Immune-privileged nerve cell differentiated from induced pluripotent stem cell and use thereof

Abstract

Disclosed in the present invention are an immune-privileged nerve cell differentiated from an induced pluripotent stem cell and the use thereof. In the present invention, an induced pluripotent stem cell obtained by means of inactivating the major histocompatibility complex HLA-I and II genes and then overexpressing fusion protein XSG006 constructed from CD47 and CD24 functional domains is differentiated to obtain a separated dopaminergic neural precursor cell with low immunogenicity. The neural precursor cell can escape from T cell attacks, and further escape from NK cell and macrophage killings. The neural precursor cell also effectively escapes from the attack of immune system in vivo. In a Parkinson's disease mouse model and a Parkinson's disease non-human primate (NHP) model, the neural precursor cell can continuously survive and have activity for a long time in a host, and fundamentally reverse Parkinson's disease. The neural precursor cell provides an experimental basis and a theoretical basis for establishing a PD treatment strategy and designing a new stem cell therapeutic drug.

Description

Neural cells differentiated from immune-privileged induced pluripotent stem cells and their application

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to a prior application with patent application number 202310657355.7 filed with the State Intellectual Property Office of China on June 5, 2023, entitled “A neural cell differentiated from immune-privileged induced pluripotent stem cells and its application”. The full text of the prior application is incorporated into the present invention by reference. Technical Field

[0003] The present invention belongs to the intersection of genetic engineering and stem cell technology, and specifically relates to a neural cell differentiated from immune-immune induced pluripotent stem cells and its application. Background Art

[0004] Stem cells are a type of "seed" cell with the ability to self-renew and differentiate into specialized somatic cells. Based on the degree of differentiation within these characteristics, stem cells are primarily categorized as totipotent stem cells (totipotent stem cells), pluripotent stem cells (PSCs), and adult stem cells. Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) possess the potential for unlimited proliferation, self-renewal, and differentiation into various cell types, holding great promise for treating cancer, neurological, cardiovascular, and other related diseases.

[0005] Research in neuroscience and regenerative medicine is an important research field at the international forefront. Currently, there are no substantial clinical solutions for most aging-related degenerative diseases, and huge market demand has not yet been met. As China moves towards an aging society, research on neurodegenerative diseases is becoming increasingly important. Parkinson's disease (PD) is a serious neurodegenerative disease with an overall incidence second only to Alzheimer's disease (AD). The progressive loss of dopaminergic neurons in the substantia nigra of the midbrain is the main pathological feature of PD. Providing cell transplantation and allowing transplanted dopaminergic neurons (DAPs) to replace the lost dopaminergic neurons in the brain is considered an effective treatment for PD. Human pluripotent stem cells can efficiently differentiate into dopamine neural precursor cells in vitro and are therefore a suitable cell source for cell transplantation therapy to treat Parkinson's disease.

[0006] Through in vitro cell culture or induced differentiation of stem cells, healthy functional cells can be regenerated in large quantities in vitro, thereby treating major neurological diseases such as Parkinson's disease, spinal cord injury, and craniocerebral trauma through allogeneic functional cell transplantation. However, immune incompatibility and immune rejection of transplanted cells remain key obstacles to its clinical application. Autologous cell transplantation can circumvent the problem of immune rejection, but the process of autologous iPS cell differentiation therapy is cumbersome, expensive, and time-consuming, requiring patients to wait a long time before receiving treatment. Allogeneic iPS cell differentiation therapy also faces the problem of graft rejection by the immune system, and long-term use of immunosuppressants will have serious toxic side effects on patients.

[0007] Therefore, there is an urgent need to develop low-immunogenic iPS-derived cell-based drugs (i.e., universal iPS-derived cell-based drugs) that are independent of immunosuppressants to meet the cell needs of regenerative medicine.

[0008] Summary of the Invention

[0009] In response to the deficiencies in the prior art, the present invention successfully constructed B2M / CIITA biallelic knockout positive clones (DKO cells) by knocking out β-2-microglobulin (B2M) in the endoplasmic reticulum of induced pluripotent stem cells (iPSCs) and knocking out CIITA, a positive regulator of MHC-II gene transcription; then a lentiviral vector was used to overexpress a new gene based on the fusion of CD47 and CD24 domains in DKO cells. The induced pluripotent stem cells thus obtained can further escape the killing of NK cells on the basis of escaping T cell attack. The cells are differentiated to obtain isolated immune-privileged dopaminergic neurons. The dopaminergic neurons can significantly reduce or escape the recognition and attack of the immune system, especially the attack of natural killer cells, macrophages, etc., and effectively treat Parkinson's disease.

[0010] In order to achieve the above object, the present invention adopts the following technical solutions:

[0011] In a first aspect, the present invention provides an isolated low-immunogenic dopaminergic neural cell differentiated from an immunoprivileged induced pluripotent stem cell (i.e., a low-immunogenic iPS cell), comprising:

[0012] 1) Reduced or absent expression of HLA-I and HLA-II human leukocyte antigens;

[0013] 2) expressing a fusion protein constructed from the functional domains of CD47 and CD24;

[0014] The cells can escape T cell attack and NK cell killing.

[0015] In certain aspects, gene editing tools (such as TALEN and / or CRISPR systems) are used in the immune privileged induced pluripotent stem cells to target one or more genes encoding one or more transcriptional regulators of HLA-I, and one or more genes encoding one or more transcriptional regulators of HLA-II, to achieve reduced or no expression of HLA-I and HLA-II genes.

[0016] In certain embodiments, to achieve reduced or no expression of HLA-I and HLA-II genes, the HLA-I transcriptional regulatory factor may preferably be selected from: one or more of B2M, TAP1, TAP2, TAP-associated glycoprotein (Tapasin), or NLRC5; the HLA-II transcriptional regulatory factor may preferably be selected from: one or more of CIITA, RFXANK, RFX5, and RFXAP;

[0017] According to the present invention, the transcriptional regulatory factors are preferably B2M and CIITA.

[0018] In certain embodiments, the immunoprivileged induced pluripotent stem cells further comprise a genetic modification targeting the CIITA gene by a rare-cutting endonuclease that selectively inactivates the CIITA gene.

[0019] In certain embodiments, the immunoprivileged induced pluripotent stem cells further comprise a genetic modification targeting the B2M gene by a rare-cutting endonuclease that selectively inactivates the B2M gene.

[0020] In certain embodiments, the genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one guide RNA sequence for specifically targeting the CIITA gene or the B2M gene.

[0021] In a specific embodiment, the CRISPR / CAS9 system is used to directly knock out the B2M and CIITA exon segments at both ends, respectively, wherein the target sequences of the gRNA for the B2M gene are SEQ ID NO: 2 and SEQ ID NO: 3, and the target sequences of the gRNA for the CIITA gene are SEQ ID NO: 4 and SEQ ID NO: 5.

[0022] In certain aspects, the immunoprivileged induced pluripotent stem cells achieve reduced or no expression of HLA-I and / or HLA-II genes by introducing gene expression modifying molecules targeting one or more genes encoding one or more transcriptional regulators of HLA-I, or one or more genes encoding one or more transcriptional regulators of HLA-II, wherein the gene expression modifying molecules comprise one selected from siRNA, shRNA, microRNA, antisense RNA, and another RNA-mediated inhibitory molecule.

[0023] In certain aspects, the functional domain of CD47 in the fusion protein comprising the functional domains of CD47 and CD24 is the CD47 transmembrane domain; preferably, the amino acid sequence of the CD47 transmembrane domain is as shown in any one of SEQ ID NOs: 6-10.

[0024] In certain aspects, the functional domain of CD24 in the fusion protein comprising the functional domains of CD47 and CD24 is the signal peptide sequence of CD24, the mature peptide of CD24, the extracellular peptide of CD24, the membrane anchor sequence of CD24, and the extracellular mature peptide of CD24; preferably, the amino acid sequence of the functional domain of CD24 is as shown in any one of SEQ ID NOs: 11-16.

[0025] In certain embodiments, the fusion protein constructed by the functional domains of CD47 and CD24 is a protein that connects the CD47 SIRPα binding domain and the membrane anchoring sequence of CD24.

[0026] In certain embodiments, the fusion protein constructed by the functional domains of CD47 and CD24 is a protein in which the SIRPα binding domain of CD47 is inserted into the linking site of the extracellular peptide and membrane anchor sequence of CD24.

[0027] In certain embodiments, the fusion protein constructed by the functional domains of CD47 and CD24 is obtained by linking CD47 to the extracellular peptide of CD24.

[0028] In certain embodiments, the fusion protein constructed by the functional domains of CD47 and CD24 is obtained by linking the CD24 mature peptide to the SIRPα binding domain of CD47.

[0029] In certain embodiments, the fusion protein constructed by the functional domains of CD47 and CD24 is a protein in which the extracellular mature peptide of CD24 is inserted into the SIRPα binding domain and the transmembrane domain connection point of CD47.

[0030] In certain embodiments, the fusion protein constructed by the functional domains of CD47 and CD24 is a fusion protein that connects the mature peptide sequence of CD24 and the transmembrane domain of CD47;

[0031] Preferably, the amino acid sequence of the fusion protein constructed by the functional domains of CD47 and CD24 has a homology of more than 70% with the sequence shown in SEQ ID NO: 1, such as more than 80% homology, and further such as more than 90%, more than 95%, or more than 98% homology;

[0032] Further preferably, the amino acid sequence of the fusion protein constructed by the functional domains of CD47 and CD24 is as shown in SEQ ID NO: 1.

[0033] In a specific embodiment, the increased expression of the fusion protein constructed with the functional domains of CD47 and CD24 is produced by introducing at least one copy of the fusion protein gene into the iPSC under the control of a promoter in the immune privileged induced pluripotent stem cells.

[0034] In certain aspects, the nucleic acid sequence encoding the fusion protein constructed by the functional domains of CD47 and CD24 can be obtained based on the amino acid sequence of the fusion protein.

