miR-25802 MIMIC FOR USE IN THE TREATMENT OF ALZHEIMER'S DISEASE. COMPOSITION AND PRODUCTION OF SMALL EXTRACELLULAR VESICLES DERIVED FROM LOADED MILK. METHOD

Abstract

The invention relates to the field of biotechnological compounds used in the treatment of neurodegenerative diseases. In Alzheimer's disease, oxidative stress, mitochondrial dysfunction, and neuroinflammation are interconnected. These are the mechanisms that nourish; microRNAs can regulate these pathways simultaneously, but in their free state... It is broken down by ribonucleases and cannot cross the cell membrane. The invention solved this problem by sequentially extracting it from mammalian milk. small extracellular vesicles isolated by centrifugation, ultracentrifugation and size-reference chromatography, Synthetic miR-25802 mimic with SEQ ID NO:1 sequence in the presence of 0.15% to 0.25% by weight of saponin. It resolves through active loading. The loading process increases the average particle diameter of the vesicle and It does not change its hydrodynamic diameter; the mimic remains protected from ribonucleases within the vesicle lumen. The composition addresses amyloid-beta-induced oxidative stress, mitochondrial dysfunction, and neuroinflammatory disorders. The invention is used to reduce the response, synaptic protein loss, and tau hyperphosphorylation. The subject matter includes the in vitro production method of the compound.

