SNP marker composition based on chloroplast genome sequence for discriminating Carex lanceolata Boott and uses thereof
A chloroplast genome-based SNP marker composition using dCAPS primers addresses the challenge of sedge species identification, ensuring accurate and cost-effective classification and management.
Patent Information
- Application Number
- KR1020250148672
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2025-10-15
- Publication Date
- 2026-07-21
- Estimated Expiration
- 2045-10-15
AI Technical Summary
Accurate identification of sedge species is challenging due to morphological similarities and the short fruit ripening period, which complicates taxonomic classification and utilization of Cyperaceae plants as biological resources.
Development of a chloroplast genome sequence-based SNP marker composition using dCAPS primers to distinguish sedge species, including a polynucleotide with an SNP base at the 31st position, and a microarray for identifying sedges, utilizing a dCAPS primer set and restriction enzyme treatment to analyze PCR products by electrophoresis.
The method provides accurate species identification of sedges, reducing errors and costs while maintaining reliability and efficiency through a simplified process, suitable for plant variety protection and seed management systems.
Smart Images

Figure 112025115147213-PAT00001_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a chloroplast genome sequence-based SNP marker composition for identifying sedges and the use thereof. Background Technology
[0002] Shade sedge ( Carex lanceolata Boott is a perennial herb belonging to the Cyperaceae family of the Poales order, growing in dry grasslands in plains or forests in mountainous areas. It has a short rhizome, and the leaves grow in clusters with dark brown fibers at the base. The flower stalks are 10–40 cm tall, and the leaves grow long after flowering; the leaf sheaths at the base are reddish-brown and split like a net. Flowering occurs from April to June, with 3–6 erect spikelets. The spikelets at the tip of the stem are male flowers, with slender, club-shaped stalks about 1 cm long. The female spikelets are 2–3 in number, growing laterally; they are short cylindrical in shape and about 1–2 cm long. The bracts are undescended, tube-like, and pointed at the tip. The scales of the female flowers are oval-shaped with short awns and a white central vein. The pericarp is an inverted egg-shaped, long oval, and shorter than the spikelet. The style is not thick at the base and stands obliquely; the stigma consists of three parts, approximately 4 mm in length, and detaches. The fruit is an achene, densely enclosed in a capsule, about 2 mm in length, triangular, and shaped like an inverted egg. It grows throughout Korea and is distributed in China, Russia, Japan, and other regions.
[0003] The Cyperaceae family is a plant group belonging to the order Poales within the monocotyledonous group of the angiosperms. It is widely distributed primarily in the temperate regions of the Northern and Southern hemispheres, with approximately 109 genera and 5,500 species reported worldwide. It is known that there are about 300 taxa in Korea, and Linnaeus [identified] the genus Cyperus ( Scirpus sp.), genus of sedges ( Cyperus sp.) and sedge genus ( CarexAlthough plants of the Cyperaceae family, which were classified as sp., are treated as weeds along with grasses, they are one of the developed plant groups possessing great species diversity in the history of plant evolution and are a major plant group forming grassland ecosystems. Accurate identification is difficult because the morphology of leaves and stems is similar between Cyperaceae and grasses, and the fruit ripening period—the most important trait for species classification—is short at 2 to 3 weeks, and the fruit falls off upon ripening, leaving only the leaves. Despite the diverse uses of Cyperaceae for medicinal and edible purposes, systematic research on the family is currently lacking globally. Therefore, in order to utilize Cyperaceae plants as biological resources, it is urgent to clarify their taxonomic status and identify their characteristics.
[0004] Meanwhile, Korean Registered Patent No. 2672563 contains 'Sedge family plant, Small Mokpo Sedge ( Carex brevispicula 'SNP marker composition for distinguishing ) and use thereof' is disclosed, and Korean Registered Patent No. 2672574 describes 'a sedge family plant, *Carex jindoensis* ( Carex taihokuensis Although 'SNP marker composition for distinguishing ) and use thereof' is disclosed, there is no description of the chloroplast genome sequence-based SNP marker composition for distinguishing sedge of the present invention and the use thereof. The problem to be solved
[0005] The present invention was derived from the above-mentioned requirements, and the inventors of the present invention (shade sedge) Carex lanceolata Based on the chloroplast genome of Boott) and the genus *Sedge* of the family Cyperaceae ( Carex SNP markers capable of distinguishing similar species were searched for, and a set of dCAPS (derived Cleaved Amplified Polymorphic Sequences) primers based on the searched SNP markers were constructed. In addition, the present invention was completed by confirming that the constructed dCAPS primer set can accurately distinguish sedge from similar species. means of solving the problem
[0006] To solve the above problem, the present invention relates to a shady sedge comprising a polynucleotide composed of eight or more consecutive nucleotides including a single nucleotide polymorphism (SNP) base located at the 31st position in the nucleotide sequence of SEQ ID NO. 1, or a polynucleotide complementary thereof. Carex lanceolata Boott provides a composition of an SNP marker for identification.