[0035] In certain aspects, the isolated low immunogenic dopaminergic neural cells are selected from dopaminergic neural precursor cells, dopaminergic neural progenitor cells, immature dopaminergic neural cells and mature dopaminergic neural cells; preferably, they are dopaminergic neural precursor cells.

[0036] In a second aspect, the present invention provides a method for differentiating the isolated low-immunogenic dopaminergic neural cells of the first aspect from immunoprivileged induced pluripotent stem cells by in vitro differentiation, wherein endogenous beta-2 microglobulin (B2M) gene activity and endogenous class II transactivator (CIITA) gene activity have been eliminated in the immunoprivileged iPSC cells; and a fusion protein constructed from the functional domains of CD47 and CD24 is expressed; preferably, the amino acid sequence of the fusion protein constructed from the functional domains of CD47 and CD24 has greater than 70% homology to the sequence shown in SEQ ID NO: 1, for example, greater than 80% homology, further for example, greater than 90%, greater than 95%, or greater than 98% homology; further preferably, the amino acid sequence of the fusion protein constructed from the functional domains of CD47 and CD24 is as shown in SEQ ID NO: 1;

[0037] The method comprises:

[0038] Differentiation of immunoprivileged induced pluripotent stem cells into hypoimmunogenic dopaminergic neural precursor cells:

[0039] (1) Culture of immune-privileged induced pluripotent stem cells:

[0040] Immunoprivileged induced pluripotent stem cells were plated in clumps on a pre-laminin-coated matrix at a density of approximately 100,000 per well and cultured in E8 complete medium. The cells were digested and passaged every 4-5 days during the culture process.

[0041] (2) Differentiation of low-immunogenic dopaminergic neural precursor cells:

[0042] S1: One day before differentiation, immunoprivileged induced pluripotent stem cells with a confluence of about 70% to 80% were digested into single cells using TrypLE enzyme and the cells were centrifuged at 8000 / cm 2 The cells were seeded at a density of 100 μg / cm2 into 6-well plates pre-coated with Vitronectin (Gibco) in a complete StemFit medium supplemented with 10 μM Y27632 to promote stem cell survival.

[0043] S2: After the cells have grown for 24 h, the medium is replaced with the first medium, which is designated as day 0 of differentiation, called D0. The cells are cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for 8 days, with the medium changed every two days.

[0044] S3: On day 9 of differentiation, cells were digested with Accutase (Innovative) and resuspended in the second culture medium. 15 million cells were seeded into a T75 suspension culture flask, shaken evenly, and cultured in a 37°C, 5% CO2 cell culture incubator for 2 days to allow the cells to spontaneously form neurospheres in suspension, thus obtaining midbrain floor plate cells.

[0045] S4: On the 11th day of differentiation, the culture medium was replaced with the third culture medium, and the cells were cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for 5 days, with the medium changed every 2.5 days to obtain dopaminergic neural progenitor cells;

[0046] S5: On the 16th day of differentiation, the culture medium was replaced with the fourth culture medium, and 5 million neurosphere cells were attached to the wall and attached to T75 culture flasks pre-coated with Vitrovectin (Gibco) for further culture. The cells were cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for 7 days, with the medium changed every 2.5 days.

[0047] S6: On day 23 of differentiation, cells were digested with Accutase (Innovative) and resuspended in the fifth culture medium. 15 million cells were seeded into a T75 suspension culture flask, shaken evenly, and cultured in a 37°C, 5% CO2 cell culture incubator for one day to allow the cells to spontaneously form neurospheres in suspension, thereby obtaining dopaminergic neural precursor cells (DAP cells).

[0048] The first culture medium is a neurobasal medium containing 1 μM-20 μM SB431542, 1 μM-3 μM DMH1, 0.2 μM-1 μM CHIR99021, and 1 μM-1.75 μM SAG;

[0049] Preferably, the first culture medium is a neurobasal medium containing 10 μM SB431542, 2 μM DMH1, 0.6 μM CHIR99021 and 1 μM SAG;

[0050] The second medium is neurobasal medium containing 5 μM-15 μM Y27632, 1 μM-20 μM SB431542, 1-3 μM DMH1, 0.2 μM-1 μM CHIR99021, and 1 μM-1.75 μM SAG;

[0051] Preferably, the second culture medium is a neurobasal medium containing 10 μM Y27632, 10 μM SB431542, 2 μM DMH1, 0.6 μM CHIR99021 and 1 μM SAG;

[0052] The third culture medium is a neurobasal medium containing 0.8 μM-1.2 μM DMH1, 0.1 μM-0.5 μM SAG, and 80 ng / mL-120 ng / mL fibroblast growth factor 8b (FGF8b);

[0053] Preferably, the third culture medium is a neurobasal medium containing 1 μM DMH1, 0.2 μM SAG and 100 ng / mL fibroblast growth factor 8b (FGF8b);

[0054] The fourth culture medium is neurobasal medium containing 0.1 μM-0.5 μM SAG and 80 ng / mL-120 ng / mL FGF8b;

[0055] Preferably, the fourth culture medium is a neurobasal medium containing 0.2 μM SAG and 100 ng / mL FGF8b;

[0056] The fifth culture medium is neurobasal medium containing 5 μM-15 μM Y27632, 0.1 μM-0.5 μM SAG, and 80 ng / mL-120 ng / mL FGF8b;

[0057] Preferably, the fifth culture medium is a neurobasal medium containing 10 μM Y27632, 0.2 μM SAG and 100 ng / mL FGF8b;

[0058] The neurobasal culture medium is selected from at least one of IMDM (Iscove's Modified Dulbecco's Medium) culture medium, Eagle's Basal Medium (BME) culture medium, GMEM culture medium, MEM culture medium, DMEM culture medium, Ham's F-12 culture medium, RPMI1640 culture medium, and Neurobasal culture medium.

[0059] Preferably, the neurobasal medium consists of the following components: 98% (v / v) DMEM / F12 (Gibco), 1% (v / v) non-essential amino acids (Non-essential amino acid, Gibco) and 1% (v / v) N2 supplement (N2 supplement, Gibco).

[0060] In a third aspect, the present invention provides a composition comprising the isolated low immunogenic dopaminergic nerve cells according to the first aspect or the isolated low immunogenic dopaminergic nerve cells prepared according to the method of the second aspect.

[0061] In certain aspects, the composition comprises the isolated low-immunogenic dopaminergic neural cells of the first aspect and one or more therapeutic agents, wherein the therapeutic agents include peptides, cytokines, small molecule compounds, macromolecules, ADCs, antibodies, nanoparticles, biosimilars, mRNA, traditional Chinese medicine, proteins, vaccines, checkpoint inhibitors, mitogens, growth factors, small RNAs, double-stranded RNA (dsRNA), mononuclear blood cells, feeder cells, feeder cell components or replacement factors thereof, vectors comprising one or more polynucleic acids of interest, antibodies, and the like.

[0062] In a fourth aspect, the present invention provides a method for treating a patient suffering from a neurodegenerative disease or condition, the method comprising administering a therapeutically effective amount of the isolated low immunogenic dopaminergic neural cells of the first aspect of the present invention, or the isolated low immunogenic dopaminergic neural cells prepared according to the method of the second aspect, or the composition of the third aspect.

[0063] In certain aspects, the method, wherein the composition further comprises a therapeutically effective carrier.

[0064] In certain aspects, the method, wherein the isolated hypoimmunogenic dopaminergic neural cells are on a biodegradable scaffold.

[0065] In certain aspects, the method, wherein the administering comprises implantation or injection.

[0066] In certain aspects, the method, wherein the neurodegenerative disease or condition is selected from Parkinson's disease, Huntington's disease, and multiple sclerosis.

[0067] In a fifth aspect, the present invention provides the use of the isolated low immunogenic dopaminergic nerve cells described in the first aspect, or the isolated low immunogenic dopaminergic nerve cells prepared according to the method of the second aspect, or the composition described in the third aspect in the preparation of a product for the treatment of neurodegenerative diseases or conditions.

[0068] In certain aspects, the use, wherein the neurodegenerative disease or condition is selected from Parkinson's disease, Huntington's disease and multiple sclerosis; preferably Parkinson's disease.

[0069] Beneficial effects of the present invention:

[0070] 1. The present invention inactivates the major histocompatibility complex (MHC) class I and II genes in induced pluripotent stem cells and then overexpresses the fusion protein XSG006 constructed from the functional domains of CD47 and CD24. The obtained induced pluripotent stem cells are differentiated to obtain isolated low-immunogenic dopaminergic neural precursor cells, which can further escape the killing of NK cells and macrophages on the basis of escaping T cell attack.

[0071] 2. The low-immunogenicity dopaminergic neural precursor cells isolated by the present invention can effectively escape the attack of the immune system in vivo (humanized mice and non-human primates). In a mouse Parkinson's disease model, the low-immunogenicity dopaminergic neural precursor cells isolated by the present invention were transplanted. The test results after 4 months showed that the number of mouse rotations in the apomorphine (APO)-induced rotation experiment was significantly reduced, and it was statistically significant; in the cylinder experiment, the number of times the mouse's right forelimb hit the wall was significantly increased, basically restored to the level before modeling, and it was statistically significant; in the rotating rod experiment, the time the mouse stayed on the rotating rod was significantly increased, and it was statistically significant. In the results of immunofluorescence staining of frozen sections of brain tissue, a large number of transplanted cells survived in the transplantation site and a certain number differentiated into dopaminergic neurons. Transplantation of DAP injection can significantly improve the Parkinson's disease behavior of mice and can fundamentally promote the differentiation of transplanted cells in the striatum to generate dopaminergic neurons to fundamentally reverse Parkinson's disease.

[0072] 3. In the non-human primate (NHP) Parkinson's disease model, the monkey low-immunogenic dopaminergic neural precursor cells isolated by the present invention can survive and produce activity in the host body for a long time.

