Dynamic human antibody light chain libraries

Abstract

The present specification provides a library comprising polynucleotides, wherein one of the polynucleotides encodes an antibody light chain having specific hypervariable regions HVR-L1, HVR-L2, and HVR-L3. Additionally, the present specification provides a library containing polynucleotides encoding a plurality of unique antibodies, each antibody comprising a heavy chain variable region and a light chain variable region. Also provided are an antibody, a polypeptide library, a vector library, a cell, a non-human animal, an antibody medium, a method for manufacturing an antibody library, a kit, and a method for manufacturing a bispecific antibody associated therewith.

Description

Technology Field

[0001] The present disclosure describes antibody light chains (e.g., , The invention relates to a library containing polynucleotides encoding the light chain of a dynamic human antibody, as well as related antibody light chains, antibodies, cells, animals, methods, and kits. Background Technology

[0002] Monoclonal antibodies have become highly useful in a wide range of fields, including biological research, medical diagnostics, and pharmaceutical products. The variability in potential binding specificity enables antibodies with valuable specificity and efficacy. However, this variability makes it difficult and challenging to screen a large number of antibodies to identify one or more antibodies with desired characteristics.

[0003] One method for identifying antibodies of interest is to screen through antibody libraries, such as libraries of cloned B cell sequences, phage display libraries, and yeast display libraries. These libraries allow screening through a significant number of antibodies representing multiple unique antibody sequences, enabling the identification of antibodies possessing specific characteristics of interest, such as binding, binding affinity, and selectivity to a specific target. However, current libraries have specific limitations. Libraries derived from biological sources, such as the human B cell repertoire, are limited to antibody sequences that can be cloned from the source. Synthetic libraries may contain non-naturally occurring sequences compared to biologically derived libraries, but this is also limited by the amount of antibodies that can be synthesized within a given period. Additionally, very large libraries require a more time-consuming and thorough screening approach; otherwise, only a fraction of the library can actually be screened for antibodies of interest.

[0004] Therefore, there is a need for the development of dynamic antibody libraries containing a robust set of dynamic units with well-defined developable sequence profiles to design and construct potentially more functionally relevant dynamic antibodies. Such libraries will significantly improve the efficiency of screening for novel and / or conformational epitopes possessing antibodies on a given antigen, as well as the diversity of antibody binding sites on antibodies within the library. Additionally, such libraries will increase the likelihood that specific antibodies of interest can be identified as having high affinity and developable profiles.

[0005] All references cited herein, including patent applications, patent publications, and UniProtKB / Swiss-Prot accession numbers, are incorporated herein by reference in their entirety as each individual document is specifically and individually included by reference.

[0006] To satisfy the above and other requirements, this specification provides antibody sequences, e.g., a light chain hypervariable region (HVR) and a light chain variable region (e.g., that enable dynamic human antibodies , A VL region) is initiated. These sequences are designed to allow antibodies having a highly flexible HVR sequence loop capable of binding to a target with high potency and / or recognizing multiple useful epitopes and / or cross-reacting with epitopes shared in different species of low sequence identity (approximately 60% sequence identity or less). Advantageously, these antibody sequences enable the generation of much smaller libraries containing multiple useful antibodies and / or much wider diversity within a given library size. Using such libraries, novel antibodies of interest can be identified that are specific to a wide range of targets or, in some cases, cross-reacting to multiple targets of interest.

[0007] Accordingly, in one aspect, the present specification provides a library comprising polynucleotides (e.g., synthetic polynucleotides), wherein one of the polynucleotides encodes an antibody light chain variable region comprising HVR-L1, HVR-L2 and HVR-L3, wherein at least two of the HVR-L1, HVR-L2 and HVR-L3 of the antibody light chain variable region comprise an amino acid sequence selected from an HVR-L1 sequence selected from the group consisting of SEQ ID NOs 1 to 4, an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9, and an HVR-L3 sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, at least 2, at least 3, at least 4, at least 5, at least 10, at least 50, at least 100, at least 200, at least 250, or 280 of the polynucleotides encode a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, wherein at least 2 of the HVR-L1, HVR-L2, and HVR-L3 of the antibody light chain variable region comprise an amino acid sequence selected from the group consisting of HVR-L1 sequences selected from SEQ ID NOs 1 to 4, HVR-L2 sequences selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 sequences selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, each polynucleotide encodes a light chain comprising HVR-L1, HVR-L2 and HVR-L3, wherein at least two of HVR-L1, HVR-L2 and HVR-L3 comprise an amino acid sequence selected from the group consisting of HVR-L1 sequences selected from SEQ ID NOs 1 to 4, HVR-L2 sequences selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 sequences selected from the group consisting of SEQ ID NOs 10 to 23.

[0008] In some embodiments, the polynucleotide contains a unique combination of HVR-L1, HVR-L2, and HVR-L3 sequences of about 1,000 or fewer. In some embodiments, the polynucleotide contains a unique combination of HVR-L1, HVR-L2, and HVR-L3 sequences of about 280 or fewer. In some embodiments, the light chain variable region comprises HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9 and HVR-L3 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, and HVR-L2 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4 and HVR-L3 of an antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, at least one of the HVR-L1, HVR-L2, and HVR-L3 of the antibody light chain variable region adopts a plurality of stereostructures when verified by structural determination and / or computer modeling. In some embodiments, at least one of the polynucleotides encoding the antibody light chain variable region is present in the vector. In some embodiments, the vector is an expression vector. In some embodiments, the vector is a display vector.In some embodiments, at least one of the polynucleotides encoding the variable region of the antibody light chain is present within the cell. In some embodiments, the cell is a bacterial, yeast, or mammalian cell (e.g., a non-human animal cell or an isolated human cell).

[0009] In some embodiments, the light chain variable region comprises three HVR-L1, HVR-L2, and HVR-L3 selected from the group consisting of: (1) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (2) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (3) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (4) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; (5) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; (6) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; (7) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; (8) HVR-L1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having an amino acid sequence of SEQ ID NO. 9, and HVR-L3 having an amino acid sequence of SEQ ID NO. 23;(9) HVR-L1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having an amino acid sequence of SEQ ID NO 9, and HVR-L3 having an amino acid sequence of SEQ ID NO 20; (10) HVR-L1 having an amino acid sequence of SEQ ID NO 3, HVR-L2 having an amino acid sequence of SEQ ID NO 9, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (11) HVR-L1 having an amino acid sequence of SEQ ID NO 4, HVR-L2 having an amino acid sequence of SEQ ID NO 6, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (12) HVR-L1 having an amino acid sequence of SEQ ID NO 4, HVR-L2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having an amino acid sequence of SEQ ID NO 23; (13) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 14; (14) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (15) HVR-L1 having the amino acid sequence of SEQ ID NO. 3, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; (16) HVR-L1 having the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 14;(17) HVR-L1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having an amino acid sequence of SEQ ID NO. 6, and HVR-L3 having an amino acid sequence of SEQ ID NO. 23; and (18) HVR-L1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having an amino acid sequence of SEQ ID NO. 7, and HVR-L3 having an amino acid sequence of SEQ ID NO. 23. In some embodiments, the light chain variable region comprises three of HVR-L1, HVR-L2, and HVR-L3 selected from the group consisting of: (1) HVR-L1 having an amino acid sequence of SEQ ID NO. 2, HVR-L2 having an amino acid sequence of SEQ ID NO. 9, and HVR-L3 having an amino acid sequence of SEQ ID NO. 18; (2) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 23; (3) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; (4) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 14; (5) HVR-L1 containing the amino acid sequence of SEQ ID NO. 3, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; (6) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 18; (7) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 7, and HVR-L3 having the amino acid sequence of SEQ ID NO. 23;(8) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 6, and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (9) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 6, and HVR-L3 having the amino acid sequence of SEQ ID NO. 17; (10) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 5, and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; and (11) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 8, and HVR-L3 having the amino acid sequence of SEQ ID NO. 11. In some embodiments, the light chain variable region comprises HVR-L1, HVR-L2, and HVR-L3 of the antibodies listed in Table 2.;

[0010] In some embodiments, the light chain variable region comprises FW-L1 comprising the amino acid sequence of SEQ ID NO. 24, FW-L2 comprising the amino acid sequence of SEQ ID NO. 25, FW-L3 comprising the amino acid sequence of SEQ ID NO. 26, and FW-L4 comprising the amino acid sequence of SEQ ID NO. 27. In some embodiments, the light chain variable region comprises a sequence selected from the group consisting of SEQ ID NOs. 28 to 50. In some embodiments, the polynucleotide encodes a full-length antibody light chain. In some embodiments, the library further comprises a polynucleotide encoding an antibody heavy chain variable region. In some embodiments, the polynucleotide encoding an antibody heavy chain variable region comprises at least one unique sequence, at least 100 unique sequences, at least 1000 unique sequences, or at least about 10 9 It includes a unique sequence of dogs.

[0011] In another aspect, the present specification provides a library comprising polynucleotides (e.g., synthetic polynucleotides) encoding a plurality of unique antibodies, wherein each antibody comprises a heavy chain variable region and a light chain variable region, and the light chain variable region of each of the plurality of antibodies comprises the same sequence, and comprises HVR-L1, HVR-L2 and HVR-L3, and at least two of HVR-L1, HVR-L2 and HVR-L3 comprise an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9, and an HVR-L3 sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9 and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, and HVR-L2 of the antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4 and HVR-L3 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments,The light chain variable region comprises three HVR-L1, HVR-L2, and HVR-L3 selected from the group consisting of: (1) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (2) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (3) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (4) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; (5) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; (6) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; (7) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; (8) HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4,HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; (9) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NO. 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; (10) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 3, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (11) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6 and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (12) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (13) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 14; (14) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (15) HVR-L1 having the amino acid sequence of SEQ ID NO. 3, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; (16) HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4,HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 14; (17) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; and (18) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 7 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23. In some embodiments, the light chain variable region comprises three of HVR-L1, HVR-L2 and HVR-L3 selected from the group consisting of: (1) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; (2) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 23; (3) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; (4) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 14; (5) HVR-L1 containing the amino acid sequence of SEQ ID NO. 3, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; (6) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 18; (7) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4,HVR-L2 containing the amino acid sequence of SEQ ID NO. 7 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 23; (8) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 6 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 23; (9) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 6 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 17; (10) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 5 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; and (11) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 8 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 11. In some embodiments, the light chain variable region includes HVR-L1, HVR-L2, and HVR-L3 of the antibodies listed in Table 2.

[0012] In some embodiments, the light chain variable region comprises FW-L1 comprising the amino acid sequence of SEQ ID NO. 24, FW-L2 comprising the amino acid sequence of SEQ ID NO. 25, FW-L3 comprising the amino acid sequence of SEQ ID NO. 26, and FW-L4 comprising the amino acid sequence of SEQ ID NO. 27. In some embodiments, the light chain variable region comprises a sequence selected from the group consisting of SEQ ID NOs. 28 to 50. In some embodiments, the heavy chain variable region of the antibody in the library comprises at least one unique sequence, at least 100 unique sequences, at least 1000 unique sequences, or at least about 10 9 It has a unique sequence. In some embodiments, the polynucleotides in the library are synthetic polynucleotides.

[0013] In another aspect, the present specification provides an antibody comprising a polypeptide expressed by a polynucleotide (e.g., a synthetic polynucleotide) from a library according to any of the above embodiments. In some embodiments, the antibody is about 10 -7 to about 10 -11 It binds to at least one type of target with the equilibrium dissociation constant (Kd) of M.

[0014] In another aspect, the present specification provides a library comprising polypeptides, wherein at least one of the polypeptides (e.g., , At least 1, at least 2, at least 5, at least 10, at least 25, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 225, at least 250, at least 275, etc.) are encoded by polynucleotides of a polynucleotide library (e.g., synthetic polynucleotides) according to any of the above embodiments. In some embodiments, at least 2 of the polypeptides are encoded by polynucleotides of a polynucleotide library. In some embodiments, at least 100 of the polypeptides are encoded by polynucleotides of a polynucleotide library. In some embodiments, each polypeptide is encoded by a polynucleotide of a polynucleotide library. In some embodiments, at least one polypeptide is a light chain variable domain. In some embodiments, at least one polypeptide is displayed on the surface of the phage. In some embodiments, the library containing the polypeptide further includes at least one heavy chain variable domain polypeptide.

[0015] In another aspect, the present specification provides a library comprising vectors, wherein at least one of the vectors (e.g., ,At least 1, at least 2, at least 5, at least 10, at least 25, at least 50, at least 75, at least 100, at least 125, at least 150, at least 175, at least 200, at least 225, at least 250, at least 275, etc.) comprises polynucleotides of a polynucleotide library according to any of the above embodiments. In some embodiments, at least 2 of the vectors comprise polynucleotides from the polynucleotide library. In some embodiments, at least 100 of the vectors comprise polynucleotides from the polynucleotide library. In some embodiments, each vector comprises a polynucleotide from the polynucleotide library. In some embodiments, at least one vector encodes a light chain variable domain polypeptide. In some embodiments, the library containing the vectors further comprises a vector encoding a heavy chain variable domain polypeptide. The present specification also provides a library comprising a population of cells, wherein at least one of the cells (e.g., , At least 1, at least 2, at least 5, at least 10, at least 100, at least 10 3 Dogs, at least 10 4 Dogs, at least 10 5 Dogs, at least 10 6 Dogs, at least 10 7 Dogs, at least 10 8 Dogs, at least 10 9 The cells (e.g., cells) include a vector of the library according to any of the above embodiments. In some embodiments, at least two of the cells include a vector of the library. In some embodiments, at least 100 of the cells include a vector of the library. In some embodiments, each cell includes a vector of the library. In some embodiments, at least one cell is a bacterium, yeast, or mammalian cell (e.g., a non-human animal cell or an isolated human cell).

[0016] In another aspect, the present specification provides a phage comprising at least one polypeptide displayed on a surface, wherein the at least one polypeptide comprises an antigen-binding domain comprising an antibody light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, wherein at least two of the antibody light chain variable regions HVR-L1, HVR-L2, and HVR-L3 comprise an amino acid sequence selected from an HVR-L1 sequence selected from the group consisting of SEQ ID NOs 1 to 4, an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9, and an HVR-L3 sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the antigen-binding domain further comprises an antibody heavy chain variable region.