[0007] The present invention also provides a microarray for identifying shade sedges, comprising a polynucleotide composed of eight or more consecutive nucleotides including an SNP base located at the 31st position in the base sequence of SEQ ID NO. 1, or a cDNA thereof.
[0008] The present invention also provides a probe composition for identifying sedge, comprising a polynucleotide composed of eight or more consecutive nucleotides including an SNP base located at the 31st position in the base sequence of SEQ ID NO. 1, or the cDNA thereof.
[0009] The present invention also provides a dCAPS (derived cleaved amplified polymorphic sequence) primer set composition for identifying sedge, comprising the oligonucleotide primers of SEQ ID NOs. 2 and 3.
[0010] The present invention also provides a kit for identifying sedge, comprising a primer set composition according to the present invention and a reagent for performing an amplification reaction.
[0011] The present invention also provides a method for identifying sedges, comprising: a step of isolating genomic DNA from a sample of a Cyperaceae plant; a step of amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and a primer set composition according to the present invention; a step of cutting the product of the amplification step with a restriction enzyme; and a step of separating the cut products by size by gel electrophoresis. Effects of the invention
[0012] Although sedges are classified based on morphological characteristics, there is a high possibility of species identification errors due to morphological similarities. The SNP marker of the present invention can accurately distinguish sedges from similar species, thereby improving the accuracy of species identification for sedges that are difficult to distinguish morphologically. Furthermore, since it is based on chloroplast genome information, it is not affected by changes in the external environment, allowing for the maintenance of consistent reliability. Additionally, using the SNP marker of the present invention allows for rapid results while reducing costs and time through a simplified experimental process, making it a practical tool for protecting plant varieties and establishing a seed management system for sedges. Brief explanation of the drawing
[0013] FIG. 1 shows the PCR amplification products of eight species of Cyperaceae plants amplified with the primer sets of SEQ ID NOs. 2 and 3 of the present invention (Table 4) and restriction enzymes Xba These are the results of electrophoresis performed after treating (Cut) or not treating (Uncut) I. Lane 1: Sedge on the chin, Lane 2: Sedge on the chin, Lane 3: Sedge on the tangle, Lane 4: Sedge on the chin, Lane 5: Sedge on the large ridge, Lane 6: Sedge on the common sedge, Lane 7: Sedge on the hairy sedge, Lane 8: Sedge on the small sedge. Specific details for implementing the invention
[0014] To achieve the objective of the present invention, the present invention provides an SNP marker composition for identifying Carex lanceolata Boott, comprising a polynucleotide composed of eight or more consecutive nucleotides including a single nucleotide polymorphism (SNP) base located at the 31st position in the nucleotide sequence of SEQ ID NO. 1, or a polynucleotide complementary thereof.
[0015] In one embodiment of the present invention, the consecutive nucleotides may be 8 to 100 consecutive nucleotides, but are not limited thereto.
[0016] In this specification, the term 'nucleotide' is a deoxyribonucleotide or ribonucleotide existing in a single-stranded or double-stranded form, and includes analogs of natural nucleotides unless specifically otherwise noted.
[0017] In an SNP marker composition according to one embodiment of the present invention, the SNP position base is the 31st base in the base sequence of SEQ ID NO. 1, and the polymorphic base information is indicated by [ / ] in the SNP base sequence information of Table 3, and the base sequence of SEQ ID NO. 1 of the present invention refers to a sequence containing a base located before the diagonal line ( / ) in Table 3.
