embodiments, the CRISPR guide RNA comprises a single guide RNA (sgRNA) containing the protospacer element sequence (an exemplary sgRNA sequence (but not including the 5' protospacer element sequence) is shown in SEQ ID NO: 55).

[0053] In some embodiments, one or more components of (i), (ii), and (iii) are provided in the form of a DNA molecule encoding the component, an mRNA molecule encoding the component, a nucleic acid molecule, a vector, an RNA molecule, a polypeptide, a ribonucleoprotein (RNP), or a protein-RNA complex, and / or a combination thereof.

[0054] Claims related to BCD cell therapy, autologous cell therapy for ocular diseases, and combination therapy. BCD cell therapy Allogenic cell therapy or autologous cell therapy without gene repair for BCD In some embodiments, methods are provided for treating or preventing eye diseases in subjects, the diseases being associated with pathological genetic or epigenetic alterations of the CYP4V2 gene. Such methods typically involve administering a cell composition to the subject, the cell composition comprising stem cell-derived retinal pigment epithelial (RPE) cells, photoreceptors or photoreceptor progenitor cells (PRCs), corneal epithelial cells (CECs), choroidal endothelial (CE) cells, and / or other ophthalmic cells.

[0055] In some embodiments, the stem cells are embryonic stem (ES) cells, iPC cells, MSCs, adult stem cells, or tissue-specific stem cells. In some embodiments, the stem cells are from or derived from one or more subjects that do not have BCD or pathogenic CYP4V2 gene. In some embodiments, the stem cells are from or derived from one or more subjects that have pathogenic mutations in the CYP4V2 gene. In some embodiments, the subjects are human subjects.

[0056] Genetically repaired autologous cell therapy for BCD In another embodiment, (a) Stem cells reprogrammed from cells isolated from subjects infected with BCD or with pathogenic mutations in the CYP4V2 gene, or stem cells isolated from subjects infected with BCD or with pathogenic mutations in the CYP4V2 gene, (b) Cells differentiated from stem cells isolated from subjects with BCD or pathogenic mutations in the CYP4V2 gene, or cells differentiated from stem cells reprogrammed from cells isolated from subjects with BCD or pathogenic mutations in the CYP4V2 gene. A cell composition containing the following is provided.

[0057] In some embodiments, the stem cells reprogrammed from cells isolated from the subject are iPC cells. In some embodiments, the iPS cells are reprogrammed from any cells of any tissue of the subject. In some embodiments, the iPS cells are reprogrammed from skin cells, blood cells, urine cells, hair cells, fibroblasts, peripheral blood mononuclear cells (PBMCs), renal epithelial cells, hair follicle cells, or dermal papilla cells. In some embodiments, the stem cells isolated from the subject are MSCs, adult stem cells, or tissue-specific stem cells. In some embodiments, the cells differentiated from the stem cells are ophthalmic cells. In some embodiments, the cells differentiated from the stem cells are RPE cells, PRCs, retinal cells, corneal cells, choroidal cells, CECs, or CE cells. In some embodiments, the cells differentiated from the stem cells are iPS-RPE, iPS-PRC, iPS-CEC, or iPS-CE cells.

[0058] In some embodiments, (i) Cells isolated from subjects affected by BCD or with pathogenic mutations in the CYP4V2 gene, to be used for reprogramming into iPSCs. (ii) Stem cells isolated from a subject infected with BCD or having a pathogenic mutation in the CYP4V2 gene, or iPS cells reprogrammed from cells isolated from a subject infected with BCD or having a pathogenic mutation in the CYP4V2 gene, (iii) Cells differentiated from stem cells isolated from a subject infected with BCD or having a pathogenic mutation in the CYP4V2 gene, or cells differentiated from iPS cells reprogrammed from cells isolated from a subject infected with BCD or having a pathogenic mutation in the CYP4V2 gene, are genetically repaired to mitigate the effects of the mutated CYP4V2 gene. In some embodiments, gene repair is performed before reprogramming to iPS cells. In some embodiments, gene repair is performed after reprogramming to iPS cells. In some embodiments, gene repair is performed before differentiation of stem cells or iPS cells. In some embodiments, gene repair is performed after differentiation of stem cells or iPS cells. In some embodiments, gene repair is performed by gene therapy. In some embodiments, gene repair is performed by gene therapy using any composition or method described in any one of the claims relating to gene therapy. In some embodiments, gene repair is performed by gene editing. In some embodiments, gene repair is performed by gene editing using any composition or method described in any one of the claims relating to CRiSPR gene therapy.

[0059] In another embodiment, a method is provided for treating or preventing ocular diseases in subjects suffering from BCD or having pathological genetic or epigenetic changes in the CYP4V2 gene. Such a method comprises administering to a subject any of the CYP4V2 autologous cell compositions described herein, the cell composition comprising stem cell-derived retinal pigment epithelial (RPE) cells, photoreceptors or photoreceptor progenitor cells (PRC), corneal epithelial cells (CEC), choroidal endothelial (CE) cells, and / or other ocular cells of the subject.

[0060] In some embodiments, the stem cells are iPC cells, MSCs, adult stem cells, or tissue-specific stem cells. In some embodiments, the iPS cells are reprogrammed using one or more of the transcription factors OCT4, SOX2, KLF4, and c-MYC. In some embodiments, the genetically repaired cells demonstrate one or more of the following compared to before gene repair: normalization of levels of one or more compounds shown in Table 2; an increase in non-defective CYP4V2 nucleic acid sequences in the cells; an increase in the amount of CYP4V2 polypeptides in the cells; and / or improvements in cell structure, cell morphology, cell viability, or cell function.

[0061] In some embodiments, the amount of cells administered is approximately 1,000 to 100 million cells per dose. In some embodiments, the administration is by injection. In some embodiments, the administration is by subretinal injection. In some embodiments, the administration is by intravitreous injection. In some embodiments, the administration is by direct injection into the retina. In some embodiments, the administration is by corneal injection. In some embodiments, the administration is by any other method of administration that effectively delivers the cells to a subretinal location, posterior location, or cornea of ​​the target eye. In some embodiments, the cells are administered by injection of a cell suspension. In some embodiments, the cells are administered as part of a sheet, matrix, scaffold, or tissue.

[0062] In some embodiments, the RPE cells are administered using a natural and / or synthetic scaffold to generate a functional RPE monolayer. In some embodiments, the subject is a human subject.

[0063] Genetically repaired autologous cell therapy for eye diseases In another embodiment, (a) Stem cells reprogrammed from cells isolated from subjects suffering from a disease caused by a mutated or defective gene, or a gene encoding a protein with incomplete or partial function or activity, or Stem cells isolated from subjects suffering from diseases caused by mutated or defective genes, or genes encoding proteins with incomplete or partial function or activity, or (b) Cells differentiated from stem cells isolated from subjects suffering from a disease caused by a mutated or defective gene, or a gene encoding a protein with incomplete or partial function or activity, or Cells differentiated from stem cells reprogrammed from cells isolated from subjects suffering from diseases caused by mutated or defective genes, or genes encoding proteins with incomplete or partial function or activity. A cell composition containing the following is provided.

[0064] In some embodiments, the stem cells reprogrammed from cells isolated from the subject are iPS cells. In some embodiments, the iPS cells are reprogrammed from any cells of any tissue of the subject. In some embodiments, the iPS cells are reprogrammed from skin cells, blood cells, urine cells, hair cells, fibroblasts, peripheral blood mononuclear cells (PBMCs), renal epithelial cells, hair follicle cells, or dermal papilla cells. In some embodiments, the stem cells isolated from the subject are MSCs, adult stem cells, or tissue-specific stem cells.

[0065] In some embodiments, the gene is involved in eye development or function, and / or mutations in the gene cause or are risk factors for eye disease. In some embodiments, the gene is involved in nerve development or function, and / or mutations in the gene cause or are risk factors for neurodegenerative disease. In some embodiments, the gene is a cytochrome P450 gene. In some embodiments, the gene is one of the genes shown in Table 4.

[0066] In some embodiments, the gene is Mutant or defective CYP4V2, CYP1B1, MYO7A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, A The genes for BCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A, or Proteins encoding incomplete or partial function or activity, such as CYP4V2, CYP1B1, MYO7A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, T The genes for XNRD2, WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A. Includes.

[0067] In some embodiments, the cells differentiated from the stem cells are any type of cell. In some embodiments, the cells differentiated from the stem cells are ophthalmic cells. In some embodiments, the cells differentiated from the stem cells are RPE cells, PRCs, retinal cells, corneal cells, choroidal cells, CECs, CE cells, or optic nerve cells. In some embodiments, the cells differentiated from the stem cells are iPS-RPE, iPS-PRCs, iPS-CECs, or iPS-CE cells. In some embodiments, the cells differentiated from the stem cells are neurons.

[0068] In some embodiments, (i) Cells isolated from subjects suffering from a disease caused by a mutated or defective gene, or a gene encoding a protein with incomplete or partial function or activity, which are used to reprogram iPSCs. (ii) Stem cells isolated from a subject suffering from a disease caused by a mutated or defective gene, or a gene encoding a protein with incomplete or partial function or activity, or iPS cells reprogrammed from cells isolated from subjects suffering from diseases caused by mutated or defective genes, or genes encoding proteins with incomplete or partial function or activity, or (iii) Cells differentiated from stem cells isolated from a subject suffering from a disease caused by a mutated or defective gene, or a gene encoding a protein with incomplete or partial function or activity, or iPS cells reprogrammed from cells isolated from subjects suffering from diseases caused by mutated or defective genes, or genes encoding proteins with incomplete or partial function or activity. This is genetically repaired to mitigate the effects of a mutated or defective gene.

[0069] In some embodiments, gene repair is performed before reprogramming to iPS cells. In some embodiments, gene repair is performed after reprogramming to iPS cells. In some embodiments, gene repair is performed before differentiation of stem cells or iPS cells. In some embodiments, gene repair is performed after differentiation of stem cells or iPS cells. In some embodiments, gene repair is performed by gene transfer therapy. In some embodiments, gene repair is performed by gene transfer therapy using any composition or method described in any one of the claims relating to gene therapy. In some embodiments, gene repair is performed by gene editing therapy. In some embodiments, gene repair is performed by gene editing therapy using any composition or method described in any one of the claims relating to CRiSPR gene therapy.

[0070] In another embodiment, a method is provided for treating or preventing a disease in a subject suffering from a disease caused by a mutated or defective gene, or a gene encoding a protein having incomplete or partial function or activity, as described in Table 4. Such a method typically involves administering an autologous cell composition described herein to a subject, the cell composition comprising retinal pigment epithelial (RPE) cells, photoreceptors or photoreceptor progenitor cells (PRCs), corneal epithelial cells (CECs), neurons, choroidal endothelial (CE) cells, and / or other ophthalmic cells derived from the subject's stem cells, wherein the mutated or defective gene in the cell composition is genetically repaired.

[0071] In yet another embodiment, a method for auto-treating the subject is provided. Such a method is typically, (i) Prepare cells from subjects suffering from eye diseases. (ii) To induce pluripotency in the cells from the subject and generate iPSCs, (iii) In the iPSC derived from the subject, genetically repair one or more mutations in the genes having mutations or defects shown in Table 4. (iv) Differentiating the iPSCs into ophthalmic cells, (v) Instead of step (iii), genetically repair the iPS-ophthalmic cells by gene transfer therapy, and (vi) Introducing the iPS-ophthalmic cells into the subject, thereby autotherapy for the subject having the eye disease, Includes.

[0072] In some embodiments, the stem cells are iPC cells, MSCs, adult stem cells, or tissue-specific stem cells. In some embodiments, the iPS cells are reprogrammed using one or more of the transcription factors OCT4, SOX2, KLF4, and c-MYC. In some embodiments, the genetically repaired cells represent one or more of the following compared to before gene repair: an increase in the non-defective target gene nucleic acid sequence within the cell; an increase in the amount of functional polypeptide encoded by the target gene within the cell; an improvement in cellular structure, morphology, or function within the cell; and / or improvement or normalization of intracellular biochemical function. In some embodiments, the amount of cells administered is approximately 1,000 to 100 million cells in a single dose.

[0073] In some embodiments, the administration is by injection. In some embodiments, the administration is by subretinal injection. In some embodiments, the administration is by intravitreous injection. In some embodiments, the administration is by direct injection into the retina. In some embodiments, the administration is by corneal injection. In some embodiments, the administration is by any other administration method that effectively delivers the cells to a subretinal location, posterior, or cornea of ​​the eye of the subject. In some embodiments, the cells are administered by injection of a cell suspension. In some embodiments, the cells are administered as part of a sheet, matrix, scaffold, or tissue. In some embodiments, the RPE cells are administered using a natural and / or synthetic scaffold to produce a functional RPE monolayer. In some embodiments, the subject is a human subject.

[0074] In some embodiments, the disease is associated with a genetic or epigenetic change or risk factor in the subject. In some embodiments, the disease is photoreceptor degeneration, retinal pigment epithelial cell degeneration, retinal degeneration, corneal degeneration, and / or choroidal disorder. In some embodiments, the disease is hereditary retinal degeneration (IRD). In some embodiments, the disease is retinitis pigmentosa (RP). In some embodiments, the disease is crystalline retinopathy (BCD, also known as Bietti crystalline corneal retinal dystrophy). In some embodiments, the disease is associated with neurodegeneration. In some embodiments, the disease is corneal dystrophy. In some embodiments, the subject has BCD or is at risk of developing BCD.

[0075] In some embodiments, the cells are fibroblasts, blood cells, or ophthalmic cells. In some embodiments, the cells are obtained from urine, hair, or hair follicles. In some embodiments, the ophthalmic cells are retinal pigment epithelial (RPE) cells, corneal epithelial (CEC) cells, choroidal endothelial (CE) cells, or photoreceptor cells (PRC).

[0076] In some embodiments, the genetic or epigenetic alteration is selected from the group consisting of mutations, insertions, single nucleotide polymorphisms, inappropriate methylation, inappropriate demethylation, and combinations thereof. In some embodiments, the genetic or epigenetic alteration is a mutation. In some embodiments, the genetic or epigenetic alteration in the iPS-ophthalmic cells from the subject is genetically repaired using gene editing. In some embodiments, the gene editing method utilizes zinc finger nuclease, TALEN technology, or CRISPR technology. In some embodiments, the genetic or epigenetic alteration in the iPSC-ophthalmic cells from the subject is genetically repaired using gene transfer. In some embodiments, the gene transfer method utilizes a recombinant AAV vector or another viral or nonviral vector to deliver a healthy copy (e.g., cDNA) of the target gene to the transplanted cells.

[0077] In some embodiments, the administration step is performed before or after the onset of disease symptoms. In some embodiments, the administration is to the eye or another organ or tissue, including neurons. In some embodiments, the administration is by injection. In some embodiments, the administration is by subretinal injection or intravitreous injection. In some embodiments, the administration is by direct injection into the retina. In some embodiments, the administration is by corneal injection. In some embodiments, the administration is by any other method of administration that effectively delivers cells to a subretinal location, posterior location, or cornea of ​​the target eye.

[0078] In some embodiments, the method further includes, prior to administration or transplantation, genotyping of the cells to confirm the presence or absence of genetic or epigenetic changes in one or more genes shown in Table 4. In some embodiments, the genetic or epigenetic change is a mutation. In some embodiments, the mutation is located within the CYP4V2 nucleic acid molecule. In some embodiments, the method further includes, prior to administration, evaluating the eye of the subject to identify the areas and extent of damaged or maintained photoreceptors, retinal cells, or corneal cells.

[0079] In some embodiments, the method further includes monitoring the subject after administration. In some embodiments, the monitoring includes non-invasive retinal imaging, corneal examination, visual field measurement, ERG, OCT, visual acuity testing, and / or functional testing. In some embodiments, the monitoring includes evaluating the subject for an immune response. In some embodiments, the method further includes evaluating the subject's eye after administration to identify areas and extent of damaged or maintained photoreceptors, retinal cells, or corneal cells.

[0080] Cell therapy - RNP claims RNP claims In another embodiment, A composition is provided comprising (a) a CRISPR guide RNA that targets a nucleic acid sequence in or within 100 bp adjacent to a target gene ("target gene"), and (b) a functional CRISPR-related protein, within a ribonucleoprotein (RNP) or protein-RNA complex.

[0081] In some embodiments, the composition further comprises (c) a donor nucleic acid sequence comprising all or part of the wild-type or functional sequence of the target gene for modification or substitution of the target gene or a portion thereof. In some embodiments, the target gene is involved in eye development or function, and / or mutations in the target gene cause or are risk factors for eye disease. In some embodiments, the target gene is involved in nerve development or function, and / or mutations in the target gene cause or are risk factors for neurodegenerative disease.

[0082] In some embodiments, the target gene is a cytochrome P450 gene. In some embodiments, the target gene includes the genes listed in Table 4 that encode a mutated or defective protein, or a protein with incomplete or partial function or activity. In some embodiments, the donor nucleic acid sequence is provided in a single-stranded donor oligonucleotide (ssODN) or vector.

[0083] In some embodiments, (a) The CRISPR guide RNA comprises (i) a CRISPR RNA (crRNA) comprising a protospacer element sequence complementary to a target sequence located within or within 100 bp adjacent to a target gene, and a sequence corresponding to a complementary region of a trans-activating crRNA (tracrRNA); and (ii) a tracrRNA comprising a region complementary to the corresponding region of the crRNA, and a sequence that interacts with CRISPR-related protein 9 (Cas9). (b) The functional CRISPR-related protein includes Cas9.

[0084] In some embodiments, the protospacer element is approximately 20 nucleotides, approximately 19 nucleotides, approximately 21 nucleotides, approximately 19–21 nucleotides, approximately 18–22 nucleotides, or approximately 16–24 nucleotides. In some embodiments, the crRNA and the tracrRNA are located within different nucleic acid molecules. In some embodiments, the crRNA and the tracrRNA are combined in a single guide RNA (sgRNA). In some embodiments, the sgRNA is approximately 88–150 bp.

[0085] In some embodiments, Cas9 is Streptococcus pyogenes (SpCas9), SpCas9 nickase (Cas9n D10A), SpCas9 (D1135E), eSpCas9, SpCas9-HF1, SpCas9 VRER, SpCas9 VQR, SpCas9EQR, Staphylococcus aureus (SaCas9), Neisseria Meningitidis, Streptococcus thermophilus, Streptococcus pneumnoniae, Campylobacter coli This includes Cas9 orthologs or variant Cas9 selected from *Campylobacter coli*, *Campylobacter jejuni*, *Streptococcus mutans*, *Pasteurella multocida*, *Bifidobacterium longum*, *Bacillus smithii*, *Treponema denticola*, *Mycoplasma canis*, and *Enterococcus faecalis*.

[0086] In some embodiments, (a) the CRISPR guide RNA comprises a crRNA containing a protospacer element sequence complementary to a target sequence in or within 100 bp adjacent to the target gene, and (b) the functional CRISPR-related protein comprises Cpf1. In some embodiments, the protospacer element is approximately 20 nucleotides, approximately 21 nucleotides, approximately 22 nucleotides, approximately 23 nucleotides, approximately 24 nucleotides, approximately 19–25 nucleotides, approximately 18–26 nucleotides, or approximately 16–28 nucleotides. In some embodiments, the CRISPR-related protein Cas9 or Cpf1 further comprises 1, 2, 3 or more nuclear localization sequences (NLS) at the N-terminus and / or C-terminus, and / or further comprises a selection marker, the non-limiting example being GFP or EGFP.

[0087] In some embodiments, the protospacer element is 100% complementary to the target sequence or contains 1, 2, 3, 4, or 5 nucleotide mismatches corresponding to the target sequence. In some embodiments, the crRNA sequence further includes a G nucleotide optionally added to the crRNA sequence immediately preceding the protospacer element. In some embodiments, the CRISPR guide RNA, crRNA, and / or tracrRNA, or sgRNA are chemically modified.

[0088] In some embodiments, the donor nucleic acid sequence is approximately 1 kb, approximately 800 bp, approximately 600 bp, approximately 500 bp, approximately 400 bp, approximately 300 bp, approximately 280 bp, approximately 260 bp, approximately 240 bp, approximately 220 bp, or approximately 200 bp or less, in the case of a donor nucleic acid sequence provided in ssODN, and approximately 30 kb, approximately 25 kb, approximately 20 kb, approximately 15 kb, approximately 10 kb, approximately 9 kb, approximately 8 kb, approximately 7 kb, approximately 6 kb, approximately 5 kb, approximately 4.5 kb, approximately 4 kb, approximately 3.5 kb, approximately 3 kb, approximately 2.5 kb, approximately 2 kb, approximately 1.5 kb, approximately 1 kb, approximately 0.5 kb, approximately 0.2 kb, or approximately 0.1 kb or less, in the case of a donor nucleic acid sequence provided in a vector.

[0089] In some embodiments, the target gene is Mutant or defective CYP4V2, CYP1B1, MYO7A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD2, WFS1, A The genes for BCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A, or Proteins encoding incomplete or partial function or activity, such as CYP4V2, CYP1B1, MYO7A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, T The genes for XNRD2, WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A. Includes.

[0090] In some embodiments, one or more components, including the CRISPR guide RNA, CRISPR-related protein, and / or the donor nucleic acid sequence, are provided separately and / or additionally to a vector, DNA, and / or mRNA that can be transcribed and / or translated into the component. In one embodiment, a pharmaceutical formulation comprising any of the compositions described herein is provided.

[0091] In another embodiment, a method is provided for treating or preventing a disease of interest caused by a mutated or defective gene, or a gene encoding a protein having incomplete or partial function or activity. Such a method includes disrupting, modifying, or replacing such gene by administering one of the compositions described herein to the subject.

[0092] In another embodiment, a method is provided for treating an eye disease of a subject caused by a mutated or defective gene, or a gene encoding a protein having incomplete or partial function or activity, or for mitigating associated risk factors. Such a method includes disrupting, modifying, or replacing such gene by administering one of the compositions described herein to the subject.

[0093] In another embodiment, methods are provided for treating a neurodegenerative disease of a subject caused by a mutated or defective gene, or a gene encoding a protein with incomplete or partial function or activity, or for mitigating associated risk factors. Such methods include disrupting, modifying, or replacing such genes by administering one of the compositions described herein to the subject.

[0094] In another embodiment, methods are provided for treating a disease of interest caused by a mutated or defective cytochrome P450 gene, or a cytochrome P450 gene encoding a protein having incomplete or partial function or activity, or for mitigating associated risk factors. Such methods include disrupting, modifying, or replacing such gene by administering one of the compositions described herein to the subject.

[0095] In some embodiments, the gene encoding the mutated or defective gene or the protein encoding the incomplete or partially functional or active gene that is disrupted, modified, or replaced is a mutated or defective version of the gene shown in Table 4, or a version of the gene encoding the incomplete or partially functional or active protein shown in Table 4. In some embodiments, the gene encoding the mutated or defective gene or the protein encoding the incomplete or partially functional or active gene is present in fibroblasts, blood, RPE, photoreceptors, retina, cornea, choroid, eye, optic nerve, neuron, or any type of cell derived from stem cells.

[0096] In some embodiments, the composition is delivered to fibroblasts, blood, RPE, photoreceptors, retina, cornea, choroid, eye, optic nerve, neuron, or stem cells, or any type of cell derived from stem cells. In some embodiments, delivery is carried out by electroporation, or by lipid-mediated transfection, nucleofection, viral transduction, or injection, or a combination thereof. In some embodiments, one or more components comprising the CRISPR guide RNA, CRISPR-related protein, and / or the donor nucleic acid sequence are administered to the target or cells via a delivery system selected from the group consisting of ribonucleoprotein or protein-RNA complexes, nanoparticles, liposomes, micelles, virosomes, nucleic acid complexes, and / or combinations thereof.

[0097] In some embodiments, the treatment is performed in vivo on the subject. In some embodiments, the treatment is performed in vitro on fibroblasts, blood, RPE, photoreceptors, retina, cornea, choroid, eye, optic nerve, neuron, or any type of cell, or any type of cell derived from stem cells. In some embodiments, the treated cells are transplanted into the subject in vivo, or, if the treated cells are stem cells, the stem cells are differentiated into the desired type of cell for transplantation, and the differentiated cells are then transplanted into the subject in vivo.

[0098] In some embodiments, the mutated or defective gene, or the gene encoding a protein with incomplete or partial function or activity, is replaced. In some embodiments, one or more mutations are modified or replaced in the mutated or defective gene, or the gene encoding a protein with incomplete or partial function or activity. In some embodiments, the mutated or defective gene, or the gene encoding a protein with incomplete or partial function or activity, is destroyed.

[0099] In some embodiments, in the mutated or defective gene, or the gene encoding the protein having incomplete or partial function or activity, nucleotides or mutations of 1 to 20, 21 to 40, 41 to 60, 61 to 80, 81 to 100, 101 to 1000, or 1001 to 10000 base pairs are disrupted, modified, or substituted. In some embodiments, a region of the mutated or defective gene, or the gene encoding the protein having incomplete or partial function or activity, is disrupted, modified, or substituted. In some embodiments, a region of about 10, 8, 6, 4, 2, or less than 1 kb in the mutated or defective gene, or the gene encoding the protein having incomplete or partial function or activity, is disrupted, modified, or substituted.

[0100] In some embodiments, the mutated or defective gene, or the gene encoding the protein having incomplete or partial function or activity, is disrupted, modified, or replaced by nucleotide insertions and / or deletions. In some embodiments, the mutated or defective gene, or the gene encoding the protein having incomplete or partial function or activity, is disrupted, modified, or replaced in one or both alleles. In some embodiments, one or more mutations or defects in the mutated or defective gene, or the gene encoding the protein having incomplete or partial function or activity, are disrupted, modified, or replaced using two or more different CRISPR guide RNAs, two or more different CRISPR-related proteins, and / or two or more different donor nucleic acid sequences.

[0101] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the method improves eye development or function or prevents degeneration of the eye, retina, or cornea. In some embodiments, the method improves neurological development or function or prevents neurodegeneration. In some embodiments, the method improves the expression or function of the P450 enzyme.

[0102] In some embodiments, homologous recombination repair based on the donor nucleic acid sequence produced introns and / or exons of the target gene. In some embodiments, homologous recombination repair based on the donor nucleic acid sequence produced splice acceptors of the target gene. Such methods further include (c) a donor nucleic acid sequence comprising all or part of the target gene shown in Table 4 having mutations or alterations for the generation of a mutated or altered target gene or a part thereof.

[0103] In some embodiments, methods are provided for producing cellular disease models of diseases caused by mutated or defective genes, or genes encoding proteins with incomplete or partial function or activity, by producing mutations in such genes. Such methods include delivering a healthy version of such gene to cells via any of the compositions described herein. In some embodiments, delivery is carried out by electroporation, or by lipid-mediated transfection, nucleofection, viral transduction, or injection, or a combination thereof. In some embodiments, the cells are fibroblasts, blood, RPE, photoreceptors, retina, cornea, choroid, eye, optic nerve, neuron, or stem cells, or any type of cell derived from stem cells.

[0104] In yet another embodiment, a composition is provided that includes cells having genes with mutations or defects as shown in Table 4.

[0105] In another embodiment, the composition described in any one of the claims of this application includes mutated or defective CYP4V2, CYP1B1, MYO7A, DFNB31, USH1C, USH1G, CDH23, PCDH15, CLRN1, ACO2, AFG3L2, ATXN2, AUH, C12orf65, CISD2, FOXC1, FOXF2, LTBP2, MTPAP, MYOC, NDUFS1, NR2F1, OPA1, OPA3, OPTN, PAX6, PDGF, PITX2, POLG, SPG7, TEK, TXNRD A composition is provided that includes cells having the gene WFS1, ABCA4, REP-1, RPE65, CEP290, PDE6B, RPGR, MERTK, MT-ND4, FAM47E, GBA, GCH1, HTRA2, LRRK2, PARK2, PINK1, SNCA, SYNJ1, NPC1, NPC2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, or CYP46A.

[0106] In some embodiments, the vector is an AAV vector. In some embodiments, the protospacer element sequence is selected from the group consisting of SEQ ID NOs. 48-52, or has at least 80% sequence identity with one of SEQ ID NOs. 48-52, and is used with a Cas protein that has NGG as a protospacer adjacent motif (PAM) to target the c.802-8_810del17insGC mutation in the CYP4V2 gene. In some embodiments, the donor nucleic acid sequence is selected from SEQ ID NOs. 56 and 57, or has at least 90% sequence identity with either SEQ ID NOs. 56 and 57 or a complementary sequence thereof, and is used to modify, disrupt, or replace the c.802-8_810del17insGC mutation in the CYP4V2 gene.

[0107] Claims related to gene therapy Claim regarding codon-optimized sequences In one embodiment, a nucleic acid molecule is provided that includes the nucleic acid sequence of Sequence ID No. 2 encoding the human CYP4V2 protein, or a nucleic acid sequence having at least 90% sequence identity with the nucleic acid sequence of Sequence ID No. 2.

[0108] In another embodiment, an expression cassette is provided comprising a nucleic acid molecule described herein and one or more control sequences operably linked to the nucleic acid sequence. In yet another embodiment, a vector is provided comprising a nucleic acid molecule described herein or an expression cassette described herein.

[0109] In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is selected from the group consisting of recombinant adenovirus vectors, recombinant lentivirus vectors, recombinant herpes simplex virus vectors, recombinant Sendai virus vectors, and recombinant retrovirus vectors. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector or plasmid. In some embodiments, the vector is a plasmid or a non-viral vector. In some embodiments, the non-viral vector is selected from the group consisting of naked nucleic acids, liposomes, dendrimers, and nanoparticles.