[0017] In another aspect, the present specification provides a non-human animal comprising a polynucleotide library according to any of the above embodiments. In some embodiments, the non-human animal is a mammal (e.g., mouse, rat, rabbit, camel, or non-human primate). In some embodiments, the non-human animal comprises a polynucleotide, wherein one of the polynucleotides encodes an antibody light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, wherein at least two of the HVR-L1, HVR-L2, and HVR-L3 of the antibody light chain variable region comprise an amino acid sequence selected from an HVR-L1 sequence selected from the group consisting of SEQ ID NOs 1 to 4, an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9, and an HVR-L3 sequence selected from the group consisting of SEQ ID NOs 10 to 23.

[0018] In another aspect, the present specification provides an antibody light chain, wherein the antibody light chain comprises a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, wherein at least two of HVR-L1, HVR-L2, and HVR-L3 comprise an amino acid sequence selected from the group consisting of HVR-L1 sequences selected from SEQ ID NOs 1 to 4, an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9, and an HVR-L3 sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9 and HVR-L3 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, and HVR-L2 of the antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4 and HVR-L3 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises three HVR-L1, HVR-L2, and HVR-L3 selected from the group consisting of: (1) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1,(1) HVR-L2 having the amino acid sequence of SEQ ID NO. 9 and HVR-L3 selected from the group consisting of SEQ ID NO. 10 to 23; (2) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 9 and HVR-L3 having the amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (3) HVR-L1 having the amino acid sequence of SEQ ID NO. 2, HVR-L2 having the amino acid sequence of SEQ ID NO. 9 and HVR-L3 having the amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (4) HVR-L1 having the amino acid sequence of SEQ ID NO. 2, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NO. 5 to 9 and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (5) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (6) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; (7) HVR-L1 having the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (8) HVR-L1 having the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (9) HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4,HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; (10) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 3, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (11) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6 and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (12) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO. 5 to 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; (13) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 14; (14) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (15) HVR-L1 having the amino acid sequence of SEQ ID NO. 3, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; (16) HVR-L1 having the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 14; (17) HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4,HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; and (18) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs. 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 7 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23. In some embodiments, the light chain variable region comprises three of HVR-L1, HVR-L2 and HVR-L3 selected from the group consisting of: (1) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; (2) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; (3) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; (4) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 14; (5) HVR-L1 containing the amino acid sequence of SEQ ID NO. 3, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; (6) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 18; (7) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 7, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 23; (8) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4,HVR-L2 having the amino acid sequence of SEQ ID NO. 6 and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (9) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 6 and HVR-L3 having the amino acid sequence of SEQ ID NO. 17; (10) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 5 and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; and (11) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 8 and HVR-L3 having the amino acid sequence of SEQ ID NO. 11. In some embodiments, the light chain variable region comprises HVR-L1, HVR-L2 and HVR-L3 of the antibodies listed in Table 2. In some embodiments, the light chain variable region comprises FW-L1 having the amino acid sequence of SEQ ID NO. 24, FW-L2 having the amino acid sequence of SEQ ID NO. 25, FW-L3 having the amino acid sequence of SEQ ID NO. 26, and FW-L4 having the amino acid sequence of SEQ ID NO. 27. In some embodiments, the light chain variable region comprises a sequence selected from the group consisting of SEQ ID NOs. 28 to 50. In some embodiments, at least one of the HVR-L1, HVR-L2, and HVR-L3 of the light chain variable region adopts a plurality of stereostructures when verified by structure determination and / or computer modeling.

[0019] In another aspect, the present specification provides an antibody comprising a heavy chain and a light chain, wherein the light chain comprises a light chain variable region as described in the present specification. In some embodiments, the light chain variable region comprises HVR-L1, HVR-L2, and HVR-L3, wherein at least two of HVR-L1, HVR-L2, and HVR-L3 comprise an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9, and an HVR-L3 sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises an HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9 and an HVR-L3 of an antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, and HVR-L2 of the antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4 and HVR-L3 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 selected from the group consisting of the following,Includes three HVR-L2 and HVR-L3: (1) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 selected from the group consisting of SEQ ID NOs 10 to 23; (2) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having the amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (3) HVR-L1 having the amino acid sequence of SEQ ID NO. 2, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having the amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (4) HVR-L1 having the amino acid sequence of SEQ ID NO. 2, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (5) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (6) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; (7) HVR-L1 having the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (8) HVR-L1 having the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (9) HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4,HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; (10) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 3, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (11) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6 and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (12) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NO. 5 to 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; (13) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 14; (14) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (15) HVR-L1 having the amino acid sequence of SEQ ID NO. 3, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; (16) HVR-L1 having the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 14; (17) HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4,HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; and (18) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs. 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 7 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23. In some embodiments, the light chain variable region comprises three of HVR-L1, HVR-L2 and HVR-L3 selected from the group consisting of: (1) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; (2) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; (3) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; (4) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 14; (5) HVR-L1 containing the amino acid sequence of SEQ ID NO. 3, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; (6) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 18; (7) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 7, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 23; (8) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4,HVR-L2 having the amino acid sequence of SEQ ID NO. 6 and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (9) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 6 and HVR-L3 having the amino acid sequence of SEQ ID NO. 17; (10) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 5 and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; and (11) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 8 and HVR-L3 having the amino acid sequence of SEQ ID NO. 11. In some embodiments, the light chain variable region comprises HVR-L1, HVR-L2 and HVR-L3 of the antibodies listed in Table 2. In some embodiments, the light chain variable region comprises FW-L1 having the amino acid sequence of SEQ ID NO. 24, FW-L2 having the amino acid sequence of SEQ ID NO. 25, FW-L3 having the amino acid sequence of SEQ ID NO. 26, and FW-L4 having the amino acid sequence of SEQ ID NO. 27. In some embodiments, the light chain variable region comprises a sequence selected from the group consisting of SEQ ID NOs. 28 to 50. In some embodiments, the antibody is about 10, -7 to about 10 -11 It binds to at least one type of target with the equilibrium dissociation constant (Kd) of M.

[0020] In another aspect, the present specification provides a polynucleotide encoding any of the variable regions of the antibody light chains described herein (e.g., , A synthetic polynucleotide is provided. In some embodiments, the polynucleotide encodes a full-length antibody light chain comprising any of the antibody light chain variable regions described herein. In some embodiments, the polynucleotide encodes an antibody comprising any of the antibody light chain variable regions described herein.

[0021] In another aspect, the present specification provides a library comprising antibody light chain variable regions, wherein at least one of the antibody light chain variable regions (e.g., , At least one, at least two, at least three, at least four, at least five, at least ten, at least fifty, at least ten hundred, etc.) comprises the amino acid sequence of any of the antibody light chain variable regions described herein. In some embodiments, each antibody light chain variable region in the library comprises the amino acid sequence of any of the antibody light chain variable regions described herein. In some embodiments, the library further comprises one or more antibody heavy chain variable regions. In some embodiments, the present specification provides a library comprising full-length antibody light chains, wherein at least one of the antibody light chains (e.g., , At least one, at least two, at least three, at least four, at least five, at least ten, at least fifty, at least ten hundred, etc.) comprises the amino acid sequence of any of the antibody light chain variable regions described herein. In some embodiments, each antibody light chain in the library comprises the amino acid sequence of any of the antibody light chain variable regions described herein. In some embodiments, the library further comprises one or more full-length antibody heavy chains. In some embodiments, the present invention provides a library comprising antibodies, wherein at least one of the antibodies (e.g., , At least one, at least two, at least three, at least four, at least five, at least ten, at least fifty, at least one hundred, etc.) comprises the amino acid sequence of any of the antibody light chain variable regions described herein. In some embodiments, each antibody in the library comprises the amino acid sequence of any of the antibody light chain variable regions described herein.

[0022] In another aspect, the present specification provides a method for manufacturing a library comprising the steps of providing a polynucleotide sequence of a library according to any of the above embodiments and assembling the same.

[0023] In another aspect, the present specification provides a method for preparing an antibody library, the method comprising: (a) selecting one, two, or three light chain HVRs comprising sequences having multiple stereostructures; and (b) assembling polynucleotide sequences to produce a library of polynucleotides (e.g., synthetic polynucleotides) encoding multiple antibody light chain variable region sequences. In some embodiments, the antibody light chain variable region sequences are human antibody sequences. In some embodiments, the antibody light chain variable region comprises HVR-L1, HVR-L2, and HVR-L3, wherein at least two of the HVR-L1, HVR-L2, and HVR-L3 of the light chain variable region comprise an amino acid sequence selected from an HVR-L1 sequence selected from the group consisting of SEQ ID NOs 1 to 4, an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9, and an HVR-L3 sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, and HVR-L2 of the antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4 and HVR-L3 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 selected from the group consisting of the following,Includes three HVR-L2 and HVR-L3: (1) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (2) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (3) HVR-L1 having the amino acid sequence of SEQ ID NO. 2, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (4) HVR-L1 having the amino acid sequence of SEQ ID NO. 2, HVR-L2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (5) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (6) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; (7) HVR-L1 having the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (8) HVR-L1 having the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4,HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; (9) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NO. 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; (10) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 3, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (11) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6 and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (12) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (13) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 14; (14) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (15) HVR-L1 having the amino acid sequence of SEQ ID NO. 3, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; (16) HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4,HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 14; (17) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; and (18) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 7 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23. In some embodiments, the light chain variable region comprises three of HVR-L1, HVR-L2 and HVR-L3 selected from the group consisting of: (1) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; (2) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 23; (3) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; (4) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 14; (5) HVR-L1 containing the amino acid sequence of SEQ ID NO. 3, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; (6) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9, and HVR-L3 containing the amino acid sequence of SEQ ID NO. 18; (7) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4,HVR-L2 containing the amino acid sequence of SEQ ID NO. 7 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 23; (8) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 6 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 23; (9) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 6 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 17; (10) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 5 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; and (11) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 8 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 11. In some embodiments, the light chain variable region comprises HVR-L1, HVR-L2, and HVR-L3 of the antibodies listed in Table 2. In some embodiments, the light chain variable region comprises FW-L1 comprising the amino acid sequence of SEQ ID NO. 24, FW-L2 comprising the amino acid sequence of SEQ ID NO. 25, FW-L3 comprising the amino acid sequence of SEQ ID NO. 26, and FW-L4 comprising the amino acid sequence of SEQ ID NO. 27. In some embodiments, the light chain variable region comprises a sequence selected from the group consisting of SEQ ID NOs. 28 to 50. In another aspect, the present specification provides a library comprising an antigen binding domain, wherein one of the antigen binding domains comprises an antibody light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, wherein at least two of HVR-L1, HVR-L2, and HVR-L3 of the antibody light chain variable region are HVR-L1 sequences selected from the group consisting of SEQ ID NOs. 1 to 4,It includes an amino acid sequence selected from an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9 and an HVR-L3 sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the antigen-binding domain further includes an antibody heavy chain variable region. In some embodiments, the antibody light chain variable region includes one or more amino acid sequences according to any of the above embodiments. In some embodiments, the library includes a phage. In some embodiments, the antigen-binding domain is displayed on the surface of at least one phage of the library. In some embodiments, the library includes a plurality of phages expressing an antigen-binding domain according to any one of the above embodiments displayed on the surface of the phage.

[0024] In another aspect, the present specification provides a method for generating a bispecific antibody comprising two antibody heavy chain variable regions and two identical light chain variable regions, the method comprising: (a) a step of screening for a first antigen-binding domain that binds to a first antigen, wherein the first antigen-binding domain comprises a first antibody heavy chain variable region and a first antibody light chain variable region, and said first antibody light chain variable region is encoded by a polynucleotide of a library according to any of the embodiments (e.g., the first antigen-binding domain comprises a first antibody heavy chain variable region and a first antibody light chain variable region, wherein the first antibody light chain variable region comprises HVR-L1, HVR-L2, and HVR-L3, and at least two of the HVR-L1, HVR-L2, and HVR-L3 of the antibody light chain variable region are an HVR-L1 sequence selected from the group consisting of SEQ ID NOs 1 to 4, an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9, and SEQ ID NO 10 Comprising an amino acid sequence selected from an HVR-L3 sequence selected from the group consisting of 23;(b) a step of screening for a second antigen-binding domain that binds to a second antigen, wherein the second antigen-binding domain comprises a second antibody heavy chain variable region and a second antibody light chain variable region, wherein the second antibody light chain variable region has the same sequence as the first antibody light chain variable region (for example, the second antigen-binding domain comprises a second antibody heavy chain variable region and a second antibody light chain variable region, wherein the second antibody light chain variable region comprises HVR-L1, HVR-L2, and HVR-L3, and at least two of the antibody light chain variable regions HVR-L1, HVR-L2, and HVR-L3 comprise an amino acid sequence selected from an HVR-L1 sequence selected from the group consisting of SEQ ID NOs 1 to 4, an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9, and an HVR-L3 sequence selected from the group consisting of SEQ ID NOs 10 to 23); and (c) a step of producing a bispecific antibody comprising a first antigen-binding domain and a second antigen-binding domain.;