Description

1 TARIFF miR-25802 MIMIC FOR USE IN THE TREATMENT OF ALZHEIMER'S DISEASE. COMPOSITION AND PRODUCTION OF SMALL EXTRACELLULAR VESICLES DERIVED FROM LOADED MILK. METHOD TECHNICAL FIELD The invention relates to the field of biotechnological compounds used in the treatment of neurodegenerative diseases. More specifically, the invention involves actively activating small extracellular vesicles (sEVs) isolated from mammalian milk. a synthetic microRNA-25802 (miR-25802) mimic loaded with Alzheimer's disease a compound formulated for use in treatment and produced using an in vitro method of that compound It is related. STATE OF THE ART Alzheimer's disease (AD) is caused by the accumulation of extracellular amyloid-beta (Aβ) plaques and intracellular neurofibrillary It is a progressive neurodegenerative disease characterized by the formation of tangles of protein aggregates. Its accumulation leads to neuroinflammation, increased oxidative stress, and mitochondrial damage; as a result of these Neuronal loss and cognitive impairment occur. Since these mechanisms form a mutually reinforcing network, a single factor leads to a pathological pathway. These substances are insufficient to stop the progression of the disease. MicroRNAs (miRNAs) simultaneously target numerous genes at the post-transcriptional level. They are short, non-coding RNA molecules that can regulate each other. Because of these characteristics, AH interacts with each other. as therapeutic candidates who can simultaneously intervene in related pathological pathways is being evaluated. However, the therapeutic use of miRNAs is limited by a significant transport problem: free miRNAs. They are rapidly degraded by ribonucleases, cannot cross the cell membrane due to their negative charge, and reach the target tissue. It cannot reach sufficient concentration. While synthetic nanocarriers partially solve this problem, they still present concerns such as immunogenicity, accumulation toxicity, and It has disadvantages in terms of production scalability. Extracellular vesicles are biocompatible carrier candidates because they are a natural medium of intercellular communication. In the current state of the technique, exosomes isolated from bovine milk are combined with synthetic miRNA mimics. It has been explained that it can be loaded and target gene editing can be achieved in this way (Del Pozo-Acebo et al., Int J Mol Sci, 2021, 22(3):1105). Active loading of extracellular vesicles by permeabilization with saponin is also a known aspect of the technique. This has been explained in the case of (Fuhrmann et al., J Control Release, 2015, 205:35-44). The same method It is also known to be used in neurodegenerative indications (Haney et al., J Control Release, 2015, 2 207:18-30). Conversely, saponin permeabilization was found to be ineffective in terms of miRNA loading. It has been reported. Abreu et al. (J Extracell Vesicles, 2021) compared various loading methods and In the case where saponin was applied, the miRNA signal largely remained in the supernatant; with this method... It was reported that the upload could not be completed. With regard to miR-25802, the state of the art suggests that this molecule plays a pathogenic role in Alzheimer's disease. It is suggested that it plays a role. Document number WO2024012600A1 describes the miR-25802 sequence and the inflammation associated with this sequence. It describes its use as a biomarker in related diseases; and as a therapeutic application. The topic suggests suppressing the molecule. Similarly, Zhao et al. (Brain Behav Immun, 2024) found miR-25802 in the plasma of AD patients. increased KLF4 suppression leads to pro-inflammatory microglial polarization via the NF-κB pathway. It opened and suppressed learning and memory with AAV9-mediated sponge in the 5xFAD mouse model. He reported that it improved his performance. Therefore, the current state of the art teaches how to reduce the miR-25802 level; this level It contains no explanation as to whether increasing it could provide therapeutic benefit. In conclusion, in the current state of the technique, a mimic that increases miR-25802 levels is a small amount of milk-derived mimic. delivery to neuronal cells via extracellular vesicles and thus Alzheimer's pathology There is no statement that teaches or recommends reducing it. PURPOSE AND BRIEF DESCRIPTION OF THE INVENTION The aim of the invention is to treat amyloid-beta-induced oxidative stress, mitochondrial dysfunction, and neuroinflammatory disorders. The response reduces synaptic protein loss and tau hyperphosphorylation simultaneously with a single compound, The goal is to provide a biocompatible and scalable therapeutic composition. Another aim of the invention is to enable the production of the compound in question without disrupting the integrity of the vesicle. The aim is to provide an in vitro method. The invention, contrary to the doctrine of the known state of the art, involves a mimic that increases the level of miR-25802 milk. When amyloid-beta is delivered to neuronal cells via small extracellular vesicles, it is produced from a specific source. It is based on determining that the resulting damage has been reduced. This