[0073] 4. Allogeneic DAP cell transplantation was performed on non-human primates (NHP) with a complete immune system. Compared with monkey WT-DAP cells, which have a short survival period in monkeys and quickly disappear due to rejection reactions, monkey DKO+G6-DAP cells have low immunity and can escape the attack of the immune system, and survive for a long time in the brains of allogeneic monkeys with a complete immune system. In vivo safety testing showed that low-immunogenic dopaminergic neural precursor cells (DKO+G6-DAP) have no difference in proliferation ability compared with unedited cells (WT-DAP), and both contain very small amounts of Ki67, indicating a low risk of tumorigenesis in vivo. Moreover, low-immunogenic DAP cells can differentiate into TH+, i.e., functional dopaminergic neurons in vivo. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1. Schematic diagram of the CRISPR / CAS9 gene knockout strategy for B2M.

[0075] Figure 2. Schematic diagram of CIITA's CRISPR / CAS9 gene knockout strategy.

[0076] Figure 3. Schematic diagram of the structure of the pGC-EF1a plasmid.

[0077] Figure 4 is a graph showing the expression of OCT-4 in various DAP cells detected by flow cytometry in Example 1;

[0078] Figure 5. Expression of FOXA2, PAX6, OTX2, and LMX1A in various DAP cells detected by flow cytometry in Example 1;

[0079] Figure 6. Immunofluorescence detection of the expression of OTX2, EN1, LMX1A and FOXA2 in various DAP cells in Example 1;

[0080] FIG7 is a graph showing the expression of HLA-I / II in various cells detected by flow cytometry after stimulating DAP cells with INF-gamma in Example 1;

[0081] Figure 8. Sequential RT-PCR identification of the DKO+G6 cell line constructed in Example 1 and its derived DAP cells.

[0082] Among them, T cells serve as a positive control for detecting HLA class I / II molecules;

[0083] FIG9 is a graph showing the results of RTCA detection of PBNK cells killing DAP cells differentiated from WT, DKO, and DKO+G6 in Example 2;

[0084] Figure 10 shows photos of MAC killing of WT, DKO, and DKO+G6 differentiated DAP cells in Example 2;

[0085] FIG11 is a graph showing the results of using RTCA to detect the killing effect of MAC cells on WT, DKO, and DKO+G6 differentiated DAP cells in Example 2;

[0086] FIG12 is a diagram showing the results of validating the immune escape effect of DAP cells differentiated from DKO+G6 in mice with human immune system in Example 2;

[0087] FIG13 shows the results of apomorphine (APO)-induced rotation experiment in the PD mouse model after transplantation of WT-DAP injection in Example 3;

[0088] Figure 14. Cylinder test results after WT-DAP injection in the PD mouse model of Example 3;

[0089] Figure 15. Rotarod test results of the PD mouse model after transplantation of WT-DAP injection in Example 3;

[0090] Figure 16 shows immunofluorescence staining results of brain sections of PD mice transplanted with cells 4 months after the cell transplantation in Example 3;

[0091] 16B is a 4x, 20x, and 60x magnification of the cut portion in 16A.

[0092] Figure 17. PET-CT results after the successful establishment of the PD monkey model in Example 4.

[0093] FIG18 is a graph showing the expression of OTX2, EN1, LMX1A and FOXA2 in DAP cells derived from various monkey stem cells detected by immunofluorescence in Example 4;

[0094] Figure 19 shows MRI results of monkey brains before and after transplantation of WT-DAP (left brain) and DKO+G6-DAP (right brain) cells in Example 4;

[0095] Figure 20. Statistical graph of the left and right food intake rate of PD monkeys before and after WT-DAP and DKO+G6-DAP cell transplantation in Example 4;

[0096] Figure 21. Schematic diagram of WT-DAP and DKO+G6-DAP cell transplantation in Example 5 and MRI results of monkey brain before and after transplantation (A); MRI statistical diagram of cell size (B).

[0097] Figure 22. Immunofluorescence staining of mouse brain in Example 5 (A), co-staining of hNA (red), Ki67 (green), and DAPI (blue), where hNA stains transplanted cells and Ki67 marks proliferating cells; statistics of immunofluorescence staining (B).

[0098] FIG23 : The results of brain immunofluorescence staining after PD-NOG transplantation of DKO+G6-DAP cells in Example 5. DETAILED DESCRIPTION

[0099] The technical solutions of the present invention will be described in further detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are encompassed within the scope of protection that the present invention is intended to protect.

[0100] Unless otherwise indicated, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods. Experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0101] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0102] A detailed description of immune-privileged pluripotent stem cells, methods for their production and methods for their use are found in 202210806871.7 filed on July 8, 2022 and PCT / CN2023 / 083761 filed on March 24, 2023, and the disclosures including the sequence listing, figures and examples are incorporated herein by reference in their entirety.

[0103] definition

[0104] The term "pluripotent cell" refers to a cell that can self-renew and proliferate while maintaining an undifferentiated state and can be induced to differentiate into a specialized cell type under appropriate conditions. As used herein, the term "pluripotent cell" encompasses embryonic stem cells and other types of stem cells, including fetal, amniotic or somatic stem cells. Exemplary human stem cell lines include the H9 human embryonic stem cell line. Other exemplary stem cell lines include those available through the National Institutes of Health Human Embryonic Stem Cell Registry and the Howard Hughes Medical Institute HUES collection (described in Cowan, CA et al., New England J. Med. 350: 13. (2004), which are incorporated herein by reference in their entirety)

[0105] As used herein, "pluripotent stem cells" have the potential to differentiate into any of the three germ layers: endoderm (e.g., gastric junction, gastrointestinal tract, lung, etc.), mesoderm (e.g., muscle, bone, blood, urogenital tissue, etc.), or ectoderm (e.g., epidermal tissue and nervous system tissue). As used herein, the term "pluripotent stem cell" also encompasses "induced pluripotent stem cells" or "iPSCs," which are pluripotent stem cells derived from non-pluripotent cells. Examples of parental cells include somatic cells that have been reprogrammed to induce a pluripotent, undifferentiated phenotype by various means. Such "iPS" or "iPSC" cells can be produced by inducing the expression of certain regulatory genes or by exogenous application of certain proteins. Methods of inducing iPS cells are known in the art and are further described below. (See, e.g., Zhou et al., Stem Cells 27(11):2667-74 (2009); Huangfu et al., Nature Biotechnol. 26(7):795 (2008); Woltjen et al., Nature 458(7239):766-770 (2009); and Zhou et al., Cell Stem Cell 8:381-384 (2009); each of which is herein incorporated by reference in its entirety).

[0106] As used herein, the term "subject" or "patient" refers to any animal, such as a domestic animal, a zoo animal, or a human. A "subject" or "patient" can be a mammal, such as a dog, a cat, a bird, a livestock animal, or a human. Specific examples of "subjects" and "patients" include, but are not limited to, individuals (particularly humans) suffering from diseases or conditions related to the liver, heart, lungs, kidneys, pancreas, brain, nervous tissue, blood, bones, bone marrow, and the like.

[0107] In this article, "immune privileged induced pluripotent stem cells" refer to pluripotent cells that retain their pluripotent characteristics and cause a reduced immune rejection reaction when transferred into an allogeneic host. In a preferred embodiment, the cells do not cause an immune response. Therefore, "immune privileged" refers to an immune response that is significantly reduced or eliminated compared to the immune response of the parental (i.e., "wild type" or "wt") cells before the immune engineering outlined herein. In many cases, the cells are immunologically low immunogenic, but still retain pluripotency and differentiation potential.

[0108] The "HLA" or "human leukocyte antigen" complex is a gene complex that encodes the major histocompatibility complex (MHC) proteins in humans. These cell surface proteins that make up the HLA complex are responsible for regulating the immune response to antigens. In humans, there are two types of MHC, class I and class II, "HLA-I" and "HLA-II." HLA-I includes three proteins, HLA-A, HLA-B, and HLA-C, which present peptides from the inside of the cell, while the antigens presented by the HLA-I complex attract killer T cells (also known as CD8+ T- cells or cytotoxic T cells). HLA-I proteins are associated with beta-2 microglobulin (B2M). HLA-II includes five proteins, HLA-DP, HLA-DM, HLA-DOB, HLA-DQ, and HLA-DR, which present antigens from the outside of the cell to T lymphocytes. This stimulates CD4+ cells (also known as T helper cells). It should be understood that the use of "MHC" or "HLA" is not meant to be limiting, as it depends on whether the gene is from human (HLA) or mouse (MHC). Therefore, as it relates to mammalian cells, these terms can be used interchangeably herein.

[0109] Herein, "CD47," also referred to as integrin-associated protein (IAP), is widely expressed on the surface of various cells. It interacts with signal regulatory protein α (SIRPα) and thrombospondin-1 (TSP-1), playing a crucial role in mediating oxidative stress responses and immune repair in certain cardiovascular diseases. As a member of the immunoglobulin superfamily of membrane proteins, CD47 consists of three components: an amino-terminal extracellular immunoglobulin variable (IgV)-like domain, a five-domain transmembrane region, and a carboxy-terminal splice variant cytoplasmic tail.

[0110] In this article, "CD24" stands for cluster of differentiation 24, also known as heat-stable antigen. It is a highly glycosylated glycosylphosphatidylinositol-anchored surface protein that is known to interact with Siglec-10 (sialic-acid-binding Ig-like lectin 10) on innate immune cells to inhibit destructive inflammatory responses in response to infection, sepsis, liver injury and chronic graft-versus-host disease. CD24 is a small molecular weight sialoglycoprotein composed of 31 amino acids with a typical mucin structure. It is located in lipid rafts through its glycosylated phosphatidylinositol (GPI) anchor.

[0111] As used herein, "gene knockout" refers to the process of inactivating a specific gene in the host cell in which it resides, resulting in the non-production of the protein of interest or the formation of an inactivated form. As will be appreciated by those skilled in the art and described further below, this can be accomplished in many different ways, including removing a nucleic acid sequence from the gene, interrupting the sequence with other sequences, changing the reading frame, or altering the regulatory components of the nucleic acid. For example, all or part of the coding region of a gene of interest can be removed or replaced by a "nonsense" sequence, all or part of a regulatory sequence such as a promoter can be removed or replaced, a translation initiation sequence can be removed or replaced, etc.