[0025] In another aspect, the present specification provides a bispecific antibody, wherein the bispecific antibody comprises: (a) a first binding domain comprising a first heavy chain variable region and a first light chain variable region, wherein the first binding domain binds to a first target; and (b) a second binding domain comprising a second heavy chain variable region and a second light chain variable region, wherein the second binding domain binds to a second target, and the second light chain variable region has the same sequence as the first light chain variable region; The first light chain variable region and the second light chain variable region comprise HVR-L1, HVR-L2, and HVR-L3, and at least two of HVR-L1, HVR-L2, and HVR-L3 comprise an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9, and an HVR-L3 sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9 and HVR-L3 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, and HVR-L2 of the antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4 and HVR-L3 of an antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments,The light chain variable region comprises HVR-L1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises three HVR-L1, HVR-L2, and HVR-L3 selected from the group consisting of the following: (1) HVR-L1 having an amino acid sequence of SEQ ID NO. 1, HVR-L2 having an amino acid sequence of SEQ ID NO. 9, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (2) HVR-L1 having an amino acid sequence of SEQ ID NO. 4, HVR-L2 having an amino acid sequence of SEQ ID NO. 9, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (3) HVR-L1 having the amino acid sequence of SEQ ID NO. 2, HVR-L2 having the amino acid sequence of SEQ ID NO. 9, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (4) HVR-L1 having the amino acid sequence of SEQ ID NO. 2, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NO. 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (5) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NO. 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (6) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the sequence selected from the group consisting of SEQ ID NO. 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; (7) HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4,HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; (8) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; (9) HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; (10) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 3, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9 and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; (11) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 6, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NO. 10 to 23; (12) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NO. 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 23; (13) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NO. 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 14; (14) HVR-L1 having the amino acid sequence of SEQ ID NO. 1, HVR-L2 having the amino acid sequence selected from the group consisting of SEQ ID NO. 5 to 9, and HVR-L3 having the amino acid sequence of SEQ ID NO. 18; (15) HVR-L1 containing the amino acid sequence of SEQ ID NO. 3,HVR-L2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9 and HVR-L3 having an amino acid sequence of SEQ ID NO 20; (16) HVR-L1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having an amino acid sequence of SEQ ID NO 9 and HVR-L3 having an amino acid sequence of SEQ ID NO 14; (17) HVR-L1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having an amino acid sequence of SEQ ID NO 6 and HVR-L3 having an amino acid sequence of SEQ ID NO 23; and (18) HVR-L1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having an amino acid sequence of SEQ ID NO 7 and HVR-L3 having an amino acid sequence of SEQ ID NO 23. In some embodiments, the light chain variable region comprises three HVR-L1, HVR-L2, and HVR-L3 selected from the group consisting of: (1) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; (2) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; (3) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; (4) HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 14; (5) HVR-L1 containing the amino acid sequence of SEQ ID NO. 3,(6) HVR-L2 containing the amino acid sequence of SEQ ID NO. 9 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 20; (6) HVR-L1 containing the amino acid sequence of SEQ ID NO. 1, HVR-L2 containing the amino acid sequence of SEQ ID NO. 9 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 18; (7) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 7 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 23; (8) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 6 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 23; (9) HVR-L1 containing the amino acid sequence of SEQ ID NO. 4, HVR-L2 containing the amino acid sequence of SEQ ID NO. 6 and HVR-L3 containing the amino acid sequence of SEQ ID NO. 17; (10) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 5, and HVR-L3 having the amino acid sequence of SEQ ID NO. 20; and (11) HVR-L1 having the amino acid sequence of SEQ ID NO. 4, HVR-L2 having the amino acid sequence of SEQ ID NO. 8, and HVR-L3 having the amino acid sequence of SEQ ID NO. 11. In some embodiments, the light chain variable region comprises HVR-L1, HVR-L2, and HVR-L3 of the antibodies listed in Table 2. In some embodiments, the light chain variable region comprises FW-L1 having the amino acid sequence of SEQ ID NO. 24, FW-L2 having the amino acid sequence of SEQ ID NO. 25, FW-L3 having the amino acid sequence of SEQ ID NO. 26, and FW-L4 having the amino acid sequence of SEQ ID NO. 27. In some embodiments, the light chain variable region comprises a sequence selected from the group consisting of SEQ ID NOs 28 to 50. In some embodiments, the first heavy chain variable region is connected to the first heavy chain invariant region, where the second heavy chain variable region is connected to the second heavy chain invariant region, andThe variable region of the first antibody light chain is connected to the constant region of the first light chain, and the variable region of the second antibody light chain is connected to the constant region of the second light chain, and the first antibody heavy chain and the second antibody light chain have the same sequence.

[0026] In another aspect, the present specification provides a kit comprising a library of polynucleotides or a group of cells comprising polynucleotides according to any of the embodiments.

[0027] It should be understood that one, some, or all of the characteristics of the various embodiments described above and in this specification may be combined to form other embodiments of the present invention. These and other aspects of the present invention will be obvious to those skilled in the art. These and other embodiments of the present invention are further described by the following detailed description. Brief explanation of the drawing

[0028] 도 1A Figure 1 shows an entropy plot based on the number of residues for amino acids in the VL domain. Entropy was calculated using 81 VL structures of human antibodies. 도 1B A diagram showing the definition of the hypervariable region (HVR) used herein for an exemplary antibody light chain variable domain (VL) sequence (SEQ No. 60) compared with the Kabat definition of the complementarity-determining region (CDR) for the same VL sequence. 도 2A Figure showing the use of HVR-L1, HVR-L2, and HVR-L3 segments for antibodies with confirmed antigen binding from the DPL5 and SEL021 antibody libraries. The amino acid sequences corresponding to the presented sequence numbers are 표 1 It can be found in. 도 2B Figure showing the use of HVR-L1, HVR-L2, and HVR-L3 segments for antibodies confirmed to bind to single and multiple antigen targets from the DPL5, SEL021, and DPL16–34 antibody libraries. The amino acid sequences corresponding to the presented sequence numbers are 표 1 It can be found in. 도 3 Figure showing affinity measurements for fab confirmed to bind to antigens TAGT-1, TAGT-2, and TAGT-3. Specific details for implementing the invention

[0029] The present disclosure describes antibody light chains (e.g., , Provides a library containing polynucleotides (e.g., non-naturally occurring or synthetic) encoding the light chains of dynamic human antibodies. Advantageously, the antibody light chains disclosed herein include HVR sequences designed to generate loops that are highly flexible for specificity to a number of substrates of interest and for more effective substrate binding. These HVR sequences are believed to enable the generation of smaller antibody libraries than conventional techniques.

[0030] I. 일반 기술

[0031] The techniques and procedures described or mentioned in this specification are generally conventional methods used by those skilled in the art, e.g., literature [Sambrook et al., Molecular Cloning: A Laboratory Manual 3d edition (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Current Protocols in Molecular Biology (FM Ausubel, et al. eds., (2003)); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (MJ MacPherson, BD Hames and GR Taylor eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual , and Animal Cell Culture (R.I. Freshney, ed. (1987)); Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Methods in Molecular Biology , Humana Press; Cell Biology: A Laboratory Notebook (J.E. Cellis, ed., 1998) Academic Press; Animal Cell Culture (R.I. Freshney), ed., 1987); Introduction to Cell and Tissue Culture (J.P. Mather and P.E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J.B. Griffiths, and D.G. Newell, eds., 1993-8) J. Wiley and Sons; Handbook of Experimental Immunology (D.M. Weir and C.C. Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987); PCR: The Polymerase Chain Reaction , (Mullis et al., eds., 1994); Current Protocols in Immunology (J.E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C.A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds., Harwood Academic Publishers, 1995); 및 Cancer: Principles and Practice of Oncology It is well understood and commonly used using the widely used method described in [VT DeVita et al., eds., JB Lippincott Company, 1993].

[0032] II. 정의

[0033] Before describing the invention in detail, it should be understood that the invention is not limited to a specific composition or biological system and, of course, may vary. It should also be understood that these terms are used merely for the purpose of describing specific embodiments and are not intended to be limiting.

[0034] As used in this specification and the appended claims, the singular form includes a plurality of objects unless the context otherwise clearly indicates. Accordingly, for example, a reference to "molecule" optionally includes a combination of two or more such molecules, etc.

[0035] The term “approx.” refers to the usual range of error for each value as readily known to those skilled in the art in the relevant technical field, as used herein. In this specification, references to “approx.” values ​​or parameters include (and describe) embodiments of the values ​​or parameters themselves.

[0036] The aspects and embodiments of the invention described herein are understood to include aspects and embodiments that "comply," "consist of," and "essentially consist of."

[0037] The term "antibody" is used in the broadest sense herein and, insofar as it exhibits the intended biological activity, specifically includes monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments (e.g., single-chain variable fragments or scFvs).

[0038] The basic 4-strand antibody unit is a heterotemeric glycoprotein composed of two identical light chains (L) and two identical heavy chains (H). V H and V L These pairs together form a single antigen-binding site. For the structure and characteristics of different classes of antibodies, refer to the literature [ Basic and Clinical Immunology Please refer to [ , 8th Ed., Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, CT, 1994, page 71 and Chapter 6].

[0039] The L chain from any vertebrate species may be assigned to one of two distinct types called kappa ("κ") and lambda ("λ") based on the amino acid sequence of its constant domain. Depending on the amino acid sequence of the constant domain of the heavy chain (CH), immunoglobulins may be assigned to different classes or isotypes. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, each having a heavy chain designated as alpha ("α"), delta ("δ"), epsilon ("ε"), gamma ("γ"), and mu ("μ"), respectively. The γ and α classes are further divided into subclasses (isotypes) based on relatively minor differences in CH sequence and function, and, for example, humans express the following subclasses: IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are widely known, and generally, for example, in the literature [Abbas et al. , Cellular and Molecular Immunology, 4 th It is listed in [ed. (WB Saunders Co., 2000)].

[0040] The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the antibody's heavy or light chain. The variable domain of the heavy chain is "V H It can be referred to as ". The variable domain of the light chain is "V L These domains can be referred to as ". These domains are generally the most variable parts of the antibody and contain antigen-binding sites."

[0041] The terms “variable domain residue numbering as in carbats” or “amino acid position numbering as in carbats” and variations thereof refer to the numbering system used for the heavy chain variable domain or light chain variable domain of the antibody compilation in the literature of carbats et al. Using this numbering system, the actual linear amino acid sequence may contain fewer or more amino acids corresponding to the shortening of the FR or HVR of the variable domain or the insertion within it. For example, the heavy chain variable domain may include a single amino acid insertion after residue 52 of H2 (residue 52a according to carbats), and an inserted residue after heavy chain FR residue 82 (e.g., residues 82a, 82b, and 82c according to carbats). The carbats numbering of residues can be determined for a given antibody by aligning the antibody sequence with the homology region to the “standard” carbats-numbered sequence.

[0042] The Kabat numbering system is generally used to refer to residues of the variable domain (approximately light chain residues 1 to 107 and heavy chain residues 1 to 113) (e.g., literature [Kabat et al. , Sequences of Immunological Interest . 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)]). The "EU numbering system" or "EU index" is generally used to refer to residues in the immunoglobulin heavy chain constant region (e.g., the aforementioned literature [Kabat et al. EU index reported in ]). "EU index as in KAVATS" refers to the residue numbering of human IgG1 EU antibodies.

[0043] The term "constant domain" refers to a portion of an immunoglobulin molecule that has a more conserved amino acid sequence compared to other parts of the immunoglobulin, namely the variable domain containing the antigen-binding site. The constant domain is the C of the heavy chain. H 1, C H 2 and C H It contains 3 domains (collectively, CH) and a CHL (or CL) domain of the light chain.

[0044] The term "whole-length antibody" (the terms "injury-free" antibody or "whole" antibody may be used interchangeably herein) may refer to an antibody in a substantially injury-free form as opposed to an antibody fragment. Similarly, the term "whole-length antibody light chain" (the terms "injury-free" antibody light chain or "whole" antibody light chain may be used interchangeably herein) may refer to an antibody light chain in a substantially injury-free form as opposed to an antibody light chain fragment. Specifically, a whole antibody comprises a light chain and a heavy chain comprising an Fc region. The invariant domain may be a native sequence invariant domain (e.g., a human native sequence invariant domain) or an amino acid sequence variant thereof. In some cases, an injury-free antibody may have one or more effector functions.

[0045] As used herein, the term “monoclonal antibody” refers to an antibody obtained from a substantially homogeneous population of antibodies, that is, the individual antibodies comprising such a population are identical except for possible naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amideation) that may be present in small amounts. Monoclonal antibodies are highly specific and directed toward a single antigenic site. In contrast to polyclonal antibody preparations, which typically comprise different antibodies directed toward different determinants (epitopes), each monoclonal antibody is directed toward a single determinant on the antigen. The modifier “monoclonal” indicates that the characteristics of the antibody are obtained from a substantially homogeneous population of antibodies and should not be interpreted as requiring antibody production by any specific method. For example, the monoclonal antibodies to be used according to the present invention may be, for example, by the hybridoma method (e.g., Kohler and Milstein . , Nature , 256:495-97 (1975); Hongo et al. , Hybridoma, 14 (3):253-260 (1995), Harlow et al., Antibodies: A Laboratory Manual , (Cold Spring Harbor Laboratory Press, 2d ed. 1988); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, NY, 1981)), recombinant DNA methods (see, e.g., U.S. Patent No. 4,816,567), phage-display technologies (see, e.g., literature [Clackson et al ., Nature , 352:624-628 (1991); Marks et al ., J. Mol. Biol. 222:581-597 (1992); Sidhu et al ., J. Mol. Biol. 338(2): 299-310 (2004); Lee et al., J. Mol. Biol.340(5):1073-1093 (2004); Fellowes, Proc. Nat'l Acad. Sci. USA 101(34):12467-472 (2004); and Lee et al ., J. Immunol. Methods [Refer to 284(1-2):119-132 (2004)]), and technology for producing human or human-like antibodies in animals having some or all of the genes encoding human immunoglobulin loci or human immunoglobulin sequences (International Patent Publications No. WO 1998 / 24893; WO 1996 / 34096; WO 1996 / 33735; WO 1991 / 10741; literature [Jakobovits et al., Proc. Nat'l Acad. Sci. USA 90:2551 (1993); Jakobovits et al ., Nature 362:255-258 (1993); Bruggemann et al ., Year in Immunol. 7:33 (1993)]; U.S. Patents No. 5,545,807; No. 5,545,806; No. 5,569,825; No. 5,625,126; No. 5,633,425; and No. 5,661,016; Literature [Marks et al ., Bio / Technology 10:779-783 (1992); Lonberg et al ., Nature 368:856-859 (1994); Morrison, Nature 368:812-813 (1994); Fishwild et al., Nature Biotechnol. 14:845-851 (1996); Neuberger, Nature Biotechnol. 14:826 (1996); and Lonberg and Huszar; Intern. Rev. Immunol. It can be manufactured by various technologies, including [13:65-93 (1995)] (see reference).

[0046] As used herein, "Hypervariable Region (HVR)" refers to a region of an antibody domain that is hypervariable in the sequence and / or forms a structurally defined loop. Generally, the antibody contains the following six HVRs: three in VH (H1, H2, H3), and three in VL (L1, L2, L3) (e.g., the literature [Xu et al., Immunity 13:37-45 (2000); Johnson and Wu, in Methods in Molecular Biology [Reference: 248:1-25 (Lo, ed., Human Press, Totowa, NJ, 2003)]). Each VH and VL consists of three HVR and four framework (FW) regions arranged from the amino terminus to the carboxy terminus in the following order: FW1-HVR1-FW2-HVR2-FW3-HVR3-FW4. Throughout this disclosure, the three HVRs of the light chain are referred to as HVR-L1, HVR-L2, and HVR-L3. For comparison, the definition of HVR (as used herein) is Fig. 1B This contradicts the kavat definition of the complementarity-determining region (CDR) for the exemplary antibody light chain variable domain shown in (Yvonne Chen et al. (1999) “Selection and Analysis of an Optimized Anti-VEGF Antibody: Crystal Structure of an Affinity-matured Fab in Complex with Antigen”, J. Mol. Biol. 293, 865-881).