unexpected effect stems from the fact that miR-25802 functions differently depending on the cell type. It is believed to originate from microglia. In the known state of the art, the described pathogenic effect is attributed to microglia. The protective effect observed within the scope of the invention is defined via cells and is at the intracellular level of neuronal cells. This is how it emerges. These two effects are not contradictory as they belong to different cellular contexts. The invention also describes small extracellular matrix (SCM) of milk origin with saponin concentrations ranging from 0.15% to 0.25% by weight. This is based on the determination that miRNA mimicry can be effectively loaded into vesicles. This result, Given the current state of the technique, which reports that saponin-based miRNA loading cannot be achieved, 35 3 It is unexpected. After the loading process, the average particle diameter and Z-mean hydrodynamic diameter of the vesicles were reduced. No statistically significant change occurs; mimicry, ribonuclease in the vesicle lumen. It is in a protected state. BRIEF DESCRIPTION OF THE FIGURES Figures 1 through 24 are graphs showing the results of the measurements made within the scope of the invention. Each graph shows... Groups compared on the horizontal axis are represented by reference markers (in Figure 2, the applied concentration is µg / mL). The measured value is shown numerically on the vertical axis (in terms of numerical value). The columns represent the average, Vertical lines represent the standard error of the mean, and circles represent individual measurement values. The measurement shown in the figure. Figure 1 Level of miR-25802 loaded into the vesicle (relative expression) Figure 2 Dose-dependent cell viability (%) Figure 3 ROS (%) Figure 4 LDH (ng / mL) Figure 5 SOD (ng / mL) Figure 6 MDA (ng / mL) Figure 7 GPX1 (ng / mL) Figure 8 BDNF (relative expression) Figure 9 ICAM1 (relative expression) Figure 10 TNF-α (relative expression) Figure 11 NfL (pg / mL) Figure 12 MIF (pg / mL) Figure 13 VEGF-A (pg / mL) Figure 14 MCP-1 (pg / mL) Figure 15 Cyt-c (pg / mL) Figure 16 TFAM (pg / mL) Figure 17 PINK1 (pg / mL) Figure 18 DNM1L (pg / mL) Figure 19 CPLX2 (ng / mL) Figure 20 ROR1 (ng / mL) Figure 21 Aβ1-40 (pg / mL) Figure 22 Total Tau (pg / mL) Figure 23 p-Tau181 (pg / mL) Figure 24 p-Tau217 (pg / mL) Reference markers 35 4 Signal Response 1 Control group 2 Amyloid-beta treated group 3. Group treated with amyloid-beta and uncharged vesicles 4. Group treated with amyloid-beta and miR-25802 loaded vesicles Uncharged vesicle preparation 6 miR-25802 loaded vesicle preparation DETAILED DESCRIPTION OF THE INVENTION Definitions Within the scope of this definition, the term "small extracellular vesicle" (sEV) refers to what is defined in the MISEV 2018 guidelines. classified, with an average particle diameter ranging from 30 to 200 nm, and containing CD9, CD63 and Flotillin-2. It refers to lipid bilayer vesicles that carry markers. The term "mimic" refers to a sequence of RNA that is identical to, or functionally equivalent to, the mature miRNA sequence and is transmitted to the cell. It refers to a synthetic double-stranded oligonucleotide that behaves like endogenous miRNA within it. This expression is the target. Molecules such as antagomirs, sponges, or antisense oligonucleotides that suppress miRNA function It does not include. The term "active loading" refers to the introduction of exogenous cargo through the temporary permeability of the vesicle membrane. It refers to the transfer of the substance into the lumen of the vesicle. Isolation of vesicles According to the invention, the vesicles were isolated from raw mammalian milk that had been confirmed to be sterile by microbiological tests. It is done. Cow's milk (Bos taurus) is used in the preferred practice. 1 mL of milk sample is centrifuged at 13,000 × g for 30 minutes at +4 °C, and cells and milk fat globules are obtained. is removed. The resulting supernatant was centrifuged at 35,000 × g for 60 minutes at +4 °C to separate casein and other large particles. Protein aggregates separate. The skimmed milk phase is ultracentrifuged at 100,000 × g for 105 minutes at +4 °C to obtain vesicle pellets. The supernatant is discarded. The pellet is resuspended in 25 mL of phosphate-buffered saline (PBS) and the second batch is prepared under the same conditions. It undergoes an ultracentrifugation step. The vesicle-enriched pellet is homogenized in 700 µL of PBS and 0.22 µm It is passed through a syringe filter with a certain pore size. 700 µL of filtered suspension was separated by size, pre-equilibrated with 10 mL of cold PBS. The sample is loaded onto a chromatography (SEC) column and eluted with 10 mL of PBS. The first 3 mL of eluate is discarded. The next 2 mL fractions are collected. The collected fractions were concentrated at 4,000 × g at 20 °C for 40 minutes to obtain a final volume of approximately 2 mL. is obtained. Active loading of facial expressions The loading step constitutes one of the distinctive technical features of the invention. In the preferred application, 200 µg vesicle protein in 1 mL 1× PBS, containing 1,000 µg synthetic miR-25802 