[0018] The fact that the SNP marker of the present invention can be used to distinguish Carex kobomugi is based on the fact that the 31st base, which is the SNP variant position in the nucleotide sequence indicated by SEQ ID NO. 1, appears differently as G or A. Regarding the nucleotide at the SNP position, if the 31st base in the nucleotide sequence of SEQ ID NO. 1 is G, it is Carex kobomugi, and if the 31st base is A, it is Carex kobomugi, a species similar to Carex kobomugi, Carex kobomugi ( Carex humilis var. nana (H.Lev. & Vaniot) Ohwi.), Jirisacho ( Carex okamotoi Ohwi.), Taraesachoo ( Carex maackii Maxim.), large sedge ( Carex humbertianaOhwi.), *Tongborisacho ( Carex kobomugi Ohwi), hairy sedge ( Carex ciliatomarginata Nakai.) or small sedge ( Carex pumila It can be determined by Thunb.)
[0019] The present invention relates to a base variation at an SNP position in the base sequence of SEQ ID NO. 1, but when such an SNP base variation is found in double-stranded gDNA (genomic DNA), it is interpreted to include a polynucleotide sequence complementary to the nucleotide sequence. Accordingly, the base at the SNP position in the complementary polynucleotide sequence also becomes a complementary base. In this regard, all sequences presented in this specification are based on sequences in the sense strand of genomic DNA unless otherwise noted.
[0020] The present invention also provides a microarray for identifying shade sedges, comprising a polynucleotide composed of eight or more consecutive nucleotides including an SNP base located at the 31st position in the base sequence of SEQ ID NO. 1, or a cDNA thereof.
[0021] Preferably, the polynucleotide may be immobilized on a substrate coated with an active group of amino-silane, poly L-lysine, or aldehyde, but is not limited thereto. Additionally, preferably, the substrate may be a silicon wafer, glass, quartz, metal, or plastic, but is not limited thereto. Methods for immobilizing the polynucleotide on the substrate may include micropipetting using a piezoelectric method, a method using a pin-shaped spotter, etc.
[0022] In this specification, the term "substrate" refers to any substrate to which a marker can be attached under conditions in which the background level of hybridization is maintained low and which possesses hybridization properties. Typically, the substrate may be a microtiter plate, a membrane (e.g., nylon or nitrocellulose), a microsphere (bead), or a chip. Before application to or immobilization on a membrane, the nucleic acid probe may be modified to promote immobilization or improve hybridization efficiency. Such modification may include homopolymer tailing, coupling with different reactive functional groups such as aliphatic groups, NH2 groups, SH groups, and carboxyl groups, or coupling with biotin, hapten, or protein.
[0023] The microarray according to the present invention can be manufactured by conventional methods known to those skilled in the art using the polynucleotide according to the present invention or its complementary polynucleotide, the polypeptide encoded by it, or its cDNA.
[0024] The present invention also provides a probe composition for identifying sedge, comprising a polynucleotide composed of eight or more consecutive nucleotides including an SNP base located at the 31st position in the base sequence of SEQ ID NO. 1, or the cDNA thereof.
[0025] In this specification, the term 'probe' refers to a hybridization probe comprising a natural or modified monomer or a linear oligomer having a bond, comprising a deoxyribonucleotide and a ribonucleotide, capable of sequence-specifically binding to the complementary strand of a nucleic acid. The probe of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species, so that it hybridizes to a DNA fragment derived from one member but not to a fragment derived from the other member. Preferably, the probe may be a single strand, more preferably a deoxyribonucleotide, for maximum efficiency in hybridization, but is not limited thereto.
[0026] In this specification, the term 'hybridization' means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur between two nucleic acid strands that are completely matched or substantially matched with some mismatch. The complementarity for hybridization may vary depending on the hybridization conditions, particularly temperature.
[0027] As a probe used in the present invention, a sequence that is perfectly complementary to the polynucleotide containing the SNP may be used, but a sequence that is substantially complementary may also be used to the extent that it does not interfere with specific hybridization. Preferably, the probe used in the present invention comprises a sequence that can hybridize to a sequence comprising 8 to 100 consecutive nucleotides, including the nucleotide at the 31st position of SEQ ID NO. 1, which is the SNP nucleotide. More preferably, the 3'-terminus or 5'-terminus of the probe has a base complementary to the SNP base. Generally, since the stability of a duplex formed by hybridization tends to be determined by the alignment of the terminal sequences, if the terminal portion of a probe having a base complementary to the SNP base at the 3'-terminus or 5'-terminus is not hybridized, such a duplex may be disassembled under strict conditions. Conditions suitable for hybridization can be determined by referring to what is commonly known in the art. The stringent conditions used for hybridization must be sufficiently strict to ensure hybridization to only one of the alleles, and can be determined by controlling factors such as temperature, ionic strength (buffer concentration), and the presence of compounds like organic solvents. These stringent conditions may be determined differently depending on the sequence being hybridized.