[0110] In some embodiments, the host cell comprises any of the nucleic acid molecules and / or any of the compositions described herein. In some embodiments, the host cell is a bacterial cell, an Escherichia coli cell, a plant cell, an insect cell, or a mammalian cell. In some embodiments, the host cell is a HEK293 cell, a HeLa cell, a Vero cell, a V27 cell, an A549 cell, a K562 cell, a B50 cell, a WI38 cell, a Hep G2 cell, or a BHK cell.

[0111] In another embodiment, any nucleic acid molecule described herein, any expression cassette described herein, or any vector described herein may be used in bacterial cells, insect cells, plant cells, mammalian cells, RPE cells, photoreceptors or photoreceptor precursors (PRCs), retinal cells, corneal cells, ophthalmic cells, neurons, nerve cells, blood cells, epithelial cells, somatic cells, iPS cells, ES cells, MSCs, adult stem cells, stem cells, or any cells derived from stem cells to express products encoded by such nucleic acid molecules.

[0112] Claims relating to EFS and / or SPA In another embodiment, a self-complementary adeno-associated virus (scAAV) vector is provided, comprising an elongation factor 1α short (EFS) promoter and / or a small polyadenylation (polyA) signal (SPA) operably linked to a nucleic acid molecule encoding a polypeptide, an interfering RNA molecule, or an oligonucleotide. In some embodiments, the EFS promoter comprises a nucleic acid sequence having at least 80% sequence identity with SEQ ID NO: 35, and the SPA comprises a nucleic acid sequence having at least 80% sequence identity with SEQ ID NO: 36.

[0113] In some embodiments, the scAAV vector is delivered to a cell such that the product encoded by the nucleic acid molecule is expressed within the cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a retinal cell, corneal cell, choroidal cell, ophthalmic cell, brain cell, neuron, nerve cell, iPS cell, ES cell, MSC, stem cell, or any cell derived from a stem cell.

[0114] In one embodiment, a method is provided for gene therapy that reduces the immune response to a viral vector to maintain transduction efficiency and / or maximizes therapeutic effects for various patients with the same genetic disorder. Such a method is (a) Establish a pool of recombinant viral vectors (e.g., rAAV) that have sufficient transduction efficiency in target cell types for gene therapy (the viral vector pool can be expanded by creating variants having antigen region mutations or other mutations that have been confirmed to have sufficient transduction efficiency in target cells associated with the disease (e.g., iPS-RPE cell lines in CYP4V2 gene therapy for BCD), or variants of the capsid of the viral vector). (b) To detect existing neutralizing antiviral vector antibodies (NAbs) against various viral vector serotypes and / or capsid mutations or variants in subjects requiring gene therapy, and / or to test and compare various viral vectors in patient-specific cells (e.g., iPS-RPE cells) derived from the above subjects; (c) Selecting from the pool of viral vectors a viral vector that has sufficient transduction efficiency and the lowest cross-reactivity with the existing NAb of the subject, and / or a viral vector that has the best phenotypic rescue result in the patient-specific cells of the subject, The pool of viral vectors includes various serotypes and / or capsid-modified viral vectors (e.g., capsid variant AAV and / or capsid protein variant AAV), Selecting the aforementioned option; (d) Using the viral vector selected from (c) for administration to the subject; and (e) Each time the subject requires administration of gene therapy, repeat (b) to (d) above (only the parts related to existing NAbs) (for example, follow-up administration to the same eye or the opposite eye, or to a different organ, etc.) Includes.

[0115] In another embodiment, a composition for treating or preventing a disease of interest is provided, comprising an effective amount of a vector and a pharmaceutically acceptable carrier. Typically, the vector comprises a nucleic acid molecule or a non-pathogenic variant thereof encoding a non-mutant or functional CYP4V2 protein, operably ligated to a control sequence.

[0116] In some embodiments, the disease is crystallin retinopathy (BCD, also known as Bietti crystalline corneal retinal dystrophy). In some embodiments, the disease is related to a genetic or epigenetic change in the subject. In some embodiments, the disease is photoreceptor degeneration, retinal pigment epithelial cell degeneration, retinal degeneration, corneal degeneration, or choroidal degeneration. In some embodiments, the retinal degeneration is retinitis pigmentosa (RP). In some embodiments, the retinal degeneration is hereditary retinal degeneration (IRD). In some embodiments, the disease is BCD. In some embodiments, the disease is corneal dystrophy. In some embodiments, the subject has BCD or is at risk of developing BCD.

[0117] In one embodiment, a vector is provided comprising a nucleic acid molecule encoding a non-mutant or functional CYP4V2 protein or a non-pathogenic variant thereof, operably ligated to a control sequence.

[0118] In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is selected from the group consisting of adeno-associated virus (AAV) vectors, adenovirus vectors, lentivirus vectors, herpes simplex virus vectors, Sendai virus vectors, and retrovirus vectors. In some embodiments, the AAV is recombinant AAV (rAAV). In some embodiments, the rAAV comprises an AAV genome or a derivative thereof, and / or an AAV capsid protein or a derivative thereof. In some embodiments, the rAAV is a chimeric AAV, a shuffled AAV, or a capsid-modified AAV.

[0119] In some embodiments, the AAV genome or AAV capsid protein is derived from one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or another naturally occurring serotype, isolate, or clade of AAV, or a derivative or hybrid thereof. In some embodiments, the rAAV is a pseudotype AAV (e.g., AAV2 / 5, AAV2 / 8, AAV2 / 1, AAV2 / 4, AAV2 / 6, AAV2 / 7, AAV2 / 12, AAV2 / 10, and AAV2 / 9). In some embodiments, the rAAV is a hybrid AAV (e.g., AAV-DJ, AAV-DJ / 8, or AAV-DJ / 9). In some embodiments, the rAAV is derived from directed evolution and / or rational design. It is developed through design (e.g., AAV 7m8 or AAV-PHP.B).

[0120] In some embodiments, the rAAV comprises one or more capsid mutations (e.g., AAV2 having one or more capsid mutations from YF, KR, TA, SA and / or TV mutations (e.g., Y444F, Y500F, Y730F, Y252F, Y272F, Y700F, Y704F, and T491V), or corresponding mutations in different AAV serotypes (e.g., AAV2 / 8(Y733F), AAV2(Y444F+Y500F+Y730F) and AAV2(quadY-F)+TV)). In some embodiments, the rAAV serotype is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Anc80, rh10, and ShH10. In some embodiments, the rAAV vector is selected from the group consisting of AAV2 / 5, AAV2 / 8, AAV2 / 8(Y733F), AAV2(Y444F+Y500F+Y730F), AAV2 / 1, AAV2 / 4, AAV2 / 9, AAV2 / 6, AAV2 / 7, AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV12, Anc80, AAV 7m8, AAV-DJ, ShH10, AAV-PHP.B, or hybrids, derivatives, or variants thereof.

[0121] In some embodiments, the rAAV vector is a single-stranded AAV vector or a self-complementary AAV (scAAV) vector. In some embodiments, the vector is a plasmid or a non-viral vector (e.g., naked nucleic acid, liposome, dendrimer, and nanoparticle).

[0122] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence is (i) Human CYP4V2 protein (SEQ ID NO: 4), (ii) Variants of human CYP4V2 protein or functional CYP4V2 protein (e.g., amino acid changes and / or splice variants) (e.g., SEQ ID NO: 5), (iii) One or more fragments of a functional CYP4V2 protein (e.g., SEQ ID NO: 6), (iv) All or part of a sequence from one or more CYP4V2 orthologs of another species (v) Non-limiting examples include other CYP4 proteins and CYP46A1, all or part of the sequence from one or more other P450 proteins. (vi) polypeptides and / or polypeptides capable of improving, treating, or inhibiting one or more biochemical abnormalities of one or more genes listed in Table 4 in the patient's cells (e.g., iPS-RPE cells of a BCD patient) (vii) The above combinations, Includes.

[0123] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or part of the amino acid sequence shown in SEQ ID NOs: 4, 5, or 6. In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or part of the amino acid sequence selected from the group consisting of CYP4V2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, and CYP46A1 (SEQ ID NOs: 4-18) and their derivatives, hybrids, variants, and / or fragments. In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or part of an amino acid sequence selected from the group consisting of CYP4V2 (or orthologs of CYP4V2) (SEQ ID NOs. 19-29) and their derivatives, hybrids, variants and / or fragments from chimpanzees, rhesus monkeys, dogs, cattle, mice, rats, chickens, frogs, horses, rabbits, and fruit flies.

[0124] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by a nucleic acid sequence comprises a polypeptide having at least 80% amino acid sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to any sequence selected from the group consisting of SEQ ID NOs. In some embodiments, the non-mutant or functional CYP4V2 protein encoded by a nucleic acid sequence comprises the sequence elements FxxGxxxCxG and ExxR (SEQ ID NOs. 30 and 31). In some embodiments, the non-mutant or functional CYP4V2 protein is a compound or agent capable of improving, treating, or inhibiting one or more biochemical abnormalities of one or more of the aforementioned genes listed in Table 4 in patient cells (e.g., iPS-RPE cells of a BCD patient).

[0125] In some embodiments, the nucleic acid molecule encodes a non-mutant or functional CYP4V2 protein according to any one of claims 43 to 50. In some embodiments, the nucleic acid molecule encodes a non-mutant or functional CYP4V2 protein comprising the amino acid sequence shown in SEQ ID NO: 4, 5, or 6, or having at least 80% sequence identity with any one of SEQ ID NO: 4, 5, or 6. In some embodiments, the nucleic acid molecule has at least 60% sequence identity with any of the sequences shown in SEQ ID NO: 1, 2, or 3. In some embodiments, the nucleic acid molecule has at least 70% sequence identity with any of the sequences shown in SEQ ID NO: 1, 2, or 3. In some embodiments, the nucleic acid molecule has at least 75% sequence identity with any of the sequences shown in SEQ ID NO: 1, 2, or 3. In some embodiments, the nucleic acid molecule has at least 76% sequence identity with any of the sequences shown in SEQ ID NO: 1, 2, or 3. In some embodiments, the nucleic acid molecule comprises the sequence shown in SEQ ID NO: 1, 2, or 3.

[0126] In some embodiments, the control sequence includes a promoter. In some embodiments, the promoter is an RPE cell-specific promoter, a retinal cell-specific promoter, a corneal cell-specific promoter, an ophthalmic cell-specific promoter, or a constitutive promoter. In some embodiments, the promoter is a mammalian β-actin promoter or a viral promoter.

[0127] In some embodiments, the promoter is a CAG promoter (hybrid CMV initial enhancer / chicken β-actin promoter (also known as CAGGS promoter, CB promoter or CBA promoter)), a chicken β-actin promoter, a small CBA (smCBA) promoter, or a CB promoter. SB The promoter is selected from the group consisting of the CBh promoter, other β-actin promoters (e.g., human β-actin promoter), elongation factor 1α short (EFS) promoter, elongation factor 1α (EF-1α) promoter, CMV promoter, PGK promoter, UBC promoter, GUSB promoter, UCOE promoter, VMD2 (vitiligo macular dystrophy 2; also known as BEST1) promoter, RPE65 promoter, or hybrids or derivatives thereof.

[0128] In some embodiments, the promoter is a CAG promoter (hybrid CMV initial enhancer / chicken β-actin promoter (also known as CAGGS promoter, CB promoter, or CBA promoter)), an elongation factor 1α short (EFS) promoter, an elongation factor 1α short (EF-1α) promoter, a CMV promoter, or a derivative or hybrid thereof. In some embodiments, the regulatory sequence includes an enhancer.

[0129] In some embodiments, the enhancer is a viral enhancer, including, but not limited to, a WPRE enhancer, an HPRE enhancer, a CTE enhancer, or derivatives or hybrids thereof. In some embodiments, the control sequence includes a polyadenylation (polyA) signal. In some embodiments, the polyA signal is a bovine growth hormone polyadenylation signal (bGH polyA), a small polyA signal (SPA), a human growth hormone polyadenylation signal (hGH polyA), an SV40 polyA signal, an SV40 late polyA signal, or derivatives or hybrids thereof. In some embodiments, the control sequence includes a Kozak sequence (SEQ ID NO: 37 or 38).

[0130] In some embodiments, the composition is formulated with a carrier and additional components suitable for a specific route of administration.

[0131] In another embodiment, a host cell containing one of the vectors described herein is provided.

[0132] In another embodiment, a method is provided for treating or preventing an eye disease in a subject, comprising administering a vector to the subject, the vector comprising a nucleic acid molecule encoding a human CYP4V2 protein or a functional CYP4V2 protein or a non-pathogenic variant thereof, operably linked to a control sequence.

[0133] In one embodiment, a method is provided for preventing, inhibiting, delaying or improving dysfunction, dystrophy, impairment, degeneration, atrophy and / or death of ophthalmic cells, comprising delivering a vector to ophthalmic cells, the vector comprising a nucleic acid molecule encoding a human CYP4V2 protein or a functional CYP4V2 protein operably linked to a control sequence, or a non-pathogenic variant thereof.

[0134] In some embodiments, the disease is crystallin retinopathy (BCD, also known as Bietti crystalline corneal retinal dystrophy, Bietti crystalline retinopathy, or Bietti retinal dystrophy). In some embodiments, the subject suffers from another clinically defined ophthalmic condition caused by a mutation in the CYP4V2 gene (e.g., hereditary retinal degeneration (IRD), retinitis pigmentosa (RP), or corneal dystrophy). In some embodiments, the eye disease is photoreceptor degeneration, retinal pigment epithelial cell degeneration, retinal degeneration, corneal dystrophy, or BCD corneal degeneration.

[0135] In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is selected from the group consisting of recombinant adeno-associated virus (rAAV) vectors, recombinant adenovirus vectors, recombinant lentivirus vectors, recombinant herpes simplex virus vectors, recombinant Sendai virus vectors, and recombinant retrovirus vectors. In some embodiments, the viral vector is an rAAV vector. In some embodiments, the rAAV vector comprises a VP1, VP2, or VP3 capsid protein selected from the group consisting of any serotype of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12, or other naturally occurring serotypes, isolates, or clades of AAV, or hybrids, variants, or derivatives thereof.

[0136] In some embodiments, the rAAV vector 5′AAV ITR is selected from one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or other naturally occurring serotypes, isolates, or clades of AAV, or their variants, chimeras, variants, or fusions. In some embodiments, the rAAV vector 3′AAV ITR is selected from one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or other naturally occurring serotypes, isolates, or clades of AAV, or their variants, chimeras, variants, or fusions. In some embodiments, the rAAV is a chimeric AAV, a shuffled AAV, or a capsid-modified AAV. In some embodiments, the rAAV is a pseudo-AAV (e.g., AAV2 / 5, AAV2 / 8, AAV2 / 1, AAV2 / 4, AAV2 / 6, AAV2 / 7, AAV2 / 12, AAV2 / 10, and AAV2 / 9). In some embodiments, the rAAV is a hybrid AAV (e.g., AAV-DJ, AAV-DJ / 8, or AAV-DJ / 9). In some embodiments, the rAAV is developed through directional evolution and / or rational design methods (e.g., AAV 7m8 or AAV-PHP.B).

[0137] In some embodiments, the rAAV comprises one or more capsid mutations (e.g., AAV2 having one or more capsid mutations from YF, KR, TA, SA and / or TV mutations (e.g., Y444F, Y500F, Y730F, Y252F, Y272F, Y700F, Y704F, and T491V), or corresponding mutations in different AAV serotypes (e.g., AAV2 / 8(Y733F), AAV2(Y444F+Y500F+Y730F) and AAV2(quadY-F)+TV)). In some embodiments, the rAAV serotype is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, Anc80, rh10, and ShH10. In some embodiments, the rAAV vector is selected from the group consisting of AAV2 / 5, AAV2 / 8, AAV2 / 8(Y733F), AAV2(Y444F+Y500F+Y730F), AAV2 / 1, AAV2 / 4, AAV2 / 9, AAV2 / 6, AAV2 / 7, AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV12, Anc80, AAV 7m8, AAV-DJ, ShH10, AAV-PHP.B, or hybrids, derivatives, or variants thereof.

[0138] In some embodiments, the rAAV vector is a single-stranded AAV vector or a self-complementary AAV (scAAV) vector. In some embodiments, the vector is a plasmid or a non-viral vector. In some embodiments, the non-viral vector is selected from the group consisting of naked nucleic acids, liposomes, dendrimers, and nanoparticles.

[0139] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence is (i) Human CYP4V2 protein (SEQ ID NO: 4), (ii) Variants of human CYP4V2 protein or functional CYP4V2 protein (e.g., amino acid changes and / or splice variants) (e.g., SEQ ID NO: 5), (iii) One or more fragments of a functional CYP4V2 protein (e.g., SEQ ID NO: 6), (iv) All or part of a sequence from one or more CYP4V2 orthologs of another species (v) Non-limiting examples include other CYP4 proteins and CYP46A1, all or part of the sequence from one or more other P450 proteins. (vi) polypeptides and / or polypeptides capable of improving, treating, or inhibiting one or more biochemical abnormalities of one or more genes listed in Table 4 in the patient's cells (e.g., iPS-RPE cells of a BCD patient) (vii) The above combinations Includes.

[0140] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or part of the amino acid sequence shown in SEQ ID NOs: 4, 5, or 6. In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or part of the amino acid sequence selected from the group consisting of CYP4V2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, and CYP46A1 (SEQ ID NOs: 4-18) and their derivatives, hybrids, variants, and / or fragments.

[0141] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises all or part of an amino acid sequence selected from the group consisting of CYP4V2 (or orthologs of CYP4V2) (SEQ ID NOs. 19-29) and their derivatives, hybrids, variants and / or fragments, of chimpanzees, rhesus monkeys, dogs, cattle, mice, rats, chickens, frogs, horses, rabbits, and fruit flies. In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises a polypeptide having at least 80% amino acid sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to any of the sequences selected from the group consisting of SEQ ID NOs.

[0142] In some embodiments, the non-mutant or functional CYP4V2 protein encoded by the nucleic acid sequence comprises the sequence elements FxxGxxxCxG and ExxR (SEQ ID NOs: 30 and 31). In some embodiments, the non-mutant or functional CYP4V2 protein is a compound or agent capable of improving, treating, or inhibiting one or more biochemical abnormalities of one or more of the genes listed in Table 4 in patient cells (e.g., iPS-RPE cells of a BCD patient). In some embodiments, the nucleic acid molecule encodes the non-mutant or functional CYP4V2 protein described in any one of claims 91 to 97. In some embodiments, the nucleic acid molecule encodes a non-mutant or functional CYP4V2 protein comprising the amino acid sequence shown in SEQ ID NOs: 4, 5, or 6, or having at least 80% sequence identity with any one of SEQ ID NOs: 4, 5, or 6. In some embodiments, the nucleic acid molecule encoding the functional CYP4V2 protein has the nucleic acid sequence shown in SEQ ID NOs: 1, 2, or 3. In some embodiments, the nucleic acid molecule encoding the functional CYP4V2 protein has at least 60% sequence identity with any of SEQ ID NOs: 1, 2, or 3.

[0143] In some embodiments, the control sequence includes a promoter. In some embodiments, the promoter is an RPE cell-specific promoter, a retinal cell-specific promoter, a corneal cell-specific promoter, or an ophthalmic cell-specific promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a mammalian β-actin promoter or a viral promoter.

[0144] In some embodiments, the promoter is a CAG promoter (hybrid CMV initial enhancer / chicken β-actin promoter (also known as CAGGS promoter, CB promoter or CBA promoter)), a chicken β-actin promoter, a small CBA (smCBA) promoter, or a CB promoter. SB The promoter is selected from the group consisting of the CBh promoter, other β-actin promoters (e.g., human β-actin promoter), elongation factor 1α short (EFS) promoter, elongation factor 1α short (EF-1α) promoter, CMV promoter, PGK promoter, UBC promoter, GUSB promoter, UCOE promoter, VMD2 (vitiligo macular dystrophy 2; also known as BEST1) promoter, RPE65 promoter, or hybrids or hybrids thereof. In some embodiments, the promoter is the CAG promoter (hybrid CMV early enhancer / chicken β-actin promoter (also known as CAGGS promoter, CB promoter, or CBA promoter)), elongation factor 1α short (EFS) promoter, elongation factor 1α short (EF-1α) promoter, CMV promoter, or derivatives or hybrids thereof.

[0145] In some embodiments, the control sequence includes an enhancer. In some embodiments, the enhancer is a viral enhancer, including, by way of non-limiting example, a WPRE enhancer, a HPRE enhancer, a CTE enhancer, or a derivative or hybrid thereof. In some embodiments, the control sequence includes a polyadenylation (polyA) signal. In some embodiments, the polyA signal is a bovine growth hormone polyadenylation signal (bGH polyA), a small polyA signal (SPA), an SV40 polyA signal, a human growth hormone polyadenylation signal (hGH polyA), an SV40 late polyA signal, or a derivative or hybrid thereof. In some embodiments, the control sequence includes a Kozak sequence (SEQ ID NO: 37 or 38).

[0146] In some embodiments, for in vitro treatment, infection of the target cells is performed at a multiplicity of infection (MOI) of about 1×10 3 GC to about 1×10 6 GC (GC: genomic copy, measuring AAV particles containing the genome (also known as vector genome (vg) or genomic particle (gp))). In some embodiments, for in vivo administration to the eye of a subject, a single administration is in the order of about 1×10 6 GC to about 2×10 13 GC (e.g., about 1×10 11 GC to about 1×10 12 GC high dose range, about 1×10 10 GC to about 1×10 11 GC medium dose range, about 1×10 9 GC to about 1×10 10 GC low dose range, about 1×10 6 GC to about 1×10 9 GC ultra-low dose range, and about 1×10 12 GC to about 2×10 13 GC ultra-high dose range), or at a dose within these ranges and any dose sufficient to provide the desired effect can be implemented.

[0147] In some embodiments, the administration step is performed before or after the onset of disease symptoms. In some embodiments, the administration is performed in the eye. In some embodiments, the administration is performed by subretinal injection. In some embodiments, the administration is performed by intravitreous injection. In some embodiments, the administration is performed by direct injection into the retina. In some embodiments, the administration is performed by any other method of administration that effectively delivers the vector to the subretinal location of the target, the posterior part of the eye, the cornea, or RPE cells, photoreceptor cells, or corneal epithelial cells.

[0148] In some embodiments, the administration is by corneal delivery. In some embodiments, the administration to the eye is achieved by delivery via the bloodstream. In some embodiments, the administration is by eye drops. In some embodiments, the administration is by lens delivery. In some embodiments, the administration is performed in the subretinal space, cornea, lens, or vitreous humor. In some embodiments, the ophthalmic cells are selected from the group consisting of retinal pigment epithelial (RPE) cells, photoreceptor cells (PRC), corneal epithelial cells (CEC), choroidal endothelial (CE) cells, retinal cells, corneal cells, lens cells, ganglion cells, optic nerve cells, and / or choroid cells, as well as cells of these types derived from stem cells (e.g., iPSCs, ES cells, MSCs, adult stem cells, and / or tissue-specific stem cells).

[0149] In some embodiments, the methods described herein may further include identifying subjects who have BCD or are at risk of developing BCD.

[0150] Claims relating to the use of EFS and / or SPA in rAAV vectors containing nucleic acid sequences encoding Cas. In one embodiment, a composition is provided comprising a recombinant adeno-associated virus (rAAV) vector comprising an elongation factor 1α short (EFS) promoter and / or a small polyadenylation (polyA) signal (SPA) operably linked to a nucleic acid molecule encoding a CRISPR-related protein (Cas).

[0151] In some embodiments, the EFS promoter consists of a nucleic acid sequence having at least 80% sequence identity with SEQ ID NO: 35, and the SPA consists of a nucleic acid sequence having at least 80% sequence identity with SEQ ID NO: 36. In some embodiments, the Cas encoded in the nucleic acid sequence operably linked to the EFS promoter and / or the SPA is Cas9 or Cpf1.

[0152] A host cell containing the rAAV described herein is provided. In some embodiments, the host cell is a bacterial cell, an Escherichia coli cell, a plant cell, an insect cell, or a mammalian cell. In some embodiments, the cell is a somatic cell or a stem cell. In some embodiments, the host cell is a retinal cell, a corneal cell, a choroidal cell, an ophthalmic cell, a brain cell, a neuron, a nerve cell, an iPS cell, an ES cell, an MSC, an adult stem cell, a tissue-specific cell, a stem cell, or any cell derived from a stem cell. In some embodiments, the rAAV vector is delivered to the host cell such that Cas encoded by the nucleic acid molecule is expressed within the cell. In some embodiments, the host cell includes any cell described in any one of claims 131 to 134.

[0153] Other features and advantages of the present invention will become apparent from the modes for carrying out the invention, the brief description of the drawings and examples, and the claims. All publications, patent applications, patents, sequences, database entries and other references referenced herein are incorporated by reference in their entirety. [Brief explanation of the drawing]

[0154] The present invention is further illustrated by the following figures and drawings, which do not limit the scope of the invention as described in the claims.

[0155] [Figure 1A(i)] iPS cell lineage derived from BCD patients (a) iPS cells generated from fibroblasts in skin biopsy samples from BCD patients (i) Patient 1 (P1) iPS cells [Figure 1A(ii)] iPS cell lines derived from BCD patients: (a) iPS cells generated from fibroblasts in skin biopsy samples from BCD patients; (ii) patient 2 (P2) iPS cells [Figure 1A(iii)] iPS cell lines derived from BCD patients (a) iPS cells generated from fibroblasts in skin biopsy samples from BCD patients (iii) Characterization of P1 and P2 iPS cell lines using Oct-4, Sox-2, and SSEA-4 markers [Figure 1A(iv)] iPS cell lines derived from BCD patients: (a) iPS cells generated from fibroblasts in skin biopsy samples from BCD patients; (iv) Characterization of P1 and P2 iPS cell lines using Nanog and Tra-1-60 markers. [Figure 1B(i)] (b) iPS cell line derived from BCD patients (i) iPS cells generated from peripheral blood mononuclear cells (PBMCs) of blood samples from BCD patients and healthy controls: (i) Phase-contrast image of the iPS cell line [Figure 1B(ii)] (b) iPS cell lineage derived from BCD patients: (ii) iPS cells generated from peripheral blood mononuclear cells (PBMCs) of blood samples from BCD patients and healthy controls: (ii) AP staining results of the iPS cell lineage [Figure 1C] iPS cell line derived from a BCD patient (c) Image of iPS cell karyotype derived from a BCD patient that appears to show a normal human karyotype. [Figure 2A(i)] iPS-RPE cell lineage derived from BCD patients (a) Bright-field image of iPS-RPE cell lineage derived from BCD patients showing RPE-specific morphology (hexagonal, pigmented, and monolayer): (i) P1 iPS-RPE cell [Figure 2A(ii)](a) Bright-field image of iPS-RPE cell lines derived from BCD patients showing RPE-specific morphology (hexagonal, pigmented, and monolayer): (ii) P2 iPS-RPE cells [Figure 2B] iPS-RPE cell line derived from BCD patients (b) Results of RPE markers in iPS-RPE cells from BCD patients, showing the presence of RPE-specific markers RPE65, CRALBP, and MITF.