[0112] "Knock-in" herein refers to the process of increasing genetic function in a host cell. This results in an increase in the level of the encoded protein. As will be appreciated by those skilled in the art, this can be achieved in several ways, including adding one or more other copies of the gene to the host cell or changing the regulatory components of the endogenous gene, thereby increasing the expression of the protein. This can be achieved by modifying the promoter, adding a different promoter, adding an enhancer, or modifying other gene expression sequences.

[0113] "Allogeneic" in this context refers to the genetic dissimilarity between the host organism and the cell transplant, in which an immune response is generated.

[0114] In the context of two or more nucleic acids or peptide sequences, the term "identity" percentage refers to two or more sequences or subsequences of the identical nucleotides or amino acid residues with a specified percentage when comparing and comparing with regard to maximum correspondence, as measured using one of the sequence comparison algorithms described below (for example, BLASTP and BLASTN or other algorithms available to those skilled in the art) or by visual inspection. Depending on application, "identity" percentage can be present in the region of the sequence compared, for example, in a functional domain, or alternatively in the total length of two sequences to be compared. For sequence comparison, a sequence is usually used as the reference sequence compared with a test sequence. When using a sequence comparison algorithm, test sequence and reference sequence are input to a computer, subsequence coordinates are specified if necessary, and sequence algorithm program parameters are specified. Then, the sequence comparison algorithm calculates the sequence identity percentages of the test sequence relative to the reference sequence based on the program parameters specified.

[0115] Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally, Ausubel et al., infra).

[0116] The BLAST algorithm is an example of an algorithm suitable for determining percent sequence identity and sequence similarity and is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0117] "Homologs" are biologically active molecules that are similar to a reference molecule at the nucleotide sequence, peptide sequence, function, or structural level. Homologs can include sequence derivatives that have a certain percentage of identity to a reference sequence. Thus, in one embodiment, homologous or derived sequences share at least 70% sequence identity. In a specific embodiment, homologous or derived sequences share at least 80% or 85% sequence identity. In a specific embodiment, homologous or derived sequences share at least 90% sequence identity. In a specific embodiment, homologous or derived sequences share at least 95% sequence identity. In a more specific embodiment, homologous or derived sequences share at least 50, 55, 60, 65, 70, 75, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity. Homologous or derived nucleic acid sequences can also be defined by their ability to maintain binding to a reference nucleic acid sequence under high stringency hybridization conditions. A homologue having structural or functional similarity to a reference molecule may be a chemical derivative of the reference molecule. Methods for detecting, generating and screening structural and functional homologues and derivatives are known in the art.

[0118] As used herein, "dopaminergic neural precursor cells" generally refer to cells that are capable of proliferating and / or differentiating into dopaminergic neurons in vitro or in vivo. Dopaminergic neural precursor cells can be derived from ventral midbrain neurons or differentiated from pluripotent stem cells. Dopaminergic neural precursor cells can also be differentiated or reprogrammed from other cell types.

[0119] The "dopaminergic nerve cells" herein are selected from dopaminergic nerve precursor cells, dopaminergic nerve progenitor cells, immature dopaminergic nerve cells and mature dopaminergic nerve cells; preferably, they are dopaminergic nerve precursor cells.

[0120] Example 1. Differentiation of midbrain dopaminergic neural precursor (DAP) cells using low immunogenic stem cells (i.e., low immunogenic iPS cells)

[0121] A. Method for preparing low-immunogenic stem cells and method for differentiating stem cells into dopaminergic neural precursor cells in vitro

[0122] After passage, WT, DKO, and DKO+G6 cells were plated onto Matrigel-coated culture flasks. After 24 hours of culture, the cells were switched to pre-differentiation medium to induce differentiation into midbrain cells. After 9 days of differentiation, highly pure midbrain cells were obtained. Subsequently, the obtained midbrain cells were expanded by adding neural progenitor cell culture medium to obtain a large number of highly pure neural progenitor cells. Finally, the neural progenitor cells were further differentiated into neurons by adding neural progenitor cell culture medium. These cells can differentiate into dopaminergic neural precursor (DAP) cells in vitro.

[0123] 1. Preparation of low-immunogenic stem cells

[0124] 1.1 Cell culture reagents:

[0125] 1.2 DKO cell preparation method:

[0126] The present invention uses human induced pluripotent stem cells (iPSC cells, human blood PBMC through CTS TM CytoTune TM -iPS2.1 Sendai virus reprogramming kit (Cat. No.: A34546) was used to reprogram iPSC cells, i.e., WT cells), and CRISPR / CAS9 was used to knock out β-2-microglobulin (B2M) in the endoplasmic reticulum, preventing the formation of functional HLA-I molecules on the cell surface, thereby escaping the killing of allogeneic CD8+ T cells; the escape from the killing of CD4+ T cells was achieved by knocking out CIITA, a positive regulator of HLA-II gene transcription, thereby reducing the expression of HLA-II class molecules.

[0127] Among them, the CRISPR / CAS9 gene knockout strategy of B2M is shown in Figure 1. B2M-gRNA1 and B2M-gRNA2 are used to directly knock out the B2M exon segment at both ends, and then the genome sequence knockout is verified using two pairs of PCR primers B2M-F1 / R1 and B2M-F2 / R2, respectively.

[0128] gRNA sequence:

[0129] B2M-gRNA1:CGTGAGTAAACCTGAATCTT

[0130] B2M-gRNA2: AGTCACATGGTTCACACGGC

[0131] Identification primers

[0132] B2M-F1:TGGGGCCAAATCATGTAGACTC

[0133] B2M-R1:TCAGTGGGGGTGAATTCAGTGT

[0134] B2M-F2+B2M-R2=608bp

[0135] After knockout: no band

[0136] B2M-F2:CAGAAGTCCTTGAGAGCCTCC

[0137] B2M-R2:TGTGCATCAGTATCTCAGCAGG

[0138] B2M-F2+B2M-R2=812bp

[0139] After knockout: 569bp.

[0140] In addition, the CRISPR / CAS9 gene knockout strategy for CIITA is shown in Figure 2 . CIITA-gRNA1 and CIITA-gRNA2 were used to directly knock out the CIITA exon segment at both ends, and then the genome sequence knockout was verified using two pairs of PCR primers, CIITA-F1 / R1 and CIITA-F2 / R2, respectively.

[0141] gRNA sequence:

[0142] CIITA-gRNA1:GATATTGGCATAAGCCTCCC

[0143] CIITA-gRNA2:CATCGCTGTTAAGAAGCTCC

[0144] Identification primers:

[0145] CIITA-F1:CTGTGCCTCTACCACTTCTATG

[0146] CIITA-R1: CCTTCCATGTCACACAACAGCC

[0147] CIITA-F1+CIITA-R1=368 bp

[0148] After knockout: no band

[0149] CIITA-F2:TGGAATCCACACTTTCCAGTTC

[0150] CIITA-R2:TGGAGTCTCCGTTCCTCCAG

[0151] CIITA-F2+CIITA-R2=889bp

[0152] After knockout: 459bp

[0153] The specific operations are as follows:

[0154] 1) Culture human induced pluripotent stem cells (iPS) in a Matrigel-coated 6-well plate using mTeSR1 to 80% density. Digest with TRYPLE, neutralize with DMEM / F12, and count. 6 Place cells in EP tubes and discard the supernatant after centrifugation.

[0155] 2) According to the Neon transfection system 100μL electroporation system, add 15μg TrueCut TM Cas9 Protein + 3 μg gRNA (B2MgRNA1 + B2MgRNA2 + CIITA gRNA1 + CIITA gRNA2) constitute the RNP system, mix well and place at room temperature for 20 minutes.

[0156] 3) Resuspend cells in 100 μL of RNP electroporation system and electroporate using the Neon transfection system at 1200 V, 30 ms, and 1 pause. Immediately after electroporation, add pre-warmed culture medium and evenly plate into one well of a Matrigel-coated 6-well plate.

[0157] 4) Replace the mTeSR1 medium with fresh medium daily. Once single cells have grown, select individual clones and place them in a 48-well plate. After the clones have expanded, collect genomic samples for PCR to detect gene editing. PCR-positive clones are sent to the company for Sanger sequencing for further verification.

[0158] 5) Identify positive B2M / CIITA biallelic knockout (DKO) cells, expand their culture, and freeze them.

[0159] 6) qPCR was performed using the following B2M-F / R and CIITA-F / R primers to detect the expression of B2M and CIITA at the RNA level in the B2M / CIITA biallelic knockout clones (DKO) to confirm the knockout.

[0160] B2M-F:AAGATGAGTATGCCTGCCGT

[0161] B2M-R:ATGCGGCATCTTCAAACCTC

[0162] CIITA-F:CCTGGAGCTTCTTAACAGCGA

[0163] CIITA-R:TGTGTCGGGTTCTGAGTAGAG.

[0164] 1.3 DKO+G6 preparation method

[0165] Overexpress the fusion protein XSG006 in the DKO cells prepared in 1.2 via lentiviral infection to create the stable fusion protein cell line DKO+G6. The fusion protein XSG006 is constructed by linking the functional domains of CD47 and CD24, linking the mature peptide sequence of CD24 with the transmembrane domain of CD47. Its amino acid sequence is shown in SEQ ID NO. 1. MGRAMVARLGLGLLLLALLLPTQIYSSETTTGTSSNSSQSTSNSGLAPNPTNATTKAAGGGGGSGGGGSGGGGSNILIVIFPIFAILLFWGQFGIKTLKYRSGGMDEKTIALLVAGLVITVIVIVGAILFVPGEYSLKNATGLGLIVTSTGILILLHYYVFSTAIGLTSFVIAILVIQVIAYILAVVGLSLCIAACIPMHGPLLISGLSILALAQLLGLVYMKFV. The nucleic acid sequence encoding XSG006 (the amino acid sequence of XSG006 is shown in SEQ ID NO: 1) was directly synthesized and constructed into a lentiviral plasmid (pGC-EF1a) driven by EF1a and carrying a puromycin selection marker. The structure of the pGC-EF1a plasmid is shown in Figure 3. The plasmid was digested with BamHI / NheI, and after successful ligation, the correctness of the inserted sequence was verified by Sanger sequencing, and viral packaging was performed. Transfect the DKO human induced pluripotent stem cells obtained in 1.2 and switch to puromycin-containing medium for screening. XSG006 is a completely exogenous sequence. Genome insertion of the sequence was verified using PCR in the constructed DKO+G6 cells. DKO cells served as a negative control. After confirming expression, cell expansion and subsequent functional testing were performed.