[0028] The present invention also provides a dCAPS (derived cleaved amplified polymorphic sequence) primer set composition for identifying sedge, comprising the oligonucleotide primers of SEQ ID NOs. 2 and 3.
[0029] The above primer set may include oligonucleotides composed of fragments of 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, or 19 or more consecutive nucleotides within the sequences of SEQ ID NOs. 2 and 3, depending on the sequence length of each primer set. For example, the primer of SEQ ID NO. 2 (22 oligonucleotides) may include oligonucleotides composed of fragments of 17 or more, 18 or more, 19 or more, 20 or more, or 21 or more consecutive nucleotides within the sequence of SEQ ID NO. 2. Additionally, the above primer may also include sequences with additions, deletions, or substitutions of the base sequences of SEQ ID NOs. 2 and 3. The oligonucleotide primer of SEQ ID NO. 2 of the present invention is a forward primer, and the oligonucleotide primer of SEQ ID NO. 3 is a reverse primer.
[0030] In this specification, the term 'primer' refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, which can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer must allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the complexity of the required DNA or RNA target, as well as primer usage conditions such as temperature and ionic strength.
[0031] In this specification, the oligonucleotide used as a primer may also comprise a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate, or a peptide nucleic acid, or may comprise an intercalating agent. Additionally, the primer may incorporate additional features that do not alter the basic properties of the primer acting as a starting point for DNA synthesis. If necessary, the primer nucleic acid sequence of the present invention may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Examples of labels include enzymes (e.g., HRP (horse radish peroxidase), alkaline phosphatase), radioisotopes (e.g., 32 There are P), fluorescent molecules, chemical groups (e.g., biotin), etc.
[0032] The appropriate length of the primer is determined by the characteristics of the primer to be used. The primer does not need to be exactly complementary to the template sequence, but must be complementary enough to form a hybrid complex with the template.
[0033] In the primer set composition according to the present invention, the primer set of SEQ ID NOs 2 and 3 is a dCAPS (derived Cleaved Amplified Polymorphic Sequences) primer set based on SNPs between the chloroplast genome sequences of Carex japonica, a plant of the sedge family, and Carex japonica-like species.
[0034] In the present invention, the term "dCAPS" refers to a PCR-based molecular marker technology for detecting SNPs or InDels (insertions / deletions). Since restriction enzyme recognition sites do not exist in the regions of SNPs or InDels between individuals, a restriction enzyme recognition site can be introduced by artificially inducing a single bp substitution. Detection is performed targeting genes known to have differences in base sequences between species, and only the corresponding genes within the species' genome are selected and amplified using the PCR method. In most markers, there is no difference in the length of the amplified gene between varieties, but since the internal sequences of the genes differ, a restriction enzyme that recognizes these sequence differences is selected and applied. It is possible to distinguish between species possessing DNA cut by restriction enzymes and species possessing DNA that is not cut, and the difference in length is easily detected by electrophoresis.
[0035] The above dCAPS markers can be designed with artificially engineered primers to distinguish changes in specific nucleotide sequences using restriction enzymes, and such primer sets are designed so that, depending on the SNPs of each species, the sequences of the PCR amplification products are divided into those containing restriction enzyme sites and those not. For example, in *Carex japonica*, the SNP nucleotide located at the 31st position in the nucleotide sequence of SEQ ID NO. 1 is G, whereas in a *Carex japonica*-like species, the SNP nucleotide located at the 31st position in the nucleotide sequence of SEQ ID NO. 1 is A; depending on these SNP positions, the PCR amplification product sequences of *Carex japonica* produced by the primer sets of SEQ ID NOs. 2 and 3 are restriction enzyme Xba Although they have restriction enzyme sites that can be cleaved by I, the PCR amplification products of sedge-like species are restriction enzymes Xba It does not have a restriction enzyme site that can be cleaved by I.
[0036] Therefore, restriction enzyme on the PCR product amplified with the primer set of SEQ ID NOs. 2 and 3 XbaWhen treated with I, the PCR amplification product of Carex kobomugi is cleaved by restriction enzymes, while the PCR amplification product of Carex kobomugi-like species is not cleaved, allowing the base type of the SNP possessed by each species to be analyzed by confirming the specific band size of the bands through electrophoresis of the products of each species. The dCAPS primer set and restriction enzyme information of the present invention are as described in Table 4 below.