[0156] [Figure 3] qRT-PCR results of CYP4V2 expression in iPS-RPE samples. WT (control). WT AVG (average of control). P1 (BCD patient 1). P1-AAV8 (P1 sample treated with AAV8.CYP4V2fv, MOI = 1.5 × 10 e4 GC / cell)

[0157] [Figure 4] qRT-PCR results of CYP4V2op expression in iPS-RPE samples. WT (control). WT AVG (mean of control). P1 and P2 (BCD patient 1 and patient 2). P1-AAV2 (P1 sample treated with AAV2.CYP4V2op, MOI = 2 × 10⁴ GC / cell). P2-AAV2 (P2 sample treated with AAV2.CYP4V2op, MOI = 2 × 10⁴ GC / cell). P2-scAAV1 (P2 sample treated with scAAV1.CYP4V2op, MOI = 2 × 10⁴ GC / cell)

[0158] [Figure 5A] Cell viability images of iPS-RPE samples not exposed to blue light. WT (control). P1 and P2 (BCD patient 1 and patient 2). Red (dead cells / disease cells), green (live cells / healthy cells). (a) Red only [Figure 5B] Cell viability images of iPS-RPE samples not exposed to blue light. WT (control). P1 and P2 (BCD patient 1 and patient 2). Red (dead cells / disease cells), green (live cells / healthy cells). (b) Red and green [Figure 6A]Cell viability images of iPS-RPE samples after 1 hour of exposure to blue light. WT (control). P1 and P2 (BCD patient 1 and patient 2). Red (dead cells / disease cells); green (live cells / healthy cells). (a) Red only [Figure 6B] Cell viability images of iPS-RPE samples after 1 hour of exposure to blue light. WT (control). P1 and P2 (BCD patient 1 and patient 2). Red (dead cells / disease cells); green (live cells / healthy cells). (b) Red and green

[0159] Gene therapy [Figure 7A]Schematic diagram and annotations of an exemplary CYP4V2 expression cassette and recombinant AAV (rAAV) vector (a) CYP4V2 expression cassette (with enhancer) packaged in a single-stranded AAV (ssAAV) vector. Note: The CYP4V2 expression cassette (shown adjacent to the AAV ITR) can be packaged in an rAAV vector with a capsid from any AAV serotype or its hybrid or variant. ITR: inverted terminal repeat (may be an AAV2 ITR or an ITR from another AAV serotype). Exemplary AAV2 ITR sequences are shown in SEQ ID NOs. 42 and 43. CYP4V2: cDNA encoding the human CYP4V2 protein or a functional variant thereof, e.g., CYP4V2st (SEQ ID NOs. 1) or CYP4V2op (SEQ ID NOs. 2) encoding the human CYP4V2 protein (SEQ ID NOs. 4), or CYP4V2fv (SEQ ID NOs. 3) encoding the functional CYP4V2 protein (SEQ ID NOs. 5). The Kozak sequence (the sequence shown in SEQ ID NO: 37 or SEQ ID NO: 38) is inserted immediately before the CYP4V2 cDNA sequence. CAG: Hybrid CAG promoter (an exemplary sequence is shown in SEQ ID NO: 32). Other promoters described herein may be used, including, but not limited to, the CMV promoter (an exemplary sequence is shown in SEQ ID NO: 40) or the EF-1α promoter (an exemplary sequence is shown in SEQ ID NO: 41). WPRE: Woodchuck hepatitis virus posttranscriptional regulatory element (an exemplary sequence is shown in SEQ ID NO: 33). bGH polyA: Polyadenylation signal for bovine growth hormone (an exemplary sequence is shown in SEQ ID NO: 34). Alternative polyA signals may be used, such as the SV40 late polyA signal (an exemplary sequence is shown in SEQ ID NO: 39). EFS: Elongation factor 1α short (EFS) core promoter. An exemplary sequence is shown in SEQ ID NO: 35. SPA: Small polyA signal. An exemplary sequence is shown in SEQ ID NO: 36.Mutant / Cleaved ITR: One of the two ITRs used in the scAAV vector is a mutant / cleaved ITR (indicated as ITR*). An example sequence is shown in SEQ ID NO: 44. In the CYP4V2 expression cassette, the enhancer is optionally present. [Figure 7B]Schematic diagram and annotations of an exemplary CYP4V2 expression cassette and recombinant AAV (rAAV) vector (b) CYP4V2 expression cassette (without enhancer) packaged in a single-stranded AAV (ssAAV) vector. Note: The CYP4V2 expression cassette (shown adjacent to the AAV ITR) can be packaged in an rAAV vector with a capsid from any AAV serotype or its hybrid or variant. ITR: inverted terminal repeat (may be an AAV2 ITR or an ITR from another AAV serotype). Exemplary AAV2 ITR sequences are shown in SEQ ID NOs. 42 and 43. CYP4V2: cDNA encoding the human CYP4V2 protein or a functional variant thereof, e.g., CYP4V2st (SEQ ID NOs. 1) or CYP4V2op (SEQ ID NOs. 2) encoding the human CYP4V2 protein (SEQ ID NOs. 4), or CYP4V2fv (SEQ ID NOs. 3) encoding the functional CYP4V2 protein (SEQ ID NOs. 5). The Kozak sequence (the sequence shown in SEQ ID NO: 37 or SEQ ID NO: 38) is inserted immediately before the CYP4V2 cDNA sequence. CAG: Hybrid CAG promoter (an exemplary sequence is shown in SEQ ID NO: 32). Other promoters described herein may be used, including, but not limited to, the CMV promoter (an exemplary sequence is shown in SEQ ID NO: 40) or the EF-1α promoter (an exemplary sequence is shown in SEQ ID NO: 41). WPRE: Woodchuck hepatitis virus posttranscriptional regulatory element (an exemplary sequence is shown in SEQ ID NO: 33). bGH polyA: Polyadenylation signal for bovine growth hormone (an exemplary sequence is shown in SEQ ID NO: 34). Alternative polyA signals may be used, such as the SV40 late polyA signal (an exemplary sequence is shown in SEQ ID NO: 39). EFS: Elongation factor 1α short (EFS) core promoter. An exemplary sequence is shown in SEQ ID NO: 35. SPA: Small polyA signal. An exemplary sequence is shown in SEQ ID NO: 36.Mutant / Cleaved ITR: One of the two ITRs used in the scAAV vector is a mutant / cleaved ITR (indicated as ITR*). An example sequence is shown in SEQ ID NO: 44. In the CYP4V2 expression cassette, the enhancer is optionally present. [Figure 7C]Schematic diagram and annotations of an exemplary CYP4V2 expression cassette and recombinant AAV (rAAV) vector (c) CYP4V2 expression cassette packaged in a self-complementary AAV (scAAV) or ssAAV vector Annotation: The CYP4V2 expression cassette (shown adjacent to the AAV ITR) can be packaged in an rAAV vector with a capsid from any AAV serotype or its hybrid or variant. ITR: inverted terminal repeat (may be an AAV2 ITR or an ITR of another AAV serotype). Exemplary AAV2 ITR sequences are shown in SEQ ID NOs. 42 and 43. CYP4V2: cDNA encoding the human CYP4V2 protein or a functional variant thereof, e.g., CYP4V2st (SEQ ID NOs. 1) or CYP4V2op (SEQ ID NOs. 2) encoding the human CYP4V2 protein (SEQ ID NOs. 4), or CYP4V2fv (SEQ ID NOs. 3) encoding the functional CYP4V2 protein (SEQ ID NOs. 5). The Kozak sequence (the sequence shown in SEQ ID NO: 37 or SEQ ID NO: 38) is inserted immediately before the CYP4V2 cDNA sequence. CAG: Hybrid CAG promoter (an exemplary sequence is shown in SEQ ID NO: 32). Other promoters described herein may be used, including, but not limited to, the CMV promoter (an exemplary sequence is shown in SEQ ID NO: 40) or the EF-1α promoter (an exemplary sequence is shown in SEQ ID NO: 41). WPRE: Woodchuck hepatitis virus posttranscriptional regulatory element (an exemplary sequence is shown in SEQ ID NO: 33). bGH polyA: Polyadenylation signal for bovine growth hormone (an exemplary sequence is shown in SEQ ID NO: 34). Alternative polyA signals may be used, such as the SV40 late polyA signal (an exemplary sequence is shown in SEQ ID NO: 39). EFS: Elongation factor 1α short (EFS) core promoter. An exemplary sequence is shown in SEQ ID NO: 35. SPA: Small polyA signal. An exemplary sequence is shown in SEQ ID NO: 36.Mutant / Cleaved ITR: One of the two ITRs used in the scAAV vector is a mutant / cleaved ITR (indicated as ITR*). An example sequence is shown in SEQ ID NO: 44. In the CYP4V2 expression cassette, the enhancer is optionally present. [Figure 8A] Cell viability images of iPS-RPE samples from BCD patients after 1 hour of exposure to blue light (no AAV.CYP4V2 treatment vs. treatment with AAV2.CYP4V2 or scAAV1.CYP4V2 (MOI = 1 × 10 e5 GC / cell)). P1 and P2 (BCD patient 1 and patient 2). Red (dead cells / disease cells); green (live cells / healthy cells). (a) Red only [Figure 8B] Cell viability images of iPS-RPE samples from BCD patients after 1 hour of exposure to blue light (no AAV.CYP4V2 treatment vs. treatment with AAV2.CYP4V2 or scAAV1.CYP4V2 (MOI = 1 × 10 e5 GC / cell)). P1 and P2 (BCD patient 1 and patient 2). Red (dead cells / disease cells); green (live cells / healthy cells). (b) Red and green [Figure 9A] Cell viability images of iPS-RPE samples from BCD patients after 1 hour of exposure to blue light (no AAV.CYP4V2 treatment vs. treatment with AAV5.CYP4V2op, AAV5.CYP4V2st, or AAV8.CYP4V2fv (MOI = 1 × 10 e5 GC / cell)). P1 (BCD patient 1). Red (dead cells / disease cells); green (live cells / healthy cells). (a) Red only [Figure 9B] Cell viability images of iPS-RPE samples from BCD patients after 1 hour of exposure to blue light (no AAV.CYP4V2 treatment vs. treatment with AAV5.CYP4V2op, AAV5.CYP4V2st, or AAV8.CYP4V2fv (MOI = 1 × 10 e5 GC / cell)). P1 (BCD patient 1). Red (dead cells / disease cells); green (live cells / healthy cells). (b) Red and green [Figure 10A]Cell viability images of iPS-RPE samples from BCD patients after 1 hour of exposure to blue light (no AAV.CYP4V2 treatment vs. treatment with AAV5.CYP4V2, scAAV1.CYP4V2, or scAAV5.CYP4V2 (MOI = 1 × 10 e4 GC / cell)). P2 (BCD patient 2). Red (dead cells / disease cells); green (live cells / healthy cells). (a) Red only [Figure 10B] Cell viability images of iPS-RPE samples from BCD patients after 1 hour of exposure to colored light (no AAV.CYP4V2 treatment vs. treatment with AAV5.CYP4V2, scAAV1.CYP4V2, or scAAV5.CYP4V2 (MOI = 1 × 10 e4 GC / cell)). P2 (BCD patient 2). Red (dead cells / disease cells); green (live cells / healthy cells). (b) Red and green [Figure 11A] Cell viability images of iPS-RPE samples from BCD patients after 1 hour of exposure to blue light (no AAV.CYP4V2 treatment vs. treatment with scAAV9.CYP4V2op (MOI = 1 × 10 e5 GC / cell)). P1 (BCD patient 1). Red (dead cells / disease cells); green (live cells / healthy cells). (a) Red only [Figure 11B] Cell viability images of iPS-RPE samples from BCD patients after 1 hour of exposure to blue light (no AAV.CYP4V2 treatment vs. treatment with scAAV9.CYP4V2op (MOI = 1 × 10 e5 GC / cell)). P1 (BCD patient 1). Red (dead cells / disease cells); green (live cells / healthy cells). (b) Red and green [Figure 12] Figure 12 shows the region of the CYP4V2 sequence and the positions of the designed guide RNA (gRNA) and primers (orange arrows) for the c.802-8_810del17insGC mutation for gRNA activity assays. [Figure 12-2] Figure 12 shows the region of the CYP4V2 sequence and the positions of the designed guide RNA (gRNA) and primers (orange arrows) for the c.802-8_810del17insGC mutation for gRNA activity assays. [Figure 12-3]Figure 12 shows the region of the CYP4V2 sequence and the positions of the designed guide RNA (gRNA) and primers (orange arrows) for the c.802-8_810del17insGC mutation for gRNA activity assays. [Figure 13] Figure 13 shows an in vitro investigation or assay. Lane 1: Amplicon + Cas9; Lane 2: Amplicon + g1 + Cas9; Lane 3: Amplicon + g2 + Cas9; Lane 4: Amplicon + g3 + Cas9; Lane 5: Amplicon + g4 + Cas9; Lane 6: Amplicon + g5 + Cas9; Lane 7: Amplicon only; M: 1kb DNA marker.

[0160] [Figure 14] Figure 14 shows a sequence comparison to identify the origin of the DNA used in the study or assay. Top: Untreated amplicon; Middle: Fragment of g2-treated amplicon; Bottom: CYP4V2 locus showing the mutation site. [Figure 14-2] Figure 14 shows a sequence comparison to identify the origin of the DNA used in the study or assay. Top: Untreated amplicon; Middle: Fragment of g2-treated amplicon; Bottom: CYP4V2 locus showing the mutation site. [Figure 14-3] Figure 14 shows a sequence comparison to identify the origin of the DNA used in the study or assay. Top: Untreated amplicon; Middle: Fragment of g2-treated amplicon; Bottom: CYP4V2 locus showing the mutation site.

[0161] [Figure 15] Figure 15 shows the structure of a gRNA vector. [Figure 16] Figure 16 shows the vector maps of gRNA (g1 used as an example), Cas9, and the PuroR co-expression plasmid pX459-hSpCas9-2A-Puro. [Figure 17]Figure 17 shows the position of the gRNA relative to the U6 promoter in the pX459-hSpCas9-2A-Puro plasmid (using g1 as an example). The "G" nucleotide between the U6 promoter and the gRNA is there to enhance the transcription efficiency promoted by the U6 promoter. This is optional and not required if a different promoter is used or if the gRNA begins with a "G" nucleotide. [Modes for carrying out the invention]

[0162] definition Where used herein and in the claims, “one” ("a" or "an") can mean one or more, depending on the context in which it is used. For example, when referring to “a cell,” it can mean “at least one cell” or “more than one cell.”

[0163] The terms “approximately” or “about” or the symbol “≒” refer to a range of ±10% (including the endpoints) of a given value or state. Unless otherwise evident from the context, all numerical values ​​presented herein may be modified by the term “approximately.”

[0164] The term "AAV.CYP4V2" refers to a recombinant adeno-associated virus (AAV) vector containing a polynucleotide encoding a functional CYP4V2 protein.

[0165] The term "CYP4V2 gene therapy" refers to the introduction of a functional CYP4V2 protein or a polynucleotide encoding a functional CYP4V2 protein into cells and / or a target. See the detailed description in this disclosure.

[0166] The terms “effective dose,” “effective dosage,” or “therapeutic effective dosage” refer to the amount of compound (e.g., vector) and / or cells that, when administered to a subject in need of treatment, is sufficient and / or appropriate to deliver that treatment. The effective dose will vary depending on the specific activity of the therapeutic agent used, the severity of the patient’s condition, and the subject’s age, physical condition, presence of other medical conditions, and nutritional status. Furthermore, any other drug therapies and / or treatments the patient may be receiving will influence the determination of the effective dose of the therapeutic agent to be administered. For further details, please refer to the description herein.

[0167] The terms “treatment” or “to treat” refer to the administration of the compositions disclosed herein (e.g., AAVs containing transgenes, and / or cells) to subjects for purposes including: 1) To prevent or protect against disease or condition, that is, to prevent the development of clinical symptoms. 2) To inhibit a disease or condition, that is, to prevent, slow down, improve, or suppress the onset of clinical symptoms. 3) To alleviate a disease or condition, i.e., to reduce clinical symptoms, and / or 4) To replace and / or restore the function lost of affected cells, tissues, and / or organs. In some embodiments, the term “treatment” or “to treat” refers to alleviating a disease or condition, i.e., reducing clinical symptoms. In some embodiments, the term “treatment” or “to treat” refers to prophylactic treatment of an object in need of treatment, either in lieu of or in addition to the foregoing. Prophylactic treatment can be achieved by providing an appropriate dose of the therapeutic agent to an object at risk of suffering from the disease, thereby substantially avoiding the onset of the disease. Those skilled in the art will understand that “prevention” and “suppression” cannot always be distinguished, as one or more ultimately induced events may be unknown or potential, or may not be confirmed in the patient for some time after the occurrence of one or more events. Accordingly, the term “prevention” as used herein is intended to encompass both “prevention” and “suppression” as defined herein, as an element of “treatment.”

[0168] The term "subject" refers to an animal, such as a mammal (e.g., a human). The methods described herein may be useful for therapeutic, preclinical, and veterinary applications in humans. In some embodiments, the subject is a mammal, and in some embodiments, the subject is a human.

[0169] A “variant” is a protein that has sequence homology to a reference bioactive protein, retaining at least some of the therapeutic and / or biological activity of that bioactive protein. For example, a variant protein may have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with respect to the reference bioactive protein. The term “bioactive protein” includes proteins that have been intentionally modified, for example, by site-directed mutagenesis, insertion, or accidental mutation. A “variant” also includes “fragments” that are cleaved forms of native or unnatural bioactive proteins that retain at least some of the therapeutic and / or biological activity.

[0170] The term “nucleic acid” is used herein to refer to all forms of nucleic acids, polynucleotides, and oligonucleotides, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Nucleic acids include genomic DNA, cDNA, and RNA. Polynucleotides include natural, synthetic, and intentionally modified or altered polynucleotides. Polynucleotides may be single-stranded, double-stranded, or triple-stranded, linear or circular, and of any length. The sequence or structure of a particular polynucleotide may be described herein in accordance with the convention of presenting the sequence in the 5' to 3' direction.

[0171] The term “sequence variant” means a gene or polypeptide modified compared to its natural or original sequence by insertion, deletion, and / or substitution of one or more nucleotides or amino acids. Insertions may be located at one or both ends of a gene or protein, and / or within an internal region of a nucleotide or amino acid sequence. In a deletion variant, one or more nucleotide or amino acid residues are removed from the gene or polypeptide described herein. In a substitution variant, one or more nucleotide or amino acid residues are removed from the gene or polypeptide and replaced with alternative residues. In one embodiment, the substitution is essentially conservative, and this type of conservative substitution is well known in the art.

[0172] As used herein, the terms “therapy” or “treatment” may be applied in vivo to an object or in vitro to cells.

[0173] As used herein, plasmids are a type of vector.

[0174] As used herein, the terms “genetically repaired” or “gene repair” mean cells that originally had a genetic defect in a gene (e.g., mutation or pathological change) and whose genetic defect has been repaired by either gene modification or disruption in the cell’s genomic DNA or mRNA (defined herein as “gene editing,” “gene editing therapy,” or “gene modification”), or gene introduction or supplementation by exogenous nucleic acid molecules into cells expressing a functional protein corresponding to the defective gene (defined herein as “gene introduction therapy” or “gene therapy”).

[0175] As used herein, the terms “percent sequence identity” or “sequence identity” shall be determined and calculated as follows: In calculating (percent) sequence identity, two sequences are aligned and the number of complete matches of nucleotides or amino acid residues between the two sequences is determined. The number of perfect matches is divided by the length of the aligned region (i.e., the number of aligned nucleotide or amino acid residues) and multiplied by 100 to obtain the percentage sequence identity value (and then rounded up to the next largest integer (e.g., 65.01% is rounded up to 66%, which is considered 66% for the purposes of this specification)). It will be understood that the length of the aligned region may be a portion of one or both sequences and may be up to the size of the net full length (without applying gaps) of the shorter sequence. To determine perfect matches and calculate sequence identity between two protein-coding nucleotide sequences, non-coding nucleotide sequences (e.g., introns, UTRs, Kozak sequences, promoters, enhancers, or other regulatory sequences) are removed before submitting the two sequences for alignment and calculating sequence identity. Needleman-Wunsch algorithm (The European Bioinformatics Institute (EMBL-EBI) and World Wide Available on the web: Use ebi.ac.uk / Tools / psa / emboss_needle / nucleotide.htmL for nucleotide alignment and ebi.ac.uk / Tools / psa / emboss_needle / for protein alignment, and default parameters (for nucleotide sequences: Matrix: EDNAFULL. Gap Open Penalty: 10. Gap Extend Penalty: 0.5. Output format: pair. End Gap Penalty: false. End Gap Open Penalty: 10. End Gap Extend Penalty: 0.5. For protein sequences: Matrix: EBLOSUM62. Gap Open Penalty: 10. Gap Extend Penalty: 0.5. Output format: pair. End Gap Penalty: false. End Gap Open Penalty: 10.. End Gap Extend Penalty: 0.5.) Using the Pairwise Sequence Alignment EMBOSS Needle with the following settings: Matrix: EBLOSUM62, Gap Open Penalty: 10, Gap Extend Penalty: 0.5, Output format: pair, End Gap Penalty: false, End Gap Open Penalty: 10, End Gap Extend Penalty: 0.5, an alignment of two sequences can be performed to determine the number of exact matches of nucleotide or amino acid residues between the two sequences and create an optimal global alignment of the two sequences.

[0176] The term "adeno-associated virus vector" refers to a nucleic acid derived from any AAV serotype, such as, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 serotypes, or other viruses or serotypes having capsid protein sequence homology to the capsid proteins of an AAV serotype. The term "recombinant adeno-associated virus" or "rAAV" refers to an infectious replication-deficient virus composed of an AAV protein shell encapsulating a nucleic acid molecule of interest flanked by AAV ITRs on one or both sides. References herein to a particular AAV serotype mean an AAV having at least one capsid protein of that AAV serotype. For example, the term "AAV2" refers to an AAV having at least one AAV serotype 2 capsid protein.

[0177] The term "CYP4V2" refers to cytochrome P450 4V2 or cytochrome P450, family 4, subfamily V, polypeptide 2 (sometimes referred to as CYP4AH1), and its orthologs in other species. Mutations in CYP4V2 are associated with BCD (see, e.g., Li et al., Am J Hum Genet. 74:817-826, 2004) and retinitis pigmentosa (see, e.g., Wang et al., PLOS ONE 7:e33673, 2012). The length of the full-length human CYP4V2 genome is approximately 22,053 bp, which can be found, for example, on the World Wide Web (genecards.org / cgi-bin / carddisp.pl?gene=CYP4V2&keywords=CYP4V2). As used herein, the term "hCYP4V2" refers to the human CYP4V2 gene or protein. It should be understood that hCYP4V2 and CYP4V2 may refer to genes or proteins that contain genetic or epigenetic alterations, or genes or proteins that do not contain genetic or epigenetic alterations.

[0178] As used herein, the term “functional CYP4V2” refers to a protein or nucleotide molecule that, when expressed, produces a protein that is effective in providing therapeutic benefits to an individual (e.g., an individual with a genetic or epigenetic alteration in the CYP4V2 molecule) (e.g., improving or rescuing abnormal fatty acid levels (such as DHA levels) in target cells). A functional CYP4V2 molecule may correspond to a wild-type hCYP4V2 sequence or its naturally occurring variants (e.g., polymorphic variants such as variants that do not contain pathological alterations), or an optimized sequence. In some embodiments, a functional CYP4V2 molecule is a CYP4V2 molecule from another species (e.g., another mammal such as rodents, rabbits, dogs, pigs, or non-human primates) that shares a similar orthology to human CYP4V2. For example, the ortholog of the human CYP4V2 sequence is the mouse mCyp4v3 sequence. In some embodiments, a functional CYP4V2 molecule is another P450 molecule (e.g., the CYP4 protein).

[0179] The term "eye cell" refers to any eye cell or a cell associated with an eye function, and non-limiting examples include retinal cells, retinal bipolar cells, photoreceptor cells or photoreceptor progenitor cells (including rods and / or cones, collectively referred to as "PRC (photoreceptor progenitor cell)"), ganglion cells, retinal pigment epithelium (RPE) cells, choroidal epithelial (CE) cells, corneal epithelium cells (CEC), choroidal cells, corneal cells, or optic nerve cells.

[0180] The terms "function loss" or "dysfunction" refer to a reduction or loss of cell function (e.g., photoreceptor function, photoreceptor cell function, retinal pigment epithelium cell function, lens function, choroidal function, or corneal function) compared to normal non-affected cells, or the same eye at an earlier time point, or the other eye. As used herein, the terms "degeneration", "atrophy", "disorder", "disease", and / or "dystrophy" can be used synonymously with function loss. The term "function enhancement" means improving the function (e.g., the function of photoreceptors, photoreceptor cells, retinal pigment epithelium cells, choroidal cells, or corneal cells), or increasing the number or proportion of functional photoreceptors or photoreceptor cells (e.g., photoreceptor cells, retinal pigment epithelium cells, choroidal cells, or corneal cells) compared to the affected eye (having the same eye disease), the same eye at an earlier time point, the untreated portion of the same eye, or the opposite eye of the same patient.

[0181] The term "transgene" refers to a donor nucleic acid intended to be introduced or introduced into a cell or an organism. The transgene includes any gene, such as the genes or cDNAs shown in Table 4.

[0182] The terms “pharmaceutically acceptable formulation,” “physiologically acceptable formulation,” and “pharmaceutically acceptable carrier” mean a bioacceptable formulation, which may be a gas, liquid, solid, or mixture thereof, suitable for one or more routes of administration in vivo, in vitro, or by contact, and may include formulations or carriers used for the treatment of other diseases (e.g., gene therapy or cell therapy for other eye diseases). A “pharmaceutically acceptable” or “physiologically acceptable” composition is a substance that is not biologically or otherwise undesirable, for example, such a substance can be administered to a subject without causing substantially undesirable biological effects. Such pharmaceutical compositions can therefore be used, for example, when administering proteins, polynucleotides, plasmids, viral vectors, or nanoparticles to cells or subjects. Such compositions include, but are not limited to, solvents (aqueous or non-aqueous), solutions (aqueous or non-aqueous), emulsions (e.g., oil in water or water in oil), suspensions, syrups, elixirs, dispersions, suspensions, coatings, isotonic agents, and absorption enhancers or retarders, which are suitable for drug administration or in vivo or in vitro contact or delivery. Aqueous and non-aqueous solvents, solutions, and suspensions may contain suspending agents, lubricants, and thickeners. Such pharmaceutically acceptable carriers include tablets (coated or uncoated), capsules (hard or soft), microbeads, powders, granules, and crystals. Auxiliary active compounds (e.g., antiseptics, antimicrobials, antivirals, antifungals, and immunosuppressants) may be incorporated into the compositions. Pharmaceutical compositions may be formulated to suit specific administration or delivery routes as described herein or known to those skilled in the art. Thus, pharmaceutical compositions may include carriers, diluents, or excipients suitable for administration by various routes.

[0183] The term "crRNA" refers to CRISPR RNA, which includes both a protospacer element and additional nucleotides complementary to tracrRNA.

[0184] The term "tracrRNA" refers to transactivating RNA, which hybridizes with crRNA, binds to the Cas9 protein, and activates the complex, causing double-strand breaks at specific sites in the genome sequence.

[0185] The term "sgRNA" refers to a single guide RNA, which is a combination of crRNA and tracrRNA (which are separate molecules in the natural CRISPR / Cas9 system of S. pyogenes) in a single RNA construct.

[0186] The term "PAM" refers to a "protospacer adjacent motif," which is a short sequence on any strand of the genome that is recognized as a cleavage site by CRISPR nucleases. PAMs differ depending on the nuclease (e.g., Cas9, Cpf1, etc.). The protospacer element sequence is usually located immediately upstream of the PAM site.

[0187] The term "protospacer element" (also known as "guide RNA," "CRISPR gRNA," "gRNA," or g1, g2, g3, g4, g5, etc.) refers to a portion of crRNA (or sgRNA) that is complementary to a target sequence of genomic DNA.

[0188] DHA: Docosahexaenoic acid; also known as 22:6(ω-3) or C22:6 n3, is a polyunsaturated omega-3 fatty acid.

[0189] AA: Arachidonic acid; a polyunsaturated omega-6 fatty acid also known as 20:4(ω-6) or C20:4 n6, or ARA.

[0190] PBS(+): Phosphate-buffered saline (PBS) containing calcium and magnesium.

[0191] PBS(-): Calcium or magnesium-free phosphate-buffered saline (PBS)

[0192] Methods and compositions for BCD cell disease models Developing appropriate BCD disease models and confirming the molecular phenotype of BCD is crucial for the research, development, and testing of BCD-related drugs and treatment options. This is also important for the study of CYP4V2 function. As outlined in the background technology section of this specification, the clinical phenotype of BCD has been characterized, established, and studied for 80 years, and the gene mutations that cause BCD have been identified for more than 10 years. However, there is still a gap between the clinical phenotype (e.g., crystalline deposits in the retina of BCD patients) and the causative CYP4V2 mutations.

[0193] Previous studies on BCD have shown abnormal fatty acid levels in fibroblasts, lymphocytes, and serum in BCD patients. For example, in Lee et al., The Metabolism of Fatty Acids in Human Bietti Crystalline Dystrophy, Invest Ophthalmol Vis Sci. 2001 Jul;42(8):1707-14, researchers used the pulse chase method to study abnormalities in fibroblasts and lymphocytes of BCD patients. Fibroblasts and lymphocytes from BCD patients and normal controls were incubated with [(14)C]18:3n-3 or [(14)C]18:2n-6. In fibroblasts from BCD patients, the conversion of 18:3n-3 to polyunsaturated fatty acids (PUFAs) was lower than in normal subjects, but this was not the case for 18:2n-6. In another study (Lai et al., Alterations in Serum Fatty Acid Concentrations and Desaturase Activities in Bietti Crystalline Dystrophy Unaffected by CYP4V2 Genotypes, Invest Ophthalmol Vis Sci 2010;51:1092-7), researchers used GC-MS to analyze serum fatty acid concentrations in serum samples from BCD patients and controls. This study found that serum concentrations of octadecanoic acid (18:0) were higher in BCD patients than in control subjects, and concentrations of octadecadienoic acid (18:1n-9) were lower. Furthermore, the total concentration of monounsaturated fatty acids in BCD patients was significantly lower than in controls.In another study (Nakano et al., CYP4V2 in Bietti's Crystalline Dystrophy: Ocular Localization, Metabolism of omega-3-Polyunsaturated Fatty Acids, and Functional Deficit of the p.H331P Variant, Mol Pharmacol 82:679-686, 2012) in which BCD patient samples were not used as study subjects, the results suggested that the CYP4V2 enzyme possesses omega-hydroxylase activity towards omega-3-PUFAs.

[0194] It is important to confirm whether the abnormal fatty acid levels observed in fibroblasts and serum of BCD patients are actually present in the RPE cells of BCD patients, which are the cells that cause BCD. Therefore, a BCD disease model that allows direct examination of RPE cells from BCD patients is desirable to deepen our understanding of the pathophysiology of BCD disease and CYP4V2 function, and to evaluate the effectiveness of treatment options. However, given the location of the RPE and the rarity of BCD, obtaining native RPE cells from BCD patients is not practical.

[0195] This disclosure provides a BCD cell model and a method for generating a BCD cell model. The BCD cell model consists of BCD patient-specific stem cells (non-limited examples include induced pluripotent stem cells (iPSCs), embryonic stem (ES) cells, somatic (or adult) stem cells, mesenchymal stem cells (MSCs)) and ophthalmic cells (non-limited examples include RPE cells, photoreceptor (rod or cone) cells, photoreceptor progenitor cells, corneal epithelial cells, lens cells, and / or choroid cells) derived from any stem cells of a BCD patient. In addition to patient-specific stem cells, a BCD cell model can also be generated by creating an artificial CYP4V2 mutation in cells of an individual without BCD, and such cells may be ES cells, iPS cells, or other stem cells, or any cells that can be reprogrammed into stem cells, or any ophthalmic cells (which may be stem cell-derived or non-derived).

[0196] Induced pluripotent stem cell technology offers an alternative to animal models for disease modeling. However, not all diseases have been successfully modeled using iPSCs (Urbach, A., Bar-Nur, O., Daley, GQ & Benvenisty, N. Differential Modeling of Fragile X Syndrome by Human Embryonic Stem Cells and Induced Pluripotent Stem Cells. Cell Stem Cell 6, 407-411 (2010)). Furthermore, considering the reported fatty acid anabolism associated with BCD, it was unclear whether patient-specific iPS cells or patient-specific iPS-RPE cells for BCD could be generated using iPS technology.