[0166] XSG006 F1: CCAGATCTACAGCAGCGAGA

[0167] XSG006 R1:GTTCTTCAGGCTGTACTCGC

[0168] XSG006 F+XSG006 R=352bp

[0169] XSG006 F2: CCAGATCTACAGCAGCGAGA

[0170] XSG006 R2:CCAGGATGTAGGCGATCACC

[0171] XSG006 F+XSG006 R=488bp

[0172] 2. Methods for Differentiating Stem Cells into Dopaminergic Neural Progenitor Cells in Vitro

[0173] 2.1 A kit for differentiating human induced pluripotent stem cells (WT cells), DKO cells, and DKO+G6 cells into dopaminergic neural progenitor cells, comprising: a first culture medium, a second culture medium, a third culture medium, a fourth culture medium, and a fifth culture medium;

[0174] The first culture medium is a neurobasal medium containing 10 μM SB431542, 2 μM DMH1, 0.6 μM CHIR99021, and 1 μM SAG;

[0175] The second medium was neurobasal medium containing 10 μM Y27632, 10 μM SB431542, 2 μM DMH1, 0.6 μM CHIR99021, and 1 μM SAG;

[0176] The third culture medium was neurobasal medium containing 1 μM DMH1, 0.2 μM SAG, and 100 ng / mL fibroblast growth factor 8b (FGF8b);

[0177] The fourth culture medium was neurobasal medium containing 0.2 μM SAG and 100 ng / mL FGF8b;

[0178] The fifth culture medium was neurobasal medium containing 10 μM Y27632, 0.2 μM SAG, and 100 ng / mL FGF8b;

[0179] The neurobasal medium consisted of the following components: 98% (v / v) DMEM / F12 (Gibco), 1% (v / v) non-essential amino acids (Gibco), and 1% (v / v) N2 supplement (Gibco).

[0180] 2.2 A method for differentiating human induced pluripotent stem cells (WT cells), DKO cells, and DKO+G6 cells into dopaminergic neural progenitor cells, comprising the steps of the kit of 2.1, as follows:

[0181] Differentiation of human induced pluripotent stem cells into dopaminergic neural precursor cells:

[0182] 1) Culture of human pluripotent stem cells:

[0183] Human induced pluripotent stem cells, DKO cells, or DKO+G6 cells were plated in clumps on a pre-laminin-coated matrix at a density of approximately 100,000 per well and cultured in E8 complete medium. Cells were digested and passaged every 4-5 days during the culture process.

[0184] 2) Differentiation of dopaminergic neural precursor cells:

[0185] S1: One day before differentiation, human pluripotent stem cells, DKO cells, and DKO+G6 cells with a confluence of about 70% to 80% were digested into single cells using TrypLE enzyme and the cells were centrifuged at 8000 / cm 2 The cells were seeded at a density of 100 μg / cm2 into 6-well plates pre-coated with Vitronectin (Gibco) in a complete StemFit medium supplemented with 10 μM Y27632 to promote stem cell survival.

[0186] S2: After the cells have grown for 24 h, the culture medium is replaced with the first culture medium in the kit described in step 2.1 (as day 0 of differentiation, D0), and the cells are cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for 8 days (the medium is changed every two days).

[0187] S3: On day 9 of differentiation, cells were digested with Accutase (Innovative) and resuspended in the second culture medium in the kit described in step 2.1. 15 million cells were seeded into a T75 suspension culture flask, shaken evenly, and cultured in a 37°C, 5% CO2 incubator for 2 days to allow the cells to spontaneously form neurospheres in suspension, thus obtaining midbrain floor plate cells.

[0188] S4: On the 11th day of differentiation, the culture medium was replaced with the third culture medium in the kit described in 2.1, and the cells were cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for 5 days (the medium was changed every 2.5 days) to obtain dopaminergic neural progenitor cells;

[0189] S5: On day 16 of differentiation, the culture medium was replaced with the fourth culture medium in the kit described in 2.1, and 5 million neurosphere cells were attached to the wall (attached to a T75 culture flask pre-coated with Vitrovectin (Gibco) and continued to be cultured). The cells were cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for 7 days (the medium was changed every 2.5 days).

[0190] S6: On day 23 of differentiation, cells were digested with Accutase (Innovative) and resuspended in the fifth culture medium in the kit described in step 2.1. 15 million cells were seeded into a T75 suspension culture flask, shaken evenly, and cultured in a 37°C, 5% CO2 cell culture incubator for one day to allow the cells to spontaneously form neurospheres in suspension. Dopaminergic neural precursor cells (DAP cells) were obtained. DAP cells differentiated from iPS cells were designated WT-DAP cells, DAP cells differentiated from DKO cells were designated DKO-DAP cells, and DAP cells differentiated from DKO+G6 were designated DKO+G6-DAP cells.

[0191] B. Analysis of the characteristics of dopaminergic neural precursor (DAP) cells differentiated from low-immunogenic stem cells

[0192] 1. Confirmation of Low Immunogenicity Stem Cell-Derived DAP Cell Markers

[0193] The identity of the derived cells was confirmed using flow cytometry and immunofluorescence. First, expression of the stemness gene OCT4 was verified to be <1% in WT, DKO, and DKO+G6-differentiated DAP cells (Figure 4), confirming that they had exited pluripotency and were fully differentiated. Secondly, FACS was used to examine the expression of the dopaminergic neural progenitor cell marker genes FOXA2, PAX6, OTX2, and LMX1A in WT, DKO, and DKO+G6-differentiated DAP cells (Figure 5).

[0194] Immunofluorescence was also used to examine the expression of dopaminergic neural progenitor cell marker genes in WT, DKO, and DKO+G6-derived cells. The cells were plated in 12-well plates. After the cells reached a density of 60-80%, the culture medium was aspirated and fixed with 4% paraformaldehyde. After permeabilization, the cells were incubated overnight at 4°C with primary antibodies against OTX2, EN1, LMX1A, and FOXA2. After washing away the primary antibodies, the cells were incubated with fluorescently labeled secondary antibodies at room temperature, and then photographed using a fluorescence microscope. As shown in Figure 6, all cells expressed dopaminergic neural progenitor cell marker genes.

[0195] 2. Determination of the Retention of the Hypoimmunogenic Phenotype of Hypoimmunogenic Derivative Cells

[0196] INF-gamma was used to stimulate WT and DKO+G6 differentiated DAP cells: cells were plated in well plates and medium containing INF-gamma was added to the cells during the next day's medium change. After 48 hours, the cells were digested and HLA-I / II expression was assessed by flow cytometry. As shown in Figure 7, positive clones of DKO+G6 stem cells with biallelic knockout of B2M / CIITA remained HLA-I / II negative even after differentiation into DAP cells, and were unable to upregulate HLA-I / II in response to INF-gamma stimulation.

[0197] The molecular sequence of XSG006 is completely exogenous. RT-PCR was used to compare the stability of XSG006 expression between WT and dopamine neural progenitor cells differentiated from them, as well as between DKO+G6 and dopamine neural progenitor cells differentiated from them (Figure 8). WT-DAP and DKO-DAP cells served as negative controls. After confirming expression, cell expansion and subsequent functional testing were performed.

[0198] Confirmation of XSG006 overexpression using primers

[0199] XSG006 F1: CCAGATCTACAGCAGCGAGA

[0200] XSG006 R1:GTTCTTCAGGCTGTACTCGC

[0201] XSG006 F+XSG006 R=352bp

[0202] C. Conclusion

[0203] Low immunogenic stem cells can be successfully differentiated into dopaminergic neural precursor (DAP) cells in vitro. The derived cells have the characteristics of DAP cells and retain the expression of low immunogenic molecules.

[0204] Example 2. Verification of low immunogenicity of dopaminergic neural precursor cells

[0205] A. Background

[0206] The human induced pluripotent stem cells selected by the present invention use CRISPR / CAS9 to knock out beta-2-microglobulin (B2M) in the endoplasmic reticulum, so that cell surface HLA-I cannot form functional molecules, thereby escaping the killing of allogeneic CD8+T cells; escaping the killing of CD4+T cells is achieved by knocking out the positive regulator CIITA of HLA-II gene transcription, thereby reducing the expression of HLA-II class molecules. And XSG006 is expressed in cells (DKO) with B2M / CIITA biallelic knockout by means of a lentivirus to escape the killing of innate immunity. The cells successfully constructed are DKO+G6, which are low immunogenic stem cells. The dopaminergic neural precursor cells (DKO+G6-DAP) derived from the low immunogenic stem cells of Example 1 should also have the ability to not activate the immune system and escape its killing.

[0207] B. In vitro detection of immune system evasion

[0208] 1. Verification of the killing function of escaped T+NK mixed lymphocytes (PBNK)

[0209] NK activation factor was added to PBMC in advance to increase the NK ratio and T cell killing performance in PBMC. Activated mixed lymphocytes (PBNK) were used as effector cells for RTCA experiments to comprehensively evaluate the immune escape ability of DKO+G6-DAP cells (PMID: 33309274). The specific operation was to perform PBNK cell killing assay on the XCelligence platform (ACEA BioSciences, San Diego, CA.). WT-DAP, DKO-DAP and DKO+G6-DAP cells were resuspended in 100 μl cell-specific culture medium (Neurobasal TM Culture medium (Cat. No. 21103049, Thermofisher) was plated on 96-well E-plates (ACEA BioSciences) coated with Matrigel (Sigma-Aldrich). After the cell index value reached 1, T cells were added at an E:T ratio of 1:1. Data were normalized and analyzed using RTCA software (ACEA). As shown in Figure 9, only DKO+G6-DAP cells were able to escape PBNK cytotoxicity.