[0037] In the present invention, the term "restriction enzyme" refers to a special enzyme as an endonuclease that identifies a specific base sequence of DNA and cleaves the double strand. In a specific embodiment of the present invention, PCR was performed based on a selected set of primers, purified using a PCR purification kit, and then treated within the active temperature using a restriction enzyme combined with the primers.
[0038] The present invention also provides a kit for identifying sedge, comprising a primer set composition according to the present invention and a reagent for performing an amplification reaction.
[0039] In the kit of the present invention, the primer set composition is as described above.
[0040] In the kit of the present invention, the reagent for performing the amplification reaction may include, but is not limited to, DNA polymerase, dNTPs, and a buffer.
[0041] In addition, the kit according to the present invention may additionally include a restriction enzyme when it includes the primer set of SEQ ID NOs. 2 and 3, and preferably the restriction enzyme Xba I may be additionally included, but is not specifically limited thereto.
[0042] The kit for identifying sedges of the present invention may also additionally include a user guide describing optimal reaction performance conditions. The guide is a printed document explaining how to use the kit, for example, the method for preparing PCR buffer, the presented reaction conditions, etc. The guide includes instructions in the form of a pamphlet or leaflet, a label attached to the kit, and on the surface of a package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media such as the Internet.
[0043] The present invention also provides a method for identifying sedges, comprising: a step of isolating genomic DNA from a sample of a Cyperaceae plant; a step of amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and a primer set composition according to the present invention; a step of cutting the product of the amplification step with a restriction enzyme; and a step of separating the cut products by size by gel electrophoresis.
[0044] In a method according to one embodiment of the present invention, the primer set composition is as described above.
[0045] In addition, in a method according to one embodiment of the present invention, the restriction enzyme Xba It may be I, but is not limited to this.
[0046] The method of the present invention comprises the step of isolating genomic DNA from a sedge plant sample. The method of isolating genomic DNA from the sedge plant sample may utilize methods known in the art, for example, the CTAB method, or the DNeasy Plant Mini kit (Quiagen), Exgene™ Plant SV (GeneAll), or Wizard prep kit (Promega). Using the isolated genomic DNA as a template, an amplification reaction may be performed using a primer set according to one embodiment of the present invention to amplify a target sequence. Methods for amplifying the target nucleic acid include polymerase chain reaction, ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, strand displacement amplification, or amplification via Qβ replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method that uses polymerase to amplify a target nucleic acid from a primer pair that specifically binds to the target nucleic acid. This PCR method is well known in the industry, and commercially available kits can also be used.
[0047] In a method according to one embodiment of the present invention, the sample of the sedge plant may be a seed, leaf, fruit, root, or stem of the plant, but is not limited thereto.
[0048] In a method according to one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling substance may be a substance that emits fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling substance may be FAM, HEX, VIC, JOE, ROX, TAMRA, Cy3, or Cy5, etc. When PCR is performed by labeling the 5' end of a primer with the labeling substance during the amplification of the target sequence, the target sequence may be labeled with a detectable fluorescent labeling substance. In addition, labeling using a radioactive substance when performing PCR 32 P or 35 When radioactive isotopes such as S are added to the PCR reaction solution, radioactivity is incorporated into the amplification product as it is synthesized, and the amplification product can be labeled as radioactive.
[0049] In one embodiment of the present invention, the method for identifying the sedge includes the step of detecting the amplification product, and the detection of the amplification product may be performed via a DNA chip, gel electrophoresis, capillary electrophoresis, radiometric measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting the amplification product, capillary electrophoresis may be performed. For example, an ABi Sequencer may be used for capillary electrophoresis. Additionally, gel electrophoresis may be performed, and depending on the size of the amplification product, agarose gel electrophoresis or acrylamide gel electrophoresis may be used. Additionally, for the fluorescence measurement method, when PCR is performed by labeling the 5'-terminus of a primer with Cy-5 or Cy-3, the target sequence is labeled with a detectable fluorescent labeling substance, and the fluorescence thus labeled can be measured using a fluorescence detector. Additionally, for the radiometric measurement method, when performing PCR 32 P or 35After labeling the amplification product by adding a radioactive isotope such as S to the PCR reaction solution, radioactivity can be measured using a radioactivity measuring instrument, for example, a Geiger counter or a liquid scintillation counter.
[0050] In the present invention, the electrophoresis method may use acrylamide gel electrophoresis or agarose gel electrophoresis depending on the size of the cleavage product resulting from restriction enzyme treatment, but is not limited thereto.