[0197] A. Induction of pluripotency Methods for producing induced pluripotent stem cells (iPSCs) are known in the art. Substantially all types of somatic cells can be used as cell sources for iPSC reprogramming. Briefly, iPSCs can be produced by introducing a specific set of proteins into cells (e.g., nucleic acids encoding a specific set of proteins, or by direct delivery of proteins). One exemplary, non-limiting method, as those skilled in the art will understand, involves introducing one or more transgenes encoding one or more of OCT4, SOX2, KLF4, and / or c-MYC (e.g., "Yamanaka factors"). In some embodiments, all four transcription factors are used in the reprogramming. In some embodiments, one, two, or three transcription factors can be used. Li et al., Stem Cells, 2009;27:2992-3000. Zhu et al., Cell Stem Cell 2010;7:651-655. In some embodiments, iPSCs may be produced by direct delivery of reprogramming proteins. Kim et al., Cell Stem Cell. 2009;4(6):472-6. The examples section shows methods for producing iPSCs using non-integrating methods, such as the Sendai virus (Example 1) or the episome method (Example 2). However, any method for producing iPSCs is assumed to be within the scope of this disclosure.

[0198] iPSCs can be generated using a variety of methods (e.g., Sendai virus, episomal methods, with or without the use of small molecules). See the Examples section. See also, for example, Hubbard et al., J. Vis. Exp., 2014, 92:52009. Also, methods for generating iPSCs from many different cell types are known in the art. See, for example, Hayashi et al., 2012, PLoS One, 7(9):e45435; Poon et al. 2015, PLoS One, 10(7):e0131288; Lamba et al. 2010, PLoS One, 5(1):e8763. Typically, iPSCs express at a detectable level at least one marker, including, as non-limiting examples, Oct-4, Sox-2, SSEA4, TRA-1-60, TRA-1-81, AP, and / or NANOG.

[0199] Any type of stem cell can be used to generate the BCD cell model described herein, including, as non-limiting examples, induced pluripotent stem cells (iPSCs), hematopoietic stem cells (HSCs), embryonic stem (ES) cells, mesenchymal stem cells, adult stem cells, or tissue-specific stem cells. The stem cells used in the methods described herein can be pluripotent, multipotent, or totipotent stem cells.

[0200] As used herein, the term “pluripotent” refers to a cell capable of developing into at least one of the ectoderm, endoderm, and mesoderm cells. In one embodiment, the term “pluripotent” refers to a totipotent and multipotent cell. As used herein, the term “totipotent” refers to a cell capable of developing into all lineages of cells. As used herein, the term “multipotent” refers to a cell that has not been terminally differentiated. The pluripotent cells disclosed herein may be any stem cells or may be produced from non-pluripotent cells such as fibroblasts using induction, dedifferentiation, and nuclear transfer methods known in the art. The pluripotent cells described herein, whether stem cells or cells produced from non-pluripotent cells, may be from subjects with BCD or CYP4V2 mutations or from healthy individuals without BCD for use as a control or for producing artificial CYP4V2 mutations.

[0201] It is possible to reprogram virtually any type of cell into iPS cells. See the subsection titled “Cell Origin” in this specification.

[0202] B.iPSC differentiation iPS cells from BCD patients were differentiated into iPS-RPE cells (or other types of ophthalmic cells (e.g., iPS-CEC, iPS-CE cells, or iPS-PRC)). Methods for differentiating iPSCs into RPE cells or other types of ophthalmic cells (e.g., CEC or PRC) are known. See, for example, the Examples section; Hayashi et al., 2012, PLoS One, 7(9):e45435, Songstad, et al., Investigative Ophthalmology & Visual Science December 2015, Vol.56, 8258-8267, and Lamba et al., PLoS One. 2010 Jan 20;5(1):e8763. For example, induced pluripotent stem cells (iPSCs) can be produced by reprogramming cells, and these can then be further differentiated into, for example, RPE cells (hereinafter referred to as "iPS-RPE"), corneal epithelial cells (hereinafter referred to as "iPS-CEC"), photoreceptor cells (or photoreceptor progenitor cells, hereinafter referred to as "iPS-PRC"), or iPS-choroidal endothelial (CE) cells (hereinafter referred to as "iPS-CE").

[0203] Differentiated cells, such as iPS-RPE cells, were tested for biochemical function (as described herein and in the Examples section) to evaluate their biochemical defects / abnormalities compared to healthy control iPS-RPE cells.

[0204] iPS-RPE cell lines prepared as described herein express indicative morphological features of RPE cells (e.g., pigmentation and hexagonal shape) and / or one or more biomarkers. Biomarkers for RPE cells (and iPS-RPE cells) are known and, in non-limiting examples, include one or more of RLBP1 (also known as CRALBP), RPE65, BESTROPHIN-1, MITF, VINCULIN, LRAT, RDH5, PAX6, MERTK, TYR, and / or ZO-1, which can be used to determine or confirm that RPE differentiation has occurred. Similarly, biomarkers for CECs (and iPS-CECs) and PRCs (and iPS-PRCs) are known and, for example, cytokeratin 12 and cytokeratin 3 for corneal epithelial cells; and Crx for photoreceptors, recavitin for rods and cones, and Nrl for rods.

[0205] Using the iPS reprogramming method and RPE differentiation method described in the Examples section, we successfully generated BCD patient-specific iPS cells and iPS-RPE cells.

[0206] Biochemical assays to identify biochemical defects / abnormalities in iPS-RPE cells from C.BCD patients, and cell viability assays to evaluate RPE atrophy. A series of biochemical assays were developed and used to evaluate and determine the phenotype of BCD patient-specific iPS-RPE cells.

[0207] First, a more complete list of fatty acids was included in the biochemical assays of this disclosure. Previous studies have identified abnormal serum fatty acid levels in BCD patients, testing samples for the following fatty acids: 16:0, 16:1, 18:0, 18:1n-9, 18:2n-6, 18:3n-3, 20:3n-6, 20:4n-6, 22:5n-3, 22:6n-3, 24:0, and 24:1. This study found that serum concentrations of octadecanoic acid (18:0) were higher and octadecadienoic acid (18:1n-9) were lower in BCD patients than in control subjects. To determine whether the same fatty acid abnormalities are present in BCD patient-specific iPS-RPE cells, and whether there are further abnormalities in other fatty acids, we developed biochemical assays encompassing more fatty acids using LC-MS (see Table 2).

[0208] Furthermore, to determine whether BCD patient-specific iPS-RPE cells possess other abnormalities in addition to fatty acids, other lipid species, including ceramide (Cer), sphingomyelin (SM), and sphingosine and sphinganin (SOSA), were included in assays that analyzed the phenotype of BCD disease models and determined the biochemical function of the CYP4V2 protein. See Table 2 for a list of the various species and compounds included in the biochemical assays used to test BCD patient-specific iPS-RPE cells.

[0209] Surprisingly, the test results (see the Examples section) revealed that BCD patient-specific iPS-RPE cells have a different fatty acid abnormality profile than those found in the serum of BCD patients.

[0210] The eye is the light-sensing organ in the human body. BCD begins with RPE atrophy, which leads to photoreceptor death and vision loss. A key function of the RPE is light absorption (Strauss, 2005, The retinal pigment epithelium in visual function. Physiol Rev 85:845-81). Exposure to ambient light may influence the development and progression of human retinal degenerations such as age-related macular degeneration (AMD) and retinitis pigmentosa (RP). The use of light exposure in eye disease models is a suitable model system for studying retinal degeneration. Light exposure, including blue light exposure, is widely used in retinal research (Dual roles of polyunsaturated fatty acids in retinal physiology and pathophysiology associated with retinal degeneration, Masaki Tanito & Robert Anderson (2009) Clinical Lipidology, 4:6, 821-827. Seko, et al., Graefes Arch Clin Exp Ophthalmol. 2001 Jan;239 (1):47-52. Blue light-induced apoptosis in cultured retinal pigment epithelium cells of the rat. Narimatsu, et al., Exp Eye Res. 2015 Mar;132:48-51. Blue light-induced inflammatory marker expression in the retinal pigment epithelium-choroid of mice and the protective effect of a yellow intraocular lens material in vivo).Blue light is found in ambient light such as sunlight and artificial lighting (e.g., office lighting), as well as in electronic display devices such as televisions, monitors, smartphones, notebooks, and tablets (Moon, et al., Blue light effect on retinal pigment epithelial cells by display devices, Integr Biol (Camb). 2017, 22;9(5):436-443. doi:10.1039 / c7ib00032d).

[0211] In this study, RPE atrophy was detected in a BCD cell model using a cell viability assay. Exposure to (blue) light induced significantly higher cell death in iPS-RPE samples from BCD patients compared to control samples. The clinical phenotype of BCD (i.e., RPE atrophy) is evident in the BCD cell model. AAV.CYP4V2 showed efficacy in rescuing RPE atrophy in the BCD cell model.

[0212] Applications of the D.BCD cell model In addition to evaluating cellular-level phenotypes associated with BCD, BCD cell models can also be used for other applications of disease models (non-limiting examples include drug screening, development of therapeutic agents or devices, determination of dosage ranges, safety and toxicity testing, testing of various formulations for BCD or other conditions associated with CYP4V2, or research into the function and applications of CYP4V2 (non-limiting examples include development and screening of drugs containing or expressing the CYP4V2 protein, such as CYP4V2 gene therapy)). Furthermore, BCD patient-specific iPS-RPEs (and other BCD patient-specific stem cell-derived ophthalmic cells, such as iPS-photoreceptor cells and iPS-corneal cells, as non-limiting examples) may be used as cell therapies in their unmodified form or after gene repair (e.g., by gene transfer or gene editing as described herein). The Examples section provides non-limiting examples of applications of BCD cell models.

[0213] E. Compound Screening Methods Importantly, the iPSC-RPE cell lines described herein can provide human cell disease models (e.g., BCD, retinitis pigmentosa, IRD). Such iPSC-RPE cells, iPSC-CEC cells, or iPSC-PRC cells can be collectively referred to as “iPSC-ophthalmic cells” and can be used for the diagnosis, prognosis, and prediction of disease onset, severity, and progression in patients with BCD, retinitis pigmentosa, or other types of hereditary retinal diseases. For example, such iPSC-ophthalmic cell lines can also be used to screen test compounds for compounds that may have therapeutic effects in treating or preventing diseases associated with genetic or epigenetic changes in CYP4V2 nucleic acid (e.g., BCD).

[0214] Pluripotent cells described herein, particularly those produced from subjects with genetic or epigenetic alterations in CYP4V2 or from subjects with ocular diseases (e.g., BCD), can be used as a research tool for identifying compounds that are therapeutic candidates for the treatment, diagnosis, prognosis, or prevention of ocular diseases (e.g., BCD). It will be understood that the test compounds can be any type of compound. They may be naturally occurring or produced by chemical synthesis. They may be structurally defined chemical compounds, uncharacterized compounds or substances, or libraries of mixtures of compounds. Those skilled in the art will understand that the test compounds may, but are not limited to, nucleic acids or their analogues, polypeptides or their analogues, antibodies, chemicals, and small molecules.

[0215] The cells described herein can be evaluated in animal models (e.g., animal model eyes) in the presence or absence of the test compound for their ability to grow and function, and for whether or not they have a tendency to form tumors. Many methods can be used to evaluate the cells, including, but not limited to, PCR techniques, immunoassays, and / or lipid / fatty acid metabolism analysis.

[0216] Methods and compositions of cell therapy As described herein, CYP4V2 gene therapy has demonstrated efficacy in correcting biochemical abnormalities in BCD patient-specific iPS-RPE cells. However, a prerequisite for gene therapy to function in vivo is that some RPE and photoreceptor cells remain in the eye of the subject during treatment. In late-stage BCD patients where little or no RPE or photoreceptor cells remain in the eye, cell therapy may be used in combination with gene therapy as an alternative therapy or treatment option.

[0217] In cell therapy, new cells are transplanted to replace dead or degenerated cells. In the case of BCD, the new cells may be RPE cells, photoreceptor cells (cone and / or rod), photoreceptor progenitor cells, choroidal cells, corneal epithelial cells, lens cells, or other types of ophthalmic cells, depending on which types of cells in the subject are degenerated and require replacement. In the following descriptions and examples herein, iPS-RPE cells were used to illustrate the methods and processes. These may also be applied to other types of ophthalmic cells.

[0218] Cell therapy for BCD, and other types of eye diseases, including, in non-limited examples, hereditary retinal diseases (IRD), retinitis pigmentosa (RP), and macular degeneration (including age-related macular degeneration (AMD)), can be classified as follows:

[0219] (1) Allogeneic transplantation: In one embodiment, RPE cells, PRCs, CECs, CE cells, and other ophthalmic cells derived from healthy donor embryonic stem cells (ESCs) or iPSCs can be used for allogeneic transplantation as cell therapy for BCD. This involves differentiating healthy ESCs or iPSCs from a healthy individual (i.e., an individual without the CYP4V2 mutation) into RPE cells and transplanting such ESC-RPE cells into the eye of a BCD patient. Methods for reprogramming iPSCs and differentiating ESCs or iPSCs into RPE are presented in the Examples section of this specification. In previous studies, RPE cells derived from embryonic stem cells (ESCs) have been used to treat age-related macular degeneration (AMD). See Schwartz et al., Investigative Ophthalmology & Visual Science April 2016, Vol.57, ORSFc1-ORSFc9. The advantage of allograft or allogenic transplantation is that it is less expensive than autologous transplantation because one common source can be used to treat multiple patients. However, it has significant disadvantages, such as the possibility that immune rejection by the host subject can greatly affect its effectiveness and duration. Furthermore, it requires the use of immunosuppressants for extended periods, which can lead to severe systemic side effects. Finally, the use of ESCs may raise ethical concerns.

[0220] (2) Autologous transplantation without gene repair: In one embodiment, autologous cells may be used in cell therapy for BCD. One such autologous source is iPS cells and iPS-RPE cells derived from BCD patients, which may be transplanted into the eyes of BCD patients. BCD is a disease with a relatively late onset. Symptoms of BCD patients typically appear in their teens, twenties, or even thirties. Furthermore, the iPS reprogramming process has a certain degree of "clock reset" effect on iPS cells and iPS cell-derived cells. Therefore, iPS-RPE cells and other iPS-ocular cells derived from BCD patients can be used as cell therapy for transplantation into BCD patients even without gene repair of the CYP4V2 mutation in the iPS-RPE cells. Methods for reprogramming iPS cells and differentiating RPE cells are presented in the Examples section of this specification. As a precautionary measure, whole-genome sequencing may be performed to determine whether any disease-causing mutations were generated during the iPS reprogramming and RPE differentiation processes, and the genomic DNA of the iPS cells or iPS-RPE cells may be compared with the genomic DNA of the source cells (e.g., fibroblasts or blood cells).

[0221] (3) Autologous cells of genetically restored patients for cell therapy of BCD and other types of IRD and RP This disclosure provides methods and compositions for generating genetically repaired autologous cells for cell therapy. As used herein, the terms “genetically repaired” or “gene repair” refer to the correction of CYP4V2 mutations or the correction or compensation of defective mRNA in the patient’s cells by gene editing of the patient’s genome (e.g., direct editing on chromosomes using CRISPR / Cas9, CRISPR / Cpf1, zinc fingers, TALEN, etc.) or by gene introduction into patient cells of a healthy copy of the CYP4V2 gene (cDNA, RNA, or other form) that is not normally incorporated into the genome (e.g., CYP4V2 gene therapy as described herein).

[0222] As diseases caused by gene mutations, autologous cells used in cell therapy for BCD or other IRD or RP ideally have their genetic defects (i.e., CYP4V2 mutations) and / or dysfunctional CYP4V2 protein corrected before transplantation. In one embodiment, as described herein, such gene repair may be achieved by gene therapy, including, as a non-limiting example, AAV-mediated gene transtherapy of nucleic acid sequences encoding and expressing functional CYP4V2 protein. Compositions and methods of CYP4V2 gene transtherapy are presented herein. See the Detailed Description of the Invention and Examples section. BCD patient-specific source cells, iPS cells, or iPS-RPE cells may be treated with AAV.CYP4V2 (presented herein), followed by iPS reprogramming and / or RPE differentiation (if applicable), and verification of improved biochemical function (presented herein), and transplanted into the eye of the same patient. In another embodiment, such gene repair may be achieved by gene editing, for example, correcting CYP4V2 mutations in the genome or RNA of BCD patient cells. In addition to being applied in vitro as part of cell therapy, such gene editing may also be applied directly in vivo as gene therapy. Such gene editing may be performed on the patient's source cells (e.g., fibroblasts or hematopoiesis), iPS cells, iPS-RPE cells, or other types of iPS-ophthalmic cells. iPS reprogramming and RPE differentiation for the production of patient-specific iPS cells and iPS-RPE cells may be performed before or after gene repair (such as gene transtherapy or gene editing).

[0223] This disclosure provides compositions and methods for correcting CYP4V2 mutations through gene editing. The Examples section describes compositions and methods for correcting the c.802-8_810del17insGC mutation, the most common mutation among BCD patients, using a CRISPR / Cas9 construct. These may also be applied in combination with other gene editing methods (e.g., CRISPR / Crp1, TALEN, zinc finger) and other IRD mutations (e.g., other CYP4V2 mutations listed in Table 1, but not limited to these) using methods known in the art.

[0224] The most common CYP4V2 mutation in BCD patients is c.802-8_810del17insGC (referring to a 17-base deletion and a 2-base (GC) insertion at a site beginning 8 bases from the end of intron 6 of the CYP4V2 gene, also known as IVS6-8 del / insGC. See Sequence ID 46, which shows the sequence of the human CYP4V2 genomic DNA region containing the c.802-8_810del17insGC mutation, and Sequence ID 47, which shows the corresponding wild-type sequence. The c.802-8_810del17insGC mutation is shown in the following sequence representing the human CYP4V2 intron 6-exon 7 junction. The intron 6 sequence is shown in lowercase, and the exon 7 sequence in uppercase. The 17bp deletion and GC insertion are shown in parentheses): caa aca gaa gca tgt gat tat cat tca aa (tca tac agG TCA TCG CT)(GC)GAA CGG GCC AAT GAA ATG AAC GCC AAT GA) (Sequence ID 46). This is expected to cause exon 7 skipping. (Xiao et al., Biochem Biophys Res Commun. 409:181-6, 2011, Meng et al., 2014, Mol. Vis., 20:1806-14, Wada et al., Am J Ophthalmol. 139:894-9, 2005, Jiao et al., European Journal of Human Genetics (2017)25, 461-471). Recent studies have estimated the age of the c.802-8_810del17insGC mutation to be 1,040-8,200 generations in Chinese and 300-1,100 generations in Japanese. Jiao et al., European Journal of Human Genetics (2017)25, 461-471.

[0225] As described herein, cell therapy (also known as cellular therapy or cytotherapy) can be used to treat or prevent the eye diseases in question. As described herein, BCD, certain RP, IRD, and other eye diseases mentioned herein are associated with genetic or epigenetic alterations of the CYP4V2 nucleic acid sequence.

[0226] Cell therapy generally involves injecting, implanting, transplanting, or otherwise delivering a cell-containing composition to a target (e.g., a patient's tissue or organ (e.g., the eye)). The methods described herein are unique in that they enable genetically repaired autologous cell therapy for subjects with eye disease.

[0227] This specification describes a method comprising obtaining cells from a subject having an eye disease (e.g., related to genetic or epigenetic changes in the CYP4V2 nucleic acid sequence) and repairing mutations in the CYP4V2 nucleic acid (such as DNA or RNA) by means of repair, such as gene editing or delivery of a nucleic acid sequence encoding a functional CYP4V2 protein (such as gene transfer). The cells may be made pluripotent (e.g., by inducing pluripotency for iPSC production) and differentiated into one or more ophthalmic cells (e.g., iPS-RPE, iPS-CEC, iPS-PRC) before administration to a subject (e.g., the subject's eye). It will be understood that the genetic repair of the cells may be performed before or after pluripotency, or after differentiation into ophthalmic cells.

[0228] A. Origin of Cells In some cases, autologous cells (e.g., subject-specific cells) may be used in the cell therapy methods described herein. For example, cells such as fibroblasts or peripheral blood mononuclear cells (PBMCs) may be obtained from the subject and used to create iPSCs as described in the Examples section. Since iPSCs can be created using substantially any type of cell, any type of cell may be used as the source cell. In some cases, iPSCs can be created using cells obtained from urine (see, for example, Zhou et al., 2012, Nat. Protoc., 7:2080-9) or hair follicle or dermal papilla cells (see, for example, Muchkaeva et al., 2014, Acta Naturae, 6:45-53).

[0229] B. Induction of pluripotency Methods for producing induced pluripotent stem cells (iPSCs) are known in the art. Briefly, iPSCs can be produced by introducing a specific set of proteins (e.g., nucleic acids encoding a specific set of proteins) into cells. Those skilled in the art will understand that one exemplary, non-limiting method involves introducing one or more transgenes encoding OCT4, SOX2, KLF4, and c-MYC (e.g., "Yamanaka factors"). In some embodiments, all four transcription factors are used in the reprogramming. In some embodiments, one, two, or three transcription factors may be used. Li et al., Stem Cells, 2009;27:2992-3000. Zhu et al., Cell Stem Cell 2010;7:651-655. In some embodiments, iPSCs may be produced by direct delivery of the reprogramming proteins. Kim et al., Cell Stem Cell. 2009;4(6):472-6. The Examples section describes methods for producing iPSCs using non-integrated methods, such as the Sendai virus (Example 1) or the episome method (Example 2). However, any method for producing iPSCs is envisioned within the scope of this disclosure.

[0230] iPSCs can be generated using various methods (e.g., Sendai virus, episome method, with or without small molecules). See the Examples section. Also, see, for example, Hubbard et al., J. Vis. Exp., 2014, 92:52009. Furthermore, methods for generating iPSCs from many different cell types are known in the art. See, for example, Hayashi et al., 2012, PLoS One, 7(9):e45435; Poon et al. 2015, PLoS One, 10(7):e0131288; Lamba et al. 2010, PLoS One, 5(1):e8763. Typically, iPSCs express at least one marker at a detectable level, including, but not limited to, Oct-4, Sox-2, SSEA4, TRA-1-60, TRA-1-81, AP, and / or NANOG.

[0231] Any type of stem cell may be used in the cell therapies described herein, and non-limiting examples include induced pluripotent stem cells (iPSCs), hematopoietic stem cells (HSCs), embryonic stem (ES) cells, mesenchymal stem cells, adult stem cells, or tissue-specific stem cells. The stem cells used in the methods described herein may be pluripotent, multipotent, or totipotent stem cells.

[0232] As used herein, the term “pluripotent” refers to a cell capable of developing into at least one of the ectoderm, endoderm, and mesoderm cells. In one embodiment, the term “pluripotent” refers to a totipotent and multipotent cell. As used herein, the term “totipotent” refers to a cell capable of developing into all lineages of cells. As used herein, the term “multipotent” refers to a cell that has not been terminally differentiated. The pluripotent cells of the present invention may be any stem cells, or they may be produced from non-pluripotent cells such as fibroblasts using induction, dedifferentiation, and nuclear transfer methods known in the art. The pluripotent cells described herein may be stem cells, cells produced from non-pluripotent cells, cells from subjects with BCD or CYP4V2 mutations, or cells from healthy individuals.

[0233] iPSCs are characterized by one or more of the following: a. The unique form of iPSCs; b. One or more pluripotency markers such as Oct-4, Sox-2, SSEA-4, TRA-1-60, TRA-1-81, Nanog, and AP; c. The ability to differentiate into a desired cell type (e.g., RPE cells); and / or d. Teratoma assay. Not all of the above are necessary for characterizing iPSCs and verifying their pluripotency (see, for example, teratomas; Buta et al., 2013, Stem Cell Res., 11(1):552-562).

[0234] C. Gene editing In the methods described herein, a number of gene editing techniques can be used to repair genetic or epigenetic changes present in the target CYP4V2 nucleic acid. Gene editing can be carried out using any number of techniques, such as clustered regularly interspaced short palindromic repeat (CRISPR) techniques (see, e.g., U.S. Patents 8,697,359, 8,889,418, 8,999,641 and U.S. Patent Publication No. 2014 / 0068797), activator-like effector nuclease (TALEN) techniques (see, e.g., Li et al., 2011, Nucleic Acids Res., 39(14):6315-25), or zinc finger nuclease techniques (see, e.g., Wright et al., 2005, The Plant J., 44:693-705).

[0235] To perform gene editing using CRISPR technology, one or more nucleic acids encoding a nuclease (for example, Cas9 nuclease is commonly used, but other nucleases (for example, other Cas nucleases such as Cpf1, or non-Cas nucleases) may be used) may be incorporated into a vector and administered to a subject as described herein. For example, the cells described herein (e.g., target cells before reprogramming to iPSCs; target iPSCs before differentiation to RPEs, corneal epithelial cells, or photoreceptor cells; or target iPSCs after differentiation to RPEs, corneal epithelial cells, or photoreceptor cells (hereinafter referred to as "iPSCs-RPE," "iPSC-CEC," or "iPSC-PRC")) may be transducted or transfected with one or more constructs (e.g., vectors, RNPs, mRNA) comprising and / or encoding at least one guide RNA (gRNA), at least one CRISPR-related protein (e.g., Cas9 or Cpf1), and at least one donor template nucleic acid. In some embodiments, for example, if gene repair is achieved by knockout, the donor template nucleic acid is not required.

[0236] Similarly, to perform gene editing using TALEN technology, nucleic acids encoding TALEN (e.g., dimeric transcription factors / nucleases) may be incorporated into a vector and administered to a subject as described herein. Similarly, to perform gene editing using zinc finger nuclease technology, nucleic acids encoding custom DNA endonucleases (e.g., heterodimers in which each subunit contains a zinc finger domain and a FokI endonuclease domain) may be incorporated into one or more vectors and administered to a subject as described herein.

[0237] The components required to implement each of these technologies are commercially available and can be customized to suit specific target sequences. See, for example, Caribou Biosciences, GenScript, CRISPR Therapeutics, Editas Medicine, Cellectis Bioresearch, Life Technologies, Sangamo BioSciences, or Sigma Aldrich Chemical Co.

[0238] Under appropriate circumstances, gene editing may occur to repair genetic or epigenetic changes in the target CYP4V2 nucleic acid, resulting in the expression of a functional CYP4V2 protein. The CYP4V2 nucleic acid sequence is considered repaired when the presence of CYP4V2 nucleic acid (such as CYP4V2 mRNA), the presence of CYP4V2 protein, or the function of CYP4V2 protein is restored. Similarly, the terms “repaired” or “corrected” may refer to restoring a sequence that has been affected (e.g., genetic or epigenetic changes) to its original state relative to a wild-type sequence or another non-mutant sequence described herein.

[0239] It may be desirable to introduce one or more mutations into cells using gene editing (e.g., CYP4V2 nucleic acid). This is a method that can be used to create a cell model of a disease (e.g., BCD). For example, gene editing may be performed on embryonic stem cells (ES cells) to create a cell line containing an artificial CYP4V2 mutation, which can then be differentiated into RPE cells. Alternatively, gene editing may be performed on an iPS cell line or RPE cell line (e.g., ARPE-19 cell line) from a healthy subject (e.g., a non-BCD subject) to create a CYP4V2 mutant iPS or CYP4V2 mutant RPE cell line.

[0240] In some cases, it is desirable to screen the cells after the gene editing process is complete (e.g., using whole-genome sequencing) to confirm that the target mutation has been repaired and that no significant off-target editing has occurred.

[0241] CRISPR, also known as CRISPR-Cas9, is composed of an RNA-induced nuclease (Cas9) and a guide RNA, which generate site-specific DNA breaks that are repaired by endogenous cellular mechanisms. Possible consequences of this approach include mutations at specific sites via mutagenic non-homologous end joining (NHEJ), resulting in insertions or deletions (indels) at the break site, and precise alterations of the genome sequence via homologous recombination (HR) using exogenously introduced donor templates. The CRISPR guide RNA consists of two RNAs: CRISPR-targeting RNA (crRNA, also referred to herein as CRISPR RNA) and trans-activating crRNA (tracrRNA). The crRNA is typically about 20 nucleotides (nt) long. crRNA hybridizes to the target DNA sequence via Watson-Crick base pairs, inducing Cas endonuclease to cleave the target genomic DNA.

[0242] To genetically repair the most common CYP4V2 mutations through gene editing, we developed various CYP4V2 mutation CRISPR modification constructs (see examples). CRISPR was chosen because it is easier to implement and more efficient than other forms of gene editing, such as TALENs and zinc finger nucleases. The CRISPR constructs include optimized in vitro validated gRNA sequences and various construct options that can be easily used to modify the c.802-8_810del17insGC mutation in BCD patient cell lines, and can yield genetically repaired cells that can be used in cell therapies, including autologous cell therapy, for BCD.