[0047] As used herein, “library” refers to a set of two or more entities having a shared class. For example, a library containing polynucleotides may refer to a set of two or more polynucleotides. The term “library” is used herein in its broadest sense and specifically encompasses sub-libraries that may or may not be combined.

[0048] As used herein, "unique" refers to a member of a set that is distinct from other members of that set. For example, a unique antibody from a library encoding multiple polynucleotides encoding antibodies may refer to an antibody having a specific sequence that is not shared by other antibodies encoded by the library. It should be understood that, substantially, a "unique" member of the physical realization of the library may exist in more than one copy. For example, the library may contain multiple "unique" antibodies, and one or more of the "unique" antibody molecules may occur in more than one copy.

[0049] As used herein, "diversity" refers to diversity and / or heterogeneity. For example, diversity of antibodies in a library may refer to various antibodies having unique sequences present in the library.

[0050] The terms “polypeptide,” “protein,” and “peptide” are used interchangeably in this specification and may refer to a polymer of two or more amino acids.

[0051] "Polynucleotide" or "nucleic acid" is used interchangeably herein and refers to a polymer of nucleotides of any length, including DNA and RNA. The nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or analogs thereof, or any substrate that can be incorporated into the polymer by DNA or RNA polymerase or by a synthetic reaction. The polynucleotides may include modified nucleotides, e.g., methylated nucleotides and analogs thereof. Where present, modifications to the nucleotide structure may be imparted before or after the assembly of the polymer. The sequence of the nucleotides may be interposed by non-nucleotide components. The polynucleotides may include modification(s) created after synthesis, e.g., conjugation to a label. Other types of modifications include, for example, "caps," substitution with one or more analogs of naturally occurring nucleotides, internucleotide modifications, for example, having an uncharged linkage (e.g., methyl phosphonate, phospholith ester, phosphoamidate, carbamate, etc.) and having a charged linkage (e.g., phosphorothioate, phosphorodithioate, etc.), containing a pendant moiety, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, ply-L-lysine, etc.), having an intercalator (e.g., acridine, psoralen, etc.), containing a chelator (e.g., metal, radioactive metal, boron, metal oxide, etc.), containing an alkylator, having a modified linkage (e.g., alpha-anomeric nucleic acid, etc.), as well as unmodified forms of polynucleotides.Additionally, any of the hydroxyl groups typically present in the sugar may be replaced, for example, by a phosphonate group or a phosphate group, protected by a standard protecting group, activated to form an additional linkage for an additional nucleotide, or conjugated to a solid or semi-solid support. The 5' and 3' terminal OH groups may be phosphorylated or substituted with an amine or an organic capping moiety of 1 to 20 carbon atoms. Other hydroxyls may also be derivatized to a standard protecting group. Polynucleotides may also contain similar forms of ribose or deoxyribose sugars generally known in the art, including, for example, 2'-O-methyl-, 2'-O-allyl-, 2'-fluoro-, or 2'-azido-ribose, carbon-cyclic sugar analogs, α-anomer sugars, epimer sugars, e.g., arabinose, xylose, or laixose, pyranose sugars, furanose sugars, sedoheptulose, acyclic analogs, and basic nucleoside analogs, e.g., methyl riboside. One or more phosphodiester linkages may be replaced by alternative linkers. These alternative linkers include, but are not limited to, embodiments in which the phosphate is P(O)S("thioate"), P(S)S("dithioate"), (O)NR2("amidate"), P(O)R, P(O)OR', CO, or CH2("formacetal") (wherein each R or R' is independently a substituted or unsubstituted alkyl (1 to 20 C), aryl, alkenyl, cycloalkyl, cycloalkenyl, or araldyl that optionally contains an H or ether (-O-) linkage). Not all linkages within the polynucleotide need to be identical. The above description applies to all polynucleotides mentioned herein, including RNA and DNA.

[0052] "Isolated" (e.g., isolated polypeptides, nucleic acids, or cells) refers to molecules separated from components of the natural environment.

[0053] Cells (e.g., cells or a population of cells containing synthetic polynucleotides or a library of synthetic polynucleotides) or isolated cells may be recipients of vector(s) for inclusion of polynucleotide inserts, or include individual cells or cell cultures that are recipients. Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or genomic DNA complementarity) to the original parent cell due to natural, accidental, or intentional mutations. Host cells include cells transfected in vivo with polynucleotide(s) (e.g., synthetic polynucleotides encoding the antibody light chain variable region of the present disclosure).

[0054] "Non-human animals" refers to any animal not classified as human, e.g., livestock, farm animals, or zoo animals, sports animals, or pets (e.g., dogs, horses, cats, cows, etc.), as well as animals used in research. Research animals are, without limitation, nematodes, arthropods, vertebrates, mammals, frogs, and rodents (e.g. , mice or rats), fish (e.g., , Zebrafish or pufferfish), birds (e.g., , It may refer to chickens), dogs, cats, and non-human primates (e.g., rhesus monkeys, cynomorgus monkeys, chimpanzees, etc.). In a preferred embodiment, the animal produces antibodies.

[0055] III. Antibody Library and Creation of Library

[0056] A specific aspect of the present disclosure relates, for example, to a library of polynucleotides encoding an antibody heavy chain variable region (VH) or a light chain variable region (VL). The library of the present disclosure may each independently contain one or more polynucleotides encoding a light chain variable region, including HVR-L1, HVR-L2, and HVR-L3, which include the HVR sequences described herein (e.g., the HVR sequences presented in Table 1).

[0057] In some embodiments, the library of the present disclosure contains fewer unique light chain HVR sequences and / or unique VL sequences than a typical antibody library. Advantageously, such a library can provide sufficient diversity for the identification of antibodies binding to one or more of a number of antigens of interest, while also allowing for more efficient screening due to the reduced library size. In some embodiments, the library of the present disclosure comprises or consists of polynucleotides containing fewer than about 1,000, fewer than about 900, fewer than about 800, fewer than about 700, fewer than about 600, fewer than about 500, fewer than about 400, or fewer than about 300 unique combinations of HVR-L1, HVR-L2, and HVR-L3 sequences. In certain embodiments, the library of the present disclosure comprises or consists of polynucleotides containing fewer than about 280 unique combinations of HVR-L1, HVR-L2, and HVR-L3 sequences.

[0058] In some embodiments, the library contains a plurality of polynucleotides, at least one of which encodes the antibody light chain variable region of the present disclosure (e.g., including HVR-L1, HVR-L2, and HVR-L3 of the present disclosure). In some embodiments, one or more of the polynucleotides encode the antibody light chain variable region including HVR-L1, HVR-L2, and HVR-L3, wherein at least one or at least two of HVR-L1, HVR-L2, and HVR-L3 comprise an amino acid sequence selected from the HVR-L1 sequence of the present disclosure (e.g., SEQ ID NOs 1 to 4), the HVR-L2 sequence of the present disclosure (e.g., SEQ ID NOs 5 to 9), and the HVR-L3 sequence of the present disclosure (e.g., SEQ ID NOs 10 to 23).In some embodiments, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 225, or at least 250 encodes antibody light chain variable regions comprising HVR-L1, HVR-L2, and HVR-L3, wherein at least one or at least two of HVR-L1, HVR-L2, and HVR-L3 comprise amino acid sequences selected from the HVR-L1 sequence of the present disclosure (e.g., SEQ ID NOs. 1 to 4), the HVR-L2 sequence of the present disclosure (e.g., SEQ ID NOs. 5 to 9), and the HVR-L3 sequence of the present disclosure (e.g., SEQ ID NOs. 10 to 23); and / or; Fewer than 300 or 280 of the polynucleotides encode an antibody light chain variable region comprising HVR-L1, HVR-L2 and HVR-L3, wherein at least one or at least two of HVR-L1, HVR-L2 and HVR-L3 comprise an amino acid sequence selected from the HVR-L1 sequence of the present disclosure (e.g., SEQ ID NOs 1 to 4), the HVR-L2 sequence of the present disclosure (e.g., SEQ ID NOs 5 to 9) and the HVR-L3 sequence of the present disclosure (e.g., SEQ ID NOs 10 to 23).In certain embodiments, each polynucleotide of the library encodes an antibody light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, wherein at least one or at least two of HVR-L1, HVR-L2, and HVR-L3 comprise an amino acid sequence selected from the HVR-L1 sequence of the present disclosure (e.g., SEQ ID NOs. 1 to 4), the HVR-L2 sequence of the present disclosure (e.g., SEQ ID NOs. 5 to 9), and the HVR-L3 sequence of the present disclosure (e.g., SEQ ID NOs. 10 to 23). In some embodiments, one or more polynucleotides of the library are vectors (e.g. , It exists within the expression vector or display vector.

[0059] In some embodiments, the polynucleotide in the library encodes an antibody light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, wherein HVR-L1 comprises a sequence selected from the group consisting of SEQ ID NOs 1 to 4. In some embodiments, the polynucleotide in the library encodes an antibody light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, wherein HVR-L2 comprises a sequence selected from the group consisting of SEQ ID NOs 5 to 9. In some embodiments, the polynucleotide in the library encodes an antibody light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3, wherein HVR-L1 comprises a sequence selected from the group consisting of SEQ ID NOs 10 to 23.

[0060] The light chain HVR sequences described herein may be included in any combination within the library of the present disclosure. In some embodiments, the light chain variable region comprises HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9 and HVR-L3 of an antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, and HVR-L2 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4 and HVR-L3 of an antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23.

[0061] In a specific embodiment, the light chain variable region comprises three HVR-L1, HVR-L2, and HVR-L3 selected from the group consisting of: HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; HVR-L1 selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 3, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs. 10 to 23;HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6, and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 14; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 3, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs. 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs. 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 14; HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs. 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23;HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising an amino acid sequence of SEQ ID NO. 7, and HVR-L3 comprising an amino acid sequence of SEQ ID NO. 23. In a specific embodiment, the light chain variable region comprises three of HVR-L1, HVR-L2, and HVR-L3 selected from the group consisting of: HVR-L1 comprising an amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising an amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising an amino acid sequence of SEQ ID NO. 18; HVR-L1 comprising an amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising an amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising an amino acid sequence of SEQ ID NO. 23; HVR-L1 comprising an amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising an amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising an amino acid sequence of SEQ ID NO. 20; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 14; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 3, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 7, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23;and HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 17; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 17; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 5, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; and HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 8, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 11. In some embodiments, the light chain variable region is; Table 2 It includes three of the antibodies listed in HVR-L1, HVR-L2, and HVR-L3. In some embodiments, the light chain variable region is Table 1 It includes three of HVR-L1, HVR-L2, and HVR-L3 listed in ). In some embodiments, the light chain variable region includes a sequence selected from sequences having at least 85%, at least 90%, or at least 95% sequence identity with sequences selected from sequences 28 to 50 or sequences selected from sequences 28 to 50.

[0062] In some embodiments, the light chain variable region further comprises a variable region light chain framework sequence juxtaposed between HVRs according to the following formula: (FW-L1)-(HVR-L1)-(FW-L2)-(HVR-L2)-(FW-L3)-(HVR-L3)-(FW-L4). In some embodiments, one, two, three, or four of the framework sequences are as follows:

[0063] FW-L1 is DIQLTQSPSSLSASVGDRVTITC (Sequence No. 24) and,

[0064] FW-L2 is WYQQKPGKAPKLLIY (Sequence No. 25) and,

[0065] FW-L3 is PSRFSGSGSGTDFTLTISSLQPEDFATY (Sequence No. 26) and,

[0066] FW-L4 is FGQGTKVEIKR It is (sequence number 27).

[0067] In some embodiments, the library contains a plurality of polynucleotides, at least one of which encodes an antibody heavy chain variable region (e.g., including HVR-H1, HVR-H2, and HVR-H3). In some embodiments, the library contains at least 10 of the antibody heavy chain variable regions. 3 Dogs, at least 10 4 Dogs, at least 10 5 Dogs, at least 10 6 Dogs, at least 10 7 Dogs, at least 10 8 Dogs, at least 10 9 Dogs, at least 10 10 Dogs, at least 10 11 Dogs or at least 10 12 It contains multiple polynucleotides encoding unique sequences. In some embodiments, the library comprises at least 10 of the antibody heavy chain variable regions. 3 It contains multiple polynucleotides encoding unique sequences. In some embodiments, the library comprises at least 10 of the antibody heavy chain variable regions. 9 It contains multiple polynucleotides encoding unique sequences. In another embodiment, the library contains a polynucleotide encoding one antibody heavy chain variable region. In some embodiments, the library contains at least 1 to 10 antibody heavy chain variable regions 3It contains multiple polynucleotides encoding a unique sequence of dogs.

[0068] In some embodiments, one or more of the polynucleotides in the library encode full-length antibody light chain(s). In other embodiments, one or more of the polynucleotides in the library encode light chain Fab fragment(s). In some embodiments, one or more of the polynucleotides in the library encode single-chain variable fragment(s).

[0069] In some embodiments, the library contains a plurality of polynucleotides encoding a plurality of unique antibodies. In some embodiments, each antibody comprises a heavy chain variable region and a light chain variable region. In some embodiments, the light chain variable region of each of the plurality of antibodies comprises the same sequence and includes HVR-L1, HVR-L2, and HVR-L3. In some embodiments, at least one or at least two of HVR-L1, HVR-L2, and HVR-L3 comprise an amino acid sequence selected from the HVR-L1 sequence of the present disclosure (e.g., SEQ ID NOs 1 to 4), the HVR-L2 sequence of the present disclosure (e.g., SEQ ID NOs 5 to 9), and the HVR-L3 sequence of the present disclosure (e.g., SEQ ID NOs 10 to 23). The light chain HVR sequences described herein may be included in any combination within the library of the present disclosure, which comprises polynucleotides encoding one or more heavy chain variable regions.