[0051] In a method according to one embodiment of the present invention, the primer set of SEQ ID NOs. 2 and 3 is designed such that the sequences of the PCR amplification products have restriction enzyme sites and do not have restriction enzyme sites depending on the SNP position bases. Specifically, the PCR amplification product sequence of Carex kobomugi is to cleave the PCR amplification product restriction enzymes that can Xba Although it has the recognition site for I, the PCR amplification product sequence of the sedge-like species is restriction enzyme Xba It does not have a recognition site for I. Therefore, when a restriction enzyme is applied to a PCR product amplified with the primer set of SEQ ID NOs. 2 and 3 and electrophoresis is performed, if bands of size 230 bp and 19 bp are detected, it can be identified as Carex kobomugi, and if a band of size 249 bp is detected, it can be identified as Carex kobomugi, Carex jiriensis, Carex tangledis, Carex magnifica, Carex tongborisi, Carex pilosa, or Carex jomborisis, which are similar species of Carex kobomugi.
[0053] The present invention will be explained in detail below through examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.
[0055] 1. Plant materials and DNA extraction
[0056] Genomic DNA was extracted from individuals germinated from seeds of eight sedge species (Carex japonica, Carex japonica, Carex jirisanensis, Carex tangled, Carex scaber, Carex turban, Carex pilosa, Carex hirsuta, and Carex pygmy) collected and held at the National Baekdudaegan Arboretum using the DNeasy® Plant Mini kit (Qiagen, Germany). Specifically, plant tissue (leaves) were ground, and 400 µl of Buffer AP1 and 4 µl of RNase (10 mg / µl) were added. Then, the mixture was incubated for 10 minutes in a temperature-controlled container set to 65°C, 130 µl of Buffer P3 was added, and the mixture was left in a freezer for 5 minutes. Afterward, the supernatant was obtained by centrifuging at 13,000 rpm for 5 minutes. The supernatant was transferred to a QIAshredder Spin Column and centrifuged at 13,000 rpm for 1 minute to obtain the supernatant, which was then transferred to a 1.5 ml tube. 1.5 times the amount of Buffer AP3 obtained was added and mixed thoroughly. The mixture was transferred to a DNeasy Mini Spin Column and centrifuged at 8,000 rpm for 1 minute, after which the solution collected in the collection tube was discarded. The column was washed once and twice, respectively, with washing buffers AW1 and AW2, and the collected solutions were discarded. DNA was then extracted by adding 80 µl of Buffer AE to the spin column transferred to a new tube.
[0058] 2. Library construction and data production for whole genome sequencing
[0059] The genomic DNA extracted above was quantified and its quality verified using electrophoresis on a 1.5% agarose gel, nanodrop, and Qubit. The recommended concentration of genomic DNA for library preparation for WGS analysis is at least 20 ng / µl based on nanodrop measurement, at least 10 ng / µl based on Qubit measurement, and a total volume of at least 30 µl.
[0060] Libraries for WGS analysis were prepared using the TruSeq DNA PCR-Free Library Prep Kit and the TruSeq Nano DNA prep kit (Illumina, USA) according to the manufacturer's instructions. Quality checks on the size of the templates inserted into the prepared libraries were performed using a TapeStation HS D1000Screen Tape (Agilent, USA), and the average inserted size ranged from 470 to 772 bp. Using a NovaSeq 6000 (Illumina Inc, USA), the data were read bidirectionally (2×151 bp paired-end) at 151 bp to produce 2.1 to 3.6 Gb of data for each tetragonal sample.
[0062] 3. Chloroplast genome assembly
[0063] The sequence pre-processing of short reads is Trimmomatic (v. 0.39) (Anthony M. Bolger et al The process was performed after removing adapter sequences and low-quality nucleotides with a phred score of 20 or less using Bioinformatics, 2014, 30(15), 2114-2120). Trimming and quality control (QC) were performed using the SLIDINGWINDOW, LEADING, and TRAILING options under the following conditions: 1) window size=4, mean quality≥15; 2) LEADING, TRAILING≥3; 3) minimum length of reads≥36 bp.