[0243] CRISPR gene editing therapy involves the use of CRISPR-related proteins (Cas), which are nucleases, and CRISPR guide RNA. The role of the CRISPR guide RNA is to guide Cas to the target sequence via a protospacer element contained in the CRISPR guide RNA that is complementary (or specific) to the target sequence. The presence of a protospacer adjacency motif (PAM) sequence is also necessary for Cas (e.g., Cas9 or Crf1) to bind to the target sequence and cleave near the target sequence. The PAM sequence is a short DNA segment (usually 2-6 nucleotides) that functions as a binding signal for Cas. Different Cass can have different PAMs and cleavage patterns. For example, in the case of Streptococcus pyogenes Cas9 (SpCas9), the standard PAM sequence is NGG. In the case of Staphylococcus aureus (SaCas9), the PAM sequence is NGRRT or NGRRN. In the case of Neisseria meningitidis (NM) and Treponema denticola (Td), the PAM sequences are NNNNGATT and NAAAAC, respectively. In modified or mutated Cas, the PAM sequence may also change. For example, the PAM sequence of SpCas9 VQR variants (D1135V, R1335Q, and T1337R) is NGAN or NGNG. The PAM sequence of SpCas9 EQR variants (D1135E, R1335Q, and T1337R) is NGAG. The PAM sequence for SpCas9 VRER variants (D1135V, G1218R, R1335E, and T1337R) is NGCG. In the case of Cpf1, the PAM sequence is TTTN. Normally, Cas produces double-strand breaks (DSBs), but modified Cas may produce single-strand breaks (e.g., SpCas9 nickase (Cas9n D10A)) or no breaks at all (dCas9). Cas9 produces a blunt end 3nt upstream of the PAM site, but Cpf1 makes a zigzag cleavage, producing a 5' overhang of 5 nucleotides 18-23 bases away from the PAM.

[0244] Cas9's CRISPR guide RNA typically includes CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). The crRNA contains a protospacer element sequence designed to be complementary (or specific) to a target sequence within or near the gene to be modified, disrupted, or replaced, and a sequence corresponding to the complementary region of the tracrRNA. The tracrRNA contains a region complementary to the corresponding region of the crRNA and a sequence that interacts with CRISPR-related protein 9 (Cas9). TracrRNA is not required for Cpf1.

[0245] The length of a protospacer element is typically about 20 nucleotides. Longer or shorter protospacer element sequences (about 16–24 nt) may be used. The protospacer element may be 100% complementary to the target sequence or may contain a mismatch with the target sequence. In some embodiments, a "G" nucleotide may be optionally added to the beginning of the protospacer element sequence.

[0246] After a DNA molecule is cleaved by Cas, it can be repaired by one of two methods. Error-prone non-homologous end joining (NHEJ) repair can cause indel mutations that may disrupt the function of the protein encoded by the gene. Using NHEJ, it is possible to create artificial mutations in a cell line. In some embodiments, it may be used to create mutations (e.g., indels in the exon or splice acceptor region) in the CYP4V2 gene of a cell line without endogenous CYP4V2 mutations (e.g., ES cells, iPS cells, or ARPE-19 cell line), thereby creating a disease cell model (e.g., a BCD cell model). Furthermore, two CRISPR guide RNAs may be used together to knock out a target region of a target gene or the entire target gene, thereby creating a knockout model. In some embodiments, for example, in the treatment of dominant genetic diseases, CRISPR-based gene silencing is used to disrupt (or silence) or delete a gene. During gene silencing, cells attempt to repair damaged DNA, but NHEJs often perform repairs with errors that disrupt the gene, thereby effectively silencing it. In some embodiments, NHEJs may also result in mutation correction, for example, especially if the mutation is a change of one nucleotide or less than about 10 nucleotides. Alternatively, if a donor nucleic acid sequence is available, DNA breaks can be repaired by homology-directed repair (HDR) for modification or substitution of the target gene. The donor nucleic acid sequence may be provided in the form of single-stranded DNA (ssDNA or single-stranded oligonucleotide (ssODN)) or a vector. In some embodiments, for donor nucleic acid sequences provided as ssODN, the donor nucleic acid sequence is approximately 1 kb, approximately 800 bp, approximately 600 bp, approximately 500 bp, approximately 400 bp, approximately 300 bp, approximately 280 bp, approximately 260 bp, approximately 240 bp, approximately 220 bp, or less than approximately 200 bp.In some embodiments, the donor nucleic acid sequence is approximately 25kb, 20kb, 15kb, 10kb, 9kb, 8kb, 7kb, 6kb, 5kb, 4.5kb, 4kb, 3.5kb, or less than or equal to 3kb, in the case of a donor nucleic acid sequence provided in a vector. In some embodiments, the donor nucleic acid sequence is symmetrical. In some embodiments, the donor nucleic acid sequence is asymmetrical. In some embodiments, the length of the donor nucleic acid sequence may be adjusted to increase the HRD rate. In some embodiments, if the PAM targeted by Cas used in CRISPR gene editing is also present in the donor nucleic acid sequence, the donor template or the DNA sequence repaired by the donor template may be prevented from being cleaved and destroyed by Cas by mutating (changing to a different nucleotide) the donor nucleic acid sequence so that the PAM is not present. In addition to correcting or replacing a mutated or defective gene or part thereof, HDR may be used to create artificial mutations (e.g., inserting mutations into exons or splice acceptor regions) in the CYP4V2 gene of cell lines lacking endogenous CYP4V2 mutations (e.g., ES cells, iPS cells, or ARPE-19 cell lines), thereby creating disease cell models (e.g., BCD cell models).

[0247] The CRISPR guide RNA and Cas used in CRISPR gene editing therapy may be provided in the form of a vector (e.g., plasmid (e.g., pX330, pX458, pX459), recombinant AAV vector, or recombinant lentiviral vector), or mRNA and / or RNA and protein encoding such components.

[0248] The donor template can be provided as ssDNA (e.g., ssODN) for use in HDR, or it can be cloned into a plasmid or other type of vector (e.g., an AAV vector (e.g., AAV2 or AAV6)) for use in HDR.

[0249] Various compositions and methods can be used to improve on-target editing or repair efficiency and / or reduce potential off-target effects. For example, various Cass (e.g., Cas9 or Cpf1), or various species of Cas (e.g., SpCas9, SaCas9, NMCas9), or variants (SpCas9, SpCas9 VQR) may be used to broaden the available PAM options for the target sequence and improve specificity. If the target sequence region does not have an NGG PAM site for SpCas9 but is AT-rich, Cpf1 may be considered instead. Since Cas9 nickase (e.g., Cas9 D10A) only generates single-strand breaks in the target DNA, two paired CRISPR guide RNAs are required to generate double-strand breaks. Because it is unlikely that two off-target nicks will be generated close enough to produce a DSB, the above requirement dramatically improves target specificity. Furthermore, asymmetric donor templates may improve the HDR rate. Catalytically inactive dCas9 does not cleave target DNA, but it can achieve sequence substitution without any error-prone repair typically associated with Cas9 cleavage. See Richardson et al., Nature Biotechnology 34, 339-344 (2016).

[0250] The two objectives of gene editing are to achieve targeted gene modification while avoiding or minimizing off-target editing. Previous studies have revealed off-target mutations caused by gene editing technologies, including non-limiting examples such as CRISPR and TALEN. See Tsai et al, Nature Biotechnology 33, 187-197 (2015), Wang et al., Nature Biotechnology 33, 175-178 (2015), and Wu, WH et al. CRISPR repair reveals causative mutation in a preclinical model of retinitis pigmentosa. Mol. Ther. 24, 1388-1394 (2016). In the case of gene editing used in vivo or in cell therapy (e.g., first transplanting cells in vitro, then transplanting cells in vivo), the avoidance or minimization of off-target editing is just as important as achieving targeted gene modification, as off-target editing can cause disease or induce tumorigenesis. It should be noted that not all off-target editing is predictable by computer software or algorithms.

[0251] Therefore, the development and validation of the CYP4V2 mutant CRISPR gene modification construct required careful design, validation, and refinement. (1) Multiple gRNA candidates were generated based on mutant CYP4V2 nucleic acid sequences containing the c.802-8_810del17insGC mutation. (2) The top five gRNAs were selected based on the following criteria (see SEQ ID NOs. 48 to 52, Table 5 and Figure 12): a. The gRNA cleavage site is close to the modification site, and Off-target profile of b.gRNA. (3) The activity of the top five gRNAs was examined in genomic DNA from BCD patients with homozygous c.802-8_810del17insGC mutations (see Figure 13). Based on (4)(2) and (3), three gRNAs were selected. Each of the three gRNAs was cloned into the pX459 plasmid along with the nucleic acid sequences encoding Cas9 and the puromycin resistance gene (Puro) for the selection of transfected cells using puromycin (see Figures 15 and 18). (5) Two donor templates (both forward-complementary and reverse-complementary) were prepared to provide HDR donor nucleic acid sequences. ssODNs containing the donor template sequences were synthesized by IDT (see SEQ ID NOs. 56 and 57). (6) In addition to plasmid constructs, we developed a CRISPR RNP construct. The RNP construct offers specific advantages compared to the other constructs. A detailed explanation is provided below and in the Examples section. (7) The CYP4V2 CRISPR modified construct will be validated in iPS cells derived from BCD patients with homozygous c.802-8_810del17insGC mutations. (8) Whole-genome sequencing will be performed on unmodified cells and iPS cells genetically repaired with the CYP4V2 mutation CRISPR modification construct to confirm the correction of the c.802-8_810del17insGC mutation and evaluate off-target editing.

[0252] A method is provided for determining the optimal conditions for transfection in iPSCs and for selecting transfected cells. See the Examples section for a detailed explanation. These constructs can be used not only for BCD patient-specific iPS cells in vitro, but also for the treatment of in vitro source cells (e.g., fibroblasts or PBMCs), iPS-RPE, iPS-PRC, iPS-CE cells, or iPS-CEC cells, or other ophthalmic cells derived from BCD patient-specific iPS cells, and are also intended for in vivo use in patients with the c.802-8_810del17insGC mutation. In one embodiment, the components of the construct may be used directly. In some embodiments, the components of the construct may be modified or cloned into different vectors to increase the transduction efficiency in vivo, increase specificity to target cell types, or achieve other objectives. For example, Cas9 may be replaced with Cas9 nickase (Cas9n D10A). Cas9 nickase possesses a mutation that allows the endonuclease to produce single-stranded nicks rather than double-strand breaks. Pairing two opposing gRNA sequences with SpCas9 nickase is an efficient gene editing method that prevents the formation of unwanted indels. In addition to plasmids, other common vectors used to package CRISPR components include lentiviral vectors and adeno-associated virus (AAV) vectors. When using AAV vectors, Staphylococcus aureus Cas9 ortholog (SaCas9) may be used as the endonuclease because SaCas9 is approximately 1 kb shorter than SpCas9 and offers greater flexibility in accommodating the constraints of AAV packaging.

[0253] Several improvements were made to the CRISPR RNP construct. Synthetic sgRNA was used instead of IVT sgRNA or crRNA:tracrRNA duplex. Because synthetic gRNA is purer than IVT sgRNA, the risk of off-target editing caused by sgRNA impurities is reduced. Furthermore, applying chemical modifications to the sgRNA to protect it from intracellular degradation can improve editing efficiency. See the examples for details.

[0254] In addition to the plasmid constructs and CRISPR RNP constructs described herein, mRNA constructs containing Cas9-encoding mRNA and guide RNA oligonucleotides may also be used.

[0255] After transfecting BCD patient-specific iPS cells with a CYP4V2 mutation CRISPR modification construct, the transfected cells are selected using puromycin. It should be understood that other markers, such as GFP, may be incorporated into the construct and used as markers instead of or in addition to puromycin. Following selection, single-cell cloning is performed, and then several cells from the single-cell clone are collected for sequencing. If the sequencing results confirm the success of on-target gene editing and no disease-causing gene editing is detected, the remaining cells of the same clone are used to differentiate into the desired ophthalmic cell type, e.g., iPS-RPE cells.

[0256] Differentiation of D.iPSCs iPS cells from genetically repaired BCD patients can be differentiated into iPS-RPE cells or other types of ophthalmic cells (e.g., iPS-CEC, iPS-CE cells, or iPS-PRC). Methods for differentiating iPSCs into RPE cells or other types of ophthalmic cells (e.g., CEC and PRC) are known. See, for example, Hayashi et al., 2012, PLoS One, 7(9):e45435, Songstad, et al., Investigative Ophthalmology & Visual Science December 2015, Vol.56, 8258-8267, and Lamba et al., PLoS One 2010 Jan 20;5(1):e8763. For example, induced pluripotent stem cells (iPSCs) may be produced by reprogramming cells and further differentiated into, for example, RPE cells (hereinafter referred to as "iPS-RPE"), corneal epithelial cells (hereinafter referred to as "iPS-CEC"), photoreceptor cells (or photoreceptor progenitor cells, hereinafter referred to as "iPS-PRC"), or iPS-choroidal endothelial (CE) cells (hereinafter referred to as "iPS-CE").

[0257] Differentiated cells, such as iPS-RPE cells, are tested for their biochemical function (as described herein and in the Examples section) to confirm that their biochemical function is improved compared to iPS-RPE cells from patients without gene repair.

[0258] iPSC-RPE cell lines prepared as described herein exhibit indicative morphologies of RPE cells (e.g., pigmentation and hexagonal shape) and / or express one or more biomarkers. Biomarkers for RPE cells (and iPS-RPE cells) are known and, in non-limiting examples, include one or more of RLBP1 (also known as CRALBP), RPE65, BESTROPHIN-1, MITF, VINCULIN, LRAT, RDH5, PAX6, MERTK, TYR, and / or ZO-1, which can be used to determine or confirm that RPE differentiation has occurred. Similarly, biomarkers for CECs (and iPS-CECs) and PRCs (and iPS-PRCs) are known and, for example, cytokeratin 12 and cytokeratin 3 for corneal epithelial cells; and Crx for photoreceptors, recavitin for rods and cones, and Nrl for rods.

[0259] E. Administration / Delivery Genetically repaired iPS-RPE cells may be used for autologous transplantation into patients from whom the iPS-RPE cells originate. Patients with BCD or other ophthalmic diseases caused by CYP4V2 mutations can be treated by the cell therapy methods provided herein. Similarly, this method may be used to provide genetically repaired autologous cell therapy for other ophthalmic diseases caused by one or more gene mutations.

[0260] Methods for administering or delivering cells are known, and methods for administering or delivering cells to the eye are known. See, for example, Wert et al., J Vis Exp. 2012;(69):4286, International Publication No. 2016 / 179496, and Schwartz et al., Investigative Ophthalmology & Visual Science April 2016, Vol.57, ORSFc1-ORSFc9. In one embodiment, ophthalmic cells may be transplanted by injection of a cell suspension, such as a suspension of RPE cells. In another embodiment, cells may be transplanted as part of a sheet or scaffold, for example, as an in vitro tissue using a native and / or synthetic scaffold to generate a polarized, functional RPE monolayer.

[0261] The therapeutically effective dose of cells administered into the eye is known to those skilled in the art and may vary depending on the type of cells transplanted, the maturity of the transplanted cells, whether post-transplant division is expected, the size or number of cells in the target region for replacement, and the patient being treated (e.g., age, sex, weight, disease progression, and condition), the route of administration, and the required regimen. The therapeutically effective dose of cells used in ocular cell therapy is approximately 1 × 10⁶ in a single dose. 3 Approximately 1 x 10⁻¹⁶ cells 8 It can be within the cellular range.

[0262] While iPSC cell lines can be created for individual subjects, a cell bank of iPSCs with a common HLA haplotype (or genetically engineered HLA haplotypes) may also be created. This is designed to achieve immunological matching with a large portion of the patient population. See, for example, Turner et al., Cell Stem Cell, 13:382-384, 2013. Furthermore, immunologically silent iPSC cell lines may be created regardless of the subject's genotype (see, for example, Riolobos et al., Mol. Ther., 21:1232-41, 2013). When combined with these methods, patient-specific iPS cells and iPS-ophthalmic cells can be used not only for strict autologous transplantation but also for transplantation into other patients.

[0263] Typically, the administration of cell therapy is performed as needed after the onset of disease symptoms or after the subject shows signs of retinal degeneration or corneal dystrophy. In one embodiment, the ophthalmic cell therapy provided herein may be used independently for the treatment of eye diseases (e.g., BCD). In another embodiment, the ophthalmic cell therapy provided herein may be used in combination with one or more other therapeutic options, including, in non-limiting examples, CYP4V2 gene transfusion therapy and / or CYP4V2 CRISPR gene editing therapy provided herein.

[0264] Similarly, administration may be a single dose or multiple doses (e.g., over several weeks, months, or years), and may be applied to the same eye or the opposite eye. Furthermore, one or more types of cells may be administered as a single dose or as separate doses.

[0265] Post-treatment evaluation may use the methods described in the CYP4V2 gene therapy section. These include, in non-limiting examples, ophthalmic examinations such as visual acuity, visual field, dark adaptation, visual function and / or visual function measured by optical coherence tomography (OCT, e.g., spectral domain-OCT (SD-OCT)) and ERG.

[0266] Methods for using CRISPR RNPs in ophthalmic cell therapy and gene therapy CRISPR RNPs are gene-editing ribonucleoprotein (RNP) complexes containing a guide RNA compounded with a Cas protein (e.g., Cas9 protein). The guide RNA consists of two RNAs, referred to as CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). In one embodiment, crRNA and tracrRNA are provided as two separate nucleic acid molecules. In another embodiment, crRNA and tracrRNA may be combined into a chimeric single guide RNA (sgRNA). The sgRNA may be about 100 nucleotides (nt) long, and may be shorter or longer as desired or as needed. The 20nt (crRNA) at the 5' end hybridizes to a target DNA sequence by Watson-Crick base pairing, inducing a Cas endonuclease to cleave the target genomic DNA, while the remaining double-stranded structure is at the 3' end for Cas9 recognition.

[0267] CRISPR RNPs have advantages and disadvantages compared to conventional Cas9 / gRNA constructs (e.g., plasmid constructs incorporating the nucleic acid sequences of CRISPR guide RNA and Cas9 protein). For example, the guide RNA (crRNA and tracrRNA) and Cas9 protein can be delivered to target cells as an intact complex, overcoming the need for the cell's own transcriptional mechanism to express the CRISPR components. As a result, CRISPR RNPs can be edited immediately after transfection. Because the CRISPR components are depleted from cells more quickly, the opportunity for off-target editing can be reduced. Furthermore, the opportunity for integration mutagenesis caused by plasmids can be reduced. Given these advantages, RNPs may also be advantageous in in vivo gene editing. On the other hand, because RNPs are rapidly eliminated from cells by protein degradation, their on-target editing efficiency may be lower than plasmid constructs, which have longer-lasting expression in the cell.

[0268] To evaluate the above hypothesis and demonstrate whether the CRISPR RNP construct can achieve both the desired gene editing objectives for ophthalmic cell therapy and gene therapy, two sets of constructs were designed. One construct is a plasmid construct, and the other is an RNP construct. Both constructs were transfected using iPS cells from the same BCD patient, and then sequenced to analyze on-target gene repair and off-target editing for each construct. Off-target editing was determined by comparison with genomic DNA from unmodified fibroblasts from the same patient. The results for both the plasmid and RNP constructs may be compared.

[0269] A detailed description of RNPs, methods for forming RNPs, and methods for generating genetically repaired cells (iPS cells and iPS-RPE cells) from BCD patients using RNP constructs are provided in the Examples section.

[0270] It should be noted that similar CRISPR RNP constructs may be used to modify or inactivate other BCD mutations as well as other RP and IRD mutations. In one embodiment, the crRNA sequence used herein is changed to a different crRNA sequence that specifically targets a different target mutation sequence. In another embodiment, the guide RNA or sgRNA in the RNP construct may be modified to enhance gene editing efficiency. See Hendel et al, Nat Biotechnol. 2015 Sep;33(9):985-989. In some embodiments, the CRISPR RNP construct may be transfected using electroporation. In some embodiments, the CRISPR RNP construct may be transfected using lipofection or nucleofection. In some embodiments, the CRISPR RNP construct may be delivered via microinjection.

[0271] In addition to genetically repairing and treating patient cells in vitro, CRISPR RNP constructs may also be used in vivo to treat ocular diseases caused by genetic mutations, and their in vivo application offers advantages over other types of CRISPR constructs (e.g., plasmids and / or mRNAs encoding CRISPR components). For example, CRISPR RNP constructs have higher potency, lower off-target risk, and / or lower toxicity or innate immune response activation compared to Cas9 mRNA and sgRNA transcribed in vitro. In one embodiment, a CRISPR RNP construct consisting of a Cas9 protein complexed with a guide RNA targeting a region of the mutant DNA sequence may be injected directly into the eye of the target (e.g., subretinal injection, intravitreal injection, or corneal injection). In another embodiment, improved editing efficiency in brain cells has been demonstrated in vivo (Staahl et al., Nat Biotechnol. 2017 May;35(5):431-434). High editing efficiency may be achieved in ophthalmic cells using modified variants of Cas9 having multiple SV40 nuclear localization sequences (NLS). Cas9 proteins having one or more NLS (N-terminal and / or C-terminal) are commercially available from various CROs such as IDT and Feldan. In some embodiments, the CRISPR RNP construct is delivered "as is". In some embodiments, the CRISPR RNP construct is formulated with a pharmaceutically acceptable carrier at the time of delivery. In some embodiments, the CRISPR RNP construct is delivered in a packaged form, e.g., as nanoparticles.

[0272] It is understood that the ratio of components of a CRISPR RNP (e.g., guide RNA and Cas9 protein) can be adjusted and optimized by testing different ratios in vitro in the patient's cell line (e.g., BCD patient-specific iPS cells or iPS-RPE cells) before in vitro or in vivo treatment. The CRISPR RNP construct may be used independently or in combination with other CRISPR constructs, the non-limiting examples of which include plasmids or vectors encoding CRISPR guide RNA or crRNA, Cas protein, or combinations thereof; mRNA encoding Cas9; guide RNA oligonucleotides; another CRISPR RNP construct; or combinations or hybrids thereof. RNP constructs may be used to modify or inactivate one or more mutations associated with one or more eye diseases.

[0273] Combination therapy of gene therapy and cell therapy This disclosure provides several treatment options for BCD and other eye diseases caused by CYP4V2 mutations, including, but not limited to, CYP4V2 gene transtherapy and CYP4V2 CRISPR gene editing therapy. Both CYP4V2 gene transtherapy and CYP4V2 gene editing therapy can be used in vivo, in vitro, or both in vivo and in vitro. When applied in vivo, CYP4V2 gene transtherapy and / or CYP4V2 CRISPR gene editing therapy can treat remaining eye cells affected by BCD as a gene therapy. When applied in vitro to patient cells or patient-derived cells, cells treated with CYP4V2 gene transtherapy and / or CYP4V2 CRISPR gene editing therapy can be transplanted into the patient as a cell therapy to replace dead or degenerated eye cells. Importantly, the gene therapy and cell therapy compositions and methods provided herein can be combined to provide patients with additional benefits that cannot be achieved by using gene therapy or cell therapy alone. Combination therapy can broaden the base of eligible patients. For example, in late-stage patients with no or very few photoreceptor or RPE cells remaining, gene therapy is not as effective as in early-stage patients. In this case, cell therapy may be beneficial by providing new cells (e.g., RPE or photoreceptor cells), but gene therapy can improve the effectiveness of cell therapy by rescuing the remaining RPE or photoreceptor cells and / or improving the health of choroidal cells that affect the state of ophthalmic cells. The combination of the rescue and replacement effects of gene therapy and cell therapy, respectively, results in improvements in combination therapy compared to gene therapy or cell therapy alone. This combination therapy may also be applicable to other eye diseases caused by one or more gene mutations.

[0274] Method and composition for CYP4V2 gene therapy This disclosure relates to various compositions comprising nucleic acid molecules encoding a functional CYP4V2 protein, and various methods of utilizing them to treat ophthalmic cells and / or ophthalmic diseases. In one embodiment, the functional CYP4V2 protein can be used directly for therapeutic purposes. In some embodiments, nucleic acid molecules encoding a functional CYP4V2 protein are used. In some embodiments, an expression cassette containing the nucleic acid molecule encoding a functional CYP4V2 protein operably linked to one or more control sequences is used to direct and control the expression of the nucleic acid molecule product. In some embodiments, a CYP4V2 expression cassette containing the nucleic acid molecule encoding a functional CYP4V2 protein and one or more control sequences to enhance delivery to target cells is packaged, and a vector is used to achieve the desired expression of the CYP4V2-encoding nucleic acid molecule product and the expression cassette.

[0275] In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the vector is a plasmid. In some embodiments, the vector is another type of virus or a non-viral vector. The therapeutic method comprises administering or delivering an effective amount (or effective concentration) of the vector to the eye and / or target cells of the subject. In one embodiment, the treatment is applied directly in vivo. In another embodiment, the treatment comprises ex vivo treatment of target cells (e.g., ocular cells) and transplantation of the treated target cells into the subject (e.g., the eye of the subject). The therapeutic method targets ocular diseases and other conditions associated with CYP4V2 mutations. In one embodiment, the ocular disease is crystallin retinopathy (BCD).

[0276] A. Functional CYP4V2 protein and nucleic acids encoding the functional CYP4V2 protein CYP4V2 (cytochrome P450, family 4, subfamily V, polypeptide 2, (MIM 608614), synonym: CYP4AH1) is one of the proteins in the cytochrome P450 superfamily (P450) and a member of cytochrome P450 subfamily 4 (CYP4). Cytochrome P450 (CYP) are important heme-containing proteins known for their role as oxidase enzymes. The term P450 derives from the spectral photometric peak at the enzyme's absorption maximum wavelength (450 nm) when the enzyme is in a reduced state and forms a complex with carbon monoxide. They are involved in the metabolism of xenobiotics and endogenous compounds, such as steroids and fatty acids. CYP enzymes have been identified in all biological kingdoms, including animals, plants, fungi, protists, bacteria, archaea, and even viruses. However, they are not ubiquitous; for example, they are not found in Escherichia coli.

[0277] P450 proteins share structurally important elements. For example, P450 proteins are identifiable by the signature sequence element FXXGXXXCXG (SEQ ID NO: 30), where cysteine ​​functions as an axial ligand for heme iron. While sequence identity among P450 proteins is relatively low, their general topography and structural folding are highly conserved. The conserved core consists of a coil called a "meander" (zigzag) structure, a four-helix bundle, helix J and helix K, and two sets of β-sheets. These constitute a heme-binding loop (containing a fully conserved cysteine ​​that functions as the fifth ligand for heme iron), a proton transport groove, and a conserved EXXR motif in helix K (SEQ ID NO: 31). P450 proteins are membrane-bound proteins primarily found in the inner mitochondrial membrane or the endoplasmic reticulum of cells.

[0278] In addition to structural similarities, P450 proteins also share functional similarities. The most common reaction catalyzed by P450 enzymes is the monooxygenase reaction, for example, in which one oxygen atom is inserted into the aliphatic portion of an organic substrate (RH), and the other oxygen atom is reduced to water. RH + O2 + NADPH + H + →ROH+H2O+NADP + . Many hydroxylation reactions (insertion of hydroxyl groups) use P450 enzymes. Many P450 enzymes have steroids and / or fatty acids as substrates.

[0279] The human CYP4V2 protein (NCBI reference sequence: NP_997235.3) has 525 amino acids (the amino acid sequence is shown in SEQ ID NO: 4). Variants of the human CYP4V2 protein exist, including pathogenic variants (i.e., mutations) (see Table 1 in this specification for a selection list of CYP4V2 mutations among BCD patients) and non-pathological (i.e., functional) variants.

[0280] In one embodiment, the functional CYP4V2 protein is the human CYP4V2 protein (SEQ ID NO: 4). In another embodiment, the functional CYP4V2 protein is a functional variant or fragment of the human CYP4V2 protein, having, as a non-limiting example, the amino acid sequence shown in SEQ ID NO: 5.

[0281] A functional CYP4V2 protein may be a variant of another functional CYP4V2 protein. The following is a study based on the creation of equivalent or improved second-generation molecules by altering the amino acids of the polypeptides described herein. For example, certain amino acids in the protein structure may be substituted with other amino acids without significantly losing their interactive binding ability to structures such as binding sites on substrate molecules (e.g., fatty acid binding sites). Since the interactive ability and properties of a protein determine its biological functional activity, specific amino acid substitutions may be made in the protein sequence and its underlying DNA or RNA coding sequence, and a protein with similar properties will still be produced. Therefore, as considered herein, it is thought that various changes can be made to the amino acid sequence of a functional CYP4V2 protein, or to the DNA or RNA sequence of its gene or coding region, without significantly losing biological utility or activity. For example, SEQ ID NO: 5 is the amino acid sequence of a CYP4V2 protein variant having one amino acid change from the human CYP4V2 protein sequence shown in SEQ ID NO: 4.

[0282] Functional CYP4V2 proteins, such as functional derivatives, variants, and / or fragments of human CYP4V2 protein, can be designed or modified using a variety of methods, algorithms, software, and tools. For example, the structure and function of various polypeptides or mutations may be modeled, determined, or predicted by NMR, X-ray crystallography, or computer modeling (e.g., ClustalW, SWISS-MODEL server, Swiss-Pdb Viewer, Polyphen-2, PROVEAN, SIFT, Condel, MutationAssessor, and FatHMM).

[0283] Functional CYP4V2 proteins may be fragments of functional CYP4V2 proteins, or may be derived from fragments of functional CYP4V2 proteins. For example, both human CYP4V2 protein (SEQ ID NO: 4) and its variant (SEQ ID NO: 5) have a transmembrane domain between approximately the 13th and 35th amino acid residues from the N-terminus. The backbone of human CYP4V2 protein (SEQ ID NO: 4) is located between approximately 36 and 525aa. Therefore, functional CYP4V2 may be derived from human CYP4V2 protein by deleting the first approximately 35 amino acids (SEQ ID NO: 6) and replacing them with a different transmembrane domain sequence. Another source of functional CYP4V2 proteins is splice variants of functional CYP4V2 proteins.