[0210] 2. Escape Macrophage (MAC) Killing Assay

[0211] WT, DKO, and DKO+G6-differentiated DAP cells were plated in 12-well plates. After 24 hours, the culture medium was removed and MAC cells were added for co-culture. After 24 hours, the remaining WT, DKO, and DKO+G6-differentiated DAP cells after MAC cell removal were observed. The results are shown in Figure 10.

[0212] MAC cell killing assays were performed on the XCelligence platform (ACEA BioSciences, San Diego, CA). WT-DAP, DKO-DAP, and DKO+G6-DAP cells were resuspended in 100 μl of cell-specific culture medium and plated on 96-well E-plates (ACEA BioSciences) coated with Matrigel (Sigma-Aldrich). After the cell index value reached 1, MAC cells were added at an E:T ratio of 1:1. Data were normalized and analyzed using RTCA software (ACEA). The results are shown in Figure 11. Both experimental results show that WT and DKO+G6-differentiated DAP cells were less cytotoxic to MAC cells than DKO-differentiated DAP cells, indicating that WT and DKO+G6-differentiated DAP cells have a significantly greater ability to evade MAC cell killing than DKO-differentiated DAP cells.

[0213] C. Using humanized mice to test the survival of low-immunogenic DAP cells in vivo

[0214] The survival of DAP cells in vivo was observed by observing bioluminescence detection (BLI) injected into the brain of humanized mice. The specific operation is: WT and DKO+G6 differentiated DAP cells were infected with lentivirus carrying luciferase (luc), and then the cells expressing luc were transplanted into the brains of CD34+HSC-reconstructed humanized immune system mice. By intraperitoneal injection of luc's luminescent substrate D-luciferin (A025011, Shanghai Yisheng Biotechnology Co., Ltd.), and using a live imaging device (iVIS spectrum, PerkinElmer) to detect the fluorescence intensity of the cells, the survival of the cells in the mouse body can be indicated. The fluorescence of the transplanted site was continuously monitored for 51 days. The fluorescence value of WT differentiated DAP cells tended to the background value, while the fluorescence value of DKO+G6 differentiated DAP cells could be detected to continue to rise after transplantation, indicating that DKO+G6 differentiated DAP cells can effectively escape the attack of the immune system in vivo compared with WT differentiated DAP cells (Figure 12).

[0215] Example 3. Dopaminergic neural precursor cells in a mouse Parkinson's disease model

[0216] This example describes a study exploring the use of in vitro differentiated dopaminergic neural precursor cells (DAPs) from stem cells for the treatment of Parkinson's disease in a mouse model. Scid beige mice were used for modeling, and three behavioral tests were performed: apomorphine-induced rotation, cylinder test, and rotarod test. Modeling mice that met the criteria were selected for cell transplantation. The experiment set up a solvent (cell preservation solution, artificial cerebrospinal fluid (ACSF), Maokang Bio, MX0951) control group and a test substance group (WT-DAP injection and DKO+G6-DAP injection). After administration, the behavior of the three groups of mice was compared by immunofluorescence staining of brain tissue pathological sections and three behavioral tests. The behavioral differences between the three groups of mice, the behavioral differences of the mice themselves before and after administration, and the changes in cell retention and dopaminergic neurons at the administration site were compared.

[0217] A. Construction of a Parkinson's disease (PD) mouse model

[0218] Scid beige mice were anesthetized with isoflurane and fixed in a stereotaxic apparatus. 6-hydroxydopamine (6-OHDA) solution (100 mg H4381 (Sigma)) was slowly injected into the substantia nigra of the left brain. Postoperatively, behavioral tests including the cylinder test, rotarod test, and apomorphine-induced rotations were performed to confirm the model.

[0219] B. DAP cell transplantation in Parkinson's disease (PD) mice

[0220] Model mice were divided into groups and injected with 2 μL of WT-DAP solution, 2 μL of DKO+G6-DAP solution, and 2 μL of cell preservation solution, respectively, into the left striatum of the mouse brain. Behavioral testing was performed monthly for 4 months after surgery. Brain samples were collected after the final test.

[0221] C. Behavioral testing of Parkinson's disease (PD) mice after treatment

[0222] 1. Apomorphine (APO)-induced rotation experiment

[0223] The results of the APO-induced rotation experiment showed that the number of rotations of the mice in the test group was significantly reduced at 4 months compared with that before transplantation, indicating that the WT-DAP injection improved the hemiplegic rotation behavior of the model mice (Figure 13).

[0224] 2. Results of the Mouse Cylinder Experiment

[0225] The results of the cylinder experiment showed that compared with before transplantation, the mice in the test group showed significant behavioral improvement at 4 months (p<0.05), and the proportion of the number of times the right forelimb hit the wall was significantly increased, indicating that the transplantation of WT-DAP injection solution was effective in improving the Parkinson's disease-related resting tremor behavior of the model mice (Figure 14).

[0226] 3. Results of the Mouse Rotarod Test

[0227] The rotarod test showed significant behavioral improvement in the test group compared to pre-transplantation mice at 4 months (p<0.05), with significantly increased time spent on the rotarod. Behavioral improvements were also significant compared to the control group (p<0.05), indicating that WT-DAP injection is effective in improving the postural and gait disorders of the model mice (Figure 15).

[0228] D. Staining of PD mouse brain sections

[0229] Immunofluorescence and immunohistochemical staining of frozen sections of PD mouse brain tissue: Tissue sections were rinsed three times for 5 minutes in PBS and blocked for 1 hour at 37°C. The blocking solution was 5% BSA and 0.3% triton-100 in PBS. Primary antibody was added and reacted slowly in a humidified chamber at 4°C for 24-48 hours. The primary antibody was diluted in 1% BSA and 0.3% triton-100 in PBS. Sections were rinsed three times for 5 minutes in PBS and incubated with fluorescent secondary antibody at room temperature in the dark for 1-2 hours. Sections were then rinsed three times for 5 minutes in PBS, mounted with DAPI, and photographed under a microscope. Coronal frozen sections of brain tissue from mice in the test group four months after cell transplantation were co-stained for stem101 (red), TH (green), and DAPI (blue) (Figure 16). Staining results showed that dopaminergic neurons had differentiated at the transplant site.

[0230] In this example, a vehicle control group (cell preservation solution) and a test group (WT-DAP injection and DKO+G6-DAP injection) were established. After the experiment, the behavior of the three groups of mice was detected by three behavioral tests, and the behavioral differences of the three groups of mice and the behavioral differences of the mice themselves before and after the experiment were compared. The test results after 4 months showed that in the apomorphine (APO)-induced rotation experiment, the number of rotations of the two test groups of mice was significantly reduced, and it was statistically significant; in the cylinder experiment, the number of times the right forelimbs of the two test groups of mice hit the wall was significantly increased, basically restored to the level before modeling, and it was statistically significant; in the rotating rod experiment, the time the two test groups of mice stayed on the rotating rod was significantly increased, and it was statistically significant. In the results of immunofluorescence staining of frozen sections of brain tissue, a large number of transplanted cells survived in the transplantation site and a certain number differentiated into dopaminergic neurons. Transplantation of DAP injection can significantly improve the Parkinson's disease behavior of mice and can fundamentally promote the differentiation of transplanted cells in the striatum to generate dopaminergic neurons to fundamentally reverse Parkinson's disease.

[0231] Example 4. Low Immunogenicity Dopaminergic Neural Precursor Cells in a Non-Human Primate (NHP) Parkinson's Disease Model

[0232] This example describes a study on the use of in vitro differentiated dopaminergic neural precursor cells (DAPs) from monkey stem cells (iPSCs) for the treatment of Parkinson's disease in a non-human primate (NHP) model. Non-human primates (NHPs) were modeled using MPTP injection, and the animals were regularly observed and evaluated using techniques and methods for evaluating PD symptoms and the function of the transplanted cells. In some cases, the methods include MRI scanning and analysis, PET analysis, video analysis, and behavioral analysis (see, for example, Kikuchi et al., Nature, 2017, 548, 592-596).

[0233] A. Construction of a Nonhuman Primate (NHP) Parkinson's Disease (PD) Model

[0234] Monkeys were injected intravenously with MPTP hydrochloride twice weekly until they developed Parkinson's symptoms, such as, but not limited to, tremor, bradykinesia, and impaired balance. 18F-PECNT was used to specifically target the dopamine transporter. PET-CT results showed that dopaminergic neurons in the left and right brains of NHPs were effectively eliminated after modeling (Figure 17), demonstrating the successful establishment of a non-human primate (NHP) model of Parkinson's disease (PD).

[0235] B. DAP Cell Transplantation in Parkinson's Disease (PD) Non-Human Primates (NHPs) DAP differentiated cells generated from stem cells were evaluated in a monkey model of Parkinson's disease (PD).

[0236] 1. In this study, monkey stem cells were differentiated according to the method described above to generate monkey WT (monkey iPSC cells, monkey blood PBMCs were differentiated by CTS TM CytoTune TM -iPS2.1 Sendai Virus Reprogramming Kit (Cat. No. A34546) and monkey DKO+G6-differentiated DAP cells (monkey DKO+G6-DAP cells). The B2M exon segment was directly knocked out at both ends using NHP-B2M-gRNA1 and NHP-B2M-gRNA2, and the knockout was verified by genomic sequence analysis using the NHP-B2M-F / R pair of PCR primers. The CIITA exon segment was directly knocked out at both ends using NHP-CIITA-gRNA1 and NHP-CIITA-gRNA2, and the knockout was verified by genomic sequence analysis using the NHP-CIITA-F / R pair of PCR primers. Monkey DKO+G6 cells overexpressed the NHP-XSG006 protein.