[0070] In some embodiments, the library of the present disclosure comprises one or more vectors encoding one or more polynucleotides of the present disclosure (e.g., synthetic polynucleotides). For example, in some embodiments, the library comprises one or more vectors encoding one or more polynucleotides (e.g., synthetic polynucleotides) encoding an antibody light chain variable region, wherein the antibody light chain variable region comprises HVR-L1, HVR-L2, and HVR-L3, wherein at least two of the antibody light chain variable regions HVR-L1, HVR-L2, and HVR-L3 comprise an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, an HVR-L2 sequence selected from the group consisting of SEQ ID NOs 5 to 9, and an HVR-L3 sequence selected from the group consisting of SEQ ID NOs 10 to 23.

[0071] Additionally, the present specification provides a method for preparing a library by, for example, providing a polynucleotide sequence (e.g., synthetic polynucleotide(s)) of a library of the present disclosure and assembling it. Additionally, the present specification provides a method for preparing a library by, for example, selecting one, two, or three light chain HVRs (e.g., one, two, or three light chain HVRs of the present disclosure) comprising sequences having multiple stereochemical structures and assembling the polynucleotide sequences to produce a library of polynucleotides (e.g. synthetic polynucleotides) encoding multiple antibody light chain variable region sequences. In some embodiments, the antibody light chain variable region sequences are human antibody sequences. In some embodiments, the antibody light chain variable region comprises HVR-L1, HVR-L2 and HVR-L3, and at least two of HVR-L1, HVR-L2 and HVR-L3 comprise amino acid sequences selected from the HVR-L1 sequence of the present disclosure (e.g., SEQ ID NOs 1 to 4), the HVR-L2 sequence of the present disclosure (e.g., SEQ ID NOs 5 to 9) and the HVR-L3 sequence of the present disclosure (e.g., SEQ ID NOs 10 to 23).

[0072] In some embodiments, at least one of the HVR-L1, HVR-L2, and HVR-L3 antibody light chain variable regions adopts a plurality of stereostructures. In some embodiments, the plurality of stereostructures are structure determinants (e.g., , It can be verified or detected using techniques known in the relevant technical field, including but not limited to X-ray crystallography or NMR and / or computer modeling.

[0073] A polynucleotide encoding a set of antibody light chain variable regions and / or heavy chain variable regions may be cloned into any suitable vector for the expression of part or all of the light chain sequence or heavy chain sequence. In some embodiments, the polynucleotide cloned into the vector is fused to all or part of a viral coat protein and enables the production of part or all of the light chain or heavy chain sequence (i.e., the production of a fusion protein) that is displayed on the surface of a particle or cell. Several types of vectors, for example, phagemid vectors, are available and may be used to carry out the invention. Phagemid vectors contain various components, including a promoter, signal sequence, phenotype-determining selector gene, replication origin site, and other essential components as generally known to those skilled in the art. In some embodiments, a polynucleotide encoding a set of antibody light chain variable regions and / or heavy chain variable regions may be closed into a vector for expression in bacterial cells for bacterial display or in yeast cells for yeast display. An exemplary vector is described in U.S. Patent Publication No. US20160145604. In some embodiments, the vector is a display vector comprising a polynucleotide encoding an amino acid sequence to be displayed on a surface (e.g., the surface of a phage, bacterium, yeast, or mammalian cell) from 5' to 3', a restriction site, a second polynucleotide encoding a surface peptide that can be displayed on the surface, and a second restriction site. In some embodiments, the second polynucleotide encodes a phage coat protein, a yeast outer wall protein, a bacterial outer membrane protein, a cell surface tether domain or adapter, or a truncated portion or derivative thereof. In certain embodiments, the second polynucleotide is gene III of filamentous phage M13, or a truncated portion or derivative thereof.In some embodiments, the surface peptide is for phage display, yeast display, bacterial display, or mammalian display, or a shuffling display among them. In some embodiments, when expressed, the amino acid sequence and the surface peptide are displayed as a fusion protein on the surface. In some embodiments, the vector further comprises a fusion tag at 5' for the first restriction site or at 3' for the second restriction site.

[0074] A specific aspect of the present disclosure relates to a group of cells containing the vector(s) described herein. Antibody light chains and / or heavy chains encoded by polynucleotides produced by any of the techniques described herein or other suitable techniques may be expressed and screened to identify antibodies having a desired structure and / or activity. Antibody expression may be performed, for example, using cell-free extracts (e.g., ribosomal display), phage display, prokaryotic cells (e.g., bacterial display), or eukaryotic cells (e.g., yeast display). In some embodiments, the cells are bacterial cells, yeast cells, or mammalian cells. Methods for transfecting bacterial cells, yeast cells, or mammalian cells are known in the art and are described in the literature cited herein. Polypeptides in these cells (e.g. , of the antibody chain) (e.g. , Screening of antibodies of interest as well as expression (from the library of the present disclosure) is described in more detail below.

[0075] Alternatively, polynucleotides are, for example, those described in the literature [Pluckthun and Skerra. (Meth. Enzymol., 1989, 178: 476; Biotechnology, 1991, 9: 273)], such as those found in E. coli ( E. coliIt can be expressed in an expression system. The mutant protein can be expressed for secretion in the medium and / or cytoplasm as described in the literature [Better and Horwitz, Meth. Enzymol., 1989, 178: 476]. In some embodiments, a single domain encoding VH and VL is attached to the 3' end of a sequence encoding a signal sequence, e.g., ompA, phoA, or pelB signal sequence, respectively (Lei et al., J. Bacteriol., 1987, 169: 4379). This gene fusion is assembled into a dicistronic construct, which is expressed from a single vector and can be secreted into the periplasmic space of E. coli, where it will be folded back and recovered in an active form (Skerra et al., Biotechnology, 1991, 9: 273). For example, antibody heavy chain genes can be expressed simultaneously with antibody light chain genes to produce antibodies or antibody fragments.

[0076] In another embodiment, the antibody sequence is expressed on the membrane surface of a prokaryotic organism, e.g., E. coli, using secretory signals and lipidation moiety as described in, for example, U.S. Patents No. US20040072740; No. US20030100023; and No. US20030036092.

[0077] Alternatively, antibodies may be expressed and screened by immobilized peripapillary expression (APEx 2-hybrid surface display) as described in the literature [Jeong et al., PNAS, 2007, 104: 8247], or by other immobilization methods as described in the literature [Mazor et al., Nature Biotechnology, 2007, 25: 563].

[0078] Higher eukaryotic cells, e.g., mammalian cells, e.g., myeloma cells (e.g., NS / 0 cells), hybridoma cells, Chinese hamster ovary (CHO), and human embryonic kidney (HEK) cells may also be used for the expression of the antibodies of the present disclosure. Typically, antibodies expressed in mammalian cells are designed to be secreted into the culture medium or expressed on the surface of the cells. The antibody or antibody fragment may be produced, for example, as an intact antibody molecule, or as individual VH and VL fragments, Fab fragments, as a single domain, or as a single chain (scFv).

[0079] In other embodiments, the antibody may be selected using a mammalian cell display (Ho et al., PNAS, 2006, 103: 9637). In some embodiments, as described above and illustrated below, the antibody is fused to all or part of a viral coat protein, enabling, for example, the production of part or all of a light chain or heavy chain sequence displayed on the surface of a particle or cell using a phage display (i.e., producing a fusion protein).

[0080] Certain aspects of the present disclosure relate to non-human animals comprising a polynucleotide library of the present disclosure. For example, the non-human animals of the present disclosure comprise a polynucleotide encoding a light chain variable region of the present disclosure. In a non-limiting example, a transgenic mouse is produced comprising a light chain immunoglobulin locus (e.g., VL locus) modified to express one or more of the light chain variable regions of the present disclosure. In some embodiments, a transgenic animal (e.g., , Mice) express antibodies or light chains encoded by polynucleotides. Techniques for modifying one or more immunoglobulin loci in non-human animals are known in the relevant art field (e.g., Xenomouse (상표명) (A method used to generate ).

[0081] Screening of antibodies derived from the library of the present disclosure may be performed by any suitable means known in the relevant art. For example, binding activity may be evaluated by standard immunoassays and / or affinity chromatography. Screening of antibodies of the present invention for catalytic function, e.g., proteolytic function, may be achieved using standard assays, e.g., hemoglobin platelet assays. Methods for determining the binding affinity of antibodies to a target include various widely known techniques, e.g., BIACORE, which measures the binding rate to a given target or antigen based on surface plasmon resonance. (상표명)In vitro assays may be performed using Bio-Layer Interferometry (BLI) as exemplified below, using equipment or the ForteBio Octet (registered trademark) RED96 platform (Pall Life Sciences). In vivo assays may be performed using any of a number of animal models and then, where appropriate, tested in humans. Cell-based biological assays are also considered. Antibodies or antigen-binding fragments may be further selected for functional activity, e.g., antagonist or agonist activity. Exemplary screening methods are described herein. For example, in some embodiments, the binding affinity between fab fragment(s) and one or more target(s) is measured by BLI by tagging the antigen with a human IgG1-Fc tag and capturing it by an anti-hIgG-Fc capture (AHC) biosensor. Fab is tagged with a His6 tag at its C-terminus of the CH1 domain and host cells, e.g. It is overexpressed in E. coli and can be purified, for example, using Ni-NTA resin. Affinity can be measured, for example, using a dynamic buffer, by using an AHC sensor (anti-human IgG-Fc capture immersion and readout biosensor) immersed in a well containing purified fab diluted to, for example, 5 to 10 μg / ml.

[0082] After identifying the binding factor by binding to a target or antigen and / or functional assay, nucleic acids can be extracted. The extracted DNA can then be used directly to transform E. coli host cells, or alternatively, the coding sequence can be amplified using PCR with suitable primers, for example, and sequenced using any typical sequencing method. The variable domain DNA of the binding site may be digested by a restriction enzyme and then inserted into a vector for protein expression.

[0083] IV. Antibodies and Antibody Production

[0084] The present specification provides antibodies identified and selected from the library described herein. Specific aspects of the present disclosure relate to antibody light or heavy chain HVR, a variable region comprising HVR, and / or polynucleotide(s) encoding the same. In some embodiments, the HVR and / or variable region is part of an antibody fragment, a full-length antibody, or a single-chain variable fragment (scFv).

[0085] In some embodiments, the light chain variable region is as follows Table 1 It includes one, two, or three of the HVR-L1, HVR-L2, and HVR-L3 sequences listed in ).

[0086]

[0087] In some embodiments, the light chain variable region is as follows Table 2 It includes three antibodies listed in HVR-L1, HVR-L2, and HVR-L3.

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095] In some embodiments, the present specification provides an antibody light chain having a light chain variable region comprising HVR-L1, HVR-L2, and HVR-L3 of the present disclosure. In some embodiments, at least two of HVR-L1, HVR-L2, and HVR-L3 comprise an amino acid sequence selected from the HVR-L1 sequence of the present disclosure (e.g., SEQ ID NOs 1 to 4), the HVR-L2 sequence of the present disclosure (e.g., SEQ ID NOs 5 to 9), and the HVR-L3 sequence of the present disclosure (e.g., SEQ ID NOs 10 to 23).

[0096] The light chain HVR sequence described herein may be included as any combination of the antibody light chain or light chain variable region of the present disclosure. In some embodiments, the light chain variable region comprises HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9 and HVR-L3 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, and HVR-L2 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9. In some embodiments, the light chain variable region comprises HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4 and HVR-L3 of the antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In some embodiments, the light chain variable region comprises HVR-L1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23. In certain embodiments, the light chain variable region comprises three HVR-L1, HVR-L2, and HVR-L3 selected from the group consisting of the following: HVR-L1 having an amino acid sequence of SEQ ID NO. 1, HVR-L2 having an amino acid sequence of SEQ ID NO. 9, and HVR-L3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; HVR-L1 having an amino acid sequence of SEQ ID NO. 2, HVR-L2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 having an amino acid sequence of SEQ ID NO. 18;HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; HVR-L1 selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising an amino acid sequence of SEQ ID NO 9, and HVR-L3 comprising an amino acid sequence of SEQ ID NO 20; HVR-L1 comprising an amino acid sequence of SEQ ID NO 3, HVR-L2 comprising an amino acid sequence of SEQ ID NO 9, and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; HVR-L1 comprising an amino acid sequence of SEQ ID NO 4, HVR-L2 comprising an amino acid sequence of SEQ ID NO 6, and HVR-L3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 10 to 23; HVR-L1 comprising an amino acid sequence of SEQ ID NO 4, HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising an amino acid sequence of SEQ ID NO 23; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs. 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 14;HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 3, HVR-L2 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 14; HVR-L1 comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; HVR-L1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 to 4, HVR-L2 comprising an amino acid sequence of SEQ ID NO. 7, and HVR-L3 comprising an amino acid sequence of SEQ ID NO. 23. In a specific embodiment, the light chain variable region comprises three of HVR-L1, HVR-L2, and HVR-L3 selected from the group consisting of: HVR-L1 comprising an amino acid sequence of SEQ ID NO. 2, HVR-L2 comprising an amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising an amino acid sequence of SEQ ID NO. 18; HVR-L1 comprising an amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising an amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising an amino acid sequence of SEQ ID NO. 23; HVR-L1 comprising an amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising an amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising an amino acid sequence of SEQ ID NO. 20;HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 14; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 3, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 1, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 9, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 18; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 7, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 23; and HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 17; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 6, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 17; HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 5, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 20; and HVR-L1 comprising the amino acid sequence of SEQ ID NO. 4, HVR-L2 comprising the amino acid sequence of SEQ ID NO. 8, and HVR-L3 comprising the amino acid sequence of SEQ ID NO. 11. In some embodiments, the light chain variable region comprises three of the antibodies listed in Table 2: HVR-L1, HVR-L2, and HVR-L3. In some embodiments, the light chain variable region comprises: Table 1It includes three of HVR-L1, HVR-L2, and HVR-L3 listed in ). In some embodiments, the light chain variable region includes a sequence selected from SEQ ID NOs 28 to 50.

[0097] In some embodiments, the light chain variable region further comprises a variable region light chain framework sequence juxtaposed between HVRs according to the following formula: (FW-L1)-(HVR-L1)-(FW-L2)-(HVR-L2)-(FW-L3)-(HVR-L3)-(FW-L4). In some embodiments, one, two, three, or four of the framework sequences are as follows:

[0098] FW-L1 is DIQLTQSPSSLSASVGDRVTITC (Sequence No. 24) and,

[0099] FW-L2 is WYQQKPGKAPKLLIY (Sequence No. 25) and,

[0100] FW-L3 is PSRFSGSGSGTDFTLTISSLQPEDFATY (Sequence No. 26) and,

[0101] FW-L4 is FGQGTKVEIKR It is (sequence number 27).