[0284] The predicted transmembrane segment of CYP4V2 is located near the N-terminus, followed by a globular structural domain typical of the CYP450 family. The globular domain of CYP4V2 contains 18 helical and β-structural segments. The heme group is located near the protein surface, with I-helices coordinated towards the interior of the protein and L-helices surface-oriented. (Li et al., Am J Hum Genet. 74:817-826, 2004). The CYP4V2 protein is remarkably active in fatty acid metabolism. Many other P450 enzymes are also involved in fatty acid metabolism. CYP4V2 is ubiquitously expressed in almost all tissues and organs. CYP4V2 expression has been observed in the heart, brain, placenta, lungs, liver, skeletal muscle, kidneys, pancreas, retina, retinal pigment epithelium, cornea, and lymphocytes (Li et al., Am J Hum Genet. 74:817-826, 2004). However, most other P450 enzymes are absent in ophthalmic cells. For example, CYP4V2 and CYP1B1 were the only P450 enzymes expressed at high levels in the ARPE-19 cell line. CYP2E1, CYP2J2, and CYP3A4 were transcribed only at low levels (5% of CYP4V2 mRNA expression), and transcripts of CYP4A11, CYP4B1, CYP4F2, CYP4F3, and CYP4F12 were not detected (Nakano, et al., Mol Pharmacol 2012;82:679-686). The fact that symptoms of CYP4V2 mutations are limited to the eyes (where CYP4V2 is the only major P450 enzyme expressed besides CYP1B1, and the only P450 subfamily 4 (CYP4) enzyme expressed) and are not shown in organs where CYP4V2 is present alongside other P450 enzymes suggests that other P450 enzymes, particularly CYP4 enzymes, may be used to replace all or part of the function of CYP4V2. In fact, the CYP4 subfamily, though not limited to these, is known to share common roles in fatty acid metabolism, such as hydroxylation of PUFAs.See Hardwick, Biochem. Pharmacol., 75(12):2263-75; Fer et al., J. Lipid Res., 49(11):2379-89; Nakano et al., Mol. Pharmacol., 2012, 82:679-686. The protein sequences of human CYP4 protein are shown in SEQ ID NOs. 8-18.

[0285] In addition to sharing substrates and functions with other proteins in the CYP4 subfamily, computer analysis revealed that CYP4V2 was formed from a replication of the ancestor of CYP46A (SEQ ID NO: 7), and that this replication further generated the entire CYP4 family. Pan et al., Int. J. Mol. Sci., 2016, 17(7)pii:E1020. doi:10.3390 / ijms17071020.

[0286] Furthermore, the CYP4V2 gene (or its ortholog, e.g., mouse Cyp4v3) is conserved in many species, including humans, chimpanzees, rhesus monkeys, dogs, cattle, mice, rats, chickens, frogs, horses, rabbits, and fruit flies (SEQ ID NOs. 19-29). Orthologs of the human gene CYP4V2 have been found in 196 organisms.

[0287] Functional CYP4V2 proteins may include, but are not limited to, the following, or may be designed, modified, or derived from the following: (i) Human CYP4V2 protein (SEQ ID NO: 4), (ii) Variants of human CYP4V2 protein or functional CYP4V2 protein (e.g., amino acid changes and / or splice variants) (e.g., SEQ ID NO: 5), (iii) One or more fragments of a functional CYP4V2 protein (e.g., SEQ ID NO: 6), (iv) CYP4V2 (or orthologous) proteins from other species, (v) Another CYP4 protein or CYP46A1, (vi) polypeptides and / or polypeptides that can improve, treat, or inhibit one or more biochemical abnormalities of one or more compounds listed in Table 2 in the patient's cells (e.g., iPS-RPE cells of a BCD patient) (vii) One or more derivatives, hybrids, or variants of any of (i) to (vi) above.

[0288] The compositions and methods of this disclosure are considered to be usable for expressing any of the above-mentioned functional CYP4V2 proteins. In one embodiment, the functional CYP4V2 protein is a polypeptide comprising all or part of the amino acid sequences shown in SEQ ID NOs: 4, 5, or 6. In some embodiments, the functional CYP4V2 protein is a polypeptide comprising all or part of the amino acid sequences selected from the group consisting of CYP4V2, CYP4A11, CYP4A22, CYP4B1, CYP4F2, CYP4F3, CYP4F8, CYP4F11, CYP4F12, CYP4F22, CYP4X1, CYP4Z1, and CYP46A (SEQ ID NOs: 4-18), and CYP4V2 of chimpanzees, rhesus monkeys, dogs, cattle, mice, rats, chickens, frogs, horses, rabbits, and fruit flies (SEQ ID NOs: 19-29), as well as their derivatives, hybrids, variants, and / or fragments. In some embodiments, the functional CYP4V2 protein may have at least 80% amino acid sequence identity to any sequence selected from the group consisting of SEQ ID NOs: 4-29 (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity). In one embodiment, the functional CYP4V2 protein is a polypeptide comprising the sequence elements FxxGxxxCxG and ExxR (SEQ ID NOs: 30 and 31).

[0289] In some embodiments, the functional CYP4V2 protein is a compound or agent that can improve, treat, or inhibit one or more biochemical abnormalities in patient cells (e.g., iPS-RPE cells from BCD patients).

[0290] In one embodiment, the functional CYP4V2 protein may be used directly to treat BCD, similar to protein-based drugs for other diseases. In another embodiment, a nucleic acid molecule encoding the functional CYP4V2 protein is used to express the functional CYP4V2 protein in target cells. In one embodiment, the nucleic acid molecule is RNA. In another embodiment, the nucleic acid molecule is DNA for long-term expression, and complementary DNA (cDNA) is an example of a non-limiting example. The cDNA may be positive-sense or negative-sense, single-stranded or double-stranded. In some embodiments, the nucleic acid encoding the functional CYP4V2 protein is operably ligated with one or more regulatory sequences to form a CYP4V2 expression cassette. In some embodiments, such an expression cassette is packaged in a vector to enhance delivery and / or expression efficiency.

[0291] A codon consists of a set of three nucleotides and either codes for a specific amino acid or terminates translation (i.e., a stop codon). Most amino acids (usually all except methionine) are coded by multiple codons. Therefore, the same protein can be expressed using different nucleic acid sequences. Sequence identity between two nucleic acid molecules coding for the same protein sequence can range from 0% to over 99%. For example, nucleic acid sequence (SEQ ID NO: 1) and another nucleic acid sequence (SEQ ID NO: 2) both code for the human CYP4V2 protein (SEQ ID NO: 4), but they share only 77% sequence identity.

[0292] Codon optimization of nucleic acid sequences can improve and / or stabilize protein expression without altering the encoded amino acid sequence. Codon optimization involves replacing codons present in the nucleic acid sequence with preferred codons encoding the same amino acids, such as those preferred for mammalian expression. A variety of strategies and parameters can be used for codon optimization, and non-limiting examples include codon use bias, GC content, CpG dinucleotide content, mRNA secondary structure, cryptic splicing sites, immature PolyA sites, internal chi sites and ribosome binding sites, negative CpG islands, RNA instability motifs (AREs), and repeat sequences (direct repeats, reverse repeats, and diad repeats). Examples include (repeat), and restrictive sites that may interfere with cloning. Methods for codon optimization are known in the art, see, for example, U.S. Patent No. 6,114,148 and U.S. Patent Publication No. 20110081708. A nucleic acid sequence encoding a codon-optimized nucleic acid sequence or polypeptide of a given amino acid sequence can be prepared by the methods described herein and / or by using various codon optimization software, such as online software.

[0293] It will be understood that, depending on the codon optimization method, configuration, algorithm, or software used, different codon-optimized nucleic acid sequences encoding the same protein can be created. However, codon optimization does not always result in improved expression compared to the wild-type, unmodified nucleic acid sequence. Alexeyev MF, Winkler HH:Gene synthesis, bacterial expression and purification of the Rickettsia prowazekii ATP / ADP translocase. Biochim Biophys Acta. 1999, 1419:299-306. 10.1016 / S0005-2736(99)00078-4; Curran KA, Leavitt JM, Karim AS, Alper HS:Metabolic engineering of muconic acid production in Saccharomyces cerevisiae. Metab Eng. 2013, 15:55-66; Agashe D, Martinez-Gomez NC, Drummond DA, Marx CJ:Good codons, Bad transcript:large reductions in gene expression and fitness arising from synonymous mutations in a Key enzyme. Mol Biol Evol. 2013, 30 (3):549-560. See 10.1093 / molbev / mss273. doi:10.1093 / molbev / mss273.

[0294] A codon-optimized nucleic acid sequence (SEQ ID NO: 2) encoding the human CYP4V2 protein (SEQ ID NO: 4) is presented herein. Both SEQ ID NO: 1 and SEQ ID NO: 2 encode the same human CYP4V2 protein (SEQ ID NO: 4). The codon-optimized nucleic acid sequence (SEQ ID NO: 2) has a codon adaptation index (CAI) of 0.95, which is an improvement over the CAI of the nucleic acid sequence shown in SEQ ID NO: 1. A CAI of 1.0 is considered perfect in the desired expression organism. It will be understood that this disclosure covers all forms of codon-optimized nucleic acid sequences, including any RNA sequence, DNA sequence, or other nucleic acid sequences corresponding to or derived from said cDNA, as exemplified by the cDNA sequence shown in SEQ ID NO: 2. It will also be understood that the nucleic acid sequence may be in single-stranded or double-stranded form, and / or may be positive sense, negative sense, antisense, or complementary sense to the sequence.

[0295] In addition to codon optimization, other methods may be used to improve translation performance. For example, Kozak or Shine-Dalgarno sequences may be used to increase the efficiency of translation initiation. Different stop codons (e.g., TGA) may be used to increase the efficiency of translation termination. In addition to the ORF sequence, the nucleic acid sequence encoding the functional CYP4V2 protein may also include one or more non-coding sequences, such as UTRs and / or one or more introns, to improve protein expression. To enhance expression, a Kozak sequence (an exemplary sequence is shown in SEQ ID NO: 36) may be inserted immediately before the cDNA encoding CYP4V2.

[0296] As discussed herein, functional variants and / or fragments of the human CYP4V2 protein are considered usable. The nucleic acid sequence encoding a functional variant (SEQ ID NO: 5) of the human CYP4V2 protein (SEQ ID NO: 4) is presented in SEQ ID NO: 3.

[0297] In some embodiments, the CYP4V2 nucleic acid molecule is a polynucleotide molecule encoding any functional CYP4V2 protein, such as SEQ ID NOs: 4-30 (as a non-limiting example), or a polynucleotide molecule encoding a polypeptide having at least 80% amino acid sequence identity with any of the sequences shown in SEQ ID NOs: 4-30. In some embodiments, the CYP4V2 nucleic acid molecule is a polynucleotide having at least 60% sequence identity with any of SEQ ID NOs: 1, 2, or 3.

[0298] The vectors (e.g., viral or nonviral vectors) and CYP4V2 expression cassettes described herein typically comprise one or more CYP4V2 nucleic acid molecules or fragments thereof. Nucleic acid molecules can take many forms, and it will be understood that non-limiting examples include DNA or RNA, single-stranded nucleic acids (e.g., ssDNA, ssRNA), double-stranded nucleic acids (e.g., dsDNA, dsRNA), positive- or negative-stranded nucleic acids, complementary DNA (cDNA), genomic DNA, messenger RNA (mRNA), small interfering RNA (siRNA), and / or DNA-directed RNA interference (ddRNAi). Nucleic acid molecules may comprise one or more nucleotide analogs or skeletal modifications. It will be understood that cDNA can be synthesized from an mRNA template in a reverse transcriptase-catalyzed reaction, or designed and synthesized based on a protein intended to encode (codon-optimized cDNA as a non-limiting example), or synthesized by mutagenesis from another nucleic acid molecule. It will also be understood that the cDNA may contain only exons, or that the exons may contain other sequences, such as untranslated regions (UTRs) and / or introns. In some examples, the vectors and CYP4V2 expression cassettes described herein may contain nucleic acid molecules having sequences encoding the human CYP4V2 protein or a functional variant or fragment thereof.

[0299] A suitable nucleic acid sequence may be any nucleic acid sequence encoding a functional CYP4V2 protein. The nucleic acid sequence may or may not contain non-coding elements such as UTRs, introns, or Kozak sequences. It may contain a wild-type sequence or a synthetic or modified sequence (e.g., a codon-optimized sequence). The nucleic acid sequence encoding the functional CYP4V2 protein may be prepared as described herein, or by other methods known in the art.

[0300] A nucleic acid molecule having the sequence shown in Sequence ID No. 1, which encodes the human CYP4V2 protein, is referred to herein as "CYP4V2st". A nucleic acid molecule having the codon-optimized sequence shown in Sequence ID No. 2, which encodes the human CYP4V2 protein, is referred to herein as "CYP4V2op". A nucleic acid molecule having the sequence shown in Sequence ID No. 3, which encodes a functional variant of the human CYP4V2 protein, is referred to herein as "CYP4V2fv". In some embodiments, the nucleic acid sequence encoding the functional CYP4V2 protein has at least 60% sequence identity with any of Sequence ID No. 1, 2, or 3.

[0301] Functional CYP4V2 proteins and nucleic acid molecules encoding such functional CYP4V2 proteins can be synthesized or isolated, purified, and detected by methods known in the art. Furthermore, protein synthesis or isolation, purification, and detection are commercially available from CROs such as Wuxi Apptec (Shanghai, China) and GenScript (Piscataway, New Jersey). Synthesis or isolation, purification, cloning, and detection of nucleic acid molecules are also commercially available from CROs including GenScript (Piscataway, New Jersey) and Integrated DNA Technologies (Coralville, Iowa).

[0302] Polypeptides may be synthesized (e.g., via recombinant protein expression or chemosynthesis) or isolated. As used herein, “purified” polypeptides are polypeptides that have been isolated or purified from naturally occurring cellular components. Typically, a polypeptide is considered “purified” if at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, or 99%) of its dry weight has been removed from naturally occurring polypeptides and natural molecules. Chemically synthesized polypeptides are “purified” because they are isolated from naturally occurring components.

[0303] Polypeptides can be purified from natural sources (e.g., biological samples) by known methods such as DEAE ion exchange, gel filtration, and hydroxyapatite chromatography. Polypeptides can also be purified by expressing nucleic acids in an expression vector, for example. Furthermore, purified polypeptides can be obtained by chemical synthesis. The purity of polypeptides can be measured using appropriate methods such as column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

[0304] Polypeptides are typically detected using antibodies. Techniques for detecting polypeptides using antibodies include enzyme-linked immunosorbent assay (ELISA), Western blotting, immunoprecipitation, and immunofluorescence. Antibodies may be polyclonal or monoclonal. Antibodies having a specific binding affinity to polypeptides or parts of polypeptides can be prepared using methods known in the art. Antibodies can be attached to solid supports such as microtiter plates using methods known in the art. In the presence of polypeptides, antibody-polypeptide complexes are formed.

[0305] An "isolated" nucleic acid molecule typically refers to a nucleic acid molecule that does not naturally possess sequences adjacent to one or both ends of the nucleic acid in the genome of the organism from which the isolated nucleic acid molecule originates (e.g., cDNA or genomic DNA fragments produced by PCR or restriction endonuclease digestion). Such isolated nucleic acid molecules are usually introduced into constructs (e.g., cloning constructs or expression constructs for use in gene therapy) for ease of manipulation, protein expression, fusion protein production, or other purposes (non-limiting examples include packaging into vectors (e.g., viral or non-viral vectors)).

[0306] Nucleic acids can be isolated using commonly used techniques in the art. For example, nucleic acids can be isolated using any method, including, but not limited to, recombinant nucleic acid techniques, site-directed mutagenesis, polymerase chain reaction (PCR), and / or other genetic engineering methods. General PCR techniques are described, for example, in *PCR Primer: A Laboratory Manual*, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, 1995. Recombinant nucleic acid techniques include, for example, restriction enzyme digestion and ligation, which can be used to isolate nucleic acids. Mutagenesis protocols are described, for example, in *In Vitro Mutagenesis Protocols*, Braman, ed., Humana Press, 2002.

[0307] Isolated nucleic acids can also be chemically synthesized as a single nucleic acid molecule or as a series of oligonucleotides.

[0308] Nucleic acid-containing constructs are known in the art. Constructs such as cloning constructs and expression constructs can be commercially made to order and can also be produced by commonly used recombinant DNA technologies in the art. Constructs may have a control sequence operably linked to the nucleic acid to be expressed, and may further include sequences such as sequences encoding a selection marker (e.g., an antibiotic resistance gene). Control sequences are discussed herein. Nucleic acid-containing constructs may encode chimeric or fusion polypeptides (i.e., polypeptides operably linked to a heterologous polypeptide, which may be either the N-terminus or C-terminus of the polypeptide). Typical heterologous polypeptides include those that can be used for the purification or detection of the encoded polypeptide (e.g., 6xHis tag, glutathione S-transferase (GST), CFP, Fc, FLAG, HA, Myc, RFP, Strep, VSV, GFP, and YFP).

[0309] Constructs that carry nucleic acid sequences can be introduced into host cells. As used herein, the term “host cell” refers to the specific cell into which the nucleic acid is introduced, and also includes the offspring of such cell that harbor the construct. Host cells can be any prokaryotic or eukaryotic cell. For example, host cells may be bacterial cells such as E. coli, or cells in insect cells, yeast, or mammalian cells (such as Chinese hamster ovary cells (CHO), COS cells, HEK293 cells, HeLa cells, Vero cells, V27 cells, A549 cells, K562 cells, B50 cells, WI38 cells, and BHK cells). Other host cells include, but are not limited to, iPS cells, ES cells, RPE cells, iPS-RPE cells, iPS-photoreceptor cells, ES-RPE cells, ARPE-19 cells, corneal cells, photoreceptor cells, choroidal cells, optic nerve cells, and other types of ophthalmic cells, nerve cells, epithelial cells, blood cells, fibroblasts, lymphocytes, and stem cell-derived cells as studied herein. Many methods for introducing nucleic acids, vectors, or expression cassettes containing nucleic acid transgenes into host cells, both in vivo and in vitro, are well known to those skilled in the art, and non-limiting examples include electroporation, sonoporation, calcium phosphate precipitation, polyethylene glycol (PEG) transformation, heat shock, lipofection, microinjection, and virus-mediated nucleic acid transfer.

[0310] Nucleic acids can be detected using any number of amplification techniques with appropriate oligonucleotide pairs (e.g., primers) (see, e.g., PCR Primer: A Laboratory Manual, 1995, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, and U.S. Patent Nos. 4,683,195, 4,683,202, 4,800,159, and 4,965,188). Many modifications of the original PCR have been developed and can be used for nucleic acid detection. Nucleic acids can also be detected by hybridization. Details of nucleic acid hybridization are discussed by Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, sections 7.37–7.57, 9.47–9.57, 11.7–11.8, and 11.45–11.57). Sambrook et al. disclose appropriate Southern blotting conditions for oligonucleotide probes with less than approximately 100 nucleotides (see sections 11.45-11.46) and for oligonucleotide probes with more than approximately 100 nucleotides (see sections 9.47-9.54).

[0311] B. Vector In some embodiments, a nucleic acid molecule encoding a functional CYP4V2 protein or a fragment thereof is delivered to ophthalmic cells requiring treatment via a vector. For delivery to ophthalmic cells, the therapeutic vector is preferably non-toxic and efficient in delivering nucleic acid molecules (e.g., DNA, RNA) to the target cells. Gene therapy vectors are known in the art and may be viral or non-viral vectors.

[0312] One approach to in vivo delivery of nucleic acids into cells involves the use of nucleic acid molecules, such as viral vectors containing cDNA. Infection of cells with viral vectors has the advantage that a large portion of the target cells can receive the nucleic acid molecules. Furthermore, molecules encoded within the viral vector, such as cDNA contained within the viral vector, are efficiently expressed in cells that have taken up the viral vector containing the nucleic acid molecules.

[0313] Examples of viral vectors that can be used include, but are not limited to, adenovirus vectors, adeno-associated virus vectors (AAV), lentivirus vectors, herpesvirus (HV) vectors such as herpes simplex virus (HSV) vectors, papillomavirus vectors, poxvirus vectors, human formyvirus (HFV) vectors, Epstein-Barr virus (EBV) vectors, vaccinia virus vectors, Sendai virus vectors, and retrovirus vectors. Plasmids can also be used to deliver nucleic acid molecules to target cells. In some examples, viral vectors are recombinant viral vectors such as recombinant AAV (rAAV) vectors. Those skilled in the art will understand that some vectors integrate into or tend to integrate into the genome of host cells (e.g., target cells), while others do not integrate into or tend not to integrate into the genome of host cells (e.g., extrachromosomal expression).

[0314] Recombinant AAV (rAAV) vectors are commonly used in gene therapy approaches. AAVs belong to the parvovirus family and each contains single-stranded DNA. rAAV vectors are currently considered the safest and most efficient platform for gene transfer into mammalian cells (Salganik et al, 2015, Microbiol. Spectr., 3(4):doi:10.1128 / microbiolspec.MDNA3-0052-2014). To date, 12 AAV serotypes (AAV1-AAV12) and over 100 variants have been isolated from human and non-human primate tissue samples (see, e.g., Gao et al., 2005, Curr. Gene Ther., 5:285-97) and other species. The methods described herein can use either naturally occurring or modified AAV species.

[0315] Wild-type AAV contains a linear, single-stranded DNA genome enclosed within a capsid composed of three proteins: VP1, VP2, and VP3. In recombinant AAV (rAAV), the rep and cap genes of the wild-type AAV genome are typically replaced with a transgene expression cassette adjacent to the AAV terminal inverted repeat (ITR) required for packaging. In this specification, the term "rAAV vector" refers to a recombinant AAV vector containing one or more capsid elements from one or more AAV viruses, or one or more capsid elements derived from one or more AAV viruses.

[0316] Despite the advantages of AAV and other viral vector-mediated gene therapies, not all viral vectors and AAV types are suitable for treating specific diseases. Two major challenges face gene therapy using viral vectors (e.g., AAV vectors): firstly, sufficient transduction efficiency by the AAV vector is desired in the target cell type; and secondly, potential immune responses induced by viral vectors must be considered. See Madsen et al., Adeno-associated virus serotype 2 induces cell-mediated immune responses directed against multiple epitopes of the capsid protein VP1. J Gen Virol 90, 2622-2633 (2009) and Mingozzi et al., CD8(+)T-cell responses to adeno-associated virus capsid in humans. Nat Med 13, 419-422 (2007). Compared to most other organs and tissues, the eye is considered immunologically advantageous, and the immune response in AAV-mediated gene therapy in the eye can be modulated with the use of immunosuppressants. However, the role of immune responses such as neutralizing antibodies (NABs) in AAV transmission in the eye is unclear in large animals. Furthermore, intravitreal AAV administration is more susceptible to interaction with the immune system than subretinal administration. Therefore, to avoid potential side effects, to ensure that the transduction / expression efficiency of the viral vector is not substantially reduced by immune responses such as NABs already present in the subject, and / or to reduce the dose of the rAAV vector, viral vectors used in ocular gene therapy should minimize or completely avoid inducing an immune response.

[0317] To address these challenges, various compositions and methods related to the design and selection of AAV vectors can be used. When using CYP4V2 gene therapy for the treatment of BCD, if the target cells of the therapy are primarily RPE cells, a vector with sufficient transduction efficiency in RPE cells is desirable. When treating corneal cells of BCD patients, a vector with sufficient transduction efficiency in corneal cells is desirable. In some embodiments, a vector with sufficient transduction efficiency in RPE cells is used. In some embodiments, a vector with sufficient transduction efficiency in corneal cells is used. In some embodiments, a vector with sufficient transduction efficiency in RPE and photoreceptor cells is used. In some embodiments, a vector with sufficient transduction efficiency in RPE, photoreceptor, and choroid cells is used. In some embodiments, a vector with sufficient transduction efficiency in retinal cells is used. In some embodiments, a vector with sufficient transduction efficiency in ophthalmic cells is used. In some embodiments, a vector with sufficient transduction efficiency in ophthalmic cells and / or blood cells is used. To address potential immune responses (e.g., NAB and cell-based immune responses to gene therapy vectors), various AAV serotypes and variants, modified AAV vectors, and / or immunosuppression protocols can be used.

[0318] The rAAV vectors used herein may be based on or derived from wild-type AAVs (e.g., any of AAV1 to AAV12, or other wild-type AAV variants isolated from humans or other species (non-limiting examples include AAV1, AAV2, AAV4, AAV5, AAV6, AAV8, AAV9, AAV10, AAV11, and AAV12)), or they may be based on or derived from modified AAVs. Modified AAVs can be produced in a variety of ways, and are not limited to, pseudotyped AAVs (e.g., AAV2 / 5, AAV2 / 8, AAV2 / 1, AAV2 / 4, AAV2 / 6, AAV2 / 7, AAV2 / 9, AAV2 / 12, AAV8 / 2), chimeric AAVs (e.g., AAV-DJ), capsid-modified AAVs (e.g., capsid-mutant AAVs (e.g., AAVs with YF, KR, TA, SA and / or TV mutations, and AAV-DJ / 8 or AAV-DJ / 9, which are capsid-mutant AAVs of AAV-DJ)), capsid-variant AAVs (e.g., AAV 7m8 and its derivatives), ancestral AAVs (e.g., Anc80), recombinant AAVs involving any changes to the genome and / or capsid of naturally occurring AAVs or variants, and any combination thereof. When referring to modified AAVs, it will be understood that there are various methods, including, but are not limited to, artificial, modified, synthesized, reconstructed, altered, evolved, designed, induced, or enhanced AAVs, or AAVs or AAV variants produced by rational design methods and / or directional evolution methods and / or DNA shuffling. The use of modified AAVs offers several advantages over unmodified AAVs, including, but are not limited to, higher transduction efficiency, higher tissue or cell specificity, less immune response, and / or suitability for certain types of administration (e.g., intravitreal injection or bloodstream delivery).

[0319] In some embodiments, the modified AAV vectors used herein are pseudotyped AAVs. AAV pseudotyping refers to the mixing of capsids and genomes from different viral serotypes. These serotypes are indicated using a slash ( / ), where AAV2 / 5 indicates a virus containing a serotype 2 genome (e.g., ITR) packaged in a serotype 5 capsid. In some embodiments, the AAV vectors are AAV2 / 1, AAV2 / 2, AAV2 / 5, AAV2 / 8, AAV2 / 6, AAV2 / 9, AAV2 / 4, AAV2 / 7, AAV2 / 10, or AAV2 / 12 vectors.

[0320] In some embodiments, the modified AAV vectors used herein are chimeric (also referred to as hybrids or shuffles) AAVs derived from different AAV serotypes (including different AAV serotypes isolated from different species). In some embodiments, the AAV vectors are AAV-DJ, AAV-DJ / 8, or AAV-DJ / 9. AAV-DJ is an AAV variant generated from a library of eight serotype AAV hybrids by DNA shuffling. Grimm, D. et al. (2008). J. Virol. 82:5887-5911. This can efficiently transduce a wide range of cell types, such as ophthalmic cells. Furthermore, chimeric AAVs have a greater ability to evade immunoneutralization than native AAVs, allowing for the efficient delivery of larger amounts of therapeutic transgenes. Hybrid AAVs may be further modified. For example, AAV-DJ / 8 and AAV-DJ / 9 were created by introducing point mutations into the heparin binding domain (HBD) of AAV-DJ. Grimm, D. et al. (2008). J. Virol. 82:5887-5911.

[0321] In some embodiments, the modified AAV used herein is a capsid mutant AAV. This involves introducing one or more mutations (e.g., point mutations) into the AAV capsid protein. Capsid mutant AAVs may have advantages over unmodified AAVs. For example, point mutations in surface-exposed tyrosine (Y) residues of the AAV capsid protein have been reported as a simple and effective method that avoids phosphorylation and subsequent ubiquitination, resulting in higher transduction efficiency both in vitro and in vivo (Zhong et al., Proc Natl Acad Sci US A. 2008;105(22):7827-32;Markusic et al., Mol Ther. 2010;18(12):2048-56, Li et al., Hum Gene Ther. 2010 Nov;21(11):1527-1543). For example, site-directed mutagenesis by phenylalanine substitution of seven AAV2 capsid tyrosine residues (Y252, Y272, Y444, Y500, Y700, Y704, and Y730) leads to vector transduction and increased transgene expression in in vitro human cells and in vivo mouse hepatocytes by bypassing the EGFR-PTK phosphorylation and ubiquitin-proteasome pathways (Zhong et al., Virology. 2008 Nov 25;381(2):194-202). Furthermore, point mutations in the AAV capsid at specific tyrosine (Y), serine (S), threonine (T), and lysine (K) residues have been reported to potentially lead to significant improvements in transduction both in vitro and in vivo (Gabriel et al., Hum Gene Ther Methods. 2013;24(2):80-93, Sen et al., Hum Gene Ther Methods. 2013;24(2):104-16, Sen et al., Sci Rep. 2013;3:1832, Wu et al., J Virol. 2006;80(22):11393-7). Capsid mutations may also be applied to modified AAVs to create other modified AAVs.For example, AAV-DJ / 8 and AAV-DJ / 9 were created by introducing point mutations into the heparin-binding domain (HBD) of the hybrid AAV AAV-DJ. Grimm, D. et al. (2008). J. Virol. 82:5887-5911. Capsid mutations can also allow AAVs to evade NAB and reduce the immune response. Furthermore, specific capsid mutations can make AAVs more suitable for intravitreous delivery. Kay et al., PLoS One, 8:e62097, 2013. In some embodiments, the AAV vectors used herein are modified AAVs having one or more capsid mutations, the capsid mutations being, but not limited to, tyrosine to phenylalanine (YF), threonine to valine (TV), lysine to arginine (KR), threonine to alanine (TA), serine to alanine (SA), and / or affecting the heparin-binding domain (HBD) and / or antigenic region of the AAV (non-limited examples include positions 459, 493, and 551). In some embodiments, the AAV vector is an AAV2 having one or more capsid mutations from among Y444F, Y500F, Y730F, Y252F, Y272F, Y700F, Y704F, and T491V (the numbers (e.g., 444) indicate the location of the point mutation in the AAV capsid). In some embodiments, the AAV vector is AAV5 having one or more capsid mutations from among Y263F and Y719F. In some embodiments, the AAV vector is AAV8 having one or more capsid mutations from among Y447F, Y733F, and T494V. In some embodiments, the AAV vector is AAV1 having the Y731F capsid variant. In some embodiments, the AAV vector is AAV6 having one or more capsid mutations from among Y445F and Y731F. In some embodiments, the AAV vector is AAV9 having the Y731F capsid mutation. In some embodiments, the AAV vector is AAV-DJ, AAV-DJ / 8, or AAV-DJ / 9 having one or more capsid mutations from among K137R, T251A, and S503A.