[0237] The corresponding materials used for the method of monkey DKO+G6 cells are:

[0238] NHP-B2M-gRNA1 CGTGAGTAAACCTGAATCTT

[0239] NHP-B2M-gRNA1 AGTCACATGGTTCACACGGC

[0240] NHP-CIITA-gRNA1 CATCGCTGTTGAGAAGCTCC

[0241] NHP-CIITA-gRNA1 GATATTGGCATAAGCCTCCC

[0242] B2M identification primers

[0243] NHP-B2M-F CATTGGCCAGAGTGGAAATG

[0244] NHP-B2M-RTGGGACTCATTCAGGGTAGTA

[0245] CIITA identification primers

[0246] NHP-CIITA-F CTGTGAGGTGACTGAGCATATC

[0247] NHP-CIITA-RGGCCAGCAATGAGCATACTA

[0248] NHP-XSG006 protein sequence

[0249] 2. Confirmation of Low Immunogenicity iPS Cell-Derived DAP Cell Markers

[0250] Immunofluorescence analysis showed that DAP-specific genes were expressed at the protein level in monkey WT and monkey DKO+G6-differentiated DAP cells. Cells were plated in 12-well plates. After reaching 60-80% confluence, the medium was aspirated and cells were fixed with 4% paraformaldehyde. After permeabilization, cells were incubated with primary antibodies against OTX2, EN1, LMX1A, and FOXA2 at 4°C overnight. After washing away the primary antibodies, fluorescently labeled secondary antibodies were incubated at room temperature, and images were taken using a fluorescence microscope. The results, as shown in Figure 18, show that all cells express DAP genes.

[0251] 3. Injection of low immunogenic monkey DAP cells into the brain of monkey PD model

[0252] Monkey DAP cells were stereotactically transplanted bilaterally into the putamen of MPTP-treated monkeys, with monkey WT DAP cells injected on the left side and monkey DKO+G6-DAP cells injected on the right side. MRI was used to assess DAP cell survival in both the left and right brains ( Figure 19 ). MRI results showed that monkey DKO+G6-DAP cells persisted in the brain over the 28-day observation period, while monkey WT DAP cells were no longer observed by day 5.

[0253] The effects of the transplanted DA neurons were evaluated using methods recognized by those skilled in the art. Changes or differences in left and right forelimb behavior, locomotion, PD symptoms, and dopaminergic function were assessed in monkeys using DAP cells differentiated from WT and DKO+G6 (Figure 20). Feeding rate results showed that after successful model establishment, both forelimbs exhibited no feeding behavior prior to cell transplantation. Following cell transplantation, the left forelimb (the side affected by the DKO+G6-DAP injection) showed signs of improvement; the right forelimb (the side affected by the WT-DAP injection) showed no significant improvement.

[0254] Example 5. Low Immunogenicity Dopaminergic Neural Precursor Cells in a Normal Non-Human Primate (NHP) Model

[0255] This embodiment describes a study on the immune privilege of dopaminergic neural precursor cells (DAP) differentiated in vitro from monkey stem cells (iPSC) in a non-human primate (NHP) model with a complete immune system. Allogeneic transplantation of NHP-DAP cells was performed on normal non-human primates that were not modeled, and it was confirmed that DAP derived from low immunogenic iPS cells could resist immune system attack. MRI scanning and analysis were used to monitor the survival of cells in vivo (see, for example, Kikuchi et al., Nature, 2017, 548, 592-596). The same batch of monkey WT-DAP cells and monkey DKO+G6-DAP cells were transplanted in immunodeficient NOG mice to confirm the in vivo safety of DAP cells. Monkey DKO+G6-DAP cells were also injected into PD-NOG mice to confirm the differentiation characteristics of low immunogenic DAP cells in vivo.

[0256] A. Allogeneic DAP cell transplantation in non-human primates (NHPs) with a complete immune system,

[0257] Monkey DAP cells were stereotactically transplanted bilaterally into the putamen, with monkey WT-DAP cells injected on the left side and monkey DKO+G6-DAP cells injected on the right side. MRI was used to assess DAP cell survival in both brain regions (Figures 21A & B). MRI scans were performed before transplantation (pre-TX), on the day of transplantation (day 0), and on days 7, 14, 21, 28, 42, 56, 90, 122, 152, 183, and 212 after transplantation. The results showed that monkey DKO+G6-DAP cells persisted in the brain over the 259-day observation period, while monkey WT-DAP cells were no longer observed from days 14 to 21. This suggests that monkey DKO+G6-DAP cells possess a low immune response, allowing them to evade immune attack and survive long-term in the brains of allogeneic monkeys with a fully functional immune system. Meanwhile, unmodified WT-DAP cells were rejected and unable to survive under the same conditions.

[0258] B. NHP-DAP cell transplantation into immunodeficient NOG mice

[0259] The method of Example 3B was used to stereo-inject monkey WT-DAP cells and monkey DKO+G6-DAP cells into the left striatum of different NOG mice. Two months after transplantation, the mice were subjected to brain sampling, and the frozen sections of NOG mouse brain tissue were immunofluorescently stained with reference to the method of Example 3D. The coronal frozen sections of the brain tissue of the mice 3 months after cell transplantation were co-stained with hNA (red) & Ki67 (green) & DAPI (blue) (Figure 22A). The staining results showed that monkey WT-DAP cells and monkey DKO+G6-DAP cells were visible in the transplantation site, and there was no difference in the size and number of clumps between cells. Both cells had only a very small amount of Ki67 (Figure 22B). In vivo safety testing showed that low immunogenic dopaminergic neural precursor cells (DKO+G6-DAP) had the same normal proliferation capacity as unedited cells (WT-DAP), and both contained very small amounts of Ki67, with low tumorigenicity in vivo.

[0260] C. NHP-DAP cell transplantation into immunodeficient PD-NOG mice

[0261] PD models were established in NOG mice using the method described in Example 3A. Monkey DKO+G6-DAP cells were then stereotactically injected into the left striatum of the model mice. Three months after transplantation, brain tissue samples were collected from the mice, and frozen sections of PD mouse brain tissue were immunofluorescently stained using the method described in Example 3D. Coronal frozen sections of brain tissue from the mice three months after cell transplantation were co-stained for hNA (red), TH (green), and DAPI (blue) (Figure 23). The staining results demonstrated that the hypoimmunogenic DAP cells could differentiate in vivo to generate TH+, i.e., functional dopaminergic neurons.

[0262] The above describes the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included in the scope of protection of the present invention.

Claims

1. An isolated low-immunogenic dopaminergic neuronal cell differentiated from an immunoprivileged induced pluripotent stem cell, characterized in that: The neural cells include: 1) The expression of HLA-I and HLA-II human leukocyte antigens is reduced or absent; 2) expressing a fusion protein constructed from the functional domains of CD47 and CD24; The cells can escape T cell attack and NK cell killing.

2. The isolated low immunogenic dopaminergic neuronal cell according to claim 1, characterized in that In the immune privileged induced pluripotent stem cells, gene editing tools are used to target one or more genes encoding one or more transcriptional regulators of HLA-I, and one or more genes encoding one or more transcriptional regulators of HLA-II, to achieve reduced or no expression of HLA-I and HLA-II genes; In certain embodiments, to achieve reduced or no expression of HLA-I and HLA-II genes, the transcriptional regulatory factor of HLA-I may be preferably selected from: one or more of B2M, TAP1, TAP2, TAP-associated glycoprotein (Tapasin) or NLRC5; the transcriptional regulatory factor of HLA-II may be preferably selected from: one or more of CIITA, RFXANK, RFX5, RFXAP; According to the present invention, the transcriptional regulatory factors are preferably B2M and CIITA.

3. The isolated low immunogenic dopaminergic neuronal cell according to claim 2, characterized in that The immunoprivileged induced pluripotent stem cells also include a genetic modification targeting the CIITA gene by a rare-cutting endonuclease that selectively inactivates the CIITA gene.

4. The isolated low immunogenic dopaminergic neural cell according to claim 2, characterized in that The immunoprivileged induced pluripotent stem cells also include a genetic modification targeting the B2M gene by a rare-cutting endonuclease that selectively inactivates the B2M gene.

5. The isolated low-immunogenic dopaminergic neuronal cell according to claim 3 or 4, characterized in that Wherein the genetic modification targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one guide RNA sequence for specifically targeting the CIITA gene or the B2M gene; In a specific embodiment, the CRISPR / CAS9 system is used to directly knock out the B2M and CIITA exon segments at both ends, respectively, wherein the target sequences of the gRNA for the B2M gene are SEQ ID NO: 2 and SEQ ID NO: 3, and the target sequences of the gRNA for the CIITA gene are SEQ ID NO: 4 and SEQ ID NO:

5.

6. The isolated low-immunogenic dopaminergic neuronal cell according to claim 1 or 2, characterized in that: The immunoprivileged induced pluripotent stem cells achieve reduced or no expression of HLA-I and / or HLA-II genes by introducing gene expression modifying molecules targeting one or more genes encoding one or more transcriptional regulatory factors of HLA-I, or one or more genes encoding one or more transcriptional regulatory factors of HLA-II, wherein the gene expression modifying molecules include one selected from siRNA, shRNA, microRNA, antisense RNA and another RNA-mediated inhibitory molecule.