with SEQ ID NO:1 sequence. It is incubated with 0.2% saponin by weight and its mimicry. Parameter Preferred value Operating range Vesicle protein content: 200 µg - 150-250 µg Facial expression amount: 1,000 µg - 800-1,200 µg Facial expression: protein ratio (a / a) 5:1 4:1 - 6:1 Saponin concentration is 0.2% by weight and 0.15%-0.25% by weight. Environment 1 mL 1× PBS - Mixing time: 10 seconds - 5-15 seconds The mixture is gently vortexed. Unloaded mimic and saponin are separated using a PD-10 size separation column. The vesicles are removed, and the initial 1.5 mL of eluate containing the vesicle fractions is collected. Control samples are prepared using the same steps but without the addition of facial expressions. Loading success is confirmed by RT-qPCR in conjunction with a ribonuclease protection assay. When ribonuclease is administered alone, miRNA levels are preserved, while ribonuclease and membrane disruptor levels are conserved. When the agent is administered concomitantly, the miRNA level decreases. This result indicates that miRNA penetrates the vesicle lumen. This indicates that it is present within it. The absolute copy number is calculated from the synthetic standard curve and It is expressed as copies per particle. Characterization Vesicles are classified according to MISEV 2018 criteria. Nanoparticle tracking analysis (NTA) is performed using a 488 nm laser. and in a system containing a high-sensitivity camera, it is done with a 1:500 dilution in serum-free PBS; 60 15 video recordings are taken, each lasting 15 seconds. In dynamic light scattering (DLS) measurements, samples are diluted 1:250 in 1 mL of 1× PBS, and 0.45 µm It is passed through a filter and measured at 25 °C. In transmission electron microscopy (TEM) imaging, the samples were found to be formvar / carbon coated copper. Apply to grills (10 µL per grill, 20 minutes), wash three times with PBS, 2.5% glutaraldehyde by weight. It is fixed in the solution for 10 minutes, washed with ultra-pure water, stained with 2% by weight uranyl acetate for 15 minutes, and It is dried at room temperature for 20 minutes. Imaging is performed at a 120 kV acceleration voltage. 35 6 Application examples Example 1 - Vesicle isolation and characterization TEM imaging of vesicles isolated using the protocol described above shows structural integrity. It has been determined that it is protected. Particle size and Z-mean hydrodynamic diameter in NTA and DLS measurements, It has been found to be compliant with the sEV class. Example 2 - Loading and vesicle integrity High throughput loading was confirmed by RT-qPCR. miR-25802 loaded vesicle. In the preparation (6), the relative miR-25802 level was measured as 2.51 ± 0.06, while in the uncharged vesicle preparation (5), No detectable levels of miR-25802 were found (n = 10; Mann-Whitney U test, p < 0.001) (Figure 1). After the loading process, the average particle diameter and Z-mean hydrodynamic diameter of the vesicles were reduced. No statistically significant change occurred (p > 0.05). This result indicates that the loading process affected the vesicle. This shows that it does not impair its physical properties. Example 3 - Comparative measurement of loading efficiency. Copy number per particle obtained under 0.2% by weight saponin conditions, electroporation, passive method. The values ​​were compared with those obtained under incubation and commercial transfection reagent conditions. Each condition... The ribonuclease protection rate and loading efficiency percentage were determined. Example 4 - Cytotoxicity and therapeutic window SH-SY5Y human neuroblastoma cells were inoculated into 96-well plates at a density of 1 × 10⁴ cells per well. Inoculated and loaded or unloaded vesicles at concentrations of 0; 0.5; 1; 2.5; 5 and 10 µg / mL were inoculated for 24 and 48 hours. The samples were treated. The MTT test was read at 540 nm, and each condition was evaluated in five replicates. The dose-response results obtained are given in the table below and in Figure 2 (n = 5 per dose). Comparisons were evaluated using one-way analysis of variance and Tukey post-hoc test, with the last column showing the values. The p-value of each dose is given relative to the control condition where no application was made. Concentration (µg / mL) Cell viability (%) p 0.0 98.34 ± 0.42 - 0.5 97.95 ± 0.38 1.000 1.0 96.60 ± 0.34 0.966 2.5 90.02 ± 1.24 0.010 5.0 87.43 ± 1.40 < 0.001 10.0 52.29 ± 3.25 < 0.001 Cell viability remained above 87% up to a concentration of 5 µg / mL; at a concentration of 10 µg / mL, it dropped to 52.29%. It showed significant cytotoxicity by dropping to levels below 0.5 and 1 µg / mL compared to the control condition. No significant difference was found; at concentrations of 2.5 and 5 µg / mL, viability was limited but not statistically significant. A detectable decrease has been observed. Accordingly, the usable concentration range within the scope of this invention is 0.5 to 5. 