[0102] In some embodiments, the present specification further provides an antibody comprising a heavy chain and a light chain, wherein the light chain comprises a light chain variable region of the present disclosure. In some embodiments, the present specification further provides an antibody fragment or scFv comprising a heavy chain variable region and a light chain variable region of the present disclosure.

[0103] In some embodiments, the antibody or antibody fragment of the present disclosure binds to at least one target (e.g., a target protein or epitope) or at least two targets with a specific binding affinity. For example, in some embodiments, the antibody or antibody fragment of the present disclosure is about 10 -7 M or less, 10 -8 M or less, 10 -9 M or less, 10 -10 M or less, or 10 -11 It binds to at least one target or at least two targets with an equilibrium dissociation constant (Kd) of M or less. In some embodiments, the antibody or antibody fragment of the present disclosure is about 10 -7 to about 10 -11 M binds to at least one target or at least two targets at the equilibrium dissociation constant (Kd). An exemplary test for determining binding affinity is described and illustrated below.

[0104] The antibodies of the present disclosure may be produced using recombinant methods and compositions as described in, for example, U.S. Patent No. 4,816,567. In some embodiments, isolated nucleic acids encoding any antibody described herein are provided. Such nucleic acids are amino acid sequences containing the VL of the antibody and / or amino acid sequences containing the VH of the antibody (e.g. , It can encode the light chain and / or heavy chain of an antibody. In some embodiments, one or more vectors containing such nucleic acids (e.g., , An expression vector or a display vector is provided herein. In some embodiments, a host cell comprising such nucleic acid is provided. In one such embodiment, the host cell comprises the following (e.g., ,Transformed to): (1) a vector comprising a nucleic acid encoding an amino acid sequence containing the VL of the antibody and an amino acid sequence containing the VH of the antibody, or (2) a first vector comprising a nucleic acid encoding an amino acid sequence containing the VL of the antibody and the V of the antibody H A second vector comprising a nucleic acid encoding an amino acid sequence including [the following]. In some embodiments, the host cell is eukaryotic, e.g., Chinese hamster ovary (CHO) cells or lymphocyte cells (e.g., Y0, NS0, Sp20 cells). In some embodiments, a method for producing an antibody is provided, wherein the method comprises the steps of: culturing a host cell comprising a nucleic acid encoding an antibody as provided above under conditions suitable for the expression of the antibody; and optionally recovering the antibody from the host cell (or host cell culture medium).

[0105] For the recombinant production of the antibody of the present disclosure, for example, a nucleic acid encoding the antibody as described above is isolated and inserted into one or more vectors for further cloning and / or expression in a host cell. Such nucleic acid can be easily isolated and sequenced using conventional procedures (for example, by using an oligonucleotide probe capable of specifically binding to genes encoding the heavy and light chains of the antibody).

[0106] Host cells suitable for the cloning or expression of antibody-coding vectors include prokaryotic or eukaryotic cells. For example, antibodies may be produced in bacteria, particularly where glycosylation and Fc effector functions are not required. For the expression of antibody fragments and polypeptides in bacteria, see U.S. Patents No. 5,648,237, No. 5,789,199, and No. 5,840,523 (also see the literature describing the expression of antibody fragments in E. coli [Charlton, Methods in Molecular Biology, Vol. 248(Refer to BKC Lo, ed., Humana Press, Totowa, NJ, 2003), pp. 245-254). After expression, the antibody [attaches] bacteria in the soluble fraction It can be isolated from cell paste and further purified.

[0107] In addition to prokaryotes, eukaryotic microorganisms, such as filamentous fungi or yeasts, including fungal and yeast strains in which the glycosylation pathway is "humanized" to produce antibodies having a partial or complete human glycosylation pattern, are suitable cloning or expression hosts for antibody-coding vectors (Literature [Gerngross, Nat. Biotech. 22:1409-1414 (2004), and Li et al., Nat. Biotech. [Reference: 24:210-215 (2006)]

[0108] Host cells suitable for the expression of glycosylated antibodies are also derived from multicellular organisms (invertebrates and vertebrates). Examples of invertebrate cells include plant and insect cells. In particular, Spodorophyta pruciperida ( Spodoptera frugiperda For the transfection of ) cells, a number of baculovirus strains that can be used with insect cells have been identified.

[0109] Plant cell cultures may also be used as hosts (e.g., U.S. Patents No. 5,959,177, 6,040,498, 6,420,548, 7,125,978 and 6,417,429 (PLANTIBODIES for producing antibodies in transgenic plants) (상표명) (Technology listed) Note).

[0110] Vertebrate cells can also be used as hosts. For example, mammalian cell lines adapted to grow in suspension may be useful. Other examples of useful mammalian host cell lines include the monkey kidney CV1 line transformed by SV40 (COS-7); human embryonic kidney lines (e.g., in the literature [Graham et al., J. Gen Virol.293 or 293 cells as described in 36:59 (1977); baby hamster kidney cells (BHK); mouse Sertoli cells (e.g., literature [Mather, Biol. Reprod. TM4 cells as described in [23:243-251 (1980)]); monkey kidney cells (CV1); African green monkey kidney cells (VERO-76); human cervical carcinoma cells (HELA); dog kidney cells (MDCK); buffalo rat liver cells (BRL 3A); human lung cells (W138); human liver cells (Hep G2); mouse mammary tumor (MMT 060562); e.g., literature [Mather et al., Annals NY Acad. Sci These are TRI cells; MRC 5 cells; and FS4 cells as described in . 383:44-68 (1982). Other useful mammalian host cell lines are Chinese hamster ovary (CHO) cells, e.g., DHFR - CHO cells (Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)); and myeloma cell lines, e.g., Y0, NS0, and Sp2 / 0. For a review of specific mammalian host cell lines suitable for antibody production, see the literature [Yazaki and Wu, Methods in Molecular Biology, Vol. 248 Please refer to [BKC Lo, ed., Humana Press, Totowa, NJ), pp. 255-268 (2003)].

[0111] Bispecific antibodies having the same / common / single light chain

[0112] The present specification further provides a bispecific antibody having the same light chain variable region of the present disclosure (e.g., having two heavy chain variable regions and two identical light chain variable regions having different binding specificities). In some embodiments, the bispecific antibody comprises two antibody heavy chain variable regions and two identical light chain variable regions, wherein the bispecific antibody binds to a first target or antigen and comprises a first binding domain comprising a first antibody heavy chain variable region and a first light chain variable region; and a second binding domain that binds to a second target or antigen and comprises a second antibody heavy chain variable region and a second antibody light chain variable region; wherein the second antibody light chain variable region has the same sequence as the first antibody light chain variable region. In some embodiments, the first binding domain and the second binding domain bind to different target biomolecules. In some embodiments, the first binding domain and the second binding domain bind to different epitopes on the same biomolecule. In some embodiments, the first antibody heavy chain variable region is a portion of the first antibody heavy chain comprising the first heavy chain variable region and the first heavy chain constant region (e.g., including CH1, hinge, CH2, and CH3). In some embodiments, the second antibody heavy chain variable region is a portion of the second antibody heavy chain comprising the second heavy chain variable region and the second heavy chain constant region (e.g., including CH1, hinge, CH2, and CH3). In some embodiments, the first antibody light chain variable region is a portion of the first antibody light chain comprising the first light chain variable region and the first light chain constant region. In some embodiments, the second antibody light chain variable region is a portion of the second antibody light chain comprising the second light chain variable region and the second light chain constant region. In some embodiments, the first antibody light chain and the second antibody light chain have the same sequence as the heavy chain of the present disclosure.

[0113] The present specification further provides a method for producing a bispecific antibody having the same light chain variable region of the present disclosure (e.g., having two heavy chain variable regions and two identical light chain variable regions having different binding specificities). In some embodiments, the method comprises: (b) binding to a first antigen and selecting a first antigen binding domain comprising a first antibody heavy chain variable region and a first light chain variable region of the present disclosure; (b) binding to a second antigen and selecting a second antigen binding domain comprising a second antibody heavy chain variable region of the present disclosure (wherein the second antibody light chain variable region has the same sequence as the first antibody light chain variable region sequence); and (c) producing a bispecific antibody comprising a heavy chain variable region comprising the amino acid sequence of the first antibody heavy chain variable region, a heavy chain variable region comprising the amino acid sequence of the second antibody heavy chain variable region, a light chain variable region comprising the amino acid sequence of the first antibody light chain variable region sequence, and a light chain variable region comprising the amino acid sequence of the second antibody light chain variable region sequence. In some embodiments, the first light chain variable region is encoded by a polynucleotide from the library of the present disclosure.

[0114] In some embodiments, the bispecific antibodies described herein may have additional specificity. For example, one of the antigen or target binding sites of the bispecific antibody may specifically bind to more than one target.

[0115] Methods for the preparation or production of bispecific antibodies are known in the relevant art. The production of full-length bispecific antibodies can be based on the co-expression of two immunoglobulin heavy-light chain pairs, wherein the two chains have different specificities (Millstein et al., Nature, 305:537-539 (1983)). Due to the random distribution of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a possible mixture of 10 different antibodies, each having only one correct bispecific structure. Purification of the correct molecule, usually performed by an affinity chromatography step, is more difficult to handle, and the product yield is low. Similar procedures are described in International Patent Publication No. WO 93 / 08829 and literature [Traunecker et al., EMBO J. It is disclosed in , 10:3655-3659 (1991)].

[0116] One approach known in the art for the preparation of bispecific antibodies is the "knobs-into-holes" or "protuberance-into-cavity" approach (see, for example, U.S. Patent No. 5,731,168). In this approach, two immunoglobulin polypeptides (e.g. ,Each of the heavy chain polypeptides includes an interface. An interface of one immunoglobulin polypeptide interacts with a corresponding interface on another immunoglobulin polypeptide, thereby enabling the two immunoglobulin polypeptides to associate. These interfaces may be manipulated so that a "knob" or "proterburance" (these terms may be used interchangeably herein) located at the interface of one immunoglobulin polypeptide corresponds to a "hole" or "cavity" (these terms may be used interchangeably herein) located at the interface of the other immunoglobulin polypeptide. In some embodiments, the hole is suitably positioned having the same or similar size as the knob so that, when the two interfaces interact, the knob of one interface can be positioned in the corresponding hole of the other interface. Although not intended to be confined to theory, it is thought that this stabilizes the heteropolymer and favors the formation of the heteropolymer over other species, for example, homopolymers. In some embodiments, this approach can be used to promote the heteropolymerization of two different immunoglobulin polypeptides to produce a bispecific antibody containing two immunoglobulin polypeptides having binding specificity to different epitopes.

[0117] In some embodiments, the knop may be formed by replacing a small amino acid side chain with a larger side chain. In some embodiments, the hole may be formed by replacing a large amino acid side chain with a smaller side chain. The knop or hole may be present at the interface in the original form, or it may be introduced by synthesis. For example, the knop or hole may be introduced by synthesis by altering the nucleic acid sequence encoding the interface to replace at least one "original" amino acid residue with at least one "imported" amino acid residue. Methods for altering the nucleic acid sequence may include standard molecular biology techniques widely known in the art. In some embodiments, the original residue may have a small side chain volume (e.g., alanine, asparagine, aspartic acid, glycine, serine, threonine, or valine), and the import residue for forming the knop is a naturally occurring amino acid and may include arginine, phenylalanine, triosine, and tryptophan. In some embodiments, the original residue may have a large side chain volume (e.g., arginine, phenylalanine, triosin, and tryptophan), and the import residue for forming the hole is a naturally occurring amino acid and may include alanine, serine, threonine, and valine.

[0118] In some embodiments, the intrinsic residue for forming the knob or hole is identified based on the three-dimensional structure of the heteropolymer or homopolymer (e.g., homodimer). Techniques known in the art for obtaining the three-dimensional structure may include X-ray crystallography and NMR. In some embodiments, the interface is an immunoglobulin (e.g. ,IgG1, IgG2, IgG3, IgG4) is the CH3 domain of the constant domain. In this embodiment, the CH3 / CH3 interface of human IgG1 comprises 16 residues on each domain located on four antiparallel β-strands. Without being bound by theory, the mutated residues are preferably located on two central antiparallel β-strands to minimize the risk that the knop may be accommodated by the surrounding solvent rather than as a compensatory hole within the partner CH3 domain. In some embodiments, the mutations forming the corresponding knop and hole within the two immunoglobulin polypeptides correspond to one or more pairs provided in the table below.

[0119]

[0120] In some embodiments, the immunoglobulin polypeptide is the above Table 3 It comprises a CH3 domain containing one or more amino acid substitutions listed in ). In some embodiments, the bispecific antibody is Table 3 A first immunoglobulin polypeptide comprising a CH3 domain having one or more amino acid substitutions listed in the left column of, and Table 3 It includes a second immunoglobulin polypeptide comprising a CH3 domain containing one or more corresponding amino acid substitutions listed in the right column of.

[0121] Following the DNA mutation as discussed above, a polynucleotide encoding a modified immunoglobulin polypeptide having one or more corresponding Knop- or Hall-forming mutations can be expressed and purified using standard recombinant techniques and cell systems known in the art (e.g., U.S. Patents No. 5,731,168; No. 5,807,706; No. 5,821,333; No. 7,642,228; No. 7,695,936; No. 8,216,805; U.S. Publication No. 2013 / 0089553; and see [Spiess et al., Nature Biotechnology 31: 753-758, 2013]). The modified immunoglobulin polypeptide can be produced using prokaryotic host cells, e.g., E. coli, or eukaryotic host cells, e.g., CHO cells. The corresponding Knop- and Hole-containing immunoglobulin polypeptides may be expressed in host cells in a co-culture and purified together as a heteropolymer, or they may be expressed in a single culture, purified separately, and assembled in vitro. In some embodiments, two strands of bacterial host cells (one expressing a Knop-containing immunoglobulin polypeptide and the other expressing a Hole-containing immunoglobulin polypeptide) are co-cultured using standard bacterial culture techniques known in the art. In some embodiments, the two strands may be mixed in a specific ratio, for example, to achieve the same expression level in the culture. In some embodiments, the two strands may be mixed in a ratio of 50:50, 60:40, or 70:30. After polypeptide expression, the cells may be lysed together and the proteins may be extracted. Standard techniques known in the art that enable the measurement of the abundance of homomers versus heteromers may include size exclusion chromatography. In some embodiments, each modified immunoglobulin polypeptide is expressed separately using standard recombinant techniques and can be assembled together in vitro.Assembly can be achieved, for example, by purifying each modified immunoglobulin polypeptide, mixing and incubating them together in equal masses, reducing the disulfide (e.g. by treatment with dithiothreitol), concentrating, and reoxidizing the polypeptide. The formed bispecific antibodies can be purified using standard techniques, including cation-exchange chromatography, and measured using standard techniques, including size exclusion chromatography. For more detailed descriptions of these methods, see the literature [Speiss et al., Nat Biotechnol Please refer to [31:753-8, 2013]. In some embodiments, the modified immunoglobulin polypeptide is separately expressed in CHO cells and can be assembled in vitro using the method described above.