[0322] In some embodiments, the modified AAV vector is an AAV containing a variant AAV capsid protein. Variant AAV capsid proteins are known in the art. In some embodiments, the non-natural capsid protein may contain a selected AAV sequence (e.g., a fragment of the vp1 capsid protein) combined with a heterologous sequence (e.g., a different selected AAV serotype, a discontinuous portion of the same AAV serotype, a non-AAV viral source, or a sequence obtained from a non-viral source). In some embodiments, the modified AAV vector contains one or more insertions of amino acids (e.g., about 5 to about 11 amino acids) in the capsid protein GH loop. Variant AAV capsid proteins may increase the infectivity of retinal cells compared to the infectivity of retinal cells by non-variant AAV (e.g., wild-type AAV). In some embodiments, the modified AAV can deliver the transgene across the blood-ocular barrier (BOB), making it suitable for delivery via the bloodstream and providing an alternative route of administration / delivery to conventional administration methods used in ocular gene therapy (e.g., subretinal injection or intravitreal injection). In some embodiments, the AAV containing the variant AAV capsid protein is AAV 7m8 or its derivatives or variants (Dalkara et al., Science Translation Medicine, 5:189ra76, 2013, PCT International Application PCT / US2012 / 034413, PCT International Application PCT / US2014 / 039015, U.S. Patent Application No. 14 / 214,011, and U.S. Patent Application No. 13 / 899,481). In some embodiments, the AAV having the variant AAV capsid protein is AAV-PHP.B.

[0323] In some embodiments, AAV vectors can be reconstructed or synthesized through the reconstruction of viral evolutionary lineages. Such reconstructions can produce ancestral, ancient, or parental AAVs. In one embodiment, the AAV vector is Anc80 (ancestor of AAV1, 2, 8, and 9) or a derivative thereof. Zinn et al., Cell Rep. 2015 Aug 11;12(6):1056-68.

[0324] In some embodiments, one or more AAV and / or other viral vectors can be modified by techniques known in the art, such as “directional evolution” and / or “rational design” (e.g., optimized for intravitreal delivery, enhanced transduction in target cell types (e.g., RPE cells), or delivery via bloodstream). See, for example, Asuri et al., Mol Ther. 20:329-338, 2012 and Yang et al., Methods Mol Biol. 709:127-139, 2011. Modified AAV or other viral vectors may be described, for example, as “modified,” “hybrid,” “evolved,” “enhanced,” or “designed” vectors. Such modifications may, for example, enable vector targeting (e.g., improved suitability for intravitreal or bloodstream delivery), improve transduction efficiency, and / or reduce immune responses, allowing for, for example, a reduction in the required dose. In some embodiments, the rAAV vector is AAV serotype rh10 (EP 20100178940) or ShH10. In some embodiments, the rAAV vector is AAV-PHP.B (U.S. Patent Publication No. 20150079038).

[0325] In some embodiments, AAV vectors can be prepared and / or selected from a combination of the strategies described herein. For example, AAV-DJ / 8 and AAV-DJ / 9 were prepared by creating point mutations in the heparin-binding domain (HBD) of the hybrid AAV AAV-DJ.

[0326] It is known in the art that some AAVs may be more suitable for intravitreous delivery than others. Many of these AAVs for intravitreous delivery involve mutations in the AAV capsid protein (e.g., AAV2(quadY-F)+TV) (Kay et al., PLoS One. 2013 Apr 26;8(4)) or variant AAV capsid proteins (e.g., AAV 7m8). Furthermore, there are AAVs suitable for delivery via the bloodstream, such as AAV-PHP.B. However, their use is not limited to intravitreous or bloodstream delivery; they can also be used as AAV vectors for subretinal administration and other routes of administration, for example.

[0327] In some embodiments, self-complementary AAV vectors (scAAV) are used. Wild-type AAV has a single-stranded DNA genome. One of the drawbacks of AAV is its single-stranded DNA genome. Because the single-stranded AAV genome relies on the cell's DNA replication mechanism to synthesize the complementary strand, transgene expression is delayed and less robust than that of double-stranded DNA. For CYP4V2 gene therapy, we developed an scAAV design that avoids the rate-limiting second strand synthesis in conventional single-stranded AAV vectors and promotes robust transgene expression (see Figure 7). scAAV.CYP4V2 has an intramolecular self-complementary CYP4V2 DNA structure that does not require host cell DNA synthesis, enabling faster and more robust expression during transduction. However, the self-complementary structure of scAAV reduces the packaging limitation of the scAAV vector from approximately 4.7–5.0 kb for ssAAV to approximately 2.4–2.5 kb for scAAV. Therefore, scAAV design requires shorter regulatory sequences (e.g., promoters, enhancers, and / or polyA signals). To ensure the expression cassette does not exceed the vector packaging limits, and depending on the length of the cDNA and other regulatory sequences used, several optional regulatory sequences, such as enhancers, may need to be excluded from the scAAV construct. One of the two ITRs in scAAV design is a cleavage ITR with a mutation at the terminal resolution site (TRS). For a detailed discussion of scAAV structure, purification, and production, see McCarthy, Molecular Therapy, Volume 16, Issue 10, pp. 1648-1656, October 2008.

[0328] Many other vector designs are also available. For example, a dual-vector system (e.g., an AAV-based dual-vector system, e.g., a trans-splicing or hybrid dual AAV vector) can be used to express a nucleic acid sequence (e.g., a CYP4V2 nucleic acid sequence). See, for example, Colella, et al., Gene Ther. 21, 450-456, 2014. For example, a dual-vector system is: (i) A first AAV vector polynucleotide having terminal inversion repeat sequences at each end (5' and 3' ends) of the polynucleotide, and having a suitable promoter operably linked between the terminal inversion repeat sequences to a partial coding sequence encoding the N-terminal portion of a protein encoded by the nucleic acid sequence of interest, and ii) A second AAV vector polynucleotide having terminal inversion repeat sequences at each end (5' and 3' ends) of the polynucleotide, and between the terminal inversion repeat sequences, a partial coding sequence encoding the C-terminal portion of the protein encoded by the target nucleic acid sequence, followed by a polyadenylation (pA) signal sequence, It may include.

[0329] Various rAAV vectors, including scAAV2 / 1, AAV2 / 2, AAV2 / 5, scAAV2 / 5, AAV2 / 8, scAAV2 / 9, and AAV2 / 2(Y444F+Y500F+Y730F), were designed and generated for this study (see schematic diagram and annotations in Figure 7). These demonstrate that rAAV vectors of various designs can be used for CYP4V2 gene therapy. Furthermore, including multiple rAAV vectors as options may be useful in reducing potential immune responses in CYP4V2 gene therapy, considering existing neutralizing antibodies and other individual immune responses to specific AAV types within the patient population. Additionally, more options would be provided if subsequent administration to the same eye or administration to the opposite eye of the same target is desired.

[0330] Methods for constructing viral delivery vectors (including those using helper-free systems) are publicly known in the art. See, for example, PCT / US2007 / 010055, U.S. Patent No. 6458587, and U.S. Patent No. 6428988 (B1). The construction of various vectors used in gene therapy (including, but not limited to, AAV, adenovirus, lentivirus, and retroviral vectors) is also commercially available from contract research organizations (CROs) and contract manufacturing organizations (CMOs), such as Vector Biolabs (Malvern, Pennsylvania) and Cell Biolabs, Inc. (San Diego, California).

[0331] In some embodiments, recombinant AAV vectors useful in the methods described herein can be prepared by culturing a host cell (e.g., HEK293 cell) containing a nucleic acid molecule encoding an AAV serotype capsid protein or a fragment thereof; a rep gene; a minigene containing at least an AAV terminal inverted repeat (ITR) and the nucleic acid molecule of interest (e.g., having a CYP4V2 nucleic acid sequence); and helper functions sufficient to package the nucleic acid of interest into the AAV capsid protein. The components that need to be cultured in the host cell to package the nucleic acid into the AAV capsid can be provided to the host cell in cis or trans. Alternatively, one or more of the required components (e.g., the nucleic acid molecule of interest, the rep sequence, the cap sequence, and / or helper functions) can be provided by a stable host cell modified to contain one or more of the required components. Any of these components can be selected from appropriate serotypes. For example, an rAAV vector may be: (a) A plasmid containing a cloned recombinant AAV genome (AAV cis plasmid) consisting of the gene of interest (e.g., cDNA encoding CYP4V2) and other desired regulatory sequences adjacent to two AAV ITRs, (b) A separate construct that expresses the AAV virus Rep gene and Cap gene in trans, (c) Adenovirus infection, or adenovirus helper factors provided by transfecting producer cells with a third plasmid providing adenovirus helper factors. The rAAV vector is produced by cotransfecting producer cells (e.g., HEK 293 cells). In addition to HEK293 cells, other cell lines may be used to produce rAAV vectors, including, but are not limited to, HeLa cells, Vero cells, A549 cells, B50 cells, WI38 cells, and BHK cells.

[0332] In some embodiments, the viral delivery vector is an rAAV virus having a capsid element from one or more of the following viruses: rAAV2 virus, rAAV2 / 5 virus, rAAV2 / 8 virus, rAAV2 / 1 virus, rAAV2 / 4 virus, rAAV2 / 6 virus, rAAV2 / 9 virus, rAAV2 / 12 virus, or AAV1, AAV2, AAV5, AAV8, AAV9, and / or AAV12 virus. In one embodiment, the viral delivery vector is an rAAV virus having one or more YF mutations, the non-limiting examples being AAV2(Y444F+Y500F+Y730F) or AAV8(Y733F).

[0333] In some embodiments, the viral delivery vector is a single-stranded rAAV (ssAAV) virus. In some embodiments, the viral delivery vector is a self-complementary rAAV (scAAV) virus.

[0334] In addition to AAV vectors, other viral vectors may be used for CYP4V2 gene therapy. For example, adenovirus vectors have also been demonstrated to be useful for gene delivery. For instance, Mori et al., 2002. IOVS, 43:1610-1615 describes the use of an adenovirus vector, type 5 Ad, with E-1 deletion and partial E-3 deletion, in which the transgene (green fluorescent protein) is driven by the CMV promoter. 10 7 ~10 8Injecting individual virus particles resulted in peak expression levels, and subretinal injection yielded higher levels of expression than intravitreous injection.

[0335] In some embodiments, the delivery vector is a plasmid containing a nucleic acid molecule encoding the human CYP4V2 protein or a functional variant or fragment thereof.

[0336] Nonviral vectors can also be used for CYP4V2 gene therapy. Examples of nonviral vectors include, but are not limited to, naked nucleic acids, dendrimers, liposomes (e.g., cationic or anionic liposomes), polymers (e.g., polyplexes), lipid polymer systems, and nanoparticles (e.g., inorganic or synthetic nanoparticles). For example, Farjo et al., 2006, PLoS 1:e38 demonstrated efficient nonviral ocular gene delivery, using compressed DNA nanoparticles as a system for nonviral gene delivery into ocular tissue. As a proof of concept, the pZEEGFP5.1 (5,147 bp) expression construct encoding enhanced green fluorescent protein (GFP) cDNA, which is transcriptionally regulated by the CMV immediate-early promoter and enhancer, was used. DNA nanoparticles were prepared by mixing plasmid DNA with CK30PEG10K (a 30-mer lysine peptide having a cysteine ​​linked to 10 kDa polyethylene glycol via a maleimide ligator at its N-terminus) using a known method. The nanoparticles were concentrated in physiological saline until the DNA concentration reached 4 mg / mL. The compressed DNA was delivered into the vitreous cavity at a dose of 0.6 μg. GFP expression was observed in the lens, retina, and pigment epithelium / choroid / sclera by PCR and microscopy.

[0337] Furthermore, numerous patents have been issued relating to methods for introducing ocular genes. Non-limiting examples include U.S. Patent No. 7,144,870, which provides a method for introducing hyaluronic acid-mediated adenovirus; U.S. Patents No. 7,122,181 and 6,555,107, which provide lentiviral vectors and their use for mediating ocular gene delivery; U.S. Patent No. 6,106,826, which provides herpes simplex virus vectors and their use for mediating ocular gene delivery; and U.S. Patent No. 5,770,580, which provides DNA expression vectors and their use for mediating ocular gene delivery.

[0338] A method for screening and selecting a vector suitable for use in CYP4V2 gene therapy from a variety of vectors is presented in the Examples section of this specification. The Examples illustrate such a method using various AAV vectors. It will be understood that such a method may be used by those skilled in the art to compare and select different types of vectors (viral vs. nonviral vectors, adenovirus vs. AAV, lentivirus vs. AAV, HSV vs. AAV, etc.).

[0339] C.CYP4V2 expression cassette and regulatory sequence This disclosure also provides an expression cassette comprising a nucleic acid sequence encoding a functional CYP4V2 protein (e.g., the nucleic acid sequence of SEQ ID NOs: 1, 2, or 3) and an expression control sequence operably ligated to the nucleic acid sequence encoding CYP4V2. In addition to the nucleic acid molecule encoding a functional CYP4V2 protein, other important elements of an expression cassette used in CYP4V2 gene therapy include one or more control sequences for regulating the expression of the nucleic acid molecule. In some embodiments, the expression cassette is packaged in a delivery vector (e.g., an rAAV vector with AAV ITRs on both sides) for improved efficiency of delivery, transduction, and / or expression. Any AAV ITR can be used in the methods described herein. The ssAAV vector described in the examples herein contains two AAV2 ITRs, each approximately 141 bp long (exemplary sequences are shown in SEQ ID NOs: 42 and 43). The scAAV vector described in the examples contains two AAV2 ITRs, one of which is cleaved (exemplary sequences are shown in SEQ ID NOs: 44 and 45). The length of the ITR is typically around 132 bp to 167 bp, depending on the parent vector used.

[0340] As used herein, the term “regulatory sequence” refers to any genetic element (e.g., a polynucleotide sequence) that exerts a regulatory effect on the replication or expression (transcription or translation) of a nucleic acid sequence, or that can otherwise direct, influence, and / or control the expression of a nucleic acid sequence. Common examples of regulatory sequences include promoters, polyadenylation (polyA) signals, enhancers, upstream regulatory domains, introns, UTRs, response or induction elements, origins of replication, internal ribosome entry sites (IRESs), transcription start sequences, termination sequences, RNA processing sequences such as splicing or polyadenylation (polyA) sequences, sequences that stabilize cytoplasmic mRNA, sequences that enhance translation efficiency (i.e., Kozak consensus sequences), sequences that enhance protein stability, or sequences that enhance the secretion of encoded proteins. Regulatory sequences may be of bacterial, yeast, insect, mammalian, or viral origin, or may be derivatives, hybrids, or variants thereof, or synthetic compounds, and vectors may contain combinations of regulatory sequences of different origins. For example, a regulatory sequence may be heterologous (e.g., from a different origin or a different gene, e.g., from a non-CYP4V2 gene) or homologous (e.g., from the same gene, e.g., from the CYP4V2 gene) to a coding sequence whose expression is being controlled (e.g., the CYP4V2 gene). As used herein, the expression “operably ligated” means that a promoter and / or other regulatory sequences are positioned relative to a nucleic acid coding sequence to direct, influence, or control the expression of the nucleic acid coding sequence. Regulatory sequences can be “operably ligated” to a nucleic acid coding sequence in the same vector or in different vectors. One or more regulatory sequences operably ligated to a nucleic acid coding sequence may be contiguous and / or act trans or remotely to direct, influence, or control the expression of the nucleic acid coding sequence. Among the regulatory sequences, promoters are essential, while other regulatory sequences such as enhancers, introns, and terminators are useful but optional.

[0341] Nucleic acid coding sequences can be promoted using a variety of promoter sequences. Some are constitutive promoters that induce expression in virtually all tissues and most cell types, while others are more regulatory. Regulated promoters may act only in specific tissues or cells (i.e., tissue or cell-specific promoters), or only at specific times during development (i.e., developmental stage-specific promoters), and may be conditioned to environmental conditions or external stimuli such as chemicals, oxygen levels, heat, or light (i.e., inducible promoters).

[0342] In some cases, it may be preferable to use a constitutive (or ubiquitous) promoter. Examples of constitutive promoters include, but are not limited to, the cytomegalovirus (CMV) promoter (Gray et al., Hum Gene Ther. 2011 Sep;22(9):1143-1153, Norman et al., PLoS ONE 5(8):e12413, Aug 2010), the chicken β-actin promoter, and the CMV / chicken β-actin / rabbit β-globin hybrid CAG (also known as CAGGS, CBA, or CB) promoter (Miyazaki J, Takaki S, Araki K, Tashiro F, Tominaga A, Takatsu K, Yamamura K. 1989. Expression vector system based on the chicken β-actin promoter directs efficient production of interleukin-5. Gene 79:269-277, Acland, GM et al. MoI Then, 2005). 12:1072-1082), small CBA (smCBA) promoter (approx. 953 bp, see Mah, et al. 2003, Hum. Gene Ther. 14:143-152, Haire, et al. 2006 IOVS, 2006, 47:3745-3753), CBh promoter (approx. 800 bp, see Gray et al., Hum Gene Ther. 2011 Sep;22(9):1143-1153), human β-actin promoter (ACTB) (Norman et al., PLoS ONE 5(8):e12413, Aug 2010), elongation factor 1α (EF-1α) promoter (Gill et al., Gene Ther. 2001;8(20):1539-1546, Norman et al., PLoS ONE) See 5(8):e12413, Aug 2010), phosphoglycerate kinase (PGK, human or mouse) promoter (Norman et al.Examples include the ubiquitin C (UBC) promoter (Norman et al., PLoS ONE 5(8):e12413, Aug 2010), the GUSB (β-glucuronidase) promoter, the minimal GUSB promoter (hGBp) (Husain, Gene Therapy (2009)16, 927-932), the UCOE promoter, the elongation factor 1α short (EFS) promoter, the Simian virus 40 (SV40) promoter, and the Rous sarcoma virus (RSV) promoter. For a general comparison and examination of various promoters, see, for example, Powell, Discov Med. 2015 Jan;19(102):49-57. It should be understood that in some cases, "constitutive" or "ubiquitous" promoters tend to be silenced or differentially promote expression in selected cell types. See, for example, McCown et al., Brain Res. 1996;713(1-2):99-107 and Gray et al., Hum Gene Ther. 2011;22:1143-1153.

[0343] In some cases, it is desirable to use cell-specific or tissue-specific promoters that direct the expression of nucleic acid coding sequences in specific types of cells or tissues. Based on this disclosure, it will be understood that cell-specific or tissue-specific promoters may be specific to ophthalmic cells, ophthalmic tissue, or lymphocytes. Types of ophthalmic cells include, but are not limited to, retinal cells, retinal bipolar cells, photoreceptor cells, rod cells and cone cells, ganglion cells, retinal pigment epithelial (RPE) cells, choroid cells, or corneal epithelial cells. Accordingly, the cell-specific promoters described herein may be retinal-specific promoters (e.g., RPE-specific, photoreceptor-specific (e.g., cone-specific and / or rod-specific) and / or choroid-specific) or corneal-specific promoters. Examples of ophthalmic cell-specific promoters include, but are not limited to, the human G protein-coupled receptor protein kinase 1 promoter (GenBank accession number AY327580), also known as rhodopsin kinase 1 (GRK1), the 292nt fragment of the GRK1 promoter (positions 1793-2087) (see Beltran et al., Gene Therapy 17:1162-74, 2010), the human interphotoreceptor retinoid-binding protein proximal (IRBP) promoter, the 235nt fragment of the hIRBP promoter, the RPGR proximal promoter, the red opsin promoter, the red-green opsin promoter, the blue opsin promoter, and the mouse opsin promoter (both long and short forms, see Le et al., Molecular Vision 2006;12:389-398, Beltran et al., Gene Therapy 17:1162-74). 2010), rhodopsin (Rho) promoter (Mussolino et al., Gene Therapy, 18:637-45, 2011), α-subunit of cone transducin (Morrissey et al., BMC Dev, Biol, 11:3, 2011), β-phosphodiesterase (PDE) promoter, retinitis pigmentosa (RP1) promoter (Nicord et al., J. Gene Vied. 9:1015-23, 2007), NXNL2 / NXNL1 promoter (Lambard et al., PLoS One, 5:el3025, 2010), RPE65 promoter (Li et al., Investigative Ophthalmology & Visual Science, December 2002, Vol.43, 3640), Retinal Degeneration Slow / Peripherin 2 (Rds / perphZ) promoter (Cai et al., Exp Eye Res, 91:186-94, 2010), VMD2 promoter (Viticular Macular Dystrophy 2, also known as BEST1, Kachi et al., Human Gene Therapy, 20:31-9, 2009), IRBP / GNAT2 promoter (hIRBP enhancer fused to the cone transducin α promoter), Retinal Degeneration Slow This includes the slow(Rds)) promoter, the hPDE6b promoter, or the VEcad promoter (VE-cadherin / cadherin 5(CDH5) / CD144 promoter). Based on the rationale and discussion presented herein, it will be understood that other promoters may be used in the art in place of or in addition to any of the exemplary promoters provided herein.

[0344] Examples of inducible promoters include, but are not limited to, calcium-sensitive promoters (e.g., the NFAT promoter, see Gene Ther. 2013 Mar;20(3):248-54), zinc-inducible sheep metallothionein (MX) promoter, dexamethasone (Dex)-inducible mouse mammary cancer virus (MMTV) promoter, T7 polymerase promoter system, ecdysone insect promoter, tetracycline repressor system, tetracycline inductor system, RU486 inductor system, rapamycin inductor system, numerous commercially available inducible promoters, and inducible promoters controlled by specific physiological conditions (e.g., temperature, acute phase, specific differentiation state of cells, or only cells in replication). In some embodiments, the inducible promoter is strictly controlled and specific to a particular ophthalmic cell type.

[0345] The promoter may be a hybrid, truncated / shortened, or modified version of another promoter and / or another regulatory sequence, or derived from another promoter and / or another regulatory sequence. For example, the CAG promoter is a hybrid of the CMV immediate early enhancer, the chicken β-actin promoter, and the rabbit β-globin gene, and the smCBA promoter is a truncated version of the CBA promoter. The promoter may also contain other elements, such as introns, exons, and / or enhancers, such as the CAG promoter. Multiple promoters may be used together in an expression cassette.

[0346] In some cases, it may be desirable to use an enhancer sequence to increase and / or stabilize expression beyond that produced by the promoter. Representative enhancer sequences are not limited to, but include post-transcriptional regulatory factors (e.g., woodchuck virus post-transcriptional regulatory element (also known as WPRE), or hepatitis B virus post-transcriptional regulatory element (also known as HPRE or HBVPRE, Donello et al., J Virol. 1998 Jun;72(6):5085-92, Sun et al., DNA Cell Biol. 2009 May;28(5):233-240), or various shortened, variant, or modified WPREs, such as shortened WPREs up to approximately 247 bp containing the minimum γ and α elements of WPRE (Choi et al., Mol Brain. 2014;7:17, Donello et al., J Virol. 1998 Jun;72(6):5085-5092, Zanta-Boussif et al., Gene Therapy (2009)16, Examples include 605-619), or 1RBP enhancers (Nicord et al., J. Gene Vied. 9:1015-23, 2007), constitutive transport element (CTE) enhancers (e.g., Mason-Pfizer monkey virus CTE or avian leukemia virus CTE), cytomegalovirus (CMV) immediate early enhancers, those derived from immunoglobulin genes or SV40 enhancers, or cis-acting elements identified in mouse proximal promoters, intronic regulatory sequences (e.g., a mini-intron splice donor / splice acceptor called SD-SA derived from SV-40), and internal ribosome entry sites (IRESs) that can be used to produce multiple polypeptides from a single gene transcript (e.g., a protein containing multiple polypeptide chains, or two different proteins; RPE, photoreceptors, and poliovirus internal ribosome entry sequences that support transgene expression in ganglion cells).

[0347] Polyadenylation of transcripts is important for nuclear transport, translation, and mRNA stability. Therefore, the efficiency of transcript polyadenylation is important for transgene expression. Representative polyA signal sequences, though not limited to these, include the SV40 polyA signal, the SV40 late polyA signal, the SV40 early polyA signal, the bovine growth hormone polyadenylation (bGH polyA) signal, the small polyA, or the human growth hormone polyadenylation (hGH polyA) signal. In some cases, upstream enhancer (USE) sequences may be used to improve the efficiency of polyA signaling (e.g., SV40 late 2×USE, HIV-1 USE (human immunodeficiency virus 1), GHV USE (ground squirrel hepatitis virus), adenovirus (L3) USE (adenovirus), hTHGB USE (human prothrombin), or hC2 USE (human C2 complement gene)) (Schambach A, Galla M, Maetzig T, Loew R, Baum C. Improving transcriptional termination of self-inactivating gamma-retroviral and lentiviral vectors. Mol Ther. 2007;15(6):1167-1173).

[0348] Similar to promoter sequences, other regulatory sequences used in expression cassettes may be hybrids, truncated / shortened versions, modified versions, or other derived versions of regulatory sequences. Examples include truncated WPRE, late SV40 2×USE, and late SV40 polyA. In addition to the elements described herein, expression cassettes may also include other regulatory sequences, such as introns, UTRs, and linker sequences. The inclusion of splice sites (i.e., exons with two adjacent introns) has been shown to be useful in increasing gene expression of proteins from expression cassettes.

[0349] It is well known in the art that control sequences or hybrid control sequences commonly have multiple versions and multiple names. For example, various promoters, enhancers, and polyA signals have many versions, including, but not limited to, the CMV promoter, EF1α promoter, WPRE enhancer, and SV40 polyA signal. The CAG promoter has several alternative names, including, but not limited to, the CBA promoter, CB promoter, or CAGGS promoter. Furthermore, control sequences can be shortened, modified, or combined with other sequences to create derivatives or variants. For example, the CAG (also known as CBA, CB, or CAGGS) promoter is a hybrid of the CMV early enhancer, the chicken β-actin promoter, and the rabbit β-globin gene, and the smCBA promoter is a cleaved CAG promoter, and CB SB It is also known in the art that the promoter is a truncated CAG promoter, differing by approximately 152 bp at the 5' end of the CMV earliest enhancer. Furthermore, the regulatory sequence may be referred to by other names; for example, post-transcriptional regulatory elements such as HPRE or WPRE are also referred to as enhancers. The regulatory sequences described herein envision all variations, derivatives, and / or hybrids of such regulatory sequences. Any exemplary sequences provided herein with respect to regulatory sequences are illustrative in nature and do not limit the definition or scope of such regulatory sequences to those shown in the exemplary sequences.

[0350] In some embodiments, microRNA (miRNA) technology may be used in the design of expression cassettes to achieve desired expression specificity (e.g., suppression of off-target transgene expression). For example, but not limited to, a target sequence of miR181 (a miRNA shown to be expressed only in ganglion cells and retina) may be added directly below the CYP4V2 cDNA to inhibit the synthesis of expression cassette-mediated CYP4V2 protein in ganglion cells and retina. Similarly, a target sequence of a miRNA expressed only in a specific cell type may be used to suppress expression cassette-mediated CYP4V2 protein expression in a particular cell type to achieve target tissue or cell-specific expression.

[0351] Design of efficient expression cassettes and delivery vectors for D.CYP4V2 gene therapy Detailed discussions of the design methods for CYP4V2 expression cassettes and delivery vectors, as well as various designs for these studies, are presented in the Examples section of this specification.

[0352] Use of EFS promoter and / or small polyA signaling (SPA) in the treatment of ocular diseases As discussed herein, gene delivery vectors have packaging size limitations. For example, the packaging limit for single-stranded AAV vectors is approximately 4.7–5.0 kb; exceeding this limit significantly reduces transduction and expression efficiency. In the case of self-complementary AAVs (scAAVs), the packaging limit is halved to approximately 2.4–2.5 kb. Therefore, size is important for vector-mediated gene delivery and gene therapy. In the case of double-stranded self-complementary vectors, it is desirable, and in some cases important, to use small-sized control sequences to ensure sufficient space for the transgene (e.g., cDNA). Due to this size limitation, large promoters are also unsuitable for use with scAAVs. In the case of CYP4V2 gene therapy, if the cDNA size is approximately 1578 bp and the AAV ITR (mutated) is approximately 258 bp, only about 500–600 bp remains for the control sequence. Since CYP4V2 is expressed almost ubiquitously, in some embodiments, it is desirable to use a constitutive promoter to drive CYP4V2 transgene expression. However, there is no space for many other constitutive promoters used in single-stranded AAV designs, such as the approximately 1.7kb constitutive CAG promoter, the approximately 953bp truncated CBA promoter (smCBA), the approximately 800bp CBh promoter, or the approximately 600bp CMV promoter. Instead, a short-length EFS promoter can be used for scAAV designs (an exemplary sequence is shown in SEQ ID NO: 34). Similar size limitations apply to other control sequences, such as the polyA signal. The bGH polyA is approximately 225bp, the SV40 polyA is approximately 240bp, and the SV40 late polyA is approximately 120bp. Any of these would occupy a large portion of the approximately 500bp length remaining for the control sequences, including the promoters. Therefore, a small polyA signal (SPA) of only approximately 54bp (an exemplary sequence is shown in SEQ ID NO: 35) was used for scAAV designs.