35 7 The concentration was determined as µg / mL, and in subsequent experiments, 5 µg / mL was applied. Example 5 - Disease model and experimental groups SH-SY5Y cells were placed in DMEM containing 10% fetal bovine serum and 1% penicillin-streptomycin by volume. Cultured in medium at 37 °C and 5% CO2 by volume. Amyloid-beta treatment for 48 hours. An in vitro Alzheimer's model was created by applying this method. Four experimental groups were compared: (i) control group, (ii) amyloid-beta administered group, (iii) amyloid-beta (iv) group treated with uncharged vesicles and group treated with amyloid-beta and miR-25802 loaded vesicles. Example 6 - Measured parameters and obtained effects In the table below, the numerical values ​​of the measurements shown in Figures 3 through 24 are expressed as mean ± mean. The standard error is given as (n = 7 in each group). These values ​​are presented in the figures in the initial application. The measurements shown are from previous experiments and do not represent a new experiment. The last column shows amyloid-beta. p-value of comparison between the group (2) and the group (4) in which miR-25802 loaded vesicle was applied It is located there. Parameter 1 2 3 4 p (2-4) ROS (%) 110.93 ± 9.07 577.25 ± 30.24 559.66 ± 35.93 143.92 ± 10.31 0.005 LDH (ng / mL) 4.11 ± 0.57 25.30 ± 1.83 25.76 ± 2.66 5.98 ± 1.15 0.004 SOD (ng / mL) 20.67 ± 3.02 3.12 ± 0.74 3.11 ± 0.80 11.81 ± 1.42 0.010 MDA (ng / mL) 65.02 ± 6.93 585.52 ± 33.56 578.82 ± 47.76 99.56 ± 15.56 0.006 GPX1 (ng / mL) 387.73 ± 33.84 30.70 ± 3.92 44.23 ± 6.86 290.28 ± 16.62 0.003 BDNF (relative) expression) 1.00 ± 0.04 0.29 ± 0.06 0.20 ± 0.05 1.01 ± 0.04 0.002 ICAM1 (relative expression) 0.93 ± 0.04 5.03 ± 0.48 5.11 ± 0.48 1.75 ± 0.15 0.019 TNF-α (relative expression) 0.91 ± 0.02 4.59 ± 0.53 4.88 ± 0.35 1.80 ± 0.13 0.024 NfL (pg / mL) 9.89 ± 2.17 207.76 ± 34.01 184.83 ± 30.80 22.21 ± 2.91 0.006 MIF (pg / mL) 125.45 ± 14.21 1019.40 ± 39.88 1033.88 ± 36.47 214.80 ± 19.04 0.019 VEGF-A (pg / mL) 108.89 ± 12.56 818.95 ± 35.25 788.00 ± 60.43 174.59 ± 15.35 0.010 MCP-1 (pg / mL) 38.72 ± 5.14 608.93 ± 43.09 578.67 ± 55.99 58.89 ± 9.26 0.004 Cyt-c (pg / mL) 3.57 ± 0.98 102.77 ± 9.56 114.11 ± 9.31 6.18 ± 0.81 0.010 TFAM (pg / mL) 21.74 ± 2.37 2.09 ± 0.24 2.08 ± 0.24 30.17 ± 3.36 < 0.001 PINK1 (pg / mL) 2.28 ± 0.31 36.54 ± 5.43 35.01 ± 4.76 3.12 ± 0.74 0.001 DNM1L (pg / mL) 4.50 ± 0.75 30.35 ± 4.82 30.85 ± 5.68 4.83 ± 0.68 0.003 CPLX2 (ng / mL) 19.86 ± 3.10 4.17 ± 0.74 3.33 ± 0.71 26.12 ± 2.74 0.002 ROR1 (ng / mL) 1.99 ± 0.34 15.60 ± 2.03 15.18 ± 2.56 3.21 ± 0.50 0.004 Aβ1-40 (pg / mL) 1.61 ± 0.16 12.76 ± 1.92 11.44 ± 2.37 1.62 ± 0.23 < 0.001 Total Tau (pg / mL) 34.17 ± 4.69 604.83 ± 37.31 515.35 ± 34.55 60.73 ± 8.01 0.003 35 8 Parameter 1 2 3 4 p (2-4) p-Tau181 (pg / mL) 16.45 ± 1.36 514.30 ± 35.11 461.69 ± 20.10 17.43 ± 1.60 < 0.001 p-Tau217 (pg / mL) 1.36 ± 0.17 22.17 ± 2.47 24.41 ± 2.04 2.29 ± 0.37 0.014 In the statistical evaluation, comparisons between groups were made using the Kruskal-Wallis test, and significant differences were found. Pairwise comparisons of the parameters found were evaluated using the Dunn post-hoc test. All Kruskal-Wallis test results showed a significant difference between groups in the parameters (p < 0.001). In all parameters, the group (4) that received miR-25802 loaded vesicle and the group (2) that received amyloid-beta The difference between them is statistically significant (p < 0.05). In contrast, group 4 and control group (1) No significant differences were found in any parameter between them (p > 0.05). This result indicates that the composition is amyloid-beta It shows that it has brought the resulting changes back to a control level. There was no difference in any parameter between the group (3) that received uncharged vesicles and the group (2) that received amyloid-beta. No statistically significant difference was found (p > 0.05). This comparison shows that the protective effect obtained... This indicates that it originates not from the carrier vesicle, but from the miR-25802 mimic loaded onto the vesicle. Example 7 - Comparative example Similar effects were observed in studies where a different microRNA mimic was loaded onto the same carrier system. This result demonstrates that the carrier system can work with different types of cargo, and the invention The feature for which protection is requested is the miR-25802 mimic with the sequence SEQ ID NO:1. It is the use of. Series information Sequence Number Description Length Sequence SEQ ID NO:1 miR-25802 mature sequence (RNA) 24 nt UCACGGAUACAGCCUCCUUUGGGA SEQ ID NO:2 miR-25802 precursor sequence (RNA) 64 nt UCACGGAUACAGCCUCCUUUGGGAUCCUGC UCUGUUCCCAUGAGACUGUAUCUGCCUGUG UCCA SEQ ID NO:3 miR-25802 forward primer (DNA) 24 nt TCACGGATACAGCCTCCTTTGGGA SEQ ID NO:4 U6 snRNA primer (DNA) 22 nt CGCAAGGATGACACGCAAATTC DISCLOSURE REGARDING GENETIC SOURCE (SMK Article 90 / 4) The small extracellular vesicles used in the invention were raw cow vesicles confirmed to be sterile by microbiological tests. It was isolated from the milk of (Bos taurus). This milk was the property of the inventors at the time the research was conducted. obtained from Atatürk University Farm (Erzurum, Türkiye), which is operated by the institution to which he belongs. The source was obtained within the borders of the Republic of Türkiye and belongs to a domestic farm animal. The invention is not based on any conventional knowledge related to genetic origin.