7. The isolated low immunogenic dopaminergic neural cell according to claim 1, characterized in that The functional domain of CD47 in the fusion protein comprising the functional domains of CD47 and CD24 is a CD47 transmembrane domain; preferably, the amino acid sequence of the CD47 transmembrane domain is as shown in any one of SEQ ID NOs: 6-10; The functional domain of CD24 in the fusion protein comprising the functional domains of CD47 and CD24 is a signal peptide sequence of CD24, a CD24 mature peptide, a CD24 extracellular peptide, a CD24 membrane anchor sequence, and a CD24 extracellular mature peptide; preferably, the amino acid sequence of the functional domain of CD24 is as shown in any one of SEQ ID NOs: 11-16; 8. The isolated low-immunogenic dopaminergic neural cell according to claim 7, characterized in that The fusion protein constructed by the functional domains of CD47 and CD24 is a fusion protein that connects the CD47 SIRPα binding domain and the membrane anchor sequence of CD24; or, In certain embodiments, the fusion protein constructed by the functional domains of CD47 and CD24 is a protein in which the SIRPα binding domain of CD47 is inserted into the linking site of the extracellular sequence and membrane anchor sequence of CD24; or, In certain embodiments, the fusion protein constructed by the functional domains of CD47 and CD24 is obtained by linking CD47 to the extracellular sequence of CD24; or, In certain embodiments, the fusion protein constructed by the functional domains of CD47 and CD24 is obtained by linking the CD24 mature peptide to the SIRPα binding domain of CD47; or, In certain embodiments, the fusion protein constructed by the functional domains of CD47 and CD24 is a fusion protein in which the extracellular mature peptide of CD24 is inserted into the linking point between the SIRPα binding domain and the transmembrane domain of CD47; or In certain embodiments, the fusion protein constructed by the functional domains of CD47 and CD24 is a fusion protein that connects the mature peptide sequence of CD24 and the transmembrane domain of CD47; Preferably, the amino acid sequence of the fusion protein constructed by the functional domains of CD47 and CD24 has more than 70% homology with the sequence shown in SEQ ID NO: 1, such as more than 80% homology, and more than 90%, more than 95%, or more than 98% homology; Further preferably, the amino acid sequence of the fusion protein constructed by the functional domains of CD47 and CD24 is as shown in SEQ ID NO: 1; In a specific embodiment, the increased expression of the fusion protein constructed by the functional domains of CD47 and CD24 is produced by introducing at least one copy of the fusion protein gene into the iPSC under the control of a promoter in the immune privileged induced pluripotent stem cells.

9. The nucleic acid sequence encoding the fusion protein constructed by the functional domains of CD47 and CD24 can be obtained according to the amino acid sequence of the fusion protein according to claim 8.

10. The isolated low immunogenic dopaminergic nerve cell according to any one of claims 1 to 9 is selected from the group consisting of dopaminergic nerve precursor cells, dopaminergic nerve progenitor cells, immature dopaminergic nerve cells and mature dopaminergic nerve cells; preferably dopaminergic nerve precursor cells.

11. A method for obtaining the isolated low immunogenic dopaminergic neural precursor cells according to any one of claims 1 to 10 from immunoprivileged induced pluripotent stem cells by in vitro differentiation, wherein endogenous β-2 microglobulin (B2M) gene activity and endogenous class II transactivator (CIITA) gene activity have been eliminated in the immunoprivileged iPSC cells; and a fusion protein constructed by the functional domains of CD47 and CD24 is expressed; preferably, the amino acid sequence of the fusion protein constructed by the functional domains of CD47 and CD24 has more than 70% homology with the sequence shown in SEQ ID NO: 1, such as more than 80% homology, and more than 90%, more than 95%, or more than 98% homology; further preferably, the amino acid sequence of the fusion protein constructed by the functional domains of CD47 and CD24 is as shown in SEQ ID NO: 1, characterized in that, The method comprises: Differentiation of immunoprivileged induced pluripotent stem cells into hypoimmunogenic dopaminergic neural precursor cells: (1) Cultivation of immune-privileged induced pluripotent stem cells: Immunoprivileged induced pluripotent stem cells were plated in the form of clumps on a matrix pre-coated with laminin at a number of about 100,000 per well, and the cells were cultured using E8 complete medium. The cells were digested and passaged every 4 to 5 days during the culture process. (2) Differentiation of low-immunogenic dopaminergic neural precursor cells: S1: One day before differentiation, immune-privileged induced pluripotent stem cells with a confluence of about 70% to 80% were digested into single cells using TrypLE enzyme and the cells were centrifuged at 8000 / cm 2 The cells were seeded at a density of 1.50 μg / cm2 into a 6-well plate pre-coated with Vitronectin (Gibco). The inoculation medium was StemFit complete medium, and 10 μM Y27632 component was added to promote stem cell survival. S2: After the cells have grown for 24 hours, the culture medium is replaced with the first culture medium, which is regarded as the 0th day of differentiation, called D0. The cells are cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for 8 days, with the medium changed every two days. S3: On the 9th day of differentiation, the cells were digested with Accutase (Innovative), and then resuspended with the second culture medium. 15 million cells were inoculated into a T75 suspension culture flask, shaken evenly, and incubated at 37°C and 5% CO2 in the second culture medium. The cells were cultured in a carbon monoxide cell culture incubator for 2 days to allow the cells to spontaneously form neurospheres in a suspended state, and midbrain floor plate cells were obtained; S4: On the 11th day of differentiation, the culture medium was replaced with the third culture medium, and the cells were cultured in a carbon dioxide cell culture incubator at 37° C. and 5% CO 2 for 5 days, with the medium changed every 2.5 days to obtain dopaminergic neural progenitor cells; S5: On the 16th day of differentiation, the culture medium was replaced with the fourth culture medium, and 5 million neurosphere cells were attached to the wall and attached to a T75 culture flask pre-coated with Vitrovectin (Gibco) for further culture. The cells were cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for 7 days, with the medium changed every 2.5 days. S6: On the 23rd day of differentiation, the cells were digested with Accutase (Innovative), and then resuspended with the fifth culture medium. 15 million cells were inoculated into a T75 suspension culture flask, shaken evenly, and cultured in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for one day to allow the cells to spontaneously form neurospheres in a suspended state, thereby obtaining dopaminergic neural precursor cells (DAP cells); The first culture medium is a neurobasal medium containing 1 μM-20 μM SB431542, 1 μM-3 μM DMH1, 0.2 μM-1 μM CHIR99021 and 1 μM-1.75 μM SAG; Preferably, the first culture medium is a neurobasal medium containing 10 μM SB431542, 2 μM DMH1, 0.6 μM CHIR99021 and 1 μM SAG; The second medium was neurobasal medium containing 5 μM-15 μM Y27632, 1 μM-20 μM SB431542, 1-3 μM DMH1, 0.2 μM-1 μM CHIR99021, and 1 μM-1.75 μM SAG; Preferably, the second culture medium is a neurobasal medium containing 10 μM Y27632, 10 μM SB431542, 2 μM DMH1, 0.6 μM CHIR99021 and 1 μM SAG; The third culture medium is a neurobasal medium containing 0.8 μM-1.2 μM DMH1, 0.1 μM-0.5 μM SAG, and 80 ng / mL-120 ng / mL fibroblast growth factor 8b (FGF8b); Preferably, the third culture medium is a neurobasal medium containing 1 μM DMH1, 0.2 μM SAG and 100 ng / mL fibroblast growth factor 8b (FGF8b); The fourth culture medium is a neurobasal medium containing 0.1 μM-0.5 μM SAG and 80 ng / mL-120 ng / mL FGF8b; Preferably, the fourth culture medium is a neurobasal medium containing 0.2 μM SAG and 100 ng / mL FGF8b; The fifth culture medium is a neurobasal medium containing 5 μM-15 μM Y27632, 0.1 μM-0.5 μM SAG, and 80 ng / mL-120 ng / mL FGF8b; Preferably, the fifth culture medium is a neurobasal medium containing 10 μM Y27632, 0.2 μM SAG and 100 ng / mL FGF8b; The neurobasal medium is selected from at least one of IMDM (Iscove's Modified Dulbecco's Medium) medium, Eagle's Basal Medium (BME) medium, GMEM medium, MEM medium, DMEM medium, Ham's F-12 medium, RPMI1640 medium, and Neurobasal medium; Preferably, the neural basal medium consists of the following components: 98% (v / v) DMEM / F12 (Gibco), 1% (v / v) non-essential amino acids (Non-essential amino acid, Gibco) and 1% (v / v) N2 supplement (N2 supplement, Gibco).

12. A method of treating a patient suffering from a neurodegenerative disease or condition, the method comprising administering a composition comprising a therapeutically effective amount of the isolated low immunogenic dopaminergic neural cells of any one of claims 1 to 10 or the isolated low immunogenic dopaminergic neural cells prepared according to the method of claim 11.

13. The method of claim 12, wherein the composition further comprises a therapeutically effective carrier; Preferably, the isolated hypoimmune dopaminergic neural cells are on a biodegradable scaffold.

14. The method of claim 12, wherein the administering comprises implantation or injection.

15. The method according to any one of claims 12-14, wherein the neurodegenerative disease or condition is selected from Parkinson's disease, Huntington's disease and multiple sclerosis; preferably Parkinson's disease.

16. A composition, characterized in that The composition comprises the isolated low immunogenic dopaminergic nerve cells according to any one of claims 1 to 10 or the isolated low immunogenic dopaminergic nerve cells prepared according to the method of claim 11.

17. The composition according to claim 16, characterized in that The composition comprises the isolated low-immunogenic dopaminergic neural cells according to any one of claims 1 to 10 and one or more therapeutic agents, wherein the therapeutic agents include peptides, cytokines, small molecule compounds, macromolecules, ADCs, antibodies, nanoparticles, biosimilars, mRNA, traditional Chinese medicines, proteins, vaccines, checkpoint inhibitors, mitogens, growth factors, small RNAs, double-stranded RNAs (dsRNAs), mononuclear blood cells, feeder cells, feeder cell components or replacement factors thereof, vectors comprising one or more polynucleic acids of interest, antibodies, and the like.

18. Use of the isolated low immunogenic dopaminergic neural cells according to any one of claims 1 to 10 or the isolated low immunogenic dopaminergic neural cells prepared according to the method of claim 11 in the preparation of a product for the treatment of a neurodegenerative disease or condition; In certain aspects, the use, wherein the neurodegenerative disease or condition is selected from Parkinson's disease, Huntington's disease and multiple sclerosis; preferably Parkinson's disease.

Images