[0353] Designs using the EFS promoter and SPA occupy only about 300 bp, totaling about 600 bp with the AAV ITR. This leaves approximately 1.8–1.9 kb of remaining packaging space for the nucleic acid sequences encoding the desired protein and other sequences in the expression cassette designed for scAAV, and approximately 4.1–4.4 kb of remaining packaging space for the nucleic acid sequences encoding the desired protein and other sequences in the expression cassette designed for ssAAV. As a result, rAAV vectors containing the EFS promoter and SPA can package larger cDNA and / or other sequences compared to using larger promoter and polyA signal sequences, with non-limiting examples including the CMV promoter, CAG promoter, smCBA promoter, CBh promoter, EF1α promoter, bGH polyA, SV40 polyA, and SV40 late polyA.

[0354] A schematic diagram of an expression cassette containing the EFS promoter and its SPA is shown in Figure 4b. The construct shown in Figure 7b contains CYP4V2 cDNA. CYP4V2 cDNA may be replaced with another target gene for expression cassettes used to express other transgenes.

[0355] This study investigated the use of the EFS promoter and SPA in expression cassettes and delivery vectors to drive nucleic acid coding sequences for the treatment of ocular diseases. A scAAV2 / 1 vector (referred to as scAAV1.EFS.CYP4V2op.SPA) containing the EFS promoter, CYP4V2 cDNA, and SPA was constructed. scAAV1-EFS-CYP4V2op-SPA was applied to iPS-RPE cells from BCD patients. Despite the short length of the EFS promoter and SPA, scAAV1-EFS-CYP4V2op-SPA demonstrated rapid and robust action in BCD patient iPS-RPE cells in just 4 days (see Table 3). This indicates that the EFS promoter and / or SPA are small-sized regulatory sequences highly useful in scAAV systems for ocular gene therapy. Furthermore, robust expression of the scAAV vector makes the scAAV design suitable for other administration routes (e.g., intravitreal delivery) in addition to subretinal delivery.

[0356] The use of EFS promoters and / or SPAs is not limited to their use in CYP4V2 gene therapy or scAAV constructs. They can be used in gene therapies involving other genes where short promoters and polyA signals are necessary for rapid and sufficient protein expression in the size of the transgene and / or the design of the scAAV.

[0357] E. Treatment options, selection of target, and administration CYP4V2 gene therapy can be applied in various ways. In some cases, the therapy may be applied in vivo to a target subject (e.g., a BCD patient) by effectively delivering a delivery vector containing a CYP4V2 expression cassette to the target cells, tissues, or organs of the therapy (e.g., RPE, photoreceptors, choroid, cornea, lymphocytes, retina, or eye). In some cases, the therapy may be applied in vitro to target cells (e.g., the patient's iPS-RPE cells, the patient's iPS-photoreceptor cells, iPS-photoreceptor progenitor cells, iPS-CECs, lymphocytes). The treated cells may then be transplanted into the subject in need (e.g., a BCD patient). In some cases, the therapy may be applied in combination with both in vivo and in vitro approaches. In some cases, CYP4V2 gene therapy may be used alone. In some cases, CYP4V2 gene therapy may be used in conjunction with other treatment options.

[0358] Candidate subjects for this treatment method include those diagnosed with BCD. Subjects suffering from other clinically defined ophthalmic conditions caused by mutations in the CYP4V2 gene (e.g., hereditary retinal degeneration (IRD), retinitis pigmentosa (RP), or corneal dystrophy) can also be treated using the method described herein. Diagnosis of BCD, IRD, RP, corneal dystrophy, or other ophthalmic conditions caused by mutations in the CYP4V2 gene can be made using methods known in the art. The method described herein may include identifying a subject (e.g., having BCD or another ophthalmic condition caused by mutations in the CYP4V2 gene, or suspected of having BCD or another ophthalmic condition caused by mutations in the CYP4V2 gene (e.g., based on the presence of symptoms of the condition and without other apparent causes), being a child, adolescent, or adult), and obtaining a sample containing genomic DNA from the subject and detecting the presence of a mutation in the CYP4V2 gene using known molecular biological methods.

[0359] Numerous mutations causing BCD have been identified in the CYP4V2 gene, and the gene At least one mutation has been identified in each of the 11 exons. The most common CYP4V2 mutation among BCD patients is c.802-8_810del17insGC (referring to a 17-base deletion and a 2-base (GC) insertion at a site beginning 8 bases from the end of intron 6 of the CYP4V2 gene, also known as IVS6-8 del / insGC. This insertion-deletion mutation is located at the intron 6-exon 7 junction, and the 17bp deletion includes the exon 7 splice-acceptor site, resulting in an in-frame deletion of 62 amino acids encoding exon 7), which has been shown by genotyping analysis to result in the deletion of exon 7. (Xiao et al., Biochem Biophys Res Commun. 409:181-6, 2011, Meng et al., 2014, Mol. Vis., 20:1806-14, Wada et al., Am J Ophthalmol. 139:894-9, 2005, Jiao et al., European Journal of Human Genetics (2017)25, 461-471). Various types of CYP4V2 mutations associated with BCD have been discovered, including non-limiting examples such as missense, splice sites, frameshifts, deletions, insertions, indels (insertions and deletions), nonsense, polymorphisms (e.g., single nucleotide polymorphisms), and premature termination. Table 1 shows a summary of selected CYP4V2 mutations among human BCD patients, which can be found in various publications and online databases, such as LOVD (databases.lovd.nl / shared / genes / CYP4V2, World Wide Web), OMIM (omim.org / allelicVariant / 608614, World Wide Web), and ClinVar (ncbi.nlm.nih.gov / clinvar?term=608614[MIM], World Wide Web).

[0360] It should be noted that the human CYP4V2 mutations in Table 1 are not exhaustive. More CYP4V2 mutations may be identified in the future. It should be understood that not all changes to the reference sequence are mutations. Some changes are non-pathological. Methods for determining whether a genetic change is pathological, i.e., a mutation, are known in the art, and non-limiting examples include comparing the mutation in question with previously clinically identified known mutations and / or determining whether a corresponding functional change exists. For example, one method for determining whether a genetic change is pathological (i.e., a mutation) is to test the biochemical function of the iPS-RPE cell line derived from the subject, as described herein, and compare it with that of a healthy control iPS-RPE cell line to assess whether there is an abnormality.

[0361] Patients with BCD or other ophthalmic conditions caused by CYP4V2 mutations that can be treated using the methods described herein preferably maintain some degree of photoreceptor and visual function (e.g., visual acuity, visual field, visual function, and / or measured by optical coherence tomography (OCT, e.g., spectral domain-OCT (SD-OCT))).

[0362] Before administration, the final product undergoes a series of processes (e.g., ultrapurification) to meet clinical-grade standards. Clinical-grade products are commercially available through various GMP facilities, including, but not limited to, the NIH Gene Therapy Resource Program (GTRP) and contract manufacturing organizations (CMOs).

[0363] Prior to administration, the subject may be tested for existing neutralizing antibodies (NAbs) against the AAV vector type to which the subject will be administered. In one embodiment, if the subject already has NAbs against such an AAV type, an alternative AAV vector with low cross-reactivity with the subject's existing NAbs, or an AAV vector with a modified capsid structure, may be used for administration to such subject in order to reduce the immune response and maintain sufficient transduction efficiency by the AAV vector. Other methods for minimizing the immune response are known in the art and include, in non-limiting examples, the application of immunosuppressants and immunosuppressive protocols before, during, and / or after treatment.

[0364] Viral or nonviral vectors, or combinations thereof (e.g., hybrid vectors), can be delivered to target ophthalmic cells by one or more physical means. Ophthalmic cells used herein include, but are not limited to, retinal pigment epithelial (RPE) cells, photoreceptor cells, corneal epithelial cells, retinal cells, retinal bipolar cells, rod cells, cone cells, ganglion cells, choroidal cells, and / or lens cells. In addition, or instead, the vector may be delivered to cells near the target cells, nearby cells, or cells that can come into contact with the target cells, non-limiting examples of which include brain cells, optic nerve cells, or blood cells.

[0365] In vitro treatment can be carried out by any method or combination of method and / or agent that effectively delivers the vector to the target cells of treatment (e.g., iPS-RPE cells of BCD patients). In vitro treatment can be carried out via one or more infections. In some cases, the vector is applied directly to cultured cells to transfect or transduce them. In some cases, other methods can be used to enhance the delivery and / or transfection / transduction efficiency in the cells, and non-limiting examples include multiple transfection / transduction, electroporation, magnetofection, or sonoporation. Methods and agents used in infecting / transfecting cells with the vector or expression cassette are known in the art and, non-limiting examples, are described in the Examples section herein.

[0366] Cells treated in vitro may subsequently be transplanted into the target eye. For example, genetically repaired iPS-RPE cells from a BCD patient can be transplanted into the patient by subretinal injection. Methods, drugs, and devices used for cell transplantation into the eye are publicly known in the art. See, for example, Wert et al., J Vis Exp. 2012;(69):4286, WO 2016 / 179496, and Schwartz et al., Investigative Ophthalmology & Visual Science April 2016, Vol.57, ORSFc1-ORSFc9.

[0367] In the case of in vivo therapy, the vector and / or expression cassette can be delivered to the target cells of the therapy in vivo (for example, through administration to the eye of a subject requiring treatment for delivery to the target cells of the therapy). Methods of delivering nucleic acid molecules, expression cassettes, and vectors to target ocular cells in vivo are known in the art. For example, in administration to the eye, depending on the target cells of the therapy, any method (or combination of method and / or drug) that effectively delivers the vector to the retina, subretinal space, choroid, or generally the posterior part of the eye, cornea, lens, or vitreous humor may be used. Administration can be carried out by any suitable means, including, but not limited to, injection (e.g., subretinal injection, intravitreal injection, direct retinal injection, direct injection into the posterior suprachoroidal space of the eye), eye drops, etc., and may be applied in combination with other delivery methods (e.g., motorized delivery to the corneal epithelium). CYP4V2 nucleic acid, expression cassettes, and / or delivery vectors may be introduced into cells using, for example, DNA particle collision (e.g., by gene gun), hydrodynamic gene transfer, eye drops, electroporation, magnetofection, or sonoporation. Methods and techniques for administration and delivery to the eye are known in the art. See, for example, Wert et al., J Vis Exp. 2012;(69):4286, International Publication 2016 / 179496, and Mohan et al., Prog Retin Eye Res. 2012 Jan;31(1):43-64.

[0368] In addition to conventional delivery to RPE cells by subretinal injection, one aspect of the methods discussed herein is intravitreous delivery of nucleic acid molecules (e.g., those having a non-mutant CYP4V2 nucleic acid sequence) for the treatment or prevention of eye diseases. Several vectors (e.g., AAV2 (quadY-F) + TV) and AAV 7m8, etc.) are particularly useful for efficient transduction into the retina by intravitreous administration. Furthermore, AAV or other viral vectors can be modified by techniques known in the art, including, for example, "directional evolution" and "rational design," to improve or optimize their suitability as vectors for gene delivery to one or more cell types or tissues (e.g., intravitreous injection) by means other than conventional subretinal injection. Because scAAV vectors have a rapid and robust expression profile, they can be used for intravitreous delivery in addition to subretinal delivery. Because CYP4V2 is distributed almost ubiquitously and expresses particularly high levels in the retina, genetic and epigenetic modifications of CYP4V2 are particularly well-suited for repair by intravitreous delivery of one or more vectors. Current gene therapies generally require subretinal delivery of vectors. Therefore, one of the technological advances achieved by the materials and methods of this disclosure is the intravitreous delivery of nucleic acid sequences (e.g., wild-type or non-mutant nucleic acid sequences, or nucleic acid sequences encoding gene-editing polypeptides) and / or polypeptides for the treatment and prevention of eye diseases associated with genetic or epigenetic alterations of the nucleic acid sequence of CYP4V2.

[0369] Several techniques and agents may be used to facilitate the administration or delivery process. A non-limiting example is the use of lubricants to prevent the vector from adhering to the delivery medium (e.g., a needle). Furthermore, the use of immunosuppressants before, during, and / or after the administration or delivery process can enhance the efficiency of infection or transduction.

[0370] Vectors can be formulated for delivery to target ocular cells using a variety of pharmaceutically and / or physiologically acceptable excipients, diluents, and / or carriers. Examples of excipients, diluents, and / or carriers (also referred to as pharmaceutically acceptable carriers) suitable for ocular administration include sterile pyrogen-free water and sterile pyrogen-free buffered saline (e.g., saline buffered with phosphate or other buffers such as HEPES to maintain an appropriate physiological level of pH), isotonic sodium chloride solutions, equilibrium salt solutions, emulsions (e.g., oil / water emulsions), and various types of wetting agents. In some examples, the formulation may contain other medical agents, pharmaceutical agents, stabilizers, buffers, carriers, adjuvants, and diluents. In some examples, the formulation may contain DBPS, glycerol, or Tween20 for long-term storage.

[0371] Methods for determining the most effective means of administration and therapeutically effective doses are known to those skilled in the art and may also vary depending on the vector, its capsid structure, vector design (e.g., ssAAV vs. scAAV), expression cassette composition, vector expression level, promoter, other regulatory sequences or nucleic acid molecules, vector titer, target cell type, target expression level, target area or number of cells, and the target of treatment (e.g., age, sex, weight, disease progression and status of the target, and potential immune response), route of administration, location of target cells (e.g., retina vs. cornea), properties and expression levels of relevant genes in wild-type cells and / or tissues, and the required regimen. The therapeutically effective dose can be determined and evaluated in disease models (e.g., BCD cell models (e.g., iPS-RPE cell lines from BCD patients)) or animal models and confirmed or refined in clinical trials. In in vitro cell therapy, the dose is usually expressed as MOI, which is then multiplied by the number of cells being treated. MOI is typically about 1 × 10⁶ per cell. 3 Approximately 1 x 10 from GC 6The infectious MOI (GC) is within the range of GC, or approximately 100 to 10,000 GC per cell (GC: measurement of AAV particles containing the genome (also known as vector genome (vg) or genome particle (gp))). In the case of in vivo treatment, in addition to the factors above, the actual dose may also be affected by the individual circumstances unique to each patient during treatment (e.g., the reduced dose during subretinal administration in patient 6 with a case of congenital choroidal absence described below). Therefore, the therapeutically effective dose for a single in vivo dose is approximately 1 × 10⁻⁶ 6 ~2×10 13 GC order (for example, approximately 1 × 10⁻¹⁰) 11 GC~approx. 1×10 12 The high-dose range of GC is approximately 1 × 10⁻⁶. 10 GC~approx. 1×10 11 GC medium dose range, approximately 1 × 10 9 GC~approx. 1×10 10 The low-dose range of GC is approximately 1 × 10⁻⁶. 6 GC~approx. 1×10 9 The ultra-low dose range of GC, and approximately 1 × 10⁻⁶ 12 GC ~ approx. 2×10 13 The dose may be in the ultra-high dose range of GC, or any dose within that range that is sufficient to provide the desired effect. In one embodiment, the composition is about 1 × 10 6 ~Approx. 2×10 13 It is administered at a GC dose. In another embodiment, the in vivo dose is determined by multiplying the number of target cells by the target MOI (e.g., 1 × 10⁶ cells). 3 GC~approx. 1×10 6 (GC). The volume of the drug containing the rAAV vector in any single administration to the eye may be in the range of approximately 1 μL (0.001 mL) to approximately 1000 μL (1 mL).

[0372] The compositions described herein may be formulated for single-dose or multi-dose administration. Similarly, administration may be a single dose or multiple doses (e.g., over several weeks, months, or years), and may be applied to the same eye or the opposite eye. In the case of multi-dose administration, the same or different AAV serotypes and / or the same or different routes of administration may be considered. The administration may also be applied to treat different tissues and cells (e.g., a single dose targeting the RPE and a subsequent dose targeting the cornea).

[0373] Methods for preparing viral vectors for use in gene therapy (such as ocular gene therapy), producing, purifying, formulating, and administering GMP are known to those skilled in the art, and methods for preparing viral vectors can be carried out by any of the numerous companies and methods demonstrated in the gene therapy studies of various groups of LCA-2 described below. The expression cassettes provided herein may be inserted into any of the exemplary viral vectors listed below, or viral vectors may be prepared based on the examples shown below. See Bainbridge et al., 2008. N Engl J Med. 358:2231-9, Maguire et al., 2008. N Engl J Med. 358:2240-8, and Hauswirth et al., Hum Gene Ther. 2008 Oct;19(10):979-990.

[0374] For example, in the Bainbridge study, the tgAAG76 vector, a recombinant adeno-associated virus vector of serotype 2, was used for gene delivery. The vector contains a human RPE65 coding sequence driven by the human RPE65 promoter and terminated by a bovine growth hormone polyadenylation site, as described elsewhere. The vector was targeted using the B50 packaging cell line, an adenovirus-adeno-associated virus hybrid shuttle vector containing the tgAAG76 vector genome, and adenovirus 5 helper virus, in accordance with GMP (Good Manufacturing Practice) guidelines. Produced by Genetics Corporation. The vector is 1 × 10 11 The vector particles were filled with buffered saline at a titer of [number] particles / mL and frozen in 1 mL aliquots at -70°C.

[0375] Maguire used a recombinant AAV2.hRPE65v2 viral vector, a replication-deficient AAV vector containing RPE65 cDNA, which has been demonstrated to produce long-term and sustained (>7.5 years, observation ongoing) recovery of visual function after a single subretinal injection of AAV2.RPE65 in a canine model of LCA2. The cis-plasmid used to construct AAV2.RPE65 contains a kanamycin resistance gene. This virus was produced by the Center for Cellular and Molecular Therapeutics after triple transfection of HEK293 cells and isolated and purified by microsolution manipulation, filtration, cation exchange chromatography (POROS 50HS, GE Healthcare, Piscataway, NJ), density gradient ultracentrifugation, and diafiltration in PBS. This combination allows for optimal purity of the AAV vector product, including efficient removal of empty capsids and residual cesium chloride. To prevent further loss of the vector to the product contact surface, PF68 NF prillpoloxamer 188 (PF68, BASF, Ludwigshafen, Germany) was added to a portion of the product. The purified viruses, both those treated with PF68 and those not treated with PF68, were passed through a 0.22 μm filter using a sterile 60 mL syringe and syringe filter, and stored frozen (-80°C) in sterile tubes until use. 1.5 × 10⁶ AAV2.hRPE65v2 samples were obtained from 150 μL of phosphate-buffered saline containing Pluronic F-68 NF prillpoloxamer 188. 10 The vector genome was injected via subretinal administration.

[0376] The viral vector used by Hauswirth was a recombinant adeno-associated virus serotype 2 (rAAV2) vector (rAAV2-CB) modified to carry the human RPE65 gene. SB -hRPE65) has been previously demonstrated to restore vision in animal models of RPE65 deficiency. The RPE65-LCA viral vector was delivered by subretinal injection (5.96 × 10⁶ in 150 μL). 10 (Vector genome).

[0377] Methods and protocols for administering therapeutic agents (e.g., proteins, nucleic acid molecules, expression cassettes, gene therapy vectors, cells) to the eye, as well as other procedures and protocols (e.g., immunological tests, ophthalmic examinations, and immunosuppressants), not limited to these, are known in the art. For example, the following is an example of subretinal injection of the AAV vector used by MacLaren to treat congenital choroidal agenesis. The first step was surgical detachment of the retina using a 41G Teflon cannula (DORC International BV, Zydrant, Netherlands) with a buffered salt solution (Alcon Laboratories, Fort Worth, Texas, USA). Once the target area of ​​the retina was detached from the underlying retinal pigment epithelium, 1 × 10⁻¹⁶ AAV2.REP1 was injected. 10 A fixed volume (0.1 mL) containing genomic particles was injected into the subretinal space created in the first five patients via a new syringe. In patient 6, a reduced volume of up to 6 × 10⁶ was used. 9Numerous genomic particles were injected. The vector was slowly injected through the same retinal incision to further enlarge the detachment. The procedure was complication-free in the first five patients, but in patient 6, detachment from the peripheral macula of the retina was difficult, requiring induction of detachment from a point near the fovea, resulting in apparent stretching of the palpebral-macular bundle. Due to concerns about stretch-related damage to this critical structure in a patient with visual acuity 6 / 7·5, a smaller amount of vector (maximum 0.06 mL) was injected in the second step. In all patients, any excess vector remaining in the syringe was drained through a cannula into a polypropylene vial and subsequently frozen. This excess vector was later tested for efficacy by Western blotting after transduction of a human-derived HT1080 cell line. Patients were treated with a 10-day course of oral prednisolone. This treatment began with 1 mg / kg (70-100 mg) for 7 days, starting 2 days before surgery, and was then reduced to 40 mg per day, 20 mg per day, and 10 mg per day. Blood samples were taken for immunological testing before surgery, 1 week post-surgery, and 5-6 weeks post-surgery. See MacLaren et al., Lancet. 2014 March 29;383(9923):1129-1137.

[0378] In Hauswirth's study, administration was performed as follows: After mild intravenous sedation, the eye to be operated on was anesthetized retrobulbarly, prepared using standard sterile methods, and draped. A standard 3-port 23-gauge central and peripheral vitrectomy was performed. The conjunctiva above the scleral incision on the right side was cut with Westcott scissors and 0.3 forceps. Hemostasis was maintained with a cauterizer with an eraser. The scleral incision was enlarged with a 20-gauge MVR blade to facilitate insertion of the subretinal cannula into the eye. The vector was drawn into a 39-gauge injection cannula (Synergetics, O'Fallon, Minnesota) and introduced into the subretinal space. At the end of the procedure, the scleral incision site was fixed with 7.0 Vicryl sutures, and the conjunctiva was closed with intermittent sutures. Antibiotics and steroids were administered subconjunctivally. Topical antibiotics and steroids were used for 20 days postoperatively. See Hauswirth et al., Hum Gene Ther. 2008 Oct;19(10):979-990.

[0379] In in vitro CYP4V2 gene therapy, post-treatment evaluation may involve comparing cellular morphology and / or biochemical function impairments in the patient's cells. For example, to assess whether cellular morphology and / or biochemical function improved after treatment, the levels of compounds that showed abnormalities in BCD patients' iPS-RPE cells (or iPS-PRC or iPS-CEC cells, if applicable) may be compared before and after treatment.

[0380] In in vivo CYP4V2 gene therapy, post-treatment evaluation may utilize ophthalmic and retinal examinations (and corneal examinations, if applicable) known in the art for retinal and corneal diseases. Non-limiting examples include functional tests such as dark adaptation, contrast sensitivity, visual field testing, visual acuity testing, color vision testing, ERG, OCT, fundus imaging, corneal examination, and mobility testing. Efficacy can be verified by improvement in visual acuity, cessation of disease progression, or slower-than-expected progression of retinal degeneration or vision loss.

[0381] One challenge of viral vector-mediated gene therapy is the immune response of the recipient. In addition to the risks traditionally associated with the recipient, the immune response can significantly reduce the transduction efficiency of the viral vector and / or make it difficult to establish long-term transgene expression. Mingozzi F, Meulenberg JJ, Hui DJ, Basner-Tschakarjan E, Hasbrouck NC, Edmonson SA, Hutnick NA, Betts MR, Kastelein JJ, Stroes ES, High KA, AAV-1-mediated gene transfer to skeletal muscle in humans results in dose-dependent activation of capsid-specific T cells. Blood. 2009 Sep 3;114(10):2077-86.

[0382] Perhaps due to the unique immunological environment of the eye, the immunological effects of various recombinant viral vectors (e.g., AAV, lentivirus, adenovirus) in ocular gene therapy appear to be fairly benign. Nevertheless, significant cellular immune responses may occur after intraocular administration of adenovirus. However, since neither AAV nor lentivirus induces cell-mediated responses, they are promising vectors for the treatment of chronic ocular (retinal) diseases. J Bennett, Immune response following intraocular delivery of recombinant viral vectors, Gene Therapy (2003)10, 977-982. doi:10.1038 / sj.gt.3302030. On the other hand, previous studies have shown that intravitreous administration of AAV vectors increases anti-AAV antibody levels in both vitreous fluid and serum of non-human primates. Furthermore, the presence of pre-existing neutralizing antibody titers in monkey serum strongly correlated with weak transgene expression, attenuated transg...

Claims

1. An RNA molecule selected from guide RNA (gRNA), CRISPR RNA (crRNA), and single guide RNA (sgRNA) that contains a nucleic acid sequence that targets the CYP4V2 gene or the c.802-8_810del17insGC mutation within the CYP4V2 gene, wherein the nucleic acid sequence is one of the following: SEQ ID NO: 48 (UGAUUAUCAUUCAAAGCGAA), SEQ ID NO: 49 (GAUUAUCAUUCAAAGCGAAC), SEQ ID NO: 50 (GAUAAUCACAUGCUUCUGUU), SEQ ID NO: 51 (UUCAUUGGCGUUCAUUUCAU), and SEQ ID NO: 52 (CACAUGCUUCUGUUUGGACU).

2. The RNA molecule according to claim 1, wherein the nucleic acid sequence is one of sequence number 48, sequence number 49, sequence number 50, and sequence number 51.

3. A chemically modified RNA molecule according to claim 1 or 2.

4. A DNA molecule encoding an RNA molecule according to claim 1 or 2.

5. An RNA molecule according to any one of claims 1 to 3, or a DNA molecule according to claim 4, wherein a "g" nucleotide is added to the start of a nucleic acid sequence that targets the CYP4V2 gene or the c.802-8_810del17insGC mutation within the CYP4V2 gene.

6. A composition comprising an RNA molecule according to any one of claims 1 to 3, a DNA molecule according to claim 4, or an RNA molecule or DNA molecule according to claim 5.

7. The composition according to claim 6, further comprising CRISPR-related protein 9 (Cas9 protein), or a nucleic acid molecule encoding Cas9 protein.

8. The composition according to claim 7, wherein the Cas9 protein, or the nucleic acid molecule encoding the Cas9 protein, further comprises one or more nuclear localization sequences (NLS) and / or selection markers.

9. The composition according to any one of claims 6 to 8, further comprising a donor nucleic acid molecule containing all or part of the wild-type sequence or functional sequence of the CYP4V2 gene.

10. The composition according to claim 9, wherein the donor nucleic acid molecule contains any one sequence of sequence numbers 47, 56, and 57 or its complementary sequence, or has at least 90% sequence identity with any one sequence of sequence numbers 56 and 57 or its complementary sequence.

11. The composition according to claim 9 or 10, wherein the donor nucleic acid molecule is contained in a single-stranded donor oligonucleotide (ssODN) or a vector.

12. The composition according to any one of claims 6 to 11, wherein one or more components are provided in the form of a DNA molecule encoding the component, an mRNA encoding the component, a nucleic acid molecule, a vector, an RNA molecule, a polypeptide, a ribonucleoprotein (RNP), or a protein-RNA complex, and / or a combination thereof.

13. The composition according to claim 12, wherein the vector is a plasmid, a recombinant AAV (rAAV) vector, a recombinant lentiviral vector, and / or a combination thereof.

14. The composition according to any one of claims 6 to 13, wherein any two or more components are present in separate molecules, combined in one molecule, combined in one complex, present in a separate vector, combined in one vector, present in one or more nucleic acid complexes, or present in one or more RNP complexes.

15. Furthermore, the composition according to any one of claims 6 to 14 comprises a pharmaceutically acceptable carrier and additional components suitable for a specific route of administration or delivery device.

16. A composition according to any one of claims 6 to 15, used to target, disrupt, modify, and / or replace mutations in the CYP4V2 gene in vivo in a subject or in vitro in a cell.

17. The composition according to claim 16, wherein the mutation in the CYP4V2 gene is the c.802-8_810del17insGC mutation.

18. A pharmaceutical composition comprising the composition according to any one of claims 6 to 17, for treating, preventing, or preventing crystallin retinopathy (BCD; also known as Bitti crystalline corneal-retinal dystrophy, Bitti crystalline retinopathy, or Bitti retinal dystrophy), retinitis pigmentosa (RP), or hereditary retinal degeneration (IRD), in a human subject in question, by delivering the composition according to any one of claims 6 to 17 to the retina of the human subject, A pharmaceutical composition in which one or more retinal pigment epithelial (RPE) cells, one or more choroidal cells, or one or more photoreceptor cells in the human subject are transduced by the composition.

19. The pharmaceutical composition according to claim 18, wherein at least one of the mutations in the CYP4V2 gene in the human subject is the c.802-8_810del17insGC mutation.

20. A cell comprising the composition according to any one of claims 6 to 17.

21. The cell according to claim 20, which is a mammalian cell or an insect cell.

22. The cell according to claim 20 or 21, which is a HEK293 cell, a 293T cell, an A459 cell, an Sf9 cell, or another cell used for vector production.

23. The cell according to claim 20, which is a retinal pigment epithelial (RPE) cell, photoreceptor cell, photoreceptor progenitor cell, choroidal cell, retinal cell, induced pluripotent stem (iPS) cell, or stem cell from a human subject or derived from a human subject having one or more mutations in the CYP4V2 gene.

24. The cell according to claim 23, wherein at least one of the mutations in the CYP4V2 gene possessed by the human subject is the c.802-8_810del17insGC mutation.

25. A pharmaceutical composition comprising the cells according to claim 20, 23, or 24 for treating, inhibiting, or preventing crystalline retinopathy (BCD; also known as Bitti crystalline corneal-retinal dystrophy, Bitti crystalline retinopathy, or Bitti retinal dystrophy), retinitis pigmentosa (RP), or hereditary retinal degeneration (IRD), associated with the c.802-8_810del17insGC mutation in the CYP4V2 gene, by delivering the cells according to claim 20, 23, or 24 to the retina of a human subject in need.