Claims

9 REQUESTS 1. A compound used in the treatment of Alzheimer's disease; its characteristic feature is that it is isolated from mammalian milk. small extracellular vesicles formed and actively loaded with SEQ into the lumen of these vesicles It contains a synthetic miR-25802 mimic with a mature sequence, indicated by ID NO:

1.

2. It is a compound according to claim 1, and its characteristic is that the small extracellular vesicles in question are from the cow (Bos taurus). It is isolated from milk.

3. A composition according to claim 1 or 2, characterized by the fact that the average particle diameter of the vesicles in question is between 30 and Located in the 200 nm range, and the vesicles in question contain CD9, CD63, and Flotillin-2 markers. It is transportation.

4. It is a combination according to any of the previous requests and its characteristic is that the miR-25802 mimic in question The ratio of vesicle protein to protein by weight should be between 4:1 and 6:1, preferably 5:

1.

5. A composition according to any of the previous requirements, characterized by the fact that the said expression contains 0.15% by weight. loaded by permeabilization in the range of 0.25%, preferably in the presence of 0.2% saponin by weight. It is the fact that.

6. It is a combination according to any of the previous requirements, and its characteristic is that the vesicle lumen of the mimic in question. It is found in a state protected from ribonucleases.

7. A composition according to any of the previous requirements, characterized by a vesicle protein concentration of 0.

5. The concentration should be between µg / mL and 5 µg / mL.

8. A compound that, according to any of the preceding claims, has the characteristic of being pharmaceutically acceptable. It contains a carrier, diluent, or auxiliary substance.

9. A compound according to any of the previous requirements, characterized by its amyloid-beta-derived oxidative properties. stress, mitochondrial dysfunction, neuroinflammatory response, synaptic protein loss, or tau Its purpose is to be used in reducing hyperphosphorylation.

10. According to Claim 1, a compound has an in vitro production method which includes the following steps: a) Mammalian milk is separated from cells, milk fat globules, and casein by successive centrifugation steps. purification, b) Obtaining vesicle pellets by ultracentrifugation of the resulting skimmed milk phase at 100,000 × g, c) the pellet in question is resuspended in phosphate-buffered brine for a second time. subjected to the ultracentrifugation step, d) Passing the resulting suspension through a filter with a pore diameter of 0.22 µm, e) Purification of the filtrate by size-restriction chromatography, f) Purified vesicles, synthetic miR-25802 mimic with SEQ ID NO:1 sequence and by weight Incubation in phosphate-buffered saline with 0.15% to 0.25% saponin, g) Removal of unloaded mimic and saponin by size separation column.

11. A method according to claim 10, the characteristic of which is; step (a) at +4 °C at 13,000 × g for 30 minutes and then performed at +4 °C at 35,000 × g for 60 minutes.

12. A method according to claim 10 or 11, with the characteristic of; per 200 µg vesicle protein in step (f). The process involves using 1,000 µg of mimic and stirring the mixture for 5 to 15 seconds.

13. A method according to any of claims 10 to 12, characterized by its loading efficiency, ribonuclease Using real-time quantifying polymerase chain reaction along with a conservation experiment and synthetic This is verified by calculating the absolute number of copies from the standard curve.

14. A method according to any of claims 10 to 13, characterized by the fact that vesicles are formed after loading. Statistically improved average particle diameter and Z-mean hydrodynamic diameter compared to pre-loading. The difference is that no significant change occurs.

15. According to claims 1 to 9, a compound of amyloid-beta is used in cultured neuronal cells. oxidative stress, mitochondrial dysfunction, or tau hyperphosphorylation caused by In vitro use for reduction.

Images