[0064] Chloroplast genome assembly is performed using the CLC Assembly Cell, which is currently considered to have high accuracy among assembly tools. Using a program without a reference genome sequence, narrow-leaved shade sedge de novoAssembly was performed. Using the NUCmer program (https: / / mummer.sourceforge.net / ), the final sequence of *Carex japonica* was completed by selecting contigs through comparison of organelle (chloroplast) sequences of closely related species registered in the NCBI GenBank. Genome sequence registered in the NCBI GenBank [ Carex siderosticta (ON920465), Carex alatauensis (NC_061251), Carex kokanica (NC_061253), Carex sargentiana (NC_061255), Carex myosuroides The gene regions of the chloroplast genome sequence were determined (chloroplast genome annotation) using the GeSeq program (https: / / chlorobox.mpimp-golm.mpg.de / geseq.html) by referring to [NC_063519] (Table 1). The results of the chloroplast genome annotation were visualized using ODGRAW tools and created as a chloroplast genome map.
[0065] chloroplast genome assembly results of Carex kobomugi (reference genome) Sample Total size(bp) GC(%) Total genes protein-coding genes tRNA genes rRNA genes narrow-leaved shade sedge 195,255 34.08 106 74 28 4
[0067] 4. WGS Analysis and SNP Discovery
[0068] 4-1. Sequence Pre-processing
[0069] The preprocessing of short reads of *Carex japonica* and other species was performed after removing adapter sequences and low-quality bases with a phred score of 20 or less using Trimmomatic (v. 0.39).
[0071] 4-2. Alignment to reference genome
[0072] Reads of Carex kobomugi and other species were mapped to the completed chloroplast genome of Carex kobomugi using the BWA program (https: / / bio-bwa.sourceforge.net / ). Filtering operations were performed on the mapped data, such as removing PCR duplicate reads and selecting only the best-hit read information.
[0074] 4-3. Variant Detection and Annotation
[0075] Variant calling was performed using the GTAK program (https: / / gatk.broadinstitute.org / hc / en-us), and a variant call file (vcf) format file was generated using the generated gvcf format file. Annotation for each variant was performed based on chloroplast genome annotation information using the SnpEff program (https: / / pcingola.github.io / SnpEff / ). Finally, variants that could be used as species identification markers were selected through variant filtering processes, such as removing multi-allele variants, depth filtering (5 <= DP), removing variants where all genotypes (GT) are identical within the species, and selecting only Homo variants.
[0077] 4-4. Selection of SNP Markers for Identification of Carex kobomugi
[0078] SNP markers capable of specifically distinguishing Carex kobomugi were selected, and the finally selected SNP markers were based on the chloroplast genome sequence of Carex kobomugi. matK It is located in the gene.
[0079] Information on SNP markers specific to sedges of the present invention, SNP flanking sequence information, and SNP-based dCAPS primer set information are shown in Tables 2 to 4, respectively.
[0080] SNP marker information for identifying Carex kobomugi Marker name Position(bp) ref. Shade sedge Other sedges Allele BD001705_VT_XbaI 2,734 A G A G / A
[0081] SNP flanking sequence information - SNP G: Carex - SNP A: Other sedges AAGGGACT GATCTTTTTATGAAGAAATTTA [ G / A ]CTTGTCTGTTTTTGGCAATATTATTTTCATTTTTGGTCTGAGCCTAATAGGTTTCATAGAAACCAATTCTCTTATTATTTGTTCTACTTTATCGGTTATTATATAAGTGTAAAAATAAATTACTTGGTGGTAAGGAGTCAAATACTAGAGGATTCTATATTAATAGATACTCTTATTAAGAGATTTGATACTTTAGT TCCAGTCCTTCCTCTCATTAGA (서열번호 1)
[0082] - Underlined and bold: SNP location bases
[0083] - Underline: Primer bonding location
[0084] SNP-based dCAPS primer set information No. Primer name Sequence (5'→3') (Sequence Number) Restriction enzyme 1 BD001705_VT_XbaI_F GATCTTTTTATGAAGAAATCTA (2) Xba I BD001705_VT_XbaI_R TCTAATGAGAGGAAGGACTGGA (3)
[0086] 5. Polymerase Chain Reaction (PCR) and Restriction Enzyme Treatment Using dCAPS Primer Set
[0087] After performing PCR using the dCAPS primer set of the present invention (Table 4), restriction enzyme on the PCR product Xba I processed I.