[0122] V. Kit

[0123] In another aspect, the present specification provides a kit comprising a library of polynucleotides of the present disclosure. In some embodiments, the kit further comprises a package insert containing instructions for using the library for expression, modification, screening, or, for example, to identify an antibody HVR or a variable region of interest. In some embodiments, the kit further comprises one or more buffers for, for example, storage, delivery, transfection, or other uses of one or more of the polynucleotides (e.g., synthetic polynucleotides). In some embodiments, the kit further comprises one or more containers for storing one or more of the polynucleotides. In some embodiments, the kit further comprises one or more vectors for, for example, transfecting one or more of the polynucleotides into host cells.

[0124] Examples

[0125] The present invention will be more fully understood by reference to the following examples. However, the examples should not be construed as limiting the scope of the disclosure. The examples and embodiments described herein are for illustrative purposes only, and it is understood that various modifications or alterations are proposed to those skilled in the art in light of this, and will be included within the spirit and scope of the application and the scope of the appended claims.

[0126] Example 1: Identification of the minimum set of dynamic motifs for a hypervariable region

[0127] To understand the variability of antibody variable domains at the structural level, an algorithm was developed to map the geometric alignment of antibody variable domains, and additionally, structural and sequence entropies were calculated based on the geometric alignment. Adopting this approach is in opposition to the traditional theory of antibody diversity determined by the well-established V(D)J recombination process coupled with conformational diversity from dynamic units (template-directed conformational selection by Linus Pauling; e.g., literature [James, L. and Tawfik, D. "Conformational diversity and protein evolution - a 60-year-old hypothesis revisited", Trends in Biochem Science By combining [refer to . 2003 Jul;28(7):361-8]), it is possible to sample a nearly infinite epitope space through the selection and adoption of antibody binding sites. As an example, this algorithm was used to analyze the structural and sequence variability of 81 high-resolution crystal structures of human antibody variable light chain domains. Entropy was calculated and plotted for all positions of the variable light chain domains ( Fig. 1A; thick lines represent structural entropy, dotted lines represent sequence entropy). Using the results obtained by calculating structural entropy and sequence entropy based on geometric alignment, hypervariable (HVR) regions were positioned, and significant locations on these variable regions were identified. For comparison, HVR (as defined by the method described above) and CDR (as defined by Kavat) were identified for exemplary antibody light chain variable domain sequences ( Fig. 1B ).

[0128] Interestingly, the variability assessed by structural alignment was generally lower than that observed in sequence alignment. Although variability was generally lower when assessed by structural alignment, numerous sites / regions exhibiting dramatic structural changes were present, suggesting that these variable regions may play a significant role in antibody function. Additionally, some of these hypervariable regions exhibit high flexibility with multiple conformations. The identification of highly variable residue regions provided a more comprehensive picture of the conservation and variability of antibody variable domains that can be utilized in novel antibody designs. The identification of dynamic motifs made it possible to encompass diverse structural variability using a reduced number of amino acid sequences. A remarkable advantage of this approach to antibody design was that it allows for the use of a more limited number of dynamic motifs in variable regions to encompass extensive antibody structural variability and provide broad flexibility in antibodies capable of binding to multiple antigens of interest. Thus, a common light chain library (referred to as DL280) was constructed using a single human germline or germline-derived sequence for the invariant residue, but the extensive structural variability identified in the variable regions HVR-L1, HVR-L2, and HVR-L3 was obtained by using a limited number of dynamic motifs for the hypervariable region.

[0129] Example 2: Creation of a Common Light Chain Library

[0130] Creation of the Light Chain Library DL280

[0131] To begin constructing the DL280 light chain library, 20 mini-genes encoding 20 combinations of HVR-L1 and HVR-L2 sequences were synthesized ( Table 1 Subsequently, the synthesized mini-genes were digested with PvuI and BamHI and ligated into the target vector Fad22, which had been digested with the same two restriction enzymes. The ligation mixture was transformed in DH10B cells, 20 constructs were purified, and their sequences were verified for the next construct step.

[0132] A total of 14 oligo pairs encoding 14 HVR-L3 sequences ( Table 1 ) was designed and synthesized. Oligo annealing was performed on a PCR machine using the following settings: 95°C for 3 minutes, followed by 35 cycles (15 seconds per cycle) starting at 95°C with the temperature decreasing by 1°C per cycle. After annealing, each pair was individually digested with PstI and Acc65I and ligated individually within the 20 aforementioned constructs digested with the same two restriction enzymes. The ligation mixtures were individually transfected in DH10B cells, and the resulting 280 constructs were purified, quantified, and sequenced. The sequences of the HVR-L1, HVR-L2, and HVR-L3 regions corresponding to these 280 constructs Table 2 Listed in ). Additionally, each of these 280 works shares the same framework area, namely FW-L1 (SEQN 24), FW-L2 (SEQN 25), FW-L3 (SEQN 26), and FW-L4 (SEQN 27). An equal amount of each of the 280 works was mixed for library construction.

[0133] The above-mentioned mixture of 280 plasmids was digested with PvuI and Acc65I and ligated into the phagemid vector Fad40, which was also digested with the same two restriction enzymes. The ligated mixture was transformed in DH10B cells, the resulting library (DL280) was purified, quantified, and stored for assembly of the complete phagemid library.

[0134] VH library creation

[0135] Multiple degenerate oligos encoding VH_vr1 and VH_vr2 were designed and synthesized, and converted into double-stranded DNA via the following protocol: 0.75 µl of 0.2 μM template oligo was mixed with 10 µl of 5x PrimeSTAR buffer, 4 µl of dNTP mixture, 1 µl of 100 μM forward primer, 1 µl of 100 μM reverse primer, 0.5 µl of PrimeSTAR HS DNA polymerase (2.5 U / µl), and 33 µl of water. The PCR solution was preheated at 96°C for 5 minutes, followed by 14 cycles (96°C for 15 seconds, 60°C for 15 seconds, 72°C for 6 seconds), and then extended at 72°C for 3 minutes. VH_vr1 was amplified using primer pairs F_1999(CGTTTGTCCTGTGCAGCTTCCGG)(SEQ No. 61) and R_1999(CGAGGCCCTTACCCGGGGCCTGACG)(SEQ No. 62), and VH_vr2 was amplified using primer pairs F_2003(CCGGGTAAGGGCCTCGAGTGG)(SEQ No. 63) and R_2003(GAGCACGTCCGTTCGAATTGTCGCGACTTATAG)(SEQ No. 64)( Table 4 It was amplified using ).

[0136] Double-stranded VH_vr1 and VH_vr2 were ligated together via overlapping sequences at the 5' or 3' ends. The protocol used is as follows: 20 ng of VH_vr1 and 20 ng of VH_vr2 templates were mixed with 10 µl of 5x PrimeSTAR buffer, 4 µl of dNTP mixture, 1 µl of 100 µM F_1999 primer, 1 µl of 100 µM R_2003 primer, 0.5 µl of PrimeSTAR HS DNA polymerase (2.5 U / µl), and water (max. 50 µl). The mixture was preheated at 96°C for 5 minutes, followed by 14 cycles (96°C for 15 seconds, 60°C for 15 seconds, 72°C for 10 seconds), and then extended at 72°C for 3 minutes. Subsequently, these PCR fragments were purified via gel electrophoresis (GENEray gel extraction kit), digested with BspEI and BstBI (Thermo Scientific), and then cloned into FTV014 digested with the same two enzymes. The ligation mixture was transformed in DH10B cells by electroporation, and colonies with a calculated diversity exceeding 10 were collected for plasmid preparation. The purified plasmid constituted the library VH-VR12.

[0137] Hundreds of degenerate oligos encoding VH_vr3 were designed and synthesized, and converted into double-stranded DNA via the following protocol: 0.75 µl of 0.2 μM template oligo was mixed with 10 µl of 5x PrimeSTAR buffer, 4 µl of dNTP mixture, 1 µl of 100 μM forward primer, 1 µl of 100 μM reverse primer, 0.5 µl of PrimeSTAR HS DNA polymerase (2.5 U / µl), and 33 µl of water. The PCR solution was preheated at 96°C for 5 minutes, followed by 14 cycles (96°C for 15 seconds, 60°C for 15 seconds, 72°C for 6 seconds), and then extended at 72°C for 3 minutes. The forward primer was S1089 (ACAACTGAACAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTG) (SEQ No. 65), and the reverse primer was S1090 (GAGGAGACGGTGACTAGTGTTCCTTGACCCCA) (SEQ No. 66) ( Table 4 ...was. Subsequently, double-stranded DNA encoding VH_vr3 was purified via gel electrophoresis (GENEray gel extraction kit), digested with AflII and SpeI (Thermo Scientific), and then cloned into FTV012 cells digested with the same two restriction enzymes. The ligation mixture was transformed in DH10B cells by electroporation, and colonies with a calculated diversity exceeding 10-fold were collected for plasmid preparation. The purified plasmid constituted the VH-VR3 library.

[0138] To assemble the full-length VH library, a mixture of purified VH-VR3 library plasmids was digested with AflII and SpeI (NEB), the VR3-encoding fragment was purified via gel electrophoresis (GENEray gel extraction kit), and then cloned into a mixture of VH-VR12 library plasmids digested with the same two restriction enzymes. The ligation products were desalted (QIAquick (registered trademark) PCR purification kit (QIAGEN)) and then rolling circle amplification (RCA) was performed. RCA was performed as follows: 40 ng of the ligation product was mixed with 10 µl of 10x NEBuffer 4, 50 µl of 100 µM pd(N)8, and water (maximum 88.5 µl), heated to 95°C for 3 minutes, and annealed for 65 cycles (30 seconds per cycle) while decreasing the temperature by 1°C per cycle. After adding 10 µl of 10 mM dNTP mix, 1 µl of 100 x BSA, and 0.5 µl of Phi29 DNA polymerase, the annealed reaction mixture was incubated overnight at 30°C. The RCA product was first digested with NotI, the DNA fragment was purified using the QIAquick (registered trademark) PCR purification kit, and further digested with XhoI. Subsequently, the digested product was ligated with T4 DNA ligase (Thermo Scientific). After purification by ethanol precipitation, the ligated product was transformed in DH10B cells by electroporation, and colonies with a calculated diversity exceeding 10-fold were collected for plasmid preparation. The purified plasmid constituted the VH-VR123 library.

[0139]

[0140] Creation of a common light chain library

[0141] The common light chain library consisted of a heavy chain library derived from the VH-VR123 library and a light chain library derived from the DL280 library. Both the VH-VR123 library plasmid and the DL280 library plasmid were digested with BspEI and SpeI (Thermo Scientific). The DNA fragment encoding the heavy chain derived from the VH-VR123 library was cloned into the vector backbone derived from the DL280 library. The ligation products were desalted (QIAquick PCR purification kit (Qiagen)), and then rolling circle amplification (RCA) was performed. RCA was performed as follows: 40 ng of the ligation product was mixed with 10 µl of 10x NEBuffer 4, 50 µl of 100 µM pd(N)8, and water (max. 88.5 µl), heated to 95°C for 3 minutes, and annealed for 65 cycles (30 seconds per cycle) while decreasing the temperature by 1°C per cycle. After adding 10 µl of 10 mM dNTP mix, 1 µl of 100 x BSA, and 0.5 µl of Phi29 DNA polymerase, the annealed reaction mixture was incubated overnight at 30°C. The RCA product was first digested with NotI, the DNA fragment was purified using a QIAquick (registered trademark) PCR purification kit, and further digested with Acc65I. Subsequently, the digested product was ligated with T4 DNA ligase (Thermo Scientific). After purification by ethanol precipitation, the ligation product was transformed into ER2738 cells by electroporation. 3.5*10 9 The total number of colonies was collected from a plate (2xYT, 1% glucose, 100 µg / ml ampicillin).

[0142] Example 3: Screening of a common light chain library for isolating antibodies of interest

[0143] Preparation of common light chain library phagemid particles

[0144] To prepare common light chain library phagemid particles for antigen panning, 1.6 liters of ER2738 cells containing a common light chain library (described in Example 2 above) were placed in a medium containing 2xYT, 2% glucose, 100 µg / ml ampicillin, and 12.5 µg / ml tetracycline with a starting OD of 0.1 600 Inoculated at. The culture had an OD of 0.6 to 0.8. 600 The culture was grown at 37°C with shaking at 250 rpm until [the target value] was reached. Subsequently, cells were infected with M13KO7 helper phage at a multiplicity of infection (MOI) of 10 for 30 minutes at 37°C. Infected ER2738 cells were grown overnight at 22°C in 3.2 liters of medium containing 2xYT, 100 µg / ml ampicillin, and 50 µg / ml kanamycin. The culture supernatant was then collected by centrifugation at 10,000 rpm for 15 minutes and filtered through a 0.45 μm low-binding membrane filter (Corning). Subsequently, phagemid particles were precipitated from the filtered supernatant using PEG / NaCl and resuspended in PBS. Additional rounds of PEG / NaCl precipitation followed by resuspension in PBS were performed. OD 268 Measurement (OD) 268 1 unit in is approximately 1*10 13 Phage titer was determined by (assuming phage particles / mL) and confirmed by plaque assay. Library phagemid particles were stored in 20% glycerol at -80°C.

[0145] Paji library panning

[0146] Antigen proteins at concentrations of 1 to 30 µg / ml were coated onto Maxisorp strips (Thermo Scientific, Catalog No. 446469) overnight at 4°C. Multiple wells of the antigen were prepared for each library. The coated wells were first blocked with 5% milk in PBS at room temperature for 1 to 2 hours and then washed with PBS. Subsequently, 1,100 µl / well of fazimid particle solution (typically 1 to 5 x 10⁶ in 2% milk-PBS) 12 The phage was added to four parallel wells and incubated for 1 to 2 hours. Subsequently, the wells were washed several times with PBS having an increasing concentration of Tween 20 (from 0.1% to 0.3%), and finally washed with PBS alone. The bound phagemid particles were eluted from a well containing 100 µl of 0.2 M glycine-HCl at room temperature for 10 minutes. The eluted phage was immediately neutralized with 18 µl of 1 M Tris-HCl (pH 9.1).