[0088] First, for PCR, a 90 µl PCR reaction mixture was prepared by mixing 30 ng of the extracted Cyperaceae plant genomic DNA, 3 µl of the dCAPS primer set (1.5 µl of 10 µM forward primer, 1.5 µl of reverse primer), 45 µl of PCR premix, and distilled water. The PCR process was performed under the following conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 53°C for 30 sec, and extension at 72°C for 1 min, repeated a total of 35 times; and final extension at 72°C for 10 min. Next, 50 ng of the PCR product, restriction enzyme XbaAfter reacting a 10 µl mixture of 2.5 U I, 1 µl buffer, and distilled water at 37°C for 24 hours, the restriction enzyme-treated PCR product was electrophoresed on a 1.7% agarose gel.
[0090] Example 1. Verification of the dCAPS primer set of the present invention for identifying sedges.
[0091] PCR was performed using the dCAPS primer set of the present invention (Table 4) with DNA samples of the sedge family plant Carex kaempferi and 7 similar species (Carex kaempferi, Carex jiriensis, Carex tangled, Carex magnifica, Carex tongborisi, Carex pilosa, Carex pyrifolia, Carex jomborifolia) as templates, and then the PCR amplification products were treated with restriction enzymes and electrophoresis was performed.
[0092] As a result, the PCR products of Carex kobomugi were cleaved into 230 bp and 19 bp fragments by restriction enzyme treatment, but the 19 bp fragment was too small to be seen with the naked eye and only the 230 bp fragment was confirmed, while the PCR products of 7 Carex kobomugi-like species were not cleaved by restriction enzyme treatment and a 249 bp band was confirmed (Fig. 1).
[0093] Through this, it was found that the SNP marker of the present invention and the dCAPS primer set produced based thereon can accurately distinguish sedge from its similar species.
Claims
Claim 1 A shady sedge comprising a polynucleotide consisting of eight or more consecutive nucleotides including a single nucleotide polymorphism (SNP) located at the 31st position in the nucleotide sequence of SEQ ID NO. 1, or a polynucleotide complementary thereof Carex lanceolata SNP marker composition for Boott identification. Claim 2 An SNP marker composition for identifying sedge, characterized in that, in claim 1, the consecutive nucleotides are 8 to 100 consecutive nucleotides. Claim 3 A microarray for identifying shady sedges, comprising a polynucleotide composed of eight or more consecutive nucleotides including the SNP base located at the 31st position in the base sequence of SEQ ID NO. 1, or the cDNA thereof. Claim 4 A probe composition for identifying sedge, comprising a polynucleotide composed of eight or more consecutive nucleotides including the SNP base located at the 31st position in the base sequence of SEQ ID NO. 1, or the cDNA thereof. Claim 5 A dCAPS (derived cleaved amplified polymorphic sequence) primer set composition for identifying sedge, comprising oligonucleotide primers of SEQ ID NOs. 2 and 3. Claim 6 A kit for identifying sedge, comprising a primer set composition according to paragraph 5 and a reagent for performing an amplification reaction. Claim 7 In claim 6, the reagent for performing the amplification reaction is a kit for identifying sedges comprising DNA polymerase, dNTPs, and a buffer. Claim 8 In paragraph 6, the above kit is a restriction enzyme Xba A kit for identifying shade sedges, characterized by additionally including I. Claim 9 A method for identifying sedges, comprising: a step of isolating genomic DNA from plant samples of sedges, sedges dendritic, sedges jirisanensis, sedges tangled, sedges large-leaved, sedges common indigo, sedges hairy indigoensis, and sedges small indigoensis; a step of amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and a primer set composition according to claim 5; a step of cutting the product of the amplification step with a restriction enzyme; and a step of separating the cut products by size by gel electrophoresis. Claim 10 In paragraph 9, the restriction enzyme is Xba A method for identifying shade sedges characterized by being I. Claim 11 In claim 9, the method wherein the amplification product amplified by the oligonucleotide primer set of SEQ ID NOs. 2 and 3 is a restriction enzyme Xba A method for identifying shade sedge characterized by identifying it as shade sedge when cut by I.
Citation Information
Patent Citations
Maker and primer set for discriminating panax ginseng chloroplast genome complete sequencing-based species and kit including same
KR101426466B1
SNP marker composition for discriminating Cyperaceae plant and uses thereof
KR1020240086797A
SNP marker composition for discriminating Cyperaceae plant 'Carex tristachya' and uses thereof
KR102672565B1
SNP marker composition for discriminating Cyperaceae plant 'Carex polyschoena' and uses thereof
KR102672571B1
SNP marker composition for discriminating Cyperaceae plant 'Carex alopecuroides' and uses thereof
KR102672572B1