[0147] Alternatively, phagemid library panning was performed using a KingFisher (Thermo Scientific) with Dynabead (M280, Streptavidin, Invitrogen, Catalog No. 60210) according to the manufacturer's instructions. 300 µl of Dynabead was washed with PBS and incubated with biotinylated anti-human Fc for 20 minutes at room temperature. The beads were then blocked with 5% BSA in PBS for 1 hour at room temperature. Fc-fusion antigens (70 to 100 pmol) were captured by 1 hour of incubation at room temperature. The beads were then washed once with PBS and 1 ml of phage library solution (typically 5 × 10⁶ in 5% BSA-PBS). 12 Up to 1*10 13The beads were incubated with canine phage particles for 1 to 2 hours. Subsequently, the beads were washed several times with PBS / Tween (0.1% to 0.3%) and PBS, and the bound phages were eluted from the beads with 100 µl of 0.2 M glycine-HCl at room temperature for 10 minutes. The eluted phages were immediately neutralized with 18 µl of 1 M Tris-HCl (pH 9.1). A total of 3 to 4 rounds of panning were performed for each antigen, and 10 to 100 times an excess of purified human Fc was included to reduce background binding.

[0148] For some of the antigens tested, 2 ml of antigen (10 to 30 µg / ml) was used to coat the immuno-tubes overnight at 4°C. The volumes of the blocking, washing, and elution solutions were increased accordingly.

[0149] Amplification of enriched phages

[0150] The eluted enriched phage pool was further amplified as follows: ER2738 cells were infected with eluted phagemid particles at 37°C for 30 minutes. The infected cells were then plated on 2xYT agar plates containing 2% glucose, 100 µg / ml ampicillin, and 12.5 µg / ml tetracycline. Colonies were collected from the plates, grown in 100 ml of 2% glucose, 100 µg / ml ampicillin, and 12.5 µg / ml tetracycline, and infected with M13KO7 helper phage. The amplified phage was purified and quantified according to the process described above. Typically, ER2738 cells were infected using the eluted phage after panning in the final round, and the resulting ER2738 colonies were taken for supernatant ELISA screening assay.

[0151] Supernatant Sandwich Elisa Test

[0152] A sensitive sandwich ELISA assay was developed to measure Fab present in the bacterial supernatant. Microplates were coated with polyclonal anti-human IgG (Fab-specific) (Sigma I5260) to capture Fab present in the bacterial supernatant, and the amount of captured Fab was subsequently detected using HRP-labeled goat anti-human Fc. A of each well 450 Fab binding activity was determined by measuring. A primary hit was defined as the ELISA signal being at least twice the background, and this was further characterized in the following example (Example 4).

[0153] Example 4: Characterization of antibodies in vitro

[0154] Fab corresponding to the primary hit identified in Example 3 above, in which the C-terminus of the CH1 domain was tagged with a His6 tag, was overexpressed in E. coli and purified using Ni-NTA resin (Thermo Fisher Scientific) according to the manufacturer's instructions. Its affinity was measured by the ForteBio Octet RED96 system. Briefly, the antigen was captured using an AHC sensor (anti-human IgG-Fc capture immersion and readout biosensor) and immersed in wells containing purified Fab diluted to 5 to 10 µg / ml using kinetic buffer (for further explanation, for example, see the literature [ForteBio, Anti-human IgG Capture (AHC) Biosensors (Refer to Product Insert 41-0072-PD (2008)). The acquired ForteBio data were processed using Data Acquisition software 7.1, and the dynamic data were fitted to a 1:1 Langmuir binding model. Fab affinities for targets TAGT-1, TAGT-2, and TAGT-3 were measured at 25°C, and Table 5and Fig. 3 These three target antigens (TAGT-1, TAGT-2, and TAGT-3) were unrelated proteins sharing less than 17% sequence identity.

[0155]

[0156]

[0157]

[0158]

[0159]

[0160] The above Table 5 As presented, multiple antibodies targeting three different antigens with high affinity could be successfully identified and selected from the prepared library.

[0161] Example 5: Application of the DL280 Library

[0162] To demonstrate the application of the DL280 light chain library assembled in Example 2 under different scenarios, three antibody libraries were constructed using the DL280 light chain library:

[0163] DPL5: A complete set of DL280 light chains paired with a large VH library

[0164] VH: Diversity is 10 9 Exceeding 1 VH

[0165] VL: Full set of DL280

[0166] SEL021: A complete set of DL280 light chains paired with a small VH library

[0167] VH: 20 VHs

[0168] VL: Full set of DL280

[0169] DPL16~DPL34: Subsets of DL280 light chains paired with large VH libraries

[0170] VH: Diversity is 1010 Exceeding 1 VH

[0171] VL: Single species of DL280

[0172] To investigate the toughness and flexibility of the DL280 light chain library, the DPL5, SEL021, and DPL16–DPL34 libraries were screened for three targets: TAGT-1, TAGT-2, and TAGT-3 (as described in Example 3). Positive hits were identified from each of the three tested libraries, a total of 165 positive hits containing 24 unique VLs were measured, and confirmed by affinity data ( Table 6 ).

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179] Among the 24 unique VLs, 9 of them bound to multiple targets when paired with different VHs. For example, Heat ID 3757 contained DL280-135 (Sequence No. 28) and VH (Sequence No. 51) and bound to TAGT-1, whereas Heat ID 5905 also contained DL280-135 but had a different VH (Sequence No. 52) and bound to a different target, TAGT-3. Similarly, when DL280-67 (Sequence No. 34) was paired with one VH (Sequence No. 56) as Heat ID 5145, it bound to TAGT-2, and when paired with a different VH (Sequence No. 57) as Heat ID 7077, it bound to TAGT-1.

[0180] It was also discovered that VL from DL280 can bind to all three target antigens when paired with different VH sequences. For example, when DL280-70 (SEQ ID 32) was paired with one VH (SEQ ID 53) as hit ID 7035, it bound to TAGT-2; when paired with a second VH (SEQ ID 54) as hit ID 4218, it bound to TAGT-1; and when paired with VH (SEQ ID 55) as hit ID 5114, it bound to TAGT-3. Two additional DL280s bound to the same target using multiple different VHs. For example, DL280-271 (SEQN 36) bound to TAGT-3 when paired with two different VHs (SEQN 58 and 59) as hit IDs 5930 and 6008, respectively. The following Table 7 represents the number of combined targets and sequences used for 24 unique VLs identified during library analysis.

[0181]

[0182] The use of the DL280 segment was analyzed for antibody hits from the DPL5 and SEL021 libraries ( Fig. 2A ).

[0183] VL 10 10 By pairing with a VH library containing excess VH sequences, 19 of the top VLs ( Table 7 As shown in [figure]), a single VL library (DPL16–34) was constructed, and these antibodies were re-screened by re-analyzing binding to TAGT-3, TAGT-2, and TAGT-1. After confirming hits from all three libraries (DPL5, SEL021, and DPL16–34), the DL280 fragment was used ( Fig. 2B re-evaluated ) Table 8Although I do not intend to be bound by theory, it is thought that multiple antigens bound by an antibody containing a given hypervariable region may exhibit high flexibility of a specific hypervariable region, and that high segmentation of a given hypervariable region may exhibit rigid folding of the hypervariable region (and surrounding polypeptide sequences).

[0184]

[0185] The segmental combination distribution was also calculated for all combinations of HVR-L1, HVR-L2, and HVR-L3 ( Table 9 and graph 10 ).

[0186]

[0187]

[0188]

[0189] A novel method used to identify dynamic motifs of the redefined hypervariable region of an antibody based on structural and sequence variability has led to the design of a limited number of VL components capable of binding to the same target or multiple different targets depending on the VH segment to which the VL component is paired. The data and antibodies described herein indicate that the DL280 light chain library, used as a whole set or a subset, is sufficiently potent to act as a VL component for antibody discovery.

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

Claims

Claim 1 (a) Multiple antibody light chain variable regions (V L As a polynucleotide encoding ), the plurality of V L Each includes three HVRs and four FW regions arranged in the order of (Framework (FW)-L1)-(Hypervariable Region (HVR)-L1)-(FW-L2)-(HVR-L2)-(FW-L3)-(HVR-L3)-(FW-L4), and the plurality of V L Each comprises FW-L1 consisting of the amino acid sequence of SEQ ID NO. 24, FW-L2 consisting of the amino acid sequence of SEQ ID NO. 25, FW-L3 consisting of the amino acid sequence of SEQ ID NO. 26, and FW-L4 consisting of the amino acid sequence of SEQ ID NO. 27, and the plurality of V L Polynucleotides comprising HVR-L1, HVR-L2, and HVR-L3 selected from the group each comprising (1) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (2) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (3) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (4) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (5) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (6) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (7) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (8) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (9) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (10) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (11) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (12) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (13) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (14) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (15) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (16) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (17) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (18) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (19) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (20) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (21) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (22) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17 , (23) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (24) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (25) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (26) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (27) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (28) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (29) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (30) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (31) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (32) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (33) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (34) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (35) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (36) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (37) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (38) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (39) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (40) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (41) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (42) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (43) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (44) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (45) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (46) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (47) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (48) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (49) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (50) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (51) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (52) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (53) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (54) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (55) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (56) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (57) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (58) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (59) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (60) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (61) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (62) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (63) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (64) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (65) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (66) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (67) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (68) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (69) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (70) HVR-L1 composed of the amino acid sequence of SEQ ID NO. 1, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (71) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (72) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (73) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (74) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (75) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (76) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (77) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (78) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (79) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (80) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (81) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (82) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (83) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (84) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (85) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (86) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (87) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (88) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (89) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (90) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (91) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (92) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (93) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (94) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (95) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (96) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (97) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (98) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (99) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (100) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (101) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (102) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (103) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (104) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (105) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (106) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (107) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (108) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (109) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (110) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (111) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (112) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (113) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (114) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (115) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (116) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (117) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (118) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (119) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (120) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (121) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (122) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (123) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (124) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (125) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (126) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (127) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (128) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (129) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (130) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (131) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (132) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (133) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (134) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (135) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (136) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (137) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (138) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (139) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (140) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 2, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (141) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (142) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (143) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (144) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (145) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (146) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (147) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (148) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (149) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (150) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (151) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (152) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (153) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (154) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (155) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (156) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (157) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (158) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (159) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (160) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (161) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (162) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (163) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (164) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (165) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (166) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (167) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (168) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (169) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (170) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (171) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (172) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (173) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (174) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (175) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (176) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (177) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (178) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (179) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (180) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (181) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (182) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (183) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (184) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (185) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (186) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (187) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (188) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (189) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (190) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (191) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (192) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (193) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (194) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (195) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (196) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (197) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (198) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (199) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (200) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (201) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (202) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (203) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (204) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (205) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (206) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (207) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (208) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (209) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (210) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 3, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (211) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (212) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (213) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (214) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (215) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (216) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (217) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (218) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (219) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (220) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (221) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (222) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (223) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (224) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 5, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (225) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (226) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (227) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (228) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (229) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (230) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (231) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (232) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (233) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (234) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (235) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (236) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (237) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (238) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 6, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (239) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (240) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (241) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (242) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (243) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (244) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (245) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (246) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (247) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (248) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (249) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (250) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (251) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (252) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 7, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (253) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (254) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (255) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (256) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (257) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (258) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (259) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (260) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (261) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (262) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (263) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (264) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (265) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, (266) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 8, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23, (267) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 10, (268) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 11, (269) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 12, (270) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 13, (271) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 composed of the amino acid sequence of SEQ ID NO. 14, (272) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 15, (273) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 16, (274) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 17, (275) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 18, (276) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 19, (277) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 20, (278) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 21, (279) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 22, and (280) HVR-L1 consisting of the amino acid sequence of SEQ ID NO. 4, HVR-L2 consisting of the amino acid sequence of SEQ ID NO. 9, and HVR-L3 consisting of the amino acid sequence of SEQ ID NO. 23; and (b) an antibody heavy chain variable region (V H As a polynucleotide encoding ), where V H A library comprising a polynucleotide selected from the group consisting of SEQ ID NOs 51 to 59. Claim 2 In paragraph 1, the plurality of V L A library in which at least one of the above HVR-L1, HVR-L2, and HVR-L3 is determined to adopt a plurality of stereostructures as verified by X-ray crystallography, NMR, and / or computer modeling. Claim 3 In paragraph 1, the plurality of V L 280 V selected from the group consisting of (a)(1) to (a)(280) L A library that contains Claim 4 A library according to claim 1, wherein the polynucleotide encodes a full-length antibody light chain. Claim 5 In paragraph 1, the above V H A polynucleotide encoding at least one unique V H A library that contains sequences. Claim 6 In claim 1, the polynucleotide encodes a plurality of unique antibodies, and V of each of the plurality of antibodies L A library that contains this identical sequence. Claim 7 In paragraph 6, the V of the antibodies in the library H A library that contains at least one unique sequence. Claim 8 A library in which the polynucleotide of the library is a synthetic polynucleotide, wherein, in claim 1. Claim 9 In claim 1, the antibody V L and the above V H A library in which each polynucleotide encoding exists within the vector. Claim 10 In claim 9, a library in which the vector is an expression vector or a display vector. Claim 11 In claim 1, the antibody V L and the above V H A library in which each polynucleotide encoding exists within the cell. Claim 12 In paragraph 11, a library in which the cell is a bacterium, yeast, or mammalian cell. Claim 13 A non-human animal comprising a library of any one of paragraphs 1 through 12. Claim 14 In Paragraph 13, the above non-human animal is a mammalian non-human animal. Claim 15 Antibody V comprising an antigen-binding domain, wherein the antigen-binding domain is defined in the library of any one of claims 1 to 12 L and antibody V H A library that includes Claim 16 A library according to claim 15, wherein the library comprises a phage, and each of the antigen-binding domains is displayed on the surface of at least one phage of the library. Claim 17 A method for manufacturing a library comprising the step of providing and assembling a polynucleotide sequence of a library according to any one of claims 1 to 12. Claim 18 A kit comprising a library of any one of claims 1 